Advertisements
Feeds:
Posts
Comments

Posts Tagged ‘surgery’


The Golden Hour of Stroke Intervention

Reporter: Irina Robu, PhD

The removal of thrombus under the image guidance, endovascular thrombectomy is preferred for an arterial embolism which is characteristic for an arterial blockage frequently caused by atrial fibrillation, a heart rhythm disorder. An arterial embolism causes restricted blood supply which leads to pain in the affected area. A thrombectomy can too be used to treat conditions in your organs which is usually associated with less benefit and more risk, a large retrospective study found.

Alejandro Spiotta, MD from Medical University of South Carolina in Charleston stated that functional independence rates were 45% for those treated in less than 30 minutes, 33% with procedures 30 to 60 minutes long, and 27% when procedures took more than 60 minutes. The results indicate that complications double after 50 minutes and the mortality risk is significantly for the over 60-minute group than in those treated in 30 to 60 minutes.

Earlier research has shown that when it comes to mechanical thrombectomy, procedure time has a noteworthy effect on patient outcomes. Based on these findings, it seems reasonable to conclude that at 60 minutes, one should consider the futility of continuing the procedure. However, procedures that last longer were connected with increased cost, worse outcomes, and increased incidence of complications, the investigators noted. Yet, the findings underscore the importance of timely recanalization and suggest there’s a point at which continuing to manipulate the intracranial artery may not be helpful for the patient.

Spiotta’s group evaluated 1,357 participants at seven U.S. medical centers, but only 12% out of the patients showed signs of posterior circulation stroke and 46% of cases received IV tissue-type plasminogen activator. The scientists use a prospectively-maintained database which consists of clinical and technical outcomes and baseline variables and can evaluate patients that underwent endovascular thrombectomy with direct aspiration as first pass technique or a stent retriever.

They collected their experience with the benefit of hindsight and joint it together, so there’s always a chance of case ascertain bias or other bias in the collection of the cases. One limitation is the fact that these are quality, busy centers, and the results might even worse if less experienced centers were included. It’s a little bit like getting the cream of the crop and analyzing their data. Upcoming studies should gather data on the relationship between specific thrombectomy devices and techniques and the success of recanalization procedures for patients with AIS.

SOURCE
https://www.medpagetoday.com/cardiology/strokes/78251

 

 

Advertisements

Read Full Post »


New 3D-printed Device could Help Treat Spinal Cord Injuries

Reporter: Irina Robu, PhD

Every ten minutes, a person is added to the national transplant waiting list in the US alone, where on average 20 people die each day while waiting for a transplant. The shortage of organ donors is not just confined to the US and scientists are turning to technology for help against this worldwide issue.

Bioprinting sounds innovative, but it has a potential to be the next big thing in healthcare and the hope is that printing and transplanting an organ will take a few hours without any risk of rejection from the body. These printed organs are created from the very cells of the body they will re-enter, matching the exact size, specifications and requirements of each individual patient. The artificial creation of human skin, tissue and internal organs sounds like something from the distant future, nevertheless much of it is happening right now in research facilities around the globe and providing new options for treatment.

Medical researchers and engineers at University of Minnesota created a groundbreaking 3-D printed device that could help patients with long term spinal injuries regain some function. A 3-D printed silicone guide, serves as a
platform for specialized cells that are then 3-D printed on top of it. The guide would be surgically implanted into the injured area of the spinal cord where it would serve as a “bridge” between living nerve cells above and below the area of injury.

According to Dr. Ann Parr “This is a very exciting first step in developing a treatment to help people with spinal cord injuries.” The expectation is that this would help patients alleviate pain as well as regain some functions like control of muscles, bowel and bladder. In the current experiments developed at University of Minnesota, years, researchers start with any kind of cell from an adult, such as a skin cell or blood cell which then use to reprogram the cells into neuronal stem cells. The engineers print these cells onto a silicone guide using an exclusive 3-D-printing technology in which the same 3-D printer is used to print both the guide and the cells. The guide keeps the cells alive and allows them to change into neurons. The team developed a prototype guide that would be surgically implanted into the damaged part of the spinal cord and help connect living cells on each side of the injury.

Despite all of these complexities, the hardest part of the entire procedure is being able to keep about 75% of cells during the 3-D printing process. But even with the latest technology, developing the prototype guides wasn’t easy. But although the research is very exciting, we need to be careful to offset expectations against reality. While the research still needs more work, there is no doubt that the future of healthcare and medicine will be very different thanks to this research.

Source

https://www.sciencedaily.com/releases/2018/08/180809093429.htm

 

Read Full Post »


Reporter and Curator: Dr. Sudipta Saha, Ph.D.

 

MRI-guided focused ultrasound (MRgFUS) surgery is a noninvasive thermal ablation method that uses magnetic resonance imaging (MRI) for target definition, treatment planning, and closed-loop control of energy deposition. Ultrasound is a form of energy that can pass through skin, muscle, fat and other soft tissue so no incisions or inserted probes are needed. High intensity focused ultrasound (HIFU) pinpoints a small target and provides a therapeutic effect by raising the temperature high enough to destroy the target with no damage to surrounding tissue. Integrating FUS and MRI as a therapy delivery system allows physicians to localize, target, and monitor in real time, and thus to ablate targeted tissue without damaging normal structures. This precision makes MRgFUS an attractive alternative to surgical resection or radiation therapy of benign and malignant tumors.

 

Hypothalamic hamartoma is a rare, benign (non-cancerous) brain tumor that can cause different types of seizures, cognitive problems or other symptoms. While the exact number of people with hypothalamic hamartomas is not known, it is estimated to occur in 1 out of 200,000 children and teenagers worldwide. In one such case at Nicklaus Children’s Brain Institute, USA the patient was able to return home the following day after FUS, resume normal regular activities and remained seizure free. Patients undergoing standard brain surgery to remove similar tumors are typically hospitalized for several days, require sutures, and are at risk of bleeding and infections.

 

MRgFUS is already approved for the treatment of uterine fibroids. It is in ongoing clinical trials for the treatment of breast, liver, prostate, and brain cancer and for the palliation of pain in bone metastasis. In addition to thermal ablation, FUS, with or without the use of microbubbles, can temporarily change vascular or cell membrane permeability and release or activate various compounds for targeted drug delivery or gene therapy. A disruptive technology, MRgFUS provides new therapeutic approaches and may cause major changes in patient management and several medical disciplines.

 

References:

 

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4005559/

 

https://www.mayoclinic.org/tests-procedures/focused-ultrasound-surgery/about/pac-20384707

 

https://www.mdtmag.com/news/2017/04/nicklaus-childrens-hospital-performs-worlds-first-focused-ultrasound-surgery-hypothalamic-hamartoma?et_cid=5922034&et_rid=765461457&location=top&et_cid=5922034&et_rid=765461457&linkid=https%3a%2f%2fwww.mdtmag.com%2fnews%2f2017%2f04%2fnicklaus-childrens-hospital-performs-worlds-first-focused-ultrasound-surgery-hypothalamic-hamartoma%3fet_cid%3d5922034%26et_rid%3d%%subscriberid%%%26location%3dtop

 

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3097768/

 

https://stanfordhealthcare.org/medical-treatments/m/mr-guided-focused-ultrasound.html

 

Read Full Post »


Imaging Technology in Cancer Surgery

Author and curator: Dror Nir, PhD

The advent of medical-imaging technologies such as image-fusion, functional-imaging and noninvasive tissue characterisation is playing an imperative role in answering this demand thus transforming the concept of personalized medicine in cancer into practice. The leading modality in that respect is medical imaging. To date, the main imaging systems that can provide reasonable level of cancer detection and localization are: CT, mammography, Multi-Sequence MRI, PET/CT and ultrasound. All of these require skilled operators and experienced imaging interpreters in order to deliver what is required at a reasonable level. It is generally agreed by radiologists and oncologists that in order to provide a comprehensive work-flow that complies with the principles of personalized medicine, future cancer patients’ management will heavily rely on computerized image interpretation applications that will extract from images in a standardized manner measurable imaging biomarkers leading to better clinical assessment of cancer patients.

As consequence of the human genome project and technological advances in gene-sequencing, the understanding of cancer advanced considerably. This led to increase in the offering of treatment options. Yet, surgical resection is still the leading form of therapy offered to patients with organ confined tumors. Obtaining “cancer free” surgical margins is crucial to the surgery outcome in terms of overall survival and patients’ quality of life/morbidity. Currently, a significant portion of surgeries ends up with positive surgical margins leading to poor clinical outcome and increase of costs. To improve on this, large variety of intraoperative imaging-devices aimed at resection-guidance have been introduced and adapted in the last decade and it is expected that this trend will continue.

The Status of Contemporary Image-Guided Modalities in Oncologic Surgery is a review paper presenting a variety of cancer imaging techniques that have been adapted or developed for intra-operative surgical guidance. It also covers novel, cancer-specific contrast agents that are in early stage development and demonstrate significant promise to improve real-time detection of sub-clinical cancer in operative setting.

Another good (free access) review paper is: uPAR-targeted multimodal tracer for pre- and intraoperative imaging in cancer surgery

Abstract

Pre- and intraoperative diagnostic techniques facilitating tumor staging are of paramount importance in colorectal cancer surgery. The urokinase receptor (uPAR) plays an important role in the development of cancer, tumor invasion, angiogenesis, and metastasis and over-expression is found in the majority of carcinomas. This study aims to develop the first clinically relevant anti-uPAR antibody-based imaging agent that combines nuclear (111In) and real-time near-infrared (NIR) fluorescent imaging (ZW800-1). Conjugation and binding capacities were investigated and validated in vitro using spectrophotometry and cell-based assays. In vivo, three human colorectal xenograft models were used including an orthotopic peritoneal carcinomatosis model to image small tumors. Nuclear and NIR fluorescent signals showed clear tumor delineation between 24h and 72h post-injection, with highest tumor-to-background ratios of 5.0 ± 1.3 at 72h using fluorescence and 4.2 ± 0.1 at 24h with radioactivity. 1-2 mm sized tumors could be clearly recognized by their fluorescent rim. This study showed the feasibility of an uPAR-recognizing multimodal agent to visualize tumors during image-guided resections using NIR fluorescence, whereas its nuclear component assisted in the pre-operative non-invasive recognition of tumors using SPECT imaging. This strategy can assist in surgical planning and subsequent precision surgery to reduce the number of incomplete resections.

