Feeds:
Posts
Comments

Posts Tagged ‘GPCR’

Pancreatic Cancer and Crossing Roads of Metabolism

Posted in Best evidence, Biomarkers & Medical Diagnostics, Calcium Signaling, Calmodulin Kinase and Contraction, Cancer and Current Therapeutics, CANCER BIOLOGY & Innovations in Cancer Therapy, Cancer Prevention: Research & Programs, Cancer Screening, Cell Biology, Signaling & Cell Circuits, Diabetes Mellitus, Diagnostic Immunology, Disease Biology, Drug Delivery Platform Technology, Gene Regulation, Gene Regulation and Evolution, Genetics & Innovations in Treatment, Genetics & Pharmaceutical, Genome Biology, Genomic Testing: Methodology for Diagnosis, Immunodiagnostics, Metabolism, Molecular Genetics & Pharmaceutical, Personal Health Applications: Tech Innovations serves HealhCare, Personalized and Precision Medicine & Genomic Research, Pharmaceutical Drug Discovery, Translational Research, Translational Science, tagged , , , , , , , , , , , , , , , , , , , , , on March 18, 2015| Leave a Comment »

Pancreatic Cancer and Crossing Roads of Metabolism

Curator: Demet Sag, PhD

 

PART I: Pancreatic Cancer

  • Intro
  • What is Pancreas cancer
  • What are the current and possible applications for treatment and early diagnosis
  • How pancreatic cancer is related to obesity, overweight, BMI, diabetes
  • Genetics of Pancreatic Cancer

PART II : Translational Research on Molecular Genetics Studies at Immune Response Mechanism 

  • Natural Killer Cells
  • IL-17
  • Chemokines

search_result- pancreatic cancer clinical trial studies

https://clinicaltrials.gov/ct2/results?term=Pancreatic+Cancer&Search=Searchpc 1

PART I: Pancreatic Cancer

Introduction:

Our body works a s a system even during complex diseases that is sometimes forgotten.  From nutrition to basic immune responses since we are born we start to change how we respond and push the envelope to keep hemostasis in our body.

During this time additional factors also increase or decrease the rate of changes such as life style, environment, inherited as well acquired genetic make-up, types of infections, weight and stress only some of them. As a result we customized our body so deserve a personalized medicine for a treatment. Customized approach is its hype with developing technology to analyze data and compare functional genomics of individuals.

However, still we need the basic cell differentiation to solve the puzzle to respond well and connect the dots for physiological problems.  At the stem of the changes there is a cell that respond and amplify its reaction to gain a support to defend at its best . Thus, in this review I like to make a possible connection for pancreatic cancer, obesity-diabetes and innate immune response through natural killer cells.

Pancreatic cancer is one of the most lethal malignancies. Pancreatic cancer is one of the most difficult cancers to treat. Fewer than 5% of patients survive more than 5 years after diagnosis. The 5-year survival rate is despite therapeutic improvements still only 6%. More than 80% of the pancreatic tumors are classified as pancreatic ductal adenocarcinoma (PDA).

When cells in the pancreas that secrete digestive enzymes (acinar cells) turn into duct-like structures, pancreatic cancer can develop. Oncogenic signaling – that which causes the development of tumors – can influence these duct-like cells to form lesions that are a cancer risk.

 

Crossing roads

The recent publication brought up the necessity to understand how pancreatic cancer and IL17 are connected.

Schematic diagram showing the central role of IL-17B–IL-17RB signaling in pancreatic cancer metastasis.

Adapted from an illustration by Heng-Hsiung Wu and colleagues

http://jem.rupress.org/content/212/3/284/F2.large.jpg

 

Simply, obesity and diabetes increases the risks of cancers, cardiovascular disease, hypertension, and type-2 DM.  There is a very big public health concern as obesity epidemic, the incidence of diabetes is increasing globally, with an estimated 285 million people, or 6.6% of the population from 20 to 79 years of age, affected this is especially more alarming as child obesity is on the rise.

According to a World Health Organization (WHO) report showing that 400 million people are obese in the world, with a predicted increase to 700 million by 2015  and in the US, 30–35 percent of adults are obese.  In addition, high BMI and increased risk of many common cancers, such as liver, endometrium, breast, pancreas, and colorectal cancers have a linear increasing relationship.

The BMI is calculated by dividing body weight in kilograms by height squared in meters kg/m2). The current standard categories of BMI are as follows: underweight, <18.5; normal weight, 18.5–24.9; overweight, 25.0–29.9; obese, 30.0–34.9; and severely obese, > or = 35.0).

Furthermore, natural killer cells not only control innate immune responses but have function in other immune responses that was not recognized well before.

Recently, there have been reports regarding Natural Killer cells on was about the function of IL17 that is produced by iNKT, a subtype of NK, for a possible drug target.  In addition, regulation of receptors that are up or downregulated by NK cells for a precise determination between compromised cells and healthy cells.

Therefore, instead of sole reliance on SNPs, or GWAS for early diagnostics or only organ system base pathology, compiling the overall health of the system is necessary for a proper molecular diagnostics and targeted therapies.

  • What is Pancreas cancer

SNAP SHOT:

Incidence

  • It is a rare type of cancer.
  • 20K to 200K US cases per year

 Medically manageable

Treatment can help

 Requires a medical diagnosis

  1. lab tests or imaging
  2. spreads rapidly and has a poor prognosis.
  3. treatments may include: removing the pancreas, radiation, and chemotherapy.

 Ages affected; even though person may develop this cancer from age 0 to 60+ there is a high rate of incidence after age 40.

 

People may experience:

  • Pain: in the abdomen or middle back
  • Whole body: nausea, fatigue, or loss of appetite
  • Also common: yellow skin and eyes, fluid in the abdomen, weight loss, or dark urine
  • The pancreas secretes enzymes that aid digestion and hormones that help regulate the metabolism of sugars.

Prescription

  • Chemotherapy regimen by injection: Irinotecan, Gemcitabine (Gemzar), Oxaliplatin (Eloxatin)
  • Other treatments: Leucovorin by injection, Fluorouracil by injection (Adrucil)

 

Also common

  • Chemotherapy regimen: Gemcitabine-Oxaliplatin regimen, Docetaxel-Gemcitabine regimen
  • Procedures: Radiation therapy, Pancreatectomy, surgery to remove pancreatic tumors

 

Specialists

  • Radiologist: Uses images to diagnose and treat disease within the body.
  • Oncologist: Specializes in cancer.
  • Palliative medicine: Focuses on improving quality of life for terminally ill patients.
  • General surgeon: Performs a range of surgeries on the abdomen, skin, breast, and soft tissue.
  • Gastroenterologist: Focuses on the digestive system and its disorders.

What are the current and possible applications for treatment and early diagnosis

Diagnostics

Several imaging techniques are employed in order to see if cancer exists and to find out how far it has spread. Common imaging tests include:

  • Ultrasound – to visualize tumor
  • Endoscopic ultrasound (EUS) – thin tube with a camera and light on one end
  • Abdominal computerized tomography (CT) scans – to visualize tumor
  • Endoscopic retrograde cholangiopancreatography (ERCP) – to x-ray the common bile duct
  • Angiogram – to x-ray blood vessels
  • Barium swallows to x-ray the upper gastrointestinal tract
  • Magnetic resonance imaging (MRI) – to visualize tumor
  • Positron emission tomography (PET) scans – useful to detect if disease has spread

 

New solutions in Diagnostics;

The study, published in Nature Communications, suggests that targeting the gene in question – protein kinase D1 (PKD1) – could lead to new ways of halting the development of one of the most difficult tumors to treat.

“As soon as pancreatic cancer develops, it begins to spread, and PKD1 is key to both processes. Given this finding, we are busy developing a PKD1 inhibitor that we can test further,” says the study’s co-lead investigator, Dr. Peter Storz.

Do we have new markers?

Is it possible check the cancer along with glucose levels or insulin at the point of care or companion diagnostics?

Therapy

New Solutions in Therapies

ABRAXANE (paclitaxel formulated as albumin bound nanoparticles; nab-paclitaxel), in combination with gemcitabine, has been recommended for use within NHS Scotland by the Scottish Medicines Consortium (SMC) for the treatment of metastatic adenocarcinoma of the pancreas.