INTRODUCTION
Diagnosis, staging, and surgical planning of colorectal cancer patients increasingly rely on imaging techniques that provide information about tumor biology and anatomical structures [1-3]. Single-photon emission computed tomography (SPECT) and positron emission tomography (PET) are preoperative nuclear imaging modalities used to provide insights into tumor location, tumor biology, and the surrounding micro-environment [4]. Both techniques depend on the recognition of tumor cells using radioactive ligands. Various monoclonal antibodies, initially developed as therapeutic agents (e.g. cetuximab, bevacizumab, labetuzumab), are labeled with radioactive tracers and evaluated for pre-operative imaging purposes [5-9]. Despite these techniques, during surgery the surgeons still rely mostly on their eyes and hands to distinguish healthy from malignant tissues, resulting in incomplete resections or unnecessary tissue removal in up to 27% of rectal cancer patients [10, 11]. Incomplete resections (R1) are shown to be a strong predictor of development of distant metastasis, local recurrence, and decreased survival of colorectal cancer patients [11, 12]. Fluorescence-guided surgery (FGS) is an intraoperative imaging technique already introduced and validated in the clinic for sentinel lymph node (SLN) mapping and biliary imaging [13]. Tumor-specific FGS can be regarded as an extension of SPECT/PET, using fluorophores instead of radioactive labels conjugated to tumor-specific ligands, but with higher spatial resolution than SPECT/PET imaging and real-time anatomical feedback [14]. A powerful synergy can be achieved when nuclear and fluorescent imaging modalities are combined, extending the nuclear diagnostic images with real-time intraoperative imaging. This combination can lead to improved diagnosis and management by integrating pre-intra and postoperative imaging. Nuclear imaging enables pre-operative evaluation of tumor spread while during surgery deeper lying spots can be localized using the gamma probe counter. The (NIR) fluorescent signal aids the surgeon in providing real-time anatomical feedback to accurately recognize and resect malignant tissues. Postoperative, malignant cells can be recognized using NIR fluorescent microscopy. Clinically, the advantages of multimodal agents in image-guided surgery have been shown in patients with melanoma and prostate cancer, but those studies used a-specific agents, following the natural lymph drainage pattern of colloidal tracers after peritumoral injection [15, 16]. The urokinase-type plasminogen activator receptor (uPAR) is implicated in many aspects of tumor growth and (micro) metastasis [17, 18]. The levels of uPAR are undetectable in normal tissues except for occasional macrophages and granulocytes in the uterus, thymus, kidneys and spleen [19]. Enhanced tumor levels of uPAR and its circulating form (suPAR) are independent prognostic markers for overall survival in colorectal cancer patients [20, 21]. The relatively selective and high overexpression of uPAR in a wide range of human cancers including colorectal, breast, and pancreas nominate uPAR as a widely applicable and potent molecular target [17,22]. The current study aims to develop a clinically relevant uPAR-specific multimodal agent that can be used to visualize tumors pre- and intraoperatively after a single injection. We combined the 111Indium isotope with NIR fluorophore ZW800-1 using a hybrid linker to an uPAR specific monoclonal antibody (ATN-658) and evaluated its performance using a pre-clinical SPECT system (U-SPECT-II) and a clinically-applied NIR fluorescence camera system (FLARE™).

Fig1 Fig2 Fig3

Robotic surgery is a growing trend as a form of surgery, specifically in urology. The following review paper propose a good discussion on the added value of imaging in urologic robotic surgery:

The current and future use of imaging in urological robotic surgery: a survey of the European Association of Robotic Urological Surgeons

 Abstract

Background

With the development of novel augmented reality operating platforms the way surgeons utilize imaging as a real-time adjunct to surgical technique is changing.

Methods

A questionnaire was distributed via the European Robotic Urological Society mailing list. The questionnaire had three themes: surgeon demographics, current use of imaging and potential uses of an augmented reality operating environment in robotic urological surgery.

Results

117 of the 239 respondents (48.9%) were independently practicing robotic surgeons. 74% of surgeons reported having imaging available in theater for prostatectomy 97% for robotic partial nephrectomy and 95% cystectomy. 87% felt there was a role for augmented reality as a navigation tool in robotic surgery.

Conclusions

This survey has revealed the contemporary robotic surgeon to be comfortable in the use of imaging for intraoperative planning it also suggests that there is a desire for augmented reality platforms within the urological community. Copyright © 2014 John Wiley & Sons, Ltd.

 Introduction

Since Röntgen first utilized X-rays to image the carpal bones of the human hand in 1895, medical imaging has evolved and is now able to provide a detailed representation of a patient’s intracorporeal anatomy, with recent advances now allowing for 3-dimensional (3D) reconstructions. The visualization of anatomy in 3D has been shown to improve the ability to localize structures when compared with 2D with no change in the amount of cognitive loading [1]. This has allowed imaging to move from a largely diagnostic tool to one that can be used for both diagnosis and operative planning.

One potential interface to display 3D images, to maximize its potential as a tool for surgical guidance, is to overlay them onto the endoscopic operative scene (augmented reality). This addresses, in part, a criticism often leveled at robotic surgery, the loss of haptic feedback. Augmented reality has the potential to mitigate this sensory loss by enhancing the surgeons visual cues with information regarding subsurface anatomical relationships [2].

Augmented reality surgery is in its infancy for intra-abdominal procedures due in large part to the difficulties of applying static preoperative imaging to a constantly deforming intraoperative scene [3]. There are case reports and ex vivo studies in the literature examining the technology in minimal access prostatectomy [3-6] and partial nephrectomy [7-10], but there remains a lack of evidence determining whether surgeons feel there is a role for the technology and if so for what procedures they feel it would be efficacious.

This questionnaire-based study was designed to assess first, the pre- and intra-operative imaging modalities utilized by robotic urologists; second, the current use of imaging intraoperatively for surgical planning; and finally whether there is a desire for augmented reality among the robotic urological community.

Methods

Recruitment

A web based survey instrument was designed and sent out, as part of a larger survey, to members of the EAU robotic urology section (ERUS). Only independently practicing robotic surgeons performing robot-assisted laparoscopic prostatectomy (RALP), robot-assisted partial nephrectomy (RAPN) and/or robotic cystectomy were included in the analysis, those surgeons exclusively performing other procedures were excluded. Respondents were offered no incentives to reply. All data collected was anonymous.

Survey design and administration

The questionnaire was created using the LimeSurvey platform (www.limesurvey.com) and hosted on their website. All responses (both complete and incomplete) were included in the analysis. The questionnaire was dynamic with the questions displayed tailored to the respondents’ previous answers.

When computing fractions or percentages the denominator was the number of respondents to answer the question, this number is variable due to the dynamic nature of the questionnaire.

Demographics

All respondents to the survey were asked in what country they practiced and what robotic urological procedures they performed. In addition to what procedures they performed surgeons were asked to specify the number of cases they had undertaken for each procedure.

 Current imaging practice

Procedure-specific questions in this group were displayed according to the operations the respondent performed. A summary of the questions can be seen in Appendix 1. Procedure-nonspecific questions were also asked. Participants were asked whether they routinely used the Tile Pro™ function of the da Vinci console (Intuitive Surgical, Sunnyvale, USA) and whether they routinely viewed imaging intra-operatively.

 Augmented reality

Before answering questions in this section, participants were invited to watch a video demonstrating an augmented reality platform during RAPN, performed by our group at Imperial College London. A still from this video can be seen in Figure 1. They were then asked whether they felt augmented reality would be of use as a navigation or training tool in robotic surgery.

f1

Figure 1. A still taken from a video of augmented reality robot assisted partial nephrectomy performed. Here the tumour has been painted into the operative view allowing the surgeon to appreciate the relationship of the tumour with the surface of the kidney

Once again, in this section, procedure-specific questions were displayed according to the operations the respondent performed. Only those respondents who felt augmented reality would be of use as a navigation tool were asked procedure-specific questions. Questions were asked to establish where in these procedures they felt an augmented reality environment would be of use.

Results

Demographics

Of the 239 respondents completing the survey 117 were independently practising robotic surgeons and were therefore eligible for analysis. The majority of the surgeons had both trained (210/239, 87.9%) and worked in Europe (215/239, 90%). The median number of cases undertaken by those surgeons reporting their case volume was: 120 (6–2000), 9 (1–120) and 30 (1–270), for RALP, robot assisted cystectomy and RAPN, respectively.

 

Contemporary use of imaging in robotic surgery

When enquiring about the use of imaging for surgical planning, the majority of surgeons (57%, 65/115) routinely viewed pre-operative imaging intra-operatively with only 9% (13/137) routinely capitalizing on the TilePro™ function in the console to display these images. When assessing the use of TilePro™ among surgeons who performed RAPN 13.8% (9/65) reported using the technology routinely.

When assessing the imaging modalities that are available to a surgeon in theater the majority of surgeons performing RALP (74%, 78/106)) reported using MRI with an additional 37% (39/106) reporting the use of CT for pre-operative staging and/or planning. For surgeons performing RAPN and robot-assisted cystectomy there was more of a consensus with 97% (68/70) and 95% (54/57) of surgeons, respectively, using CT for routine preoperative imaging (Table 1).

Table 1. Which preoperative imaging modalities do you use for diagnosis and surgical planning?

  CT MRI USS None Other
RALP (n = 106) 39.8% 73.5% 2% 15.1% 8.4%
(39) (78) (3) (16) (9)
RAPN (n = 70) 97.1% 42.9% 17.1% 0% 2.9%
(68) (30) (12) (0) (2)
Cystectomy (n = 57) 94.7% 26.3% 1.8% 1.8% 5.3%
(54) (15) (1) (1) (3)

Those surgeons performing RAPN were found to have the most diversity in the way they viewed pre-operative images in theater, routinely viewing images in sagittal, coronal and axial slices (Table 2). The majority of these surgeons also viewed the images as 3D reconstructions (54%, 38/70).

Table 2. How do you typically view preoperative imaging in the OR? 3D recons = three-dimensional reconstructions

  Axial slices (n) Coronal slices (n) Sagittal slices (n) 3D recons. (n) Do not view (n)  
RALP (n = 106) 49.1% 44.3% 31.1% 9.4% 31.1%
(52) (47) (33) (10) (33)
RAPN (n = 70) 68.6% 74.3% 60% (42) 54.3% 0%
(48) (52) (38) (0)
Cystectomy (n = 57) 70.2% 52.6% 50.9% 21.1% 8.8%
(40) (30) (29) (12) (5)

The majority of surgeons used ultrasound intra-operatively in RAPN (51%, 35/69) with a further 25% (17/69) reporting they would use it if they had access to a ‘drop-in’ ultrasound probe (Figure 2).

f2

Figure 2. Chart demonstrating responses to the question – Do you use intraoperative ultrasound for robotic partial nephrectomy?