The SMC decision is based on results from the MPACT (Metastatic Pancreatic Adenocarcinoma Clinical Trial) study, published in the October 2013 edition of the New England Journal of Medicine, which demonstrated an increase in median overall survival of 1.8 months when compared to gemcitabine alone [(8.5 months vs. 6.7 months respectively) (HR 0.72; 95% CI 0.62 to 0.83 P<0.001)]. 

Updated results from post-hoc analysis of the MPACT trial based on an extended data cut-off (8 months) at the time the trial was closed demonstrated an increase in the median overall survival benefit of 2.1 months when compared to gemcitabine alone [(8.7 months vs. 6.6 months respectively) (HR 0.72,95% CI = 0.62 to 0.83, P<.001)].

Using radioactive bacteria to stop the spread of pancreatic cancer – scientists from Albert Einstein College of Medicine of Yeshiva University used bacteria to carry radioisotopes commonly used in cancer treatment directly into pancreatic cancer cells. They found in animal experiments that the incidence of secondary tumors went down dramatically – i.e. the cancer was much less likely to spread (metastasize).

Targeting stroma is another approached that is followed by TGen to potentially extend patient survival in all cases including advanced cases based on a report at Clinical Cancer Research, published online by the American Association for Cancer Research. Thus this eliminates one of the limiting factor to reach tumor cells and destroying the accumulation of stroma — the supporting connective tissue that includes hyaluronan and few other collagen types.

One of the study leaders, Andrew Biankin, a Cancer Research UK scientist at the University of Glasgow in the UK said that “Being able to identify which patients would benefit from platinum-based treatments would be a game-changing moment for treating pancreatic cancer, potentially improving survival for a group of patients.” 

 In the journal Nature, the international team- including scientists from Cancer Research UK showed the evidence of large chunks of DNA being shuffled around, which they were able to classify according to the type of disruption they created in chromosomes.

The study concludes there are four subtypes of pancreatic cancer, depending on the frequency, location and types of DNA rearrangement. It terms the subtypes: stable, locally rearranged, scattered and unstable.

Can we develop an immunotherapy?

 Genetics of Pancreatic Cancer 

There are many ongoing studies to develop diagnostics technologies and treatments. However, the etiology of PC is not well understood. Pancreas has dual functions that include 2% of endocrine hormone secretion and 98% exocrine secretion, enzymes, to help digestion. As a result, pancreatic cancer is related to obesity, overweight, diabetes.

First, eliminating the risk factors can be the simplest path. Next approach is dropping the obesity and diabetes to prevent the occurrence of cancers since in the U.S. population, 50 percent are overweight, 30 percent are medically obese and 10 percent have diabetes mellitus (DM). Tobacco smoking, alcohol consumptions, chronic pancreatitis, and genetic risk factors, have been recognized as potential risk factors for the development and progression of PC.

Many studies showed that the administration of anti-diabetic drugs such as metformin and thiazolidinediones (TZD) class of PPAR-γ agonists decreases the risk of cancers.  Thus, these agents are thought to be the target to diagnose or cure PC.

Type 2 diabetes mellitus has been associated with an increased risk of several human cancers, such as liver, pancreatic, endometrial, colorectal, breast, and bladder cancer. The majority of the data show that metformin therapy decreases, while insulin secretagog drugs slightly increase the risk of certain types of cancers in type 2 diabetes.

Metformin can decrease cell proliferation and induce apoptosis in certain cancer cell lines. Endogenous and exogenous (therapy induced) hyperinsulinemia may be mitogenic and may increase the risk of cancer in type 2 diabetes. Type 2 diabetes mellitus accounts for more than 95% of the cases.

In PDA these cells have been reported to express specific genes such as Aldh1 or CD133. To date, more than 20 case-control studies and cohort and nested case-control studies with information on the association between diabetes and pancreatic cancer, BMI and cancer, and obesity and cancer have been reported.

Meta analysis and cohort studies:

 

  1. Meta studies for Diabetes and PC

Most of the diabetes and PC studies were included in two meta-analyses, in 1995 and in 2005, investigating the risk of pancreatic cancer in relation to diabetes.

The first meta-analysis, conducted in 1995, included 20 of these 40 published case-control and cohort studies and reported an overall estimated relative risk (RR) of pancreatic cancer of 2.1 with a 95% confidence interval (CI) of 1.6-2.8. These values were relatively unchanged when the analyses were restricted to patients who had diabetes for at least 5 years (RR, 2.0 [95% CI, 1.2-3.2]).

The second meta-analysis, which was conducted in 2005, included 17 case-control and 19 cohort and nested case-control studies published from 1996 to 2005 and demonstrated an overall odds ratio (OR) for pancreatic cancer of 1.8 and 95% CI of 1.7-1.9 .   Individuals diagnosed with diabetes within 4 years before their pancreatic cancer diagnosis had a 50% greater risk of pancreatic cancer than did those diagnosed with diabetes more than 5 years before their cancer diagnosis (OR, 2.1 [95% CI, 1.9-2.3] versus OR, 1.5 [95% CI, 1.3-1.8]; P = 0.005).

  1. In a recent pooled analysis of 2192 patients with pancreatic cancer and 5113 cancer-free controls in three large case-control studies conducted in the United States (results of two of the three studies were published after 2005),
  2. Risk estimates decreased as the number of years with diabetes increased.
  3. Individuals with diabetes for 2 or fewer, 3-5, 6-10, 11-15, or more than 15 years had ORs (95% CIs) of 2.9 (2.1-3.9), 1.9 (1.3-2.6), 1.6 (1.2-2.3), 1.3 (0.9-2.0), and 1.4 (1.0-2.0), respectively (P < 0.0001 for trend).

pc2

  1. Meta Studies between BMI and PC

Meta studies in 2003 and 2008 showed a week positive association between BMI and PC.  In 2003, a meta-analysis of six case-control and eight prospective studies including 6,391 PC cases 2% increase in risk per 1 kg/m2 increase in BMI. In 2008, 221 datasets, including 282,137 incidence of cancer cases with 3,338,001 subjects the results were similar  RR, 1.12; CI, 1.02–1.22.

In 2007, 21 prospective studies handled , 10 were from the United States, 9 were from Europe, and 2 were from Asia and studies was conducted including 3,495,981 individuals and 8,062 PC cases. There was no significant difference between men and women and the estimated summary risk ratio (RR) per 5 kg/m2 increase in BMI was 1.12 (95% CI, 1.06–1.17) in men and women combined.

This study concluded that concluded that there was a positive association between BMI and risk of PC, per  a 5 kg/m2 increase in BMI may be equal to  a 12% increased risk of PC.

  • The location and type of the obesity may also signal for a higher risk. The recent Women’s Health Initiative study in the United States among 138,503 postmenopausal showed that  women central obesity  in relation to PC (n=251) after average of 7.7 years of follow-up duration demonstrated that central adiposity is related to developing PC at a higher risk. Based on their result “women in the highest quintile of waist-to-hip ratio have a 70 percent (95% CI, 10–160%) greater risk of PC compared with women in the lowest quintile”
  • Age of obesity or being overweight versus risk of developing PC was also examined.
  • Regardless of their DM status they were at risk and decreased their survival even more so among men than women between age of 14-59.

overweight   14 to 39 years   (highest odds ratio [OR], 1.67; 95% CI, 1.20–2.34) or

obese            20 to 49 years     (highest OR, 2.58; 95% CI, 1.70–3.90)   , independent of DM status.

  • This association was different between men and women from the ages of 14 to 59:

stronger in men               (adjusted OR, 1.80; 95% CI, 1.45–2.23)

weaker in women            (adjusted OR, 1.32; 95% CI, 1.02–1.70).

  • The effect of BMI , obesity and overweight had reduced overall survival of PC regardless of disease stage and tumor resection status

high BMI (= or > 25)                          20 to 49 years , an earlier onset of PC by 2 to 6 years.

obese patients: hazard ratio,               1.86, 95% CI, 1.35–2.56).

overweight or obese                             30 to 79 years,  in the year prior to recruitment

overweight patients: hazard ratio,       1.26, 95% CI, 0.94–1.69;

Similarly, the authors concluded that:

  • Being overweight or obese during early adulthood was associated with a greater risk of PC and a younger age of disease onset, whereas obesity at an older age was associated with a lower overall survival in patients diagnosed with PC.
  • More recently, several large prospective cohort studies with a long duration of follow-up has been conducted in the U.S. showing a positive association between high BMI and the risk of PC (adjusted RR 1.13–1.54), suggesting the role of obesity and overweight with higher risk in the development and eventual death due to PC.
  • Although the role of smoking and gender in the association of obesity and PC is not clear, the new evidence strongly supports a positive association of high BMI with increased risk of PC, consistent with the majority of early findings; however, all recent studies strongly suggest that obesity and overweight are independent risk factor of PC.
  • Diabetes was associated with a 1.8-fold increase in risk of pancreatic cancer (95% CI, 1.5-2.1).

How pancreatic cancer is related to obesity, overweight, BMI, diabetes

 pc3

Connections in Physiology and Pathology:

Altogether cumulative data suggest that DM has a three-fold increased risk for the development of PC and a two-fold risk for biliary cancer insulin resistance and abnormal glucose metabolism, even in the absence of diabetes, is associated with increased risk for the development of PC.  Obesity alters the metabolism towards insulin resistance through affecting gene expression of inflammatory cytokines, adipose hormones such as adipokines, and PPAR-γ.

Furthermore, adiponectin also pointed out to be a negative link factor for cancers such as colon, breast, and PC.  Therefore, insulin resistance is one of the earliest negative effects of obesity, early altered glucose metabolism, chronic inflammation, oxidative stress and decreased levels of adipose hormone adiponectin and PPAR-γ, key regulators for adipogenesis.

Potential pathways directly linking obesity and diabetes to pancreatic cancer. Obesity and diabetes cause mutiple alterations in glucose and lipid hemastasis, microenvironments, and immune responses, which result in the activation of several oncogenic signaling pathways.

These deregulations increase cell survival and proliferation, eventually leading to the development and progression of pancreatic cancer. ROS, reactive oxygen species; IGF-1, insulin-like growth factor-1; IR, insulin receptors; IGF-1R, insulin-like growth factor-1 receptors; TNFR, tumor necrosis factor receptors; TLR, Toll-like receptors; HIF-1α, hypoxia-inducible factor-α1; AMPK, AMP kinase; IKK, IκB kinase; PPAR-γ, peroxisome proliferator-activated receptor-γ; VEGF, vascular endothelial growth factor; MAPK, MAP kinase; mTOR, mammalian target of rapamycin; TSC, tuberous sclerosis complex; Akt, protein kinase B. PI3K, phosphoinositide-3-kinase; STAT3, activator of transcription-3; JNK, c-Jun NH2-terminal kinase.

Top six pathways interacting with obesity or diabetes in modifying the risk of pancreatic cancer are Chemokine Signaling, Pathways in cancer, Cytokine-cytokine receptor interaction, Calcium signaling pathway. MAPK signaling pathway.

This analysis showed

  • GNGT2,
  • RELA,
  • TIAM1,
  • CBLC,
  • IFNA13, 
  • IL22RA1, 
  • IL2RA
  • GNAS,
  • MAP2K7,
  • DAPK3, 
  • EPAS1 and 
  • FOS as contributor genes.

  Furthermore, top overrepresented canonical pathways, including

  1. Role of RIG1-like Receptors in Antiviral Innate Immunity,
  2. Role of PI3K/AKT Signaling in the Pathogenesis of Influenza, and
  3. Molecular Mechanisms of Cancer

in genes interacting with risk factors (P < 10−8) are

  • TRAF6, 
  • RELA,
  • IFNA7,
  • IFNA4,
  • NFKB2,
  • IFNA10,
  • IFNA16,
  • NFKB1,
  • IFNA1/IFNA13,
  • IFNA5,
  • IFNA14,
  • IFNA,
  • GSK3B,
  • IFNA16,
  • IFNA14,
  • TP53,
  • FYN,
  • ARHGEF4,
  • GNAS,
  • CYCS ,
  • AXIN1,
  • ADCY4,
  • PRKAR2A,
  • ARHGEF1 ,
  • CDC42,
  • RAC,3
  • SIN3A,
  • RB1,
  • FOS ,
  • CDH1,
  • NFKBIA,
  • GNAT1,
  • PAK3,
  • RHOA,
  • RASGRP1,
  • PIK3CD,
  • BMP6,
  • CHEK2, and
KEGG code Pathway description Risk factor No. of genes/genes with marginal effecta No. of SNPs/eigenSNPs in the interaction analysisb PG x Ec Major contributing genesd
hsa04062e Chemokine Signalinge Obesity 175/27 695/181 3.29 × 10−6 GNGT2 RELA TIAM1
hsa05200 Pathways in cancer Obesity 315/37 806/212 5.35 × 10−4 CBLC RELA
hsa04060 Cytokine-cytokine receptor interaction Obesity 247/36 422/149 6.97 × 10−4 IFNA13 IL22RA1 IL2RA
hsa04020 Calcium signaling pathway Diabetes 171/24 759/190 1.57 × 10−4 GNAS
hsa04010 MAPK signaling pathway Diabetes 260/32 523/154 3.56 × 10−4 FOS MAP2K7
hsa05200 Pathways in cancer Diabetes 315/37 806/212 4.46 × 10−4 DAPK3 EPAS1 FOS

aNumber of genes making up the pathway/ number of genes survived the PCA-LRT (P ≤ 0.10).

bNumber of SNPs in the “reconstructed” pathways/number of principal components for LRT.

cP value was estimated by LRT in logistic regression model with adjustment of age, sex, study site, pack years(continuous), obesity or diabetes as appropriate, and five principal components for population structure.

dGenes with PG x E ≤ 0.05 in logistic regression and P ≤ 0.10 in PCA-LRT.

ePathways remained significant after Bonferroni correction (P < 1.45 × 10−4)

pc4

Top overrepresented canonical pathways in genes interacting with risk factors (P < 10−8)

Biological process Risk factor P Valuea Ratiob Contributing genes
Role of RIG1-like Receptors in Antiviral Innate Immunity Obesity 6.71 × 10−11 12/49 (0.25) TRAF6 RELA IFNA7 IFNA4 NFKB2 IFNA10 IFNA16 NFKB1
IFNA1/IFNA13 IFNA5 IFNA14 IFNA6
Role of PI3K/AKT Signaling in the Pathogenesis of Influenza Obesity 8.64 × 10−9 12/74 (0.12) RELA IFNA7 IFNA4 NFKB2 GSK3B IFNA10 IFNA16 NFKB1
IFNA1/IFNA13 IFNA5 IFNA14 IFNA6
Molecular Mechanisms of Cancer Diabetes 1.03 × 10−9 24/378 (0.063) TP53 FYN ARHGEF4 GNAS CYCS AXIN1 ADCY4 PRKAR2A
ARHGEF1 CDC42 RAC3 SIN3A RB1 FOS CDH1 NFKBIA GNAT1
PAK3 RHOA RASGRP1 PIK3CD BMP6 CHEK2 E2F2

aCalculated using Fisher’s exact test (right-tailed).

bNumber of genes interacting with a risk factor of interest (P ≤ 0.05) in a given pathway divided by total number of genes making up that pathway.

Pancreatic Cancer and Diabetes:

We conclude that diabetes type II has a fundamental influence on pancreatic ductal adenocarcinoma by stimulating cancer cell proliferation, while metformin inhibits cancer cell proliferation. Chronic inflammation had only a minor effect on the pathophysiology of an established adenocarcinoma.

  • Diabetes increases tumor size and proliferation of carcinoma cells
  • Diabetes does not decrease cell death in carcinomas
  • Diabetes II like syndrome reduces the number of Aldh1+cells within the tumor
  • Metformin decreases tumor size and proliferation of carcinoma cells

 

Much is known about factors increasing the likelihood to develop PDA. Identified risk factors include among others chronic pancreatitis, long lasting diabetes, and obesity. Patients with chronic and especially hereditary pancreatitis have a very high relative risk of developing pancreatic cancer of 13.3 and 69.0, respectively. Patients with diabetes and obesity have a moderately increased relative risk of 1.8 and 1.3. These studies indicate that a substantial number of patients with PDA also suffer from local inflammation or diabetes.

http://www.biomedcentral.com/1471-2407/15/51/figure/F3?highres=y

http://www.biomedcentral.com/content/figures/s12885-015-1047-x-4.jpg

pc5

Potential mechanisms underlying the associations of diabetes and cancer.