Desire for augmented reality

Overall, 87% of respondents envisaged a role for augmented reality as a navigation tool in robotic surgery and 82% (88/107) felt that there was an additional role for the technology as a training tool.

The greatest desire for augmented reality was among those surgeons performing RAPN with 86% (54/63) feeling the technology would be of use. The largest group of surgeons felt it would be useful in identifying tumour location, with significant numbers also feeling it would be efficacious in tumor resection (Figure 3).

f3

Figure 3. Chart demonstrating responses to the question – In robotic partial nephrectomy which parts of the operation do you feel augmented reality image overlay would be of assistance?

When enquiring about the potential for augmented reality in RALP, 79% (20/96) of respondents felt it would be of use during the procedure, with the largest group feeling it would be helpful for nerve sparing 65% (62/96) (Figure 4). The picture in cystectomy was similar with 74% (37/50) of surgeons believing augmented reality would be of use, with both nerve sparing and apical dissection highlighted as specific examples (40%, 20/50) (Figure 5). The majority also felt that it would be useful for lymph node dissection in both RALP and robot assisted cystectomy (55% (52/95) and 64% (32/50), respectively).

f4

Figure 4. Chart demonstrating responses to the question – In robotic prostatectomy which parts of the operation do you feel augmented reality image overlay would be of assistance?

f5

Figure 5. Chart demonstrating responses to the question – In robotic cystectomy which parts of the operation do you feel augmented reality overlay technology would be of assistance?

Discussion

The results from this study suggest that the contemporary robotic surgeon views imaging as an important adjunct to operative practice. The way these images are being viewed is changing; although the majority of surgeons continue to view images as two-dimensional (2D) slices a significant minority have started to capitalize on 3D reconstructions to give them an improved appreciation of the patient’s anatomy.

This study has highlighted surgeons’ willingness to take the next step in the utilization of imaging in operative planning, augmented reality, with 87% feeling it has a role to play in robotic surgery. Although there appears to be a considerable desire for augmented reality, the technology itself is still in its infancy with the limited evidence demonstrating clinical application reporting only qualitative results [3, 7, 11, 12].

There are a number of significant issues that need to be overcome before augmented reality can be adopted in routine clinical practice. The first of these is registration (the process by which two images are positioned in the same coordinate system such that the locations of corresponding points align [13]). This process has been performed both manually and using automated algorithms with varying degrees of accuracy [2, 14]. The second issue pertains to the use of static pre-operative imaging in a dynamic operative environment; in order for the pre-operative imaging to be accurately registered it must be deformable. This problem remains as yet unresolved.

Live intra-operative imaging circumvents the problems of tissue deformation and in RAPN 51% of surgeons reported already using intra-operative ultrasound to aid in tumour resection. Cheung and colleagues [9] have published an ex vivo study highlighting the potential for intra-operative ultrasound in augmented reality partial nephrectomy. They report the overlaying of ultrasound onto the operative scene to improve the surgeon’s appreciation of the subsurface tumour anatomy, this improvement in anatomical appreciation resulted in improved resection quality over conventional ultrasound guided resection [9]. Building on this work the first in vivo use of overlaid ultrasound in RAPN has recently been reported [10]. Although good subjective feedback was received from the operating surgeon, the study was limited to a single case demonstrating feasibility and as such was not able to show an outcome benefit to the technology [10].

RAPN also appears to be the area in which augmented reality would be most readily adopted with 86% of surgeons claiming they see a use for the technology during the procedure. Within this operation there are two obvious steps to augmentation, anatomical identification (in particular vessel identification to facilitate both routine ‘full clamping’ and for the identification of secondary and tertiary vessels for ‘selective clamping’ [15]) and tumour resection. These two phases have different requirements from an augmented reality platform; the first phase of identification requires a gross overview of the anatomy without the need for high levels of registration accuracy. Tumor resection, however, necessitates almost sub-millimeter accuracy in registration and needs the system to account for the dynamic intra-operative environment. The step of anatomical identification is amenable to the use of non-deformable 3D reconstructions of pre-operative imaging while that of image-guided tumor resection is perhaps better suited to augmentation with live imaging such as ultrasound [2, 9, 16].

For RALP and robot-assisted cystectomy the steps in which surgeons felt augmented reality would be of assistance were those of neurovascular bundle preservation and apical dissection. The relative, perceived, efficacy of augmented reality in these steps correlate with previous examinations of augmented reality in RALP [17, 18]. Although surgeon preference for utilizing augmented reality while undertaking robotic prostatectomy has been demonstrated, Thompson et al. failed to demonstrate an improvement in oncological outcomes in those patients undergoing AR RALP [18].

Both nerve sparing and apical dissection require a high level of registration accuracy and a necessity for either live imaging or the deformation of pre-operative imaging to match the operative scene; achieving this level of registration accuracy is made more difficult by the mobilization of the prostate gland during the operation [17]. These problems are equally applicable to robot-assisted cystectomy. Although guidance systems have been proposed in the literature for RALP [3-5, 12, 17], none have achieved the level of accuracy required to provide assistance during nerve sparing. In addition, there are still imaging challenges that need to be overcome. Although multiparametric MRI has been shown to improve decision making in opting for a nerve sparing approach to RALP [19] the imaging is not yet able to reliably discern the exact location of the neurovascular bundle. This said, significant advances are being made with novel imaging modalities on the horizon that may allow for imaging of the neurovascular bundle in the near future [20].

 

Limitations

The number of operations included represents a significant limitation of the study, had different index procedures been chosen different results may have been seen. This being said the index procedures selected were chosen as they represent the vast majority of uro-oncological robotic surgical practice, largely mitigating for this shortfall.

Although the available ex vivo evidence suggests that introducing augmented reality operating environments into surgical practice would help to improve outcomes [9, 21] the in vivo experience to date is limited to small volume case series reporting feasibility [2, 3, 14]. To date no study has demonstrated an in vivo outcome advantage to augmented reality guidance. In addition to this limitation augmented reality has been demonstrated to increased rates of inattention blindness among surgeons suggesting there is a trade-off between increasing visual information and the surgeon’s ability to appreciate unexpected operative events [21].

 

Conclusions

This survey shows the contemporary robotic surgeon to be comfortable with the use of imaging to aid intra-operative planning; furthermore it highlights a significant interest among the urological community in augmented reality operating platforms.

Short- to medium-term development of augmented reality systems in robotic urology surgery would be best performed using RAPN as the index procedure. Not only was this the operation where surgeons saw the greatest potential benefits, but it may also be the operation where it is most easily achievable by capitalizing on the respective benefits of technologies the surgeons are already using; pre-operative CT for anatomical identification and intra-operative ultrasound for tumour resection.

 

Conflict of interest

None of the authors have any conflicts of interest to declare.

Appendix 1

Question Asked Question Type
Demographics
In which country do you usually practise? Single best answer
Which robotic procedures do you perform?* Single best answer
Current Imaging Practice
What preoperative imaging modalities do you use for the staging and surgical planning in renal cancer? Multiple choice
How do you typically view preoperative imaging in theatre for renal cancer surgery? Multiple choice
Do you use intraoperative ultrasound for partial nephrectomy? Yes or No
What preoperative imaging modalities do you use for the staging and surgical planning in prostate cancer? Multiple choice
How do you typically view preoperative imaging in theatre for prostate cancer? Multiple choice
Do you use intraoperative ultrasound for robotic partial nephrectomy? Yes or No
Which preoperative imaging modality do you use for staging and surgical planning in muscle invasive TCC? Multiple choice
How do you typically view preoperative imaging in theatre for muscle invasive TCC? Multiple choice
Do you routinely refer to preoperative imaging intraoperativley? Yes or No
Do you routinely use Tilepro intraoperativley? Yes or No
Augmented Reality
Do you feel there is a role for augmented reality as a navigation tool in robotic surgery? Yes or No
Do you feel there is a role for augmented reality as a training tool in robotic surgery? Yes or No
In robotic partial nephrectomy which parts of the operation do you feel augmented reality image overlay technology would be of assistance? Multiple choice
In robotic nephrectomy which parts of the operation do you feel augmented reality image overlay technology would be of assistance? Multiple choice
In robotic prostatectomy which parts of the operation do you feel augmented reality image overlay technology would be of assistance? Multiple choice
Would augmented reality guidance be of use in lymph node dissection in robotic prostatectomy? Yes or No
In robotic cystectomy which parts of the operation do you feel augmented reality image overlay technology would be of assistance? Multiple choice
Would augmented reality guidance be of use in lymph node dissection in robotic cystectomy? Yes or No
*The relevant procedure related questions were displayed based on the answer to this question

References

1. Foo J-L, Martinez-Escobar M, Juhnke B, et al.Evaluating mental workload of two-dimensional and three-dimensional visualization for anatomical structure localization. J Laparoendosc Adv Surg Tech A 2013; 23(1):65–70.

2. Hughes-Hallett A, Mayer EK, Marcus HJ, et al.Augmented reality partial nephrectomy: examining the current status and future perspectives. Urology 2014; 83(2): 266–273.

3. Sridhar AN, Hughes-Hallett A, Mayer EK, et al.Image-guided robotic interventions for prostate cancer. Nat Rev Urol 2013; 10(8): 452–462.

4. Cohen D, Mayer E, Chen D, et al.Eddie’ Augmented reality image guidance in minimally invasive prostatectomy. Lect Notes Comput Sci 2010; 6367: 101–110.

5. Simpfendorfer T, Baumhauer M, Muller M, et al.Augmented reality visualization during laparoscopic radical prostatectomy. J Endourol 2011; 25(12): 1841–1845.

6. Teber D, Simpfendorfer T, Guven S, et al.In vitro evaluation of a soft-tissue navigation system for laparoscopic prostatectomy. J Endourol 2010; 24(9): 1487–1491.

7. Teber D, Guven S, Simpfendörfer T, et al.Augmented reality: a new tool to improve surgical accuracy during laparoscopic partial nephrectomy? Preliminary in vitro and in vivo Eur Urol 2009; 56(2): 332–338.