  • AdipoR1/R2, adiponectin receptor 1/2;
  • AMPK, 5′-AMPactivated protein kinase;
  • IGF-1, insulin-like growth factor-1;
  • IGF-1R, insulin-like growth factor-1 receptor;
  • IKK, IκA;B kinase; IR, insulin receptor;
  • IRS-1, insulin receptor substrate-1;
  • MAPK, mitogen-activated-protein-kinase;
  • mTOR, mammalian target of rapamycin;
  • NF-κA;B, nuclear factor-κA;B;
  • ObR, leptin receptor;
  • PAI-1, plasminogen activator inhibitor-1;
  • PI3-K, phosphatidylinositol 3-kinase;
  • ROS, Reactive oxygen species;
  • TNF-α, tumor necrosis factor- α;
  • TNF-R1, tumor necrosis factor-receptor 1;
  • uPA, urokinase-type plasminogen activator;
  • uPAR, urokinase-type plasminogen activator receptor;
  • VEGF, vascular endothelial growth factor;
  • VEGFR, vascular endothelial growth factor receptor.

http://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=3238796_nihms-277874-f0001.jpg

Type 2 diabetes mellitus is likely the third modifiable risk factor for pancreatic cancer after cigarette smoking and obesity. The relationship between diabetes and pancreatic cancer is complex. Diabetes or impaired glucose tolerance is present in more than 2/3rd of pancreatic cancer patients.

Epidemiological investigations have found that long-term type 2 diabetes mellitus is associated with a 1.5-fold to 2.0-fold increase in the risk of pancreatic cancer. A causal relationship between diabetes and pancreatic cancer is also supported by findings from prediagnostic evaluations of glucose and insulin levels in prospective studies.

Insulin resistance and associated hyperglycemia, hyperinsulinemia, and inflammation have been suggested to be the underlying mechanisms contributing to development of diabetes-associated pancreatic cancer.

Stem Cells

http://www.ncbi.nlm.nih.gov/core/lw/2.0/html/tileshop_pmc/tileshop_pmc_inline.html?title=Click%20on%20image%20to%20zoom&p=PMC3&id=3410675_nihms295920f1.jpg

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3932318/

pc6

“A study by Permert et al.using glucose tolerance tests in patients with newly diagnosed pancreatic cancer showed that 75% of patients met criteria for diabetes. Pannala et al. used fasting blood glucose values or previous use of antidiabetic medications to define diabetes in patients with pancreatic cancer (N.=512) and age-matched control non-cancer subjects attending primary care clinics (N.=933) “

Distribution of fasting blood glucose among pancreatic cancer cases and controls. From Pannala et al.

“ They reported a nearly seven-fold higher prevalence of diabetes in pancreatic cancer patients compared to controls (47% vs. 7%). In a retrospective study using similar criteria, Chari et al. found the prevalence of diabetes in pancreatic cancer patients to be 40%.  http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3932318/”

 

Relationship between type 2 diabetes and risk of pancreatic cancer in case-control and nested case control studies. “Diamond: point estimate representing study-specific relative risks or summary relative risks with 95% CIs. Horizontal lines: represent 95% confidence intervals (CIs). Test for heterogeneity among studies: P<0.001, I2=93.6%. 1, cohort studies (N.=27) use incidence or mortality rate as the measurements of relative risk; 2, cohort studies (N.=8) use standardized incidence/mortality rate as the measurement of relative risk. From Benet al.”

 http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3932318/

Table II

Sensitivity and specificity for biomarkers for pancreatic cancer.

Biomarker Study Sensitivity Specificity N.
CA19-9 Goonetilleke 68 79 82 Meta-analysis
Steinberg 69 81 90 Meta-analysis
CA125 Duraker 85 57 78 123
Haguland 86 45 76 95
CEA Ni 87 45 75 68
Haglund 86 54 76 95
Zhao 88 25 86 143
Duraker 85 39 91 123
SPan-1 Kiriyama 74 81 76 64
Chung 89 92 83 67
Kobayashi 90 82 85 200
Du-PAN 2 Satake 83 48 85 239
Sawabu 91 72 94 32
Kawa 92 64 – 200

NIHMS552557.html

PART II:  Targets for Immunomodulation to develop a therapy


Natural Killer Cells:

Natural Killer cells usually placed under non-specific immune response as a first defend mechanism during innate immunity.  NKs responses to innate immune reactions but not only viruses but also bacteria and parasitic infections develop a new line of defense.  These reactions involve amplification of many cytokines based on the specific infection or condition.  Thus, these activities help NKs to evolve.

However, their functions proven to be more than innate immune response since from keeping the pregnancy term to prevent recurrent abortions to complex diseases such as cancer, diabetes and cardiovascular conditions they have roles thorough awakening chemokines and engaging them specifically with their receptors to activate other immune cells.  For example, there is a signaling mechanism connection between NKs and DCs to respond attacks.  Furthermore, there are interactions between various types of immune cells and they are specific for example between NK and Tregs.

During pregnancy there is a special kind of interaction between NK cells and Tregs.

  • There can be several reasons such as to protect pregnancy from the immunosuppressive environment so then the successful implantation of the embryo and tolerance of the mother to the embryo can be established. In normal pregnancy, these cells are not killers, but rather provide a microenvironment that is pregnancy compatible and supports healthy placentation.
  • During cancer development tumors want to build a microenvironment through an array of highly orchestrated immune elements to generate a new environment against the host. In normal pregnancy, decidua, the uterine endometrium,  is critical for the development of placental vasculature.
  • This is the region gets thicks and thin during female cycles to prevent or accept pregnancies. As a result, mother nature created that 70% of all human decidual lymphocytes are NK cells, defined as uterine or decidual NK (dNK) cells.
  • The NK cell of decidua (dNK) and  peripheral blood NK cells are different since  dNK cells are characterized as CD56brightCD16−CD3−, express killer cell immunoglobulin-like receptors and exhibit low killing capacity despite the presence of cytolytic granules, and a higher frequency of CD4+CD25bright   

The lesson learn here is that pregnancy and mammary tissue are great examples of controlling cellular differentiation and growth since after pregnancy all these cells go back to normal state.

Understanding these minute differences and relations to manipulate gene expression may help to:

  1. Develop better biomaterials to design long lasting medical devices and to deliver vaccines without side effects.
  2. Generate safer vaccines as NKcells are the secret weapons in DC vaccination and studying their behavior together with T-cell activation in vaccinated individuals might predict clinical outcome.
  3. Establish immunotherapies based on interactions between NK cells and Tregs for complex diseases not only cancer, but also many more such as autoimmune disorder, transplants, cardiovascular, diabetes.

pc 1

Trascription factors are the silence players of the gene expression that matches input to output as a cellular response either good or bad but this can be monitored and corrected with a proper meical device or diagnostics tool to provide successful treatment regimen.

  • Therefore, the effects of Tregs on NK during gene regulation analyzed and compared among other living organisms for concerved as well as signature sequence targets even though the study is on human.
  • Unfortunatelly we can’t mutate the human for experimental purposes so comparative developmental studies now its widely called stem cell biology with a system biology approach may help to establish the pathway.

NK and T reg regulation share a common interest called T box proteins. These proteins are conserved and also play role in development of heart at very early development, embryology.  What is shared among all T-box is simply lie behind the capacity for DNA binding through the T-box domain and transcriptional regulatory activity, which plays a role in controlling the expression of developmental gene in all animal species.

 The Special T box protein: T-bet

The first identified T-box protein was Brachyury (T). in a nut shell

  • The T-box domain is made up of about 180 amino-acid residues that includes a specific sequence of DNA
  • called T-box  domain,  TCACACCT between residues 135 and 326 in mouse.
  • However, T-bet which is the T-box protein expressed in T cells and also called as TBX21 is quite conserved in 18 members of the T-box protein (TBX) family
  • since it has a crucial dual role during development and for coordination of both innate and adaptive immune responses.