8. Pratt P, Mayer E, Vale J, et al.An effective visualisation and registration system for image-guided robotic partial nephrectomy. J Robot Surg 2012; 6(1): 23–31.

9. Cheung CL, Wedlake C, Moore J, et al.Fused video and ultrasound images for minimally invasive partial nephrectomy: a phantom study. Med Image Comput Comput Assist Interv 2010; 13(Pt 3): 408–415.

10. Hughes-Hallett A, Pratt P, Mayer E, et al.Intraoperative ultrasound overlay in robot-assisted partial nephrectomy: first clinical experience. Eur Urol 2014; 65(3): 671–672.

11. Nakamura K, Naya Y, Zenbutsu S, et al.Surgical navigation using three-dimensional computed tomography images fused intraoperatively with live video. J Endourol 2010; 24(4): 521–524.

12. Ukimura O, Gill IS. Imaging-assisted endoscopic surgery: Cleveland clinic experience. J Endourol2008; 22(4):803–809.

13. Altamar HO, Ong RE, Glisson CL, et al.Kidney deformation and intraprocedural registration: a study of elements of image-guided kidney surgery. J Endourol 2011; 25(3): 511–517.

14. Nicolau S, Soler L, Mutter D, Marescaux J. Augmented reality in laparoscopic surgical oncology. Surg Oncol2011; 20(3): 189–201.

15. Ukimura O, Nakamoto M, Gill IS. Three-dimensional reconstruction of renovascular-tumor anatomy to facilitate zero-ischemia partial nephrectomy. Eur Urol2012; 61(1): 211–217.

16. Pratt P, Hughes-Hallett A, Di Marco A, et al. Multimodal reconstruction for image-guided interventions. In:Yang GZ, Darzi A (eds) Proceedings of the Hamlyn symposium on medical robotics: London. 2013; 59–61.

17. Mayer EK, Cohen D, Chen D, et al.Augmented reality image guidance in minimally invasive prostatectomy. Eur Urol Supp 2011; 10(2): 300.

18. Thompson S, Penney G, Billia M, et al.Design and evaluation of an image-guidance system for robot-assisted radical prostatectomy. BJU Int 2013; 111(7): 1081–1090.

19. Panebianco V, Salciccia S, Cattarino S, et al.Use of multiparametric MR with neurovascular bundle evaluation to optimize the oncological and functional management of patients considered for nerve-sparing radical prostatectomy. J Sex Med 2012; 9(8): 2157–2166.

20. Rai S, Srivastava A, Sooriakumaran P, Tewari A. Advances in imaging the neurovascular bundle. Curr Opin Urol2012; 22(2): 88–96.

21. Dixon BJ, Daly MJ, Chan H, et al.Surgeons blinded by enhanced navigation: the effect of augmented reality on attention. Surg Endosc 2013; 27(2): 454–461.

Read Full Post »

Imaging-guided cancer treatment


Imaging-guided cancer treatment

Writer & reporter: Dror Nir, PhD

It is estimated that the medical imaging market will exceed $30 billion in 2014 (FierceMedicalImaging). To put this amount in perspective; the global pharmaceutical market size for the same year is expected to be ~$1 trillion (IMS) while the global health care spending as a percentage of Gross Domestic Product (GDP) will average 10.5% globally in 2014 (Deloitte); it will reach ~$3 trillion in the USA.

Recent technology-advances, mainly miniaturization and improvement in electronic-processing components is driving increased introduction of innovative medical-imaging devices into critical nodes of major-diseases’ management pathways. Consequently, in contrast to it’s very small contribution to global health costs, medical imaging bears outstanding potential to reduce the future growth in spending on major segments in this market mainly: Drugs development and regulation (e.g. companion diagnostics and imaging surrogate markers); Disease management (e.g. non-invasive diagnosis, guided treatment and non-invasive follow-ups); and Monitoring aging-population (e.g. Imaging-based domestic sensors).

In; The Role of Medical Imaging in Personalized Medicine I discussed in length the role medical imaging assumes in drugs development.  Integrating imaging into drug development processes, specifically at the early stages of drug discovery, as well as for monitoring drug delivery and the response of targeted processes to the therapy is a growing trend. A nice (and short) review highlighting the processes, opportunities, and challenges of medical imaging in new drug development is: Medical imaging in new drug clinical development.

The following is dedicated to the role of imaging in guiding treatment.

Precise treatment is a major pillar of modern medicine. An important aspect to enable accurate administration of treatment is complementing the accurate identification of the organ location that needs to be treated with a system and methods that ensure application of treatment only, or mainly to, that location. Imaging is off-course, a major component in such composite systems. Amongst the available solution, functional-imaging modalities are gaining traction. Specifically, molecular imaging (e.g. PET, MRS) allows the visual representation, characterization, and quantification of biological processes at the cellular and subcellular levels within intact living organisms. In oncology, it can be used to depict the abnormal molecules as well as the aberrant interactions of altered molecules on which cancers depend. Being able to detect such fundamental finger-prints of cancer is key to improved matching between drugs-based treatment and disease. Moreover, imaging-based quantified monitoring of changes in tumor metabolism and its microenvironment could provide real-time non-invasive tool to predict the evolution and progression of primary tumors, as well as the development of tumor metastases.

A recent review-paper: Image-guided interventional therapy for cancer with radiotherapeutic nanoparticles nicely illustrates the role of imaging in treatment guidance through a comprehensive discussion of; Image-guided radiotherapeutic using intravenous nanoparticles for the delivery of localized radiation to solid cancer tumors.

 Graphical abstract

 Abstract

One of the major limitations of current cancer therapy is the inability to deliver tumoricidal agents throughout the entire tumor mass using traditional intravenous administration. Nanoparticles carrying beta-emitting therapeutic radionuclides [DN: radioactive isotops that emits electrons as part of the decay process a list of β-emitting radionuclides used in radiotherapeutic nanoparticle preparation is given in table1 of this paper.) that are delivered using advanced image-guidance have significant potential to improve solid tumor therapy. The use of image-guidance in combination with nanoparticle carriers can improve the delivery of localized radiation to tumors. Nanoparticles labeled with certain beta-emitting radionuclides are intrinsically theranostic agents that can provide information regarding distribution and regional dosimetry within the tumor and the body. Image-guided thermal therapy results in increased uptake of intravenous nanoparticles within tumors, improving therapy. In addition, nanoparticles are ideal carriers for direct intratumoral infusion of beta-emitting radionuclides by convection enhanced delivery, permitting the delivery of localized therapeutic radiation without the requirement of the radionuclide exiting from the nanoparticle. With this approach, very high doses of radiation can be delivered to solid tumors while sparing normal organs. Recent technological developments in image-guidance, convection enhanced delivery and newly developed nanoparticles carrying beta-emitting radionuclides will be reviewed. Examples will be shown describing how this new approach has promise for the treatment of brain, head and neck, and other types of solid tumors.

The challenges this review discusses

  • intravenously administered drugs are inhibited in their intratumoral penetration by high interstitial pressures which prevent diffusion of drugs from the blood circulation into the tumor tissue [1–5].
  • relatively rapid clearance of intravenously administered drugs from the blood circulation by kidneys and liver.
  • drugs that do reach the solid tumor by diffusion are inhomogeneously distributed at the micro-scale – This cannot be overcome by simply administering larger systemic doses as toxicity to normal organs is generally the dose limiting factor.
  • even nanoparticulate drugs have poor penetration from the vascular compartment into the tumor and the nanoparticles that do penetrate are most often heterogeneously distributed

How imaging could mitigate the above mentioned challenges

  • The inclusion of an imaging probe during drug development can aid in determining the clearance kinetics and tissue distribution of the drug non-invasively. Such probe can also be used to determine the likelihood of the drug reaching the tumor and to what extent.

Note: Drugs that have increased accumulation within the targeted site are likely to be more effective as compared with others. In that respect, Nanoparticle-based drugs have an additional advantage over free drugs with their potential to be multifunctional carriers capable of carrying both therapeutic and diagnostic imaging probes (theranostic) in the same nanocarrier. These multifunctional nanoparticles can serve as theranostic agents and facilitate personalized treatment planning.

  • Imaging can also be used for localization of the tumor to improve the placement of a catheter or external device within tumors to cause cell death through thermal ablation or oxidative stress secondary to reactive oxygen species.

See the example of Vintfolide in The Role of Medical Imaging in Personalized Medicine

vinta

Note: Image guided thermal ablation methods include radiofrequency (RF) ablation, microwave ablation or high intensity focused ultrasound (HIFU). Photodynamic therapy methods using external light devices to activate photosensitizing agents can also be used to treat superficial tumors or deeper tumors when used with endoscopic catheters.

  • Quality control during and post treatment

For example: The use of high intensity focused ultrasound (HIFU) combined with nanoparticle therapeutics: HIFU is applied to improve drug delivery and to trigger drug release from nanoparticles. Gas-bubbles are playing the role of the drug’s nano-carrier. These are used both to increase the drug transport into the cell and as ultrasound-imaging contrast material. The ultrasound is also used for processes of drug-release and ablation.

 HIFU

Additional example; Multifunctional nanoparticles for tracking CED (convection enhanced delivery)  distribution within tumors: Nanoparticle that could serve as a carrier not only for the therapeutic radionuclides but simultaneously also for a therapeutic drug and 4 different types of imaging contrast agents including an MRI contrast agent, PET and SPECT nuclear diagnostic imaging agents and optical contrast agents as shown below. The ability to perform multiple types of imaging on the same nanoparticles will allow studies investigating the distribution and retention of nanoparticles initially in vivo using non-invasive imaging and later at the histological level using optical imaging.

 multi

Conclusions

Image-guided radiotherapeutic nanoparticles have significant potential for solid tumor cancer therapy. The current success of this therapy in animals is most likely due to the improved accumulation, retention and dispersion of nanoparticles within solid tumor following image-guided therapies as well as the micro-field of the β-particle which reduces the requirement of perfectly homogeneous tumor coverage. It is also possible that the intratumoral distribution of nanoparticles may benefit from their uptake by intratumoral macrophages although more research is required to determine the importance of this aspect of intratumoral radionuclide nanoparticle therapy. This new approach to cancer therapy is a fertile ground for many new technological developments as well as for new understandings in the basic biology of cancer therapy. The clinical success of this approach will depend on progress in many areas of interdisciplinary research including imaging technology, nanoparticle technology, computer and robot assisted image-guided application of therapies, radiation physics and oncology. Close collaboration of a wide variety of scientists and physicians including chemists, nanotechnologists, drug delivery experts, radiation physicists, robotics and software experts, toxicologists, surgeons, imaging physicians, and oncologists will best facilitate the implementation of this novel approach to the treatment of cancer in the clinical environment. Image-guided nanoparticle therapies including those with β-emission radionuclide nanoparticles have excellent promise to significantly impact clinical cancer therapy and advance the field of drug delivery.