T-Bet was originally cloned for its role in Th1 lineage, it has a role in Th2 development, too. 

The whole mechanism based on direct activation and modulation mechanisms in that  T-Bet directly activates IFN-γ gene transcription and enhances development of Th1 cells at the same time modulates IL-2 and Th2 cytokines in an IFN-γ-independent manner that creates an attenuation of Th2 cell development.

Thus, certain lipids ligands or markers can be utilized during vaccine design to steer the responses for immune therapies against autoimmune diseases.   As a result, tumors can be removed and defeated by manipulating NKs action.

 

INKT:

NKT has functions in diabetes, asthma. One cell type that has been proposed to contribute immensely to the development of asthma is NKT cells, which constitute a small population of lymphocytes that express markers of both T cells (T-cell receptor, TCR) and NK cells (e.g., NK1.1, NKG2D). NKT cells can be subdivided into at least three subtypes, based on their TCR. Type I NKT cells or invariant NKT (iNKT) cells express invariant TCR chains (V14–J18 in mice and V24–J18 in humans) coupled with a limited repertoire of V chains (V8, V7 and V2 in mice and V11 in humans).

The studies in the past decade showed the protective mechanism of NKT cells during the development of Type 1 diabetes can be complex.

  1. First, NKT cells can impair the differentiation of anti-islet reactive T cells into Th1 effector cells in a cell–cell contact dependent manner, which did not require Th2 cytokine production or CD1d recognition.
  2. Second, NKT cells accumulating in the pancreas can indirectly suppress diabetogenic CD4+T cells via IFN-γ production.
  3. Last, anergic iNKT cells induced by protracted αGalCer stimulation can induce the production of noninflammatory DCs, which inhibit diabetes development in an Ag-specific fashion.

These findings point to an important protective role for NKT cells during autoimmune pathogenesis in the pancreas.

A crucial role has been suggested for invariant natural killer T cells (iNKT) in regulating the development of asthma, a complex and heterogeneous disease characterized by airway inflammation and airway hyperreactivity (AHR).

iNKT cells constitute a unique subset of T cells responding to endogenous and exogenous lipid antigens, rapidly secreting a large amount of cytokines, which amplify both innate and adaptive immunity.

IL17:

Terashima A et al (2008) identified a novel subset of natural killer T (NKT) cells that expresses the interleukin 17 receptor B (IL-17RB) for IL-25 (also known as IL-17E) and is essential for the induction of Airway hypersensitive reaction (AHR). IL-17RB is preferentially expressed on a fraction of CD4(+) NKT cells but not on other splenic leukocyte populations tested.

They strongly suggested that IL-17RB(+) CD4(+) NKT cells play a crucial role in the pathogenesis of asthma.

NKT connection can be established between through targeting IL17 and IL17RB. There is a functional specialization of interleukin-17 family members. Interleukin-17A (IL-17A) is the signature cytokine of the recently identified T helper 17 (Th17) cell subset. IL-17 has six family members (IL-17A to IL-17F).

Although IL-17A and IL-17F share the highest amino acid sequence homology, they perform distinct functions; IL-17A is involved in the development of autoimmunity, inflammation, and tumors, and also plays important roles in the host defenses against bacterial and fungal infections, whereas IL-17F is mainly involved in mucosal host defense mechanisms. IL-17E (IL-25) is an amplifier of Th2 immune responses.

 There is no one easy answer for the role of IL-17 in pancreatic cancer as there are a number of unresolved issues and but it can be only suggested that  pro-tumorigenic IL-17 activity is confined to specific subsets of patients with pancreatic cancer since there is a increased expression of IL-17RB in these patients about ∼40% of pancreatic cancers presented on their histochemical staining (IHC-  immunohistochemistry.

IL17 and breast cancer:

In addition, during breast cancer there is an increased signaling of interleukin-17 receptor B (IL-17RB) and IL-17B.  They promoted tumor formation in breast cancer cells in vivo and even created acinus formation in immortalized normal mammary epithelial cells in vitro cell culture assays.

  • Furthermore, the elevated expression of IL-17RB not only present itself  stronger than HER2 for a better prognosis but also brings the shortest survival rate if patients have increased  IL-17RB and HER2 levels.
  • However, decreased level of IL-17RB in trastuzumab-resistant breast cancer cells significantly reduced their tumor growth.  This may prompt a different independent  role for  IL-17RB and HER2  in breast cancer development.
  • In addition, treatment with antibodies specifically against IL-17RB or IL-17B effectively attenuated tumorigenicity of breast cancer cells.

These results suggest that the amplified IL-17RB/IL-17B signaling pathways may serve as a therapeutic target for developing treatment to manage IL-17RB-associated breast cancer.

IL 17 and Asthma:

A requirement for iNKT cells has also been shown in a model of asthma induced with air pollution, ozone and induced with respiratory viruses chronic asthma studied in detail. In these studies specific types of NKT cells found to that specific types of NK and receptors trigger of asthma symptoms. Taken together, these studies indicate that both Th2 cells (necessary for allergen-specific responses) and iNKT cells producing IL-4 and IL-13 are required for the development of allergen-induced AHR.

Although CD4+ IL-4/IL-13-producing iNKT cells (in concert with antigen-specific Th2 cells) are crucial in allergen-induced AHR, NK1.1–IL-17-producing iNKT cells have a major role in ozone-induced AHR.

A main question in iNKT cell biology involves the identification of lipid antigens that can activate iNKT cells since this allow to identify which microorganisms to attack as  a result, the list of microorganisms that produce lipids that activate iNKT cells is rapidly growing.

Invariant natural killer T cells (iNKT) cell function in airway hyperreactivity (AHR). iNKT cells secrete various cytokines, including Th2 cytokines, which have direct effects on hematopoietic cells, airway smooth muscle cells, and goblet cells. Alternatively, iNKT cells could regulate other cell types that are known to be involved in asthma pathogenesis, e.g., neutrophils and alveolar macrophages.

http://www.nature.com/mi/journal/v2/n5/images/mi200996f1.jpg

Chemokines:

Chemokines  have a crucial role in organogenesis of various organs including lymph nodes, arising from their key roles in stem cell migration. Moreover, most homeostatic chemokines can control the movement of lymphocytes and dendritic cells and eventually adaptive immunity. Chemokines are heparin-binding proteins with 4 cysteine residues in the conserved positions.

The human chemokine system has about 48 chemokines. They are subgrouped based on:

  • Number of cysteines
  • Number of amino acid separating cysteines
  • Presence or absence of ELR motif includes, 3-amino acid sequence, glutamic acid-leucine-arginine
  • functionally classified as inflammatory, homeostatic, or both, based on their expression patterns

Chemokines are structurally divided into 4 subgroups :CXC, CC, CX3C, and C. X represent an aminoacid so the first 2 cysteines are separated by 1 is grouped as CXC and 3 amino acids is called CX3C chemokines but in CC  the first 2 cysteines are adjacent. In the C chemokines there is no second and fourth cysteines.

Various types of inflammatory stimuli induce abundantly the expression of inflammatory chemokines to induce the infiltration of inflammatory cells such as granulocytes and monocytes/macrophages.

  • inflammatory chemokines are CXC chemokines with ELR motif and CCL2.
  • homeostatic chemokines are expressed constitutively in specific tissues or cells.

cmi20132f2

Chemokines exert their biological activities by binding their corresponding receptors, which belong to G-protein coupled receptor (GPCR) with 7-span transmembrane portions. Thus, the target cell specificity of each chemokine is determined by the expression pattern of its cognate receptor .

Moreover, chemokines can bind to proteoglycans and glycosaminoglycans with a high avidity, because the carboxyl-terminal region is capable of binding heparin.

Consequently, most chemokines are produced as secretory proteins, but upon their secretion, they are immobilized on endothelium cells and/or in extracellular matrix by interacting with proteoglycans and glycosaminoglycans. The immobilization facilitates the generation of a concentration gradient, which is important for inducing the target cells to migrate in a directed way.

The human chemokine system.

Chemokine receptor Chemokines Receptor expression in
Leukocytes Epithelium Endothelium
CXCR1 CXCL6, 8 PMN + −
CXCR2 CXCL1, 2, 3, 5, 6, 7, 8 PMN + +
CXCR3 CXCL4, 9, 10, 11 Th1, NK − +
CXCR4 CXCL12 Widespread + +
CXCR5 CXCL13 B − −
CXCR6 CXCL16 Activated T + −
CXCR7 (ACKR3) CXCL12, CXCL11 Widespread + +
Unknown CXCL14 (acts on monocytes)
CCR1 CCL3, 4, 5, 7, 14, 15, 16, 23 Mo, Mϕ, iDC, NK + +
CCR2 CCL2, 7, 8, 12, 13 Mo, Mϕ, iDC, NK
activated T, B		 + +
CCR3 CCL5, 7, 11, 13, 15, 24, 26, 28 Eo, Ba, Th2 − +
CCR4 CCL2, 3, 5, 17, 22 iDC, Th2, NK, T, Mϕ − −
CCR5 CCL3, 4, 5, 8 Mo, Mϕ, NK, Th1
activated T		 + −
CCR6 CCL20 iDC, activated T, B + −
CCR7 CCL19, 21 mDC, Mϕ, naïve T
activated T		 + −
CCR8 CCL1, 4, 17 Mo, iDC, Th2, Treg − −
CCR9 CCL25 T + −
CCR10 CCL27, 28 Activated T, Treg + −
Unknown CCL18 (acts on mDC and naïve T)
CX3CR1 CX3CL1 Mo, iDC, NK, Th1 + −
XCR1 XCL1, 2 T, NK − −
Miscellaneous Scavenger receptors for chemokines
Duffy antigen (ACKR1) CCL2, 5, 11, 13, 14
CXCL1, 2, 3, 7, 8
D6 (ACKR2) CCL2, 3, 4, 5, 7, 8, 12
CCL13, 14, 17, 22
CCRRL1 (ACKR4) CCL19, CCL21, CCL25

Leukocyte anonyms are as follows. Ba: basophil, Eo: eosinophil, iDC: immature dendritic cell, mDC: mature dendritic cell, Mo: monocyte, Mϕ: macrophage, NK: natural killer cell, Th1: type I helper T cell, Th2: type II helper T cell, and Treg: regulatory T cell.

 pc9

There are differences between  human liver and peripheral NK cells. Regulation of NK cell functions by CD226, CD96 and TIGIT.close. CD226 binding to CD155 or CD112 at the cell surface of transformed or infected cells triggers cytotoxic granule exocytosis and target cell lysis by natural killer (NK) cells. TIGIT, CD226, CD96 and CRTAM ligand specificity and signalling.close.

Regulation of NK cell-mediated cancer immunosurveillance through CD155 expression.close.   CD155 is frequently overexpressed by cancer cells.

pc10

Liver NK cells Circulating NK cells References
CD3-CD56+ 30.6% (11.6–51.3%) 12.8% (1–22%) 17
CD56bright/total NK cell ~50% ~10% 18,19
CD56dim/total NK cell ~50% ~90% 18,19
CD27 high low 20,21
CD16 − + 18,22
CD69 +/−, higher +/− 16
Chemokine receptor CCR7 and CXCR3
(CD56bright)		 CXCR1, CX3CR1
(CD56dim)		 13,23
Inhibitory receptor (NKG2A) high low 24
Natural cytotoxicity higher high 18,19
TRAIL high low 1
Perforin, Granzyme B high low 2
Cytokine production high
(MIP-1α/β, IL-10,
TNF-α, TNF-β, IFN-γ,
GM-CSF)		 low
(TNF-α, TNF-β, IFN-γ,
GM-CSF, IL-10)		 18
ADCC – high 25
  • In conclusion, having to develop precise early diagnostics is about determining the overlapping genes as key among diabetes, obesity, overweight and pancreas functions even pregnancy can be suggested.

 

  • It seems feasible to develop an immunotherapy for pancreatic cancer with the focus on chemokines and primary  signaling between iNKT and Tregs such as one of the recent plausable target IL-17 and IL17 RB.

References:

 Heng-Hsiung Wu,1et al Targeting IL-17B–IL-17RB signaling with an anti–IL-17RB antibody blocks pancreatic cancer metastasis by silencing multiple chemokines. Published March 2, 2015 // JEM vol. 212 no. 3 333-349 

MUNIRAJ1andS. T. CHARI2 Minerva Gastroenterol Dietol. 2012 Dec; 58(4): 331–345.PMCID: PMC3932318

Beaudoin L. et al. NKT cells inhibit the onset of diabetes by impairing the development of pathogenic T cells specific for pancreatic β cells. Immunity. 2002;17:725–736.

Wang J, Cho S, Ueno A, et al. Ligand-dependent induction of noninflammatory dendritic cells by anergic invariant NKT cells minimizes autoimmune inflammation.J. Immunol. 2008;181:2438–2445.

Lee HH, Meyer EH, Goya S, et al. Apoptotic cells activate NKT cells through T cell Ig-like mucin-like-1 resulting in airway hyper-reactivity. J. Immunol.2010;185:5225–5235.

Huang CK1, et al  6. Autocrine/paracrine mechanism of interleukin-17B receptor promotes breast tumorigenesis through NF-κB-mediated antiapoptotic pathway. Oncogene. 2014 Jun 5;33(23):2968-77.

Terashima A1 et al  A novel subset of mouse NKT cells bearing the IL-17 receptor B responds to IL-25 and contributes to airway hyperreactivity. J Exp Med. 2008 Nov 24;205(12):2727-33.

Isaksson B et al. Lifestyle factors and pancreatic cancer risk: a cohort study from the Swedish Twin Registry. Int J Cancer. 2002;98:480–482.

Larsson SC et al Overall obesity, abdominal adiposity, diabetes and cigarette smoking in relation to the risk of pancreatic cancer in two Swedish population-based cohorts. Br J Cancer.2005;93:1310–1315.

Michaud DS et al Physical activity, obesity, height, and the risk of pancreatic cancer. JAMA.2001;286:921–929.

Patel AV et al Obesity, recreational physical activity, and risk of pancreatic cancer in a large U.S. Cohort.Cancer Epidemiol Biomarkers Prev. 2005;14:459–466.

Rapp K et al  Obesity and incidence of cancer: a large cohort study of over 145,000 adults in Austria. Br J Cancer. 2005;93:1062–1067.

Shibata A et al. A prospective study of pancreatic cancer in the elderly. Int J Cancer. 1994;58:46–49.

Howe GR, Jain M, Miller AB. Dietary factors and risk of pancreatic cancer: results of a Canadian population-based case-control study. Int J Cancer.1990;45:604–608.

Nilsen TI, Vatten LJ. A prospective study of lifestyle factors and the risk of pancreatic cancer in Nord-Trondelag, Norway. Cancer Causes Control.2000;11:645–652.

Zatonski W et al Nutritional factors and pancreatic cancer: a case-control study from south-west Poland. Int J Cancer. 1991;48:390–394.

Berrington de GA et al A meta-analysis of obesity and the risk of pancreatic cancer. Br J Cancer. 2003;89:519–523.

Larsson SC, Orsini N, Wolk A. Body mass index and pancreatic cancer risk: A meta-analysis of prospective studies. Int J Cancer. 2007;120:1993–1998.

Renehan AG et al  Body-mass index and incidence of cancer: a systematic review and meta-analysis of prospective observational studies. Lancet. 2008;371:569–578.

Luo J et al Obesity and risk of pancreatic cancer among postmenopausal women: the Women’s Health Initiative (United States) Br J Cancer. 2008;99:527–531.

Li D et al Body mass index and risk, age of onset, and survival in patients with pancreatic cancer.JAMA. 2009;301:2553–2562.

Jiao L et al . Body mass index, effect modifiers, and risk of pancreatic cancer: a pooled study of seven prospective cohorts. Cancer Causes Control. 2010;21:1305–1314.

Johansen D et al Metabolic factors and the risk of pancreatic cancer: a prospective analysis of almost 580,000 men and women in the Metabolic Syndrome and Cancer Project. Cancer Epidemiol Biomarkers Prev. 2010;19:2307–2317.