Read Full Post »


Topical Bovine Thrombin Induces Vascular Cell Proliferation

Demet Sağ, Kamran Baig*, Steven Hanish*, Jeffrey Lawson

 

 

 

Running Foot:

Use of bovine thrombin induces the cell proliferation at anastomosis

Department of Surgery

Duke University Medical Center

Durham, NC 27710

United States of America

* Equally worked

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Box 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu

demet.sag@gmail.com

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Abstract:

Specific Aim:  The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.

Methods and Results:  Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery.    Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting.  Expression of PAR  (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR.  All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin.  These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK.  Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.

Conclusion:  Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.

Abbreviations: ERK, extracellular regulated kinase; ES, embryonic stem cells; JIP, JNK-interacting protein; JNK, c-Jun NH2-terminal kinase; JNKK, JNK kinase; JNKBP, JNK binding protein; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MEK, MAPK/ERK kinase; MEKK, MEK kinase; MKK, MAPK kinase.

Keywords: Hemostatics, Signal transduction; Thrombin, PTGF

————————————————————————————————————

Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4].  It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI  during various surgical procedures.  Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6].  Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].

Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin.  It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9].  Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10].  Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.

Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs.  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].

Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself.  There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs)   [24-27].

Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33].  To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure.  We had tested the impact of topical bovine thrombin affect at the anastomosis.

Materials and Methods:

Surgical Procedure:  We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency.  Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine.  Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days.  In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used.   Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.

Ki67 Immunostaining:  The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks.  The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0).  The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum.  The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast.  As a result, positive tissues became brown and negatives were red.

MAPKs Immunostaining:  The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody.  The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.

Immunoblotting:  Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h.  Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS.  The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).

RNA isolation and RT-PCR: The harvested vessels were kept in RNAlater (Ambion, Austin, TX).   The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.

The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler.  The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse); PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT  3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).

CTGF and Cyr61:  The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers.  For CTGF the primers were  forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.

RESULTS:

First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin.   Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs.   We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment.    These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr  treatment with BT.  This data  the hypothesis for the function of PAR receptors in vascular tissues that  they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.

 

TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:

Next question was to make linear correlation between the expressions of PARs  to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues.   Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes.  Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared.  If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min.  Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli.  The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls.    Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.

Proliferation of the tissue depends on pERK

PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen.   Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured.   As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.

First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues).  We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins.  The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls.  This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.

The next target was JNK that plays a role in the inflammation, stress, and differentiation.    In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application.  This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients.   The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots.  Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.

Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues.  The expression of p38 was higher than JNK but much lower than ERK.  Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.

In general, all MAPKs showed increased in their phosphorylation level.  The level of activated MAPK expression was increased 200% in the tested animal.  The order of expression from high to low would be  ERK, JNK, and p38.

The genetic expression change

The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement.   Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection.  The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment.  Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.

DISCUSSION:

The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access  that leads to the cell proliferation and inflammation  through MAPKs  as well as  downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.

From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues.  We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding.  This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.

It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions.  In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent.   Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.

The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used.  The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle.  In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase.  During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.

Next, level of evidence was the signaling pathway analysis from membrane to the nucleus.  As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK,  pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel.  Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK).  The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation.  In our data we had detected the elvation of ERK more than the other MAPKs.   In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.

Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis.  The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.  

Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered  thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.

 

 

 

 

 

 

 

REFERENCES:

1.         Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.

2.         Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.

3.         TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.

4.         Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.

5.         Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.

6.         Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.

7.         Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.

8.         Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.

9.         Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.

10.       Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.

11.       Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.

12.       Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.

13.       Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.

14.       Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.

15.       Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.

16.       Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.

17.       Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.

18.       Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.

19.       Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.

20.       Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.

21.       Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.

22.       Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.

23.       Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.

24.       Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.

25.       Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.

26.       Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.

27.       Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.

28.       Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.

29.       Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.

30.       Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.

31.       Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.

32.       Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.

33.       McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.

34.       Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.

35.       Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.

36.       Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.

37.       Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.

38.       Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.

39.       Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.

40.       Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.

41.       Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.

Figure Legends:

Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR.        PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr

Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation

Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues

Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues

Figure 5: The activity of p38. (A) Immunostaining of total and activated p38.  Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues

Figure 6: The Expression of CTGF and Cyr61 after Thrombin Treatment. (A)CTGF            (B) Cyr61 expressions of treated and un-treated with TBT veins at 24h and 7 days.Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment

Read Full Post »


aprotinin-sequence.Par.0001.Image.260

aprotinin-sequence.Par.0001.Image.260 (Photo credit: redondoself)

English: Protein folding: amino-acid sequence ...

Protein folding: amino-acid sequence of bovine BPTI (basic pancreatic trypsin inhibitor) in one-letter code, with its folded 3D structure represented by a stick model of the mainchain and sidechains (in gray), and the backbone and secondary structure by a ribbon colored blue to red from N- to C-terminus. 3D structure from PDB file 1BPI, visualized in Mage and rendered in Raster3D. (Photo credit: Wikipedia)

 

 

 

 

 

 

 

 

 

 

 

 

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Demet Sag, PhD*†, Kamran Baig, MBBS, MRCS; James Jaggers, MD, Jeffrey H. Lawson, MD, PhD

Departments of Surgery and Pathology (J.H.L.) Duke University Medical Center Durham, NC  27710

Correspondence and Reprints:

                             Jeffrey H. Lawson, M.D., Ph.D.

                              Departments of Surgery & Pathology

                              DUMC Box 2622

                              Durham, NC  27710

                              (919) 681-6432 – voice

                              (919) 681-1094 – fax

                              lawso006@mc.duke.edu

*Current Address: Demet SAG, PhD

                          3830 Valley Centre Drive Suite 705-223, San Diego, CA 92130

Support:

Word Count: 4101 Journal Subject Heads:  CV surgery, endothelial cell activationAprotinin, Protease activated receptors,

Potential Conflict of Interest:         None

Abstract

Introduction:  Cardiopulmonary bypass is associated with a systemic inflammatory response syndrome, which is responsible for excessive bleeding and multisystem dysfunction. Endothelial cell activation is a key pathophysiological process that underlies this response. Aprotinin, a serine protease inhibitor has been shown to be anti-inflammatory and also have significant hemostatic effects in patients undergoing CPB. We sought to investigate the effects of aprotinin at the endothelial cell level in terms of cytokine release (IL-6), tPA release, tissue factor expression, PAR1 + PAR2 expression and calcium mobilization. Methods:  Cultured Human Umbilical Vein Endothelial Cells (HUVECS) were stimulated with TNFa for 24 hours and treated with and without aprotinin (200KIU/ml + 1600KIU/ml). IL-6 and tPA production was measured using ELISA. Cellular expression of Tissue Factor, PAR1 and PAR2 was measured using flow cytometry. Intracellular calcium mobilization following stimulation with PAR specific peptides and agonists (trypsin, thrombin, Human Factor VIIa, factor Xa) was measured using fluorometry with Fluo-3AM. Results: Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNFa stimulated HUVECS (p=0.043). Aprotinin treatment of TNFa activated endothelial cells significantly reduce the amount of tPA released in a dose dependent manner (A200 p=0.0018, A1600 p=0.033). Aprotinin resulted in a significant downregulation of TF expression to baseline levels. At 24 hours, we found that aprotinin treatment of TNFa stimulated cells resulted in a significant downregulation of PAR-1 expression. Aprotinin significantly inhibited the effects of the protease thrombin upon PAR1 mediated calcium release. The effects of PAR2 stimulatory proteases such as human factor Xa, human factor VIIa and trypsin on calcium release was also inhibited by aprotinin. Conclusion:  We have shown that aprotinin has direct anti-inflammatory effects on endothelial cell activation and these effects may be mediated through inhibition of proteolytic activation of PAR1 and PAR2. Abstract word count: 297

INTRODUCTION   Each year it is estimated that 350,000 patients in the United States, and 650,000 worldwide undergo cardiopulmonary bypass (CPB). Despite advances in surgical techniques and perioperative management the morbidity and mortality of cardiac surgery related to the systemic inflammatory response syndrome(SIRS), especially in neonates is devastatingly significant. Cardiopulmonary bypass exerts an extreme challenge upon the haemostatic system as part of the systemic inflammatory syndrome predisposing to excessive bleeding as well as other multisystem dysfunction (1). Over the past decade major strides have been made in the understanding of the pathophysiology of the inflammatory response following CPB and the role of the vascular endothelium has emerged as critical in maintaining cardiovascular homeostasis (2).

CPB results in endothelial cell activation and initiation of coagulation via the Tissue Factor dependent pathway and consumption of important clotting factors. The major stimulus for thrombin generation during CPB has been shown to be through the tissue factor dependent pathway. As well as its effects on the fibrin and platelets thrombin has been found to play a role in a host of inflammatory responses in the vascular endothelium. The recent discovery of the Protease-Activated Receptors (PAR), one of which through which thrombin acts (PAR-1) has stimulated interest that they may provide a vital link between inflammation and coagulation (3).

Aprotinin is a nonspecific serine protease inhibitor that has been used for its ability to reduce blood loss and preserve platelet function during cardiac surgery procedures requiring cardiopulmonary bypass and thus the need for subsequent blood and blood product transfusions. However there have been concerns that aprotinin may be pro-thrombotic, especially in the context of coronary artery bypass grafting, which has limited its clinical use. These reservations are underlined by the fact that the mechanism of action of aprotinin has not been fully understood. Recently aprotinin has been shown to exert anti-thrombotic effects mediated by blocking the PAR-1 (4). Much less is known about its effects on endothelial cell activation, especially in terms of Tissue Factor but it has been proposed that aprotinin may also exert protective effects at the endothelial level via protease-activated receptors (PAR1 and PAR2). In this study we simulated in vitro the effects of endothelial cell activation during CPB by stimulating Human Umbilical Vein Endothelial Cells (HUVECs) with a proinflammatory cytokine released during CPB, Tumor Necrosis Factor (TNF-a) and characterize the effects of aprotinin treatment on TF expression, PAR1 and PAR2 expression, cytokine release IL-6 and tPA secretion.  In order to investigate the mechanism of action of aprotinin we studied its effects on PAR activation by various agonists and ligands.