Godsland IF. Insulin resistance and hyperinsulinaemia in the development and progression of cancer. Clin Sci (Lond) 2010;118:315–332. Kahn BB, Flier JS. Obesity and insulin resistance. J Clin Invest. 2000;106:473–481.

Pisani P. Hyper-insulinaemia and cancer, meta-analyses of epidemiological studies. Arch Physiol Biochem. 2008;114:63–70.

Jazet IM, Pijl H, Meinders AE. Adipose tissue as an endocrine organ: impact on insulin resistance. Neth J Med. 2003;61:194–212.

Kahn SE, Hull RL, Utzschneider KM. Mechanisms linking obesity to insulin resistance and type 2 diabetes. Nature. 2006;444:840–846.

Shoelson et al  Obesity related hyperinsulinaemia and hyperglycaemia and cancer development. Arch Physiol Biochem. 2009;115:86–96.

Boyd DB. Insulin and cancer. Integr Cancer Ther. 2003;2:315–329.

Fisher WE, Boros LG, Schirmer WJ. Insulin promotes pancreatic cancer: evidence for endocrine influence on exocrine pancreatic tumors. J Surg Res.1996;63:310–313.

P Matangkasombut1,2, et al Natural killer T cells and the regulation of asthma Mucosal Immunology (2009) 2, 383–392;

Tahir SM, Cheng O, Shaulov A, et al. Loss of IFN-γ production by invariant NK T cells in advanced cancer. J. Immunol. 2001;167:4046–4050.

Motohashi S, Kobayashi S, Ito T, et al. Preserved IFN-α production of circulating Vα24 NKT cells in primary lung cancer patients. Int. J. Cancer.2002;102:159–165.

Toura I, Kawano T, Akutsu Y, Nakayama T, Ochiai T, Taniguchi M. Cutting edge: inhibition of experimental tumor metastasis by dendritic cells pulsed with α-galactosylceramide. J. Immunol. 1999;163:2387–2391.

Chang DH, Osman K, Connolly J, et al. Sustained expansion of NKT cells and antigen-specific T cells after injection of α-galactosyl-ceramide loaded mature dendritic cells in cancer patients. J. Exp. Med. 2005;201:1503–1517.

Ambrosino E, Terabe M, Halder RC, et al. Cross-regulation between type I and type II NKT cells in regulating tumor immunity: a new immunoregulatory axis. J. Immunol. 2007;179:5126–5136.  uncovered a new immunoregulatory axis where vNKT cells can inhibit the antitumor activity of iNKT cells and CD8+ T cells

Crowe NY, Coquet JM, Berzins SP, et al. Differential antitumor immunity mediated by NKT cell subsets in vivo. J. Exp. Med. 2005;202:1279–1288.

Novak J, Beaudoin L, Park S, et al. Prevention of Type 1 diabetes by invariant NKT cells is independent of peripheral CD1d expression. J. Immunol.2007;178:1332–1340.

Everhart J, Wright D. Diabetes mellitus as a risk factor for pancreatic cancer. A meta-analysis. JAMA. 1995;273:1605–9.

Huxley R et al Type-II diabetes and pancreatic cancer: a meta-analysis of 36 studies. Br J Cancer. 2005;92:2076–83.

Ben Q, Xu M, Ning X, Liu J, Hong S, Huang W, et al. Diabetes mellitus and risk of pancreatic cancer: A meta-analysis of cohort studies. Eur J Cancer.2011;47:1928–37.

Clinic, Mayo. “Mayo researchers identify gene that pushes normal pancreas cells to change shape.”Medical News Today. MediLexicon, Intl., 24 Feb. 2015. Web.10 Mar. 2015.

James D. Byrne et al Local iontophoretic administration of cytotoxic therapies to solid tumors

Sci Transl Med 4 February 2015: Vol. 7, Issue 273, p. 273ra14 Sci. Transl. Med. DOI: 10.1126/scitranslmed.3009951, published online 4 February 2015, abstract.

Mayo Clinic news release, accessed 20 February 2015 via Newswise.

Additional source: ACS, What are the key statistics about pancreatic cancer?, accessed 20 February 2015.

Additional source: ACS, What is pancreatic cancer?, accessed 20 February 2015.

Scottish Medicines Consortium. Treatment Assessment. February 2015

NHS England. Cancer Drugs Fund list Version 3. Available at http://www.england.nhs.uk/wp-content/uploads/2015/01/ncdf-list-dec14.pdf . Last accessed January 2015

NHS England. Cancer Drugs Fund: Albumin-bound paclitaxel decision summary. Available athttp://www.england.nhs.uk/wp-content/uploads/2015/01/ncdf-summ-albumin-pac.pdf. Accessed February 2015

Cancer Research UK. Pancreatic cancer key stats. Available athttp://www.cancerresearchuk.org/cancer-info/cancerstats/keyfacts/pancreatic-cancer/cancerstats-key-facts-on-pancreatic-cancer. Accessed February 2015

Cancer Research UK. Statistics and outlook for pancreatic cancer. Available athttp://www.cancerresearchuk.org/about-cancer/type/pancreatic-cancer/treatment/statistics-and-outlook-for-pancreatic-cancer Accessed February 2015

ISD Scotland. Cancer statistics: Pancreatic Cancer. Available at http://www.isdscotland.org/Health-Topics/Cancer/Cancer-Statistics/Pancreatic/ Accessed February 2015

Von Hoff DD, et al. Increased Survival in Pancreatic Cancer with nab-Paclitaxel plus Gemcitabine. N Engl J Med. 2013;369:1691 – 1703. Available at:http://www.nejm.org/doi/full/10.1056/NEJMoa1304369 Accessed February 2015

Goldstein D et al. nab-Paclitaxel plus gemcitabine for metastatic pancreatic cancer: long-term survival from a phase III trial. JNCI J Ntal Cancer Inst, 2015, 1-10. DOI: 10.1093/jnci/dju413. Accessed February 2015

The Translational Genomics Research Inst. “TGen study: Destroying tumor material that ‘cloaks’ cancer cells could benefit patients.” Medical News Today. MediLexicon, Intl., 27 Feb. 2015. Web. 10 Mar. 2015.

Mol Carcinog. 2012 Jan; 51(1): 64–74. doi:  10.1002/mc.20771

Mendonça FM1, de Sousa FR1, Barbosa AL1, Martins SC1, Araújo RL1, Soares R2, Abreu C1. Metabolism. 2015 Metabolic syndrome and risk of cancer: which link? Feb;64(2):182-9.

Huang CK1, et al  Autocrine/paracrine mechanism of interleukin-17B receptor promotes breast tumorigenesis through NF-κB-mediated antiapoptotic pathway. Oncogene. 2014 Jun 5;33(23):2968-77.

 Jiao L et al  Dietary consumption of advanced glycation end products andpancreatic cancer in the prospective NIH-AARP Diet and Health Study.

 Cancer. 2014 Dec 1;120(23):3669-75. doi: 10.1002/cncr.28863. Epub 2014 Oct 14. Clinical and pathologic features of familial pancreatic cancer.

The Rockefeller University Press, doi: 10.1084/jem.20141702 Cancer Lett. 2015 Jan 28;356(2 Pt A):281-8. doi: 10.1016/j.canlet.2014.03.028. Epub 2014 Apr 2.

 Humphris JL1, et al  Australian Pancreatic Cancer Genome Initiative  Br J Cancer. 2014 Nov 25;111(11):2180-6. doi: 10.1038/bjc.2014.525. Epub 2014 Oct 2.

Søreide K1, Sund M2.  Epidemiological-molecular evidence of metabolic reprogramming on proliferation, autophagy and cell signaling in pancreas cancer.  Am J Clin Nutr. 2015 Jan;101(1):126-34. doi: 10.3945/ajcn.114.098061. Epub 2014 Nov 19.

Lin CC1, et al .Independent and joint effect of type 2 diabetes and gastric and hepatobiliary diseases on risk of pancreatic cancer risk: 10-year follow-up of population-based cohort.