These experiments provide insight into the effects of aprotinin on endothelial related coagulation mechanisms in terms of Tissue Factor expression and indicate it effects are mediated through Protease-Activated Receptors (PAR), which are seven membrane spanning proteins called G-protein coupled receptors (GPCR), that link coagulant and inflammatory pathways. Therefore, in this study we examine the effects of aprotinin on the human endothelial cell coagulation biology by different-dose aprotinin, 200 and 1600units.  The data demonstrates that aprotinin appears to directly alter endothelial expression of inflammatory cytokines, tPA and PAR receptor expression following treatment with TNF.  The direct mechanism of action is unknown but may act via local protease inhibition directly on endothelial cells.  It is hoped that with improved understanding of the mechanisms of action of aprotinin, especially an antithrombotic effect at the endothelial level the fears of prothrombotic tendency may be lessened and its use will become more routine.  

METHODS Human Umbilical Vein Endothelial Cells (HUVECS) used as our model to study the effects of endothelial cell activation on coagulant biology. In order to simulate the effects of cardiopulmonary bypass at the endothelial cell interface we stimulated the cells with the proinflammatory cytokine TNFa. In the study group the HUVECs were pretreated with low (200kIU/mL) and high (1600kIU/mL) dosages of aprotinin prior to stimulation with TNFa and complement activation fragments. The effects of TNFa stimulation upon endothelial Tissue Factor expression, PAR1 and PAR2 expression, and tPA and IL6 secretion were determined and compared between control and aprotinin treated cells. In order to delineate whether aprotinin blocks PAR activation via its protease inhibition properties we directly activated PAR1 and PAR2 using specific agonist ligands such thrombin (PAR1), trypsin, Factor VIIa, Factor Xa (PAR2) in the absence and presence of aprotinin.

Endothelial Cell Culture HUVECs were supplied from Clonetics. The cells were grown in EBM-2 containing 2MV bullet kit, including 5% FBS, 100-IU/ml penicillin, 0.1mg/mL streptomycin, 2mmol/L L-glutamine, 10 U/ml heparin, 30µg/mL EC growth supplement (ECGS). Before the stimulation cells were starved in 0.1%BSA depleted with FBS and growth factors for 24 hours. Cells were sedimented at 210g for 10 minutes at 4C and then resuspended in culture media. The HUVECs to be used will be between 3 and 5 passages.

Assay of IL-6 and tPA production Levels of IL-6 were measured with an ELISA based kit (RDI, MN) according to the manufacturers instructions. tPA was measured using a similar kit (American Diagnostica).

  Flow Cytometry The expression of transmembrane proteins PAR1, PAR2 and tissue factor were measured by single color assay as FITC labeling agent. Prepared suspension of cells disassociated trypsin free cell disassociation solution (Gibco) to be labeled. First well washed, and resuspended into “labeling buffer”, phosphate buffered saline (PBS) containing 0.5% BSA plus 0.1% NaN3, and 5% fetal bovine serum to block Fc and non-specific Ig binding sites. Followed by addition of 5mcl of antibody to approx. 1 million cells in 100µl labeling buffer and incubate at 4C for 1 hour. After washing the cells with 200µl with wash buffer, PBS + 0.1% BSA + 0.1% NaN3, the cells were pelletted at 1000rpm for 2 mins. Since the PAR1 and PAR2 were directly labeled with FITC these cells were fixed for later analysis by flow cytometry in 500µl PBS containing 1%BSA + 0.1% NaN3, then add equal volume of 4% formalin in PBS. For tissue factor raised in mouse as monoclonal primary antibody, the pellet resuspended and washed twice more as before, and incubated at 4C for 1 hour addition of 5µl donkey anti-mouse conjugated with FITC secondary antibody directly to the cell pellets at appropriate dilution in labeling buffer. After the final wash three times, the cell pellets were resuspended thoroughly in fixing solution. These fixed and labeled cells were then stored in the dark at 4C until there were analyzed. On analysis, scatter gating was used to avoid collecting data from debris and any dead cells. Logarithmic amplifiers for the fluorescence signal were used as this minimizes the effects of different sensitivities between machines for this type of data collection.  

Intracellular Calcium Measurement

Measured the intracellular calcium mobilization by Fluo-3AM. HUVECs were grown in calcium and phenol free EBM basal media containing 2MV bullet kit. Then the cell cultures were starved with the same media by 0.1% BSA without FBS for 24 hour with or without TNFa stimulation presence or absence of aprotinin (200 and 1600KIU/ml). Next the cells were loaded with Fluo-3AM 5µg/ml containing agonists, PAR1 specific peptide SFLLRN-PAR1 inhibitor, PAR2 specific peptide SLIGKV-PAR2 inhibitor, human alpha thrombin, trypsin, factor VIIa, factor Xa for an hour at 37C in the incubation chamber. Finally the media was replaced by Flou-3AM free media and incubated for another 30 minutes in the incubation chamber. The readings were taken at fluoromatic bioplate reader. For comparison purposes readings were taken before and during Fluo-3AM loading as well.  

RESULTS Aprotinin reduces IL-6 production from activated/stimulated HUVECS The effects of aprotinin analyzed on HUVEC for the anti-inflammatory effects of aprotinin at cultured HUVECS with high and low doses.  Figure 1 shows that TNF-a stimulated a considerable increase in IL-6 production, 370.95 ± 109.9 mg/mL.   If the drug is used alone the decrease of IL-6 at the low dose is 50% that is 183.95 ng/ml and with the high dose of 20% that is 338.92 from 370.95ng/ml being compared value.  TNFa-aprotinin results in reduction of the IL-6 expression from 370.95ng/ml to 58.6 (6.4fold) fro A200 and 75.85 (4.9 fold) ng/ml, for A1600.  After the treatment the cells reach to the below baseline limit of IL-6 expression. Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNF-a stimulated HUVECS (p=0.043).  Therefore, the aprotinin prevents inflammation as well as loss of blood.  

Aprotinin reduces tPA production from stimulated HUVECS Whether aprotinin exerted part of its fibrinolytic effects through inhibition of tPA mediated plasmin generation examined by the effects on TNFa stimulated HUVECS. Figure 2 also demonstrates that the amount of tPA released from HUVECS under resting, non-stimulated conditions incubated with aprotinin are significantly different. Figure 2 represents that the resting level of tPA released from non-stimulated cells significantly, by 100%, increase following TNF-a stimulation for 24 hours.  After application of aprotinin alone at two doses the tPA level goes down 25% of TNFa stimulated cells.  However, aprotinin treatment of TNF-a activated endothelial cells significantly lower the amount of tPA release in a dose dependent manner that is low dose decreased 25 but high dose causes 50% decrease of tPA expression (A200 p=0.0018, A1600 p=0.033) This finding suggests that aprotinin exerts a direct inhibitory effect on endothelial cell tPA production.

Aprotinin and receptor expression on activated HUVECS

TF is expressed when the cell in under stress such as TNFa treatments. The stimulated HUVECs with TNF-a tested for the expression of PAR1, PAR2, and tissue factor by single color flow cytometry through FITC labeled detection antibodies at 1, 3, and 24hs.

 

Tissue Factor expression is reduced:

Figure 3 demonstrates that there is a fluctuation of TF expression from 1 h to 24h that the TF decreases at first hour after aprotinin application 50% and 25%, A1600 and A200 respectively.  Then at 3 h the expression come back up 50% more than the baseline.  Finally, at 24h the expression of TF becomes almost as same as baseline.  Moreover, TNFa stimulated cells remains 45% higher than baseline after at 3h as well as at 24h.

PAR1 decreased:
Figure 4 demonstrates that aprotinin reduces the PAR1 expression 80% at 24h but there is no affect at 1 and 3 h intervals for both doses.

During the treatment with aprotinin only high dose at 1 hour time interval decreases the PAR1 expression on the cells. This data explains that ECCB is affected due to the expression of PAR1 is lowered by the high dose of aprotinin.

PAR2 is decreased by aprotinin:

  Figure 5 shows the high dose of aprotinin reduces the PAR2 expression close to 25% at 1h, 50% at 3h and none at 24h.  This pattern is exact opposite of PAR1 expression.  Figure 5 demonstrates the 50% decrease at 3h interval only.  Does that mean aprotinin affecting the inflammation first and then coagulation?

This suggests that aprotinin may affect the PAR2 expression at early and switched to PAR1 reduction later time intervals.  This fluctuation can be normal because aprotinin is not a specific inhibitor for proteases.  This approach make the aprotinin work better the control bleeding and preventing the inflammation causing cytokine such as IL-6.

Aprotinin inhibits Calcium fluxes induced by PAR1/2 specific agonists

  The specificity of aprotinin’s actions upon PAR studied the effects of the agent on calcium release following proteolytic and non-proteolytic stimulation of PAR1 and PAR2. Figure 6A (Figure 6) shows the stimulation of the cells with the PAR1 specific peptide (SFLLRN) results in release of calcium from the cells. Pretreatment of the cells with aprotinin has no significant effect on PAR1 peptide stimulated calcium release. This suggests that aprotinin has no effect upon the non-proteolytic direct activation of the PAR 1 receptor. Yet, Figure 6B (Figure 6) demonstrates human alpha thrombin does interact with the drug as a result the calcium release drops below base line after high dose (A1600) aprotinin used to zero but low dose does not show significant effect on calcium influx. Figure 7 demonstrates the direct PAR2 and indirect PAR2 stimulation by hFVIIa, hFXa, and trypsin of cells.  Similarly, at Figure 7A aprotinin has no effect upon PAR2 peptide stimulated calcium release, however, at figures 7B, C, and D shows that PAR2 stimulatory proteases Human Factor Xa, Human Factor VIIa and Trypsin decreases calcium release. These findings indicate that aprotinin’s mechanism of action is directed towards inhibiting proteolytic cleavage and hence subsequent activation of the PAR1 and PAR2 receptor complexes.  The binding site of the aprotinin on thrombin possibly is not the peptide sequence interacting with receptors.