Wang Z1 et al  Metformin is associated with reduced risk of pancreatic cancer in patients with type 2 diabetes mellitus: a systematic review and meta-analysis. Diabetes Res Clin Pract. 2014 Oct;106(1):19-26. doi: 10.1016/j.diabres.2014.04.007. Epub 2014 Apr 18.

Preziosi G1, Oben JA2, Fusai G3. Obesity and pancreatic cancer.  Surg Oncol. 2014 Jun;23(2):61-71. doi: 10.1016/j.suronc.2014.02.003. Epub 2014 Mar 12.

Berger NA1. Obesity and cancer pathogenesis. Ann N Y Acad Sci. 2014 Apr;1311:57-76. doi: 10.1111/nyas.12416.

De Souza AL1, Saif MW. Diabetes and pancreatic cancer. JOP. 2014 Mar 10;15(2):118-20. doi: 10.6092/1590-8577/2286.

Timofte D et al Metabolic disorders in patients operated for pancreatic cancer.  Rev Med Chir Soc Med Nat Iasi. 2014 Apr-Jun;118(2):392-8.

Lowenfels AB, Maisonneuve P. Epidemiologic and etiologic factors of pancreatic cancer. Hematol Oncol Clin North Am. 2002;16:1–16.

Lowenfels AB, Sullivan T, Fiorianti J, Maisonneuve P. The epidemiology and impact of pancreatic diseases in the United States. Curr Gastroenterol Rep.2005;7:90–95.

Michaud DS. Epidemiology of pancreatic cancer. Minerva Chir. 2004;59:99–111.

Schuster DP. Obesity and the Development of Type 2 Diabetes: the Effects of Fatty Tissue Inflamation. Dovepress; 2010. pp. 253–262.

WHO. World Health Organization Fact Sheet for World Wide Prevalence of Obesity. 2006. http://www.who.int/mediacentre/factsheets/fs311/en/index.html.

Chang S et al, State ranks of incident cancer burden due to overweight and obesity in the United States, 2003. Obesity (Silver Spring) 2008;16:1636–1650.

Lewis L. Lanie  Evolutionary struggles between NK cells and viruses Nature Reviews Immunology 8, 259-268 (April 2008) | doi:10.1038/nri2276

Seth, S. et al. The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochem. Biophys. Res. Commun. 364, 959–965 (2007).

de Andrade et al DNAM-1 control of natural killer cells functions through nectin and nectin-like proteins. Immunol. Cell Biol. 92, 237–244 (2014).

Orange, J. S. Formation and function of the lytic NK-cell immunological synapse. Nature Rev. Immunol. 8, 713–725 (2008).

Lagrue, K. et al. The central role of the cytoskeleton in mechanisms and functions of the NK cell immune synapse. Immunol. Rev. 256, 203–221 (2013).

Vyas, Y. M. et al. Spatial organization of signal transduction molecules in the NK cell immune synapses during MHC class I-regulated noncytolytic and cytolytic interactions. J. Immunol. 167, 4358–4367 (2001).

Shibuya, K. et al. CD226 (DNAM-1) is involved in lymphocyte function-associated antigen 1 costimulatory signal for naive T cell differentiation and proliferation. J. Exp. Med. 198,1829–1839 (2003).

Lozano, E. et al  The CD226/CD155 interaction regulates the proinflammatory (TH1/TH17)/anti-inflammatory (TH2) balance in humans. J. Immunol. 191, 3673–3680 (2013).

Maier, M. K. et al. The adhesion receptor CD155 determines the magnitude of humoral immune responses against orally ingested antigens. Eur. J. Immunol. 37, 2214–2225(2007).

Pende, D. et al. Expression of the DNAM-1 ligands, Nectin-2 (CD112) and poliovirus receptor (CD155), on dendritic cells: relevance for natural killer-dendritic cell interaction.Blood 107, 2030–2036 (2006).

O’Leary et al  T cell- and B cell-independent adaptive immunity mediated by natural killer cells. Nature Immunol. 7, 507–516(2006).

Sanchez-Correa, B. et al. Decreased expression of DNAM-1 on NK cells from acute myeloid leukemia patients. Immunol. Cell Biol. 90, 109–115 (2012).

Mamessier, E. et al. Human breast cancer cells enhance self tolerance by promoting evasion from NK cell antitumor immunity. J. Clin. Invest. 121, 3609–3622 (2011).

Nakai, R. et al. Overexpression of Necl-5 correlates with unfavorable prognosis in patients with lung adenocarcinoma. Cancer Sci. 101, 1326–1330 (2010).

Tane, S. et al. The role of Necl-5 in the invasive activity of lung adenocarcinoma. Exp. Mol. Pathol. 94, 330–335 (2013).

Sloan, K. E. et al. CD155/PVR plays a key role in cell motility during tumor cell invasion and migration. BMC Cancer 4, 73 (2004)

Chan, C. J., Smyth, M. J. & Martinet, L. Molecular mechanisms of natural killer cell activation in response to cellular stress. Cell Death Differ. 21, 5–14 (2014).

Li, M. et al. T-cell immunoglobulin and ITIM domain (TIGIT) receptor/poliovirus receptor (PVR) ligand engagement suppresses interferon-γ production of natural killer cells via β-arrestin 2-mediated negative signaling. J. Biol. Chem. 289, 17647–17657 (2014).

Guma, M. et al. Imprint of human cytomegalovirus infection on the NK cell receptor repertoire. Blood 104, 3664–3671 (2004).

Sharma S. Natural killer cells and regulatory T cells in early pregnancy loss.

Int J Dev Biol. 2014;58(2-4):219-29. doi: 10.1387/ijdb.140109ss. Review.

Mukaida N, Sasaki S, Baba T. Chemokines in cancer development and progression and their potential as targeting molecules for cancer treatment.  Mediators Inflamm. 2014;2014:170381. doi: 10.1155/2014/170381. Epub 2014 May 22. Review.

Van Elssen CH, Oth T, Germeraad WT, Bos GM, Vanderlocht J.  Natural killer cells: the secret weapon in dendritic cell vaccination strategies.Clin Cancer Res. 2014 Mar 1;20(5):1095-103. doi: 10.1158/1078-0432.CCR-13-2302. Review.

Gardner AB, Lee SK, Woods EC, Acharya AP. Biomaterials-based modulation of the immune system. Biomed Res Int. 2013;2013:732182. doi: 10.1155/2013/732182. Epub 2013 Sep 22. Review.

Pedroza-Pacheco I, Madrigal A, Saudemont A. Interaction between natural killer cells and regulatory T cells: perspectives for immunotherapy. Cell Mol Immunol. 2013 May;10(3):222-9. doi: 10.1038/cmi.2013.2. Epub 2013 Mar 25. Review.

Lindau D, Gielen P, Kroesen M, Wesseling P, Adema GJ.  The immunosuppressive tumour network: myeloid-derived suppressor cells, regulatory T cells and natural killer T cells. Immunology. 2013 Feb;138(2):105-15. doi: 10.1111/imm.12036. Review.

Tian Z, Chen Y, Gao B.Natural killer cells in liver disease.  Hepatology. 2013 Apr;57(4):1654-62. doi: 10.1002/hep.26115. Review.

Joyce S, Girardi E, Zajonc DM. J NKT cell ligand recognition logic: molecular basis for a synaptic duet and transmission of inflammatory effectors. Immunol. 2011 Aug 1;187(3):1081-9. doi: 0.4049/jimmunol.1001910. Review.

Diana J, Gahzarian L, Simoni Y, Lehuen A. Innate immunity in type 1 diabetes.  Discov Med. 2011 Jun;11(61):513-20. Review.

Wu L, Van Kaer L.Natural killer T cells in health and disease. Front Biosci (Schol Ed). 2011 Jan 1;3:236-51. Review.

Cantorna MT.  Why do T cells express the vitamin D receptor? Ann N Y Acad Sci. 2011 Jan;1217:77-82. doi: 10.1111/j.1749-6632.2010.05823.x. Epub 2010 Nov 29. Review.

Key Papers:

These papers, Gilfian et all and Iguchi-Manaka et al,  were the first to show the role of CD226 in NK cell- and CD8+ T cell-mediated tumour immunosurveillance using Cd226−/− mice.

  • Gilfillan, S.et al. DNAM-1 promotes activation