Measurement of calcium concentration is essential to understand the mechanism of aprotinin on endothelial cell coagulation and inflammation because these mechanisms are tightly controlled by presence of calcium.  For example, activation of PAR receptors cause activation of G protein q subunit that leads to phosphoinositol to secrete calcium from endoplasmic reticulum into cytoplasm or activation of DAG to affect Phospho Lipase C (PLC). In turn, certain calcium concentration will start the serial formation of chain reaction for coagulation.  Therefore, treatment of the cells with specific factors, thrombin receptor activating peptides (TRAPs), human alpha thrombin, trypsin, human factor VIIa, and human factor Xa, would shed light into the effect of aprotinin on the formation of complexes for pro-coagulant activity.    DISCUSSION   There are two fold of outcomes to be overcome during cardiopulmonary bypass (CPB):  mechanical stress and the contact of blood with artificial surfaces results in the activation of pro- and anticoagulant systems as well as the immune response leading to inflammation and systemic organ failure.  This phenomenon causes the “postperfusion-syndrome”, with leukocytosis, increased capillary permeability, accumulation of interstitial fluid, and organ dysfunction.  CPB is also associated with a significant inflammatory reaction, which has been related to complement activation, and release of various inflammatory mediators and proteolytic enzymes. CPB induces an inflammatory state characterized by tumor necrosis factor-alpha release. Aprotinin, a low molecular-weight peptide inhibitor of trypsin, kallikrein and plasmin has been proposed to influence whole body inflammatory response inhibiting kallikrein formation, complement activation and neutrophil activation (5, 6). But shown that aprotinin has no significant influence on the inflammatory reaction to CPB in men.  Understanding the endothelial cell responses to injury is therefore central to appreciating the role that dysfunction plays in the preoperative, operative, and postoperative course of nearly all cardiovascular surgery patients.  Whether aprotinin increases the risk of thrombotic complications remains controversial.   The anti-inflammatory properties of aprotinin in attenuating the clinical manifestations of the systemic inflammatory response following cardiopulmonary bypass are well known(15) 16)  However its mechanisms and targets of action are not fully understood. In this study we have investigated the actions of aprotinin at the endothelial cell level. Our experiments showed that aprotinin reduced TNF-a induced IL-6 release from cultured HUVECS. Thrombin mediates its effects through PAR-1 receptor and we found that aprotinin reduced the expression of PAR-1 on the surface of HUVECS after 24 hours incubation. We then demonstrated that aprotinin inhibited endothelial cell PAR proteolytic activation by thrombin (PAR-1), trypsin, factor VII and factor X (PAR-2) in terms of less release of Ca preventing the activation of coagulation.  So aprotinin made cells produce less receptor, PAR1, PAR2, and TF as a result there would be less Ca++ release.    Our findings provide evidence for anti-inflammatory as well as anti-coagulant properties of aprotinin at the endothelial cell level, which may be mediated through its inhibitory effects on proteolytic activation of PARs.   IL6   Elevated levels of IL-6 have been shown to correlate with adverse outcomes following cardiac surgery in terms of cardiac dysfunction and impaired lung function(Hennein et al 1992). Cardiopulmonary bypass is associated with the release of the pro-inflammatory cytokines IL-6, IL-8 and TNF-a.  IL-6 is produced by T-cells, endothelial cells as a result monocytes and plasma levels of this cytokine tend to increase during CPB (21, 22). In some studies aprotinin has been shown to reduce levels of IL-6 post CPB(23) Hill(5). Others have failed to demonstrate an inhibitory effect of aprotinin upon pro-inflammatory cytokines following CPB(24) (25).  Our experiments showed that aprotinin significantly reduced the release of IL-6 from TNF-a stimulated endothelial cells, which may represent an important target of its anti-inflammatory properties. Its has been shown recently that activation of HUVEC by PAR-1 and PAR-2 agonists stimulates the production of IL-6(26). Hence it is possible that the effects of aprotinin in reducing IL-6 may be through targeting activation of such receptors.   TPA   Tissue Plasminogen activator is stored, ready made, in endothelial cells and it is released at its highest levels just after commencing CPB and again after protamine administration. The increased fibrinolytic activity associated with the release of tPA can be correlated to the excessive bleeding postoperatively. Thrombin is thought to be the major stimulus for release of t-PA from endothelial cells. Aprotinin’s haemostatic properties are due to direct inhibition of plasmin, thereby reducing fibrinolytic activity as well as inhibiting fibrin degradation.  Aprotinin has not been shown to have any significant effect upon t-PA levels in patients post CPB(27), which would suggest that aprotinin reduced fibrinolytic effects are not the result of inhibition of t-PA mediated plasmin generation. Our study, however demonstrates that aprotinin inhibits the release of t-PA from activated endothelial cells, which may represent a further haemostatic mechanism at the endothelial cell level.   TF   Resting endothelial cells do not normally express tissue factor on their cell surface. Inflammatory mediators released during CPB such as complement (C5a), lipopolysaccharide, IL-6, IL-1, TNF-a, mitogens, adhesion molecules and hypoxia may induce the expression of tissue factor on endothelial cells and monocytes. The expression of TF on activated endothelial cells activates the extrinsic pathway of coagulation, ultimately resulting in the generation of thrombin and fibrin. Aprotinin has been shown to reduce the expression of TF on monocytes in a simulated cardiopulmonary bypass circuit (28).

We found that treatment of activated endothelial cells with aprotinin significantly reduced the expression of TF after 24 hours. This would be expected to result in reduced thrombin generation and represent an additional possible anticoagulant effect of aprotinin. In a previous study from our laboratory we demonstrated that there were two peaks of inducible TF activity on endothelial cells, one immediately post CPB and the second at 24 hours (29). The latter peak is thought to be responsible for a shift from the initial fibrinolytic state into a procoagulant state.  In addition to its established early haemostatic and coagulant effect, aprotinin may also have a delayed anti-coagulant effect through its inhibition of TF mediated coagulation pathway. Hence its effects may counterbalance the haemostatic derangements, i.e. first bleeding then thrombosis caused by CPB. The anti-inflammatory effects of aprotinin may also be related to inhibition of TF and thrombin generation. PARs  

It has been suggested that aprotinin may target PAR on other cells types, especially endothelial cells. We investigated the role of PARs in endothelial cell activation and whether they can be the targets for aprotinin.  In recent study by Day group(30) demonstrated that endothelial cell activation by thrombin and downstream inflammatory responses can be inhibited by aprotinin in vitro through blockade of protease-activated receptor 1. Our results provide a new molecular basis to help explain the anti-inflammatory properties of aprotinin reported clinically.    The finding that PAR-2 can also be activated by the coagulation enzymes factor VII and factor X indicates that PAR may represent the link between inflammation and coagulation.  PAR-2 is believed to play an important role in inflammatory response. PAR-2 are widely expressed in the gastrointestinal tract, pancreas, kidney, liver, airway, prostrate, ovary, eye of endothelial, epithelial, smooth muscle cells, T-cells and neutrophils. Activation of PAR-2 in vivo has been shown to be involved in early inflammatory processes of leucocyte recruitment, rolling, and adherence, possibly through a mechanism involving platelet-activating factor (PAF)   We investigated the effects of TNFa stimulation on PAR-1 and PAR-2 expression on endothelial cells. Through functional analysis of PAR-1 and PAR-2 by measuring intracellular calcium influx we have demonstrated that aprotinin blocks proteolytic cleavage of PAR-1 by thrombin and activation of PAR-2 by the proteases trypsin, factor VII and factor X.  This confirms the previous findings on platelets of an endothelial anti-thrombotic effect through inhibition of proteolysis of PAR-1. In addition, part of aprotinin’s anti-inflammatory effects may be mediated by the inhibition of serine proteases that activate PAR-2. There have been conflicting reports regarding the regulation of PAR-1 expression by inflammatory mediators in cultured human endothelial cells. Poullis et al first showed that thrombin induced platelet aggregation was mediated by via the PAR-1(4) and demonstrated that aprotinin inhibited the serine protease thrombin and trypsin induced platelet aggregation. Aprotinin did not block PAR-1 activation by the non-proteolytic agonist peptide, SFLLRN indicating that the mechanism of action was directed towards inhibiting proteolytic cleavage of the receptor. Nysted et al showed that TNF did not affect mRNA and cell surface protein expression of PAR-1 (35), whereas Yan et al showed downregulation of PAR-1 mRNA levels (36). Once activated PAR1 and PAR2 are rapidly internalized and then transferred to lysosomes for degradation.

Endothelial cells contain large intracellular pools of preformed receptors that can replace the cleaved receptors over a period of approximately 2 hours, thus restoring the capacity of the cells to respond to thrombin. In this study we found that after 1-hour stimulation with TNF there was a significant upregulation in PAR-1 expression. However after 3 hours and 24 hours there was no significant change in PAR-1 expression suggesting that cleaved receptors had been internalized and replenished. Aprotinin was interestingly shown to downregulate PAR-1 expression on endothelial cells at 1 hour and increasingly more so after 24 hours TNF stimulation. These findings may suggest an effect of aprotinin on inhibiting intracellular cycling and synthesis of PAR-1.    

Conclusions   Our study has identified the anti-inflammatory and coagulant effects of aprotinin at the endothelial cell level. All together aprotinin affects the ECCB by reducing the t-PA, IL-6, PAR1, PAR 2, TF expressions. Our data correlates with the previous foundlings in production of tPA (7, (8) 9) 10), and  decreased IL-6 levels (11) during coronary artery bypass graft surgery (12-14). We have importantly demonstrated that aprotinin may target proteolytic activation of endothelial cell associated PAR-1 to exert a possible anti-inflammatory effect. This evidence should lessen the concerns of a possible prothrombotic effect and increased incidence of graft occlusion in coronary artery bypass patients treated with aprotinin. Aprotinin may also inhibit PAR-2 proteolytic activation, which may represent a key mechanism for attenuating the inflammatory response at the critical endothelial cell level. Although aprotinin has always been known as a non-specific protease inhibitor we would suggest that there is growing evidence for a PAR-ticular mechanism of action.  

REFERENCES

1.         Levy, J. H., and Tanaka, K. A. Inflammatory response to cardiopulmonary bypass. Ann Thorac Surg. 75: S715-720, 2003.

2.         Verrier, E. D., and Morgan, E. N. Endothelial response to cardiopulmonary bypass surgery. Ann Thorac Surg. 66: S17-19; discussion S25-18, 1998.

3.         Cirino, G., Napoli, C., Bucci, M., and Cicala, C. Inflammation-coagulation network: are serine protease receptors the knot? Trends Pharmacol Sci. 21: 170-172, 2000. 4.         Poullis, M., Manning, R., Laffan, M., Haskard, D. O., Taylor, K. M., and Landis, R. C. The antithrombotic effect of aprotinin: actions mediated via the proteaseactivated receptor 1. J Thorac Cardiovasc Surg. 120: 370-378, 2000.

5.         Hill, G. E., Alonso, A., Spurzem, J. R., Stammers, A. H., and Robbins, R. A. Aprotinin and methylprednisolone equally blunt cardiopulmonary bypass-induced inflammation in humans. J Thorac Cardiovasc Surg. 110: 1658-1662, 1995.

6.         Hill, G. E., Pohorecki, R., Alonso, A., Rennard, S. I., and Robbins, R. A. Aprotinin reduces interleukin-8 production and lung neutrophil accumulation after cardiopulmonary bypass. Anesth Analg. 83: 696-700, 1996. 7.         Lu, H., Du Buit, C., Soria, J., Touchot, B., Chollet, B., Commin, P. L., Conseiller, C., Echter, E., and Soria, C. Postoperative hemostasis and fibrinolysis in patients undergoing cardiopulmonary bypass with or without aprotinin therapy. Thromb Haemost. 72: 438-443, 1994.

8.         de Haan, J., and van Oeveren, W. Platelets and soluble fibrin promote plasminogen activation causing downregulation of platelet glycoprotein Ib/IX complexes: protection by aprotinin. Thromb Res. 92: 171-179, 1998.

9.         Erhardtsen, E., Bregengaard, C., Hedner, U., Diness, V., Halkjaer, E., and Petersen, L. C. The effect of recombinant aprotinin on t-PA-induced bleeding in rats. Blood Coagul Fibrinolysis. 5: 707-712, 1994.

10.       Orchard, M. A., Goodchild, C. S., Prentice, C. R., Davies, J. A., Benoit, S. E., Creighton-Kemsford, L. J., Gaffney, P. J., and Michelson, A. D. Aprotinin reduces cardiopulmonary bypass-induced blood loss and inhibits fibrinolysis without influencing platelets. Br J Haematol. 85: 533-541, 1993.

11.       Tassani, P., Augustin, N., Barankay, A., Braun, S. L., Zaccaria, F., and Richter, J. A. High-dose aprotinin modulates the balance between proinflammatory and anti-inflammatory responses during coronary artery bypass graft surgery. J Cardiothorac Vasc Anesth.14: 682-686, 2000.

12.       Asehnoune, K., Dehoux, M., Lecon-Malas, V., Toueg, M. L., Gonieaux, M. H., Omnes, L., Desmonts, J. M., Durand, G., and Philip, I. Differential effects of aprotinin and tranexamic acid on endotoxin desensitization of blood cells induced by circulation through an isolated extracorporeal circuit. J Cardiothorac Vasc Anesth. 16: 447-451, 2002.

13.       Dehoux, M. S., Hernot, S., Asehnoune, K., Boutten, A., Paquin, S., Lecon-Malas, V., Toueg, M. L., Desmonts, J. M., Durand, G., and Philip, I. Cardiopulmonary bypass decreases cytokine production in lipopolysaccharide-stimulated whole blood cells: roles of interleukin-10 and the extracorporeal circuit. Crit Care Med. 28: 1721-1727, 2000.

14.       Greilich, P. E., Brouse, C. F., Rinder, C. S., Smith, B. R., Sandoval, B. A., Rinder, H. M., Eberhart, R. C., and Jessen, M. E. Effects of epsilon-aminocaproic acid and aprotinin on leukocyte-platelet adhesion in patients undergoing cardiac surgery. Anesthesiology. 100: 225-233, 2004.

15.       Mojcik, C. F., and Levy, J. H. Aprotinin and the systemic inflammatory response after cardiopulmonary bypass. Ann Thorac Surg. 71: 745-754, 2001.

16.       Landis, R. C., Asimakopoulos, G., Poullis, M., Haskard, D. O., and Taylor, K. M. The antithrombotic and antiinflammatory mechanisms of action of aprotinin. Ann Thorac Surg. 72: 2169-2175, 2001.

17.       Asimakopoulos, G., Kohn, A., Stefanou, D. C., Haskard, D. O., Landis, R. C., and Taylor, K. M. Leukocyte integrin expression in patients undergoing cardiopulmonary bypass. Ann Thorac Surg. 69: 1192-1197, 2000.

18.       Landis, R. C., Asimakopoulos, G., Poullis, M., Thompson, R., Nourshargh, S., Haskard, D. O., and Taylor, K. M. Effect of aprotinin (trasylol) on the inflammatory and thrombotic complications of conventional cardiopulmonary bypass surgery. Heart Surg Forum. 4 Suppl 1: S35-39, 2001.

19.       Asimakopoulos, G., Thompson, R., Nourshargh, S., Lidington, E. A., Mason, J. C., Ratnatunga, C. P., Haskard, D. O., Taylor, K. M., and Landis, R. C. An anti-inflammatory property of aprotinin detected at the level of leukocyte extravasation. J Thorac Cardiovasc Surg. 120: 361-369, 2000.

20.       Asimakopoulos, G., Lidington, E. A., Mason, J., Haskard, D. O., Taylor, K. M., and Landis, R. C. Effect of aprotinin on endothelial cell activation. J Thorac Cardiovasc Surg. 122: 123-128, 2001.

21.       Butler, J., Chong, G. L., Baigrie, R. J., Pillai, R., Westaby, S., and Rocker, G. M. Cytokine responses to cardiopulmonary bypass with membrane and bubble oxygenation. Ann Thorac Surg. 53: 833-838, 1992.

22.       Hennein, H. A., Ebba, H., Rodriguez, J. L., Merrick, S. H., Keith, F. M., Bronstein, M. H., Leung, J. M., Mangano, D. T., Greenfield, L. J., and Rankin, J. S. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg. 108: 626-635, 1994.

23.       Diego, R. P., Mihalakakos, P. J., Hexum, T. D., and Hill, G. E. Methylprednisolone and full-dose aprotinin reduce reperfusion injury after cardiopulmonary bypass. J Cardiothorac Vasc Anesth. 11: 29-31, 1997.

24.       Ashraf, S., Tian, Y., Cowan, D., Nair, U., Chatrath, R., Saunders, N. R., Watterson, K. G., and Martin, P. G. “Low-dose” aprotinin modifies hemostasis but not proinflammatory cytokine release. Ann Thorac Surg. 63: 68-73, 1997.

25.       Schmartz, D., Tabardel, Y., Preiser, J. C., Barvais, L., d’Hollander, A., Duchateau, J., and Vincent, J. L. Does aprotinin influence the inflammatory response to cardiopulmonary bypass in patients? J Thorac Cardiovasc Surg. 125: 184-190, 2003.

26.       Chi, L., Li, Y., Stehno-Bittel, L., Gao, J., Morrison, D. C., Stechschulte, D. J., and Dileepan, K. N. Interleukin-6 production by endothelial cells via stimulation of protease-activated receptors is amplified by endotoxin and tumor necrosis factor-alpha. J Interferon Cytokine Res. 21: 231-240, 2001.

27.       Ray, M. J., and Marsh, N. A. Aprotinin reduces blood loss after cardiopulmonary bypass by direct inhibition of plasmin. Thromb Haemost. 78: 1021-1026, 1997.

28.       Khan, M. M., Gikakis, N., Miyamoto, S., Rao, A. K., Cooper, S. L., Edmunds, L. H., Jr., and Colman, R. W. Aprotinin inhibits thrombin formation and monocyte tissue factor in simulated cardiopulmonary bypass. Ann Thorac Surg. 68: 473-478, 1999.

29.       Jaggers, J. J., Neal, M. C., Smith, P. K., Ungerleider, R. M., and Lawson, J. H. Infant cardiopulmonary bypass: a procoagulant state. Ann Thorac Surg. 68: 513-520, 1999.

30.       Day, J. R., Taylor, K. M., Lidington, E. A., Mason, J. C., Haskard, D. O., Randi, A. M., and Landis, R. C. Aprotinin inhibits proinflammatory activation of endothelial cells by thrombin through the protease-activated receptor 1. J Thorac Cardiovasc Surg. 131: 21-27, 2006.

31.       Vergnolle, N. Proteinase-activated receptor-2-activating peptides induce leukocyte rolling, adhesion, and extravasation in vivo. J Immunol. 163: 5064-5069, 1999.

32.       Vergnolle, N., Hollenberg, M. D., Sharkey, K. A., and Wallace, J. L. Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2)-activating peptides in the rat paw. Br J Pharmacol. 127: 1083-1090, 1999.

33.       McLean, P. G., Aston, D., Sarkar, D., and Ahluwalia, A. Protease-activated receptor-2 activation causes EDHF-like coronary vasodilation: selective preservation in ischemia/reperfusion injury: involvement of lipoxygenase products, VR1 receptors, and C-fibers. Circ Res. 90: 465-472, 2002.

34.       Maree, A., and Fitzgerald, D. PAR2 is partout and now in the heart. Circ Res. 90: 366-368, 2002.

35.       Nystedt, S., Ramakrishnan, V., and Sundelin, J. The proteinase-activated receptor 2 is induced by inflammatory mediators in human endothelial cells. Comparison with the thrombin receptor. J Biol Chem. 271: 14910-14915, 1996.

36.       Yan, W., Tiruppathi, C., Lum, H., Qiao, R., and Malik, A. B. Protein kinase C beta regulates heterologous desensitization of thrombin receptor (PAR-1) in endothelial cells. Am J Physiol. 274: C387-395, 1998.

37.       Shinohara, T., Suzuki, K., Takada, K., Okada, M., and Ohsuzu, F. Regulation of proteinase-activated receptor 1 by inflammatory mediators in human vascular endothelial cells. Cytokine. 19: 66-75, 2002.

FIGURES

Figure 1: IL-6 production following TNF-a stimulation Figure 1

Figure 2:  tPA production following TNF-a stimulation Figure 2

Figure 3:  Tissue Factor Expression on TNF-a stimulated HUVECS Figure 3

Figure 4:  PAR-1 Expression on TNF-a stimulated HUVECS Figure 4

Figure 5:  PAR-2 Expression on TNF-a stimulated HUVECS Figure 5

Figure 6:  Calcium Fluxes following PAR1 Activation Figure 6

Figure 7:  Calcium Fluxes following PAR2 Activation Figure 7

 

Read Full Post »

Older Posts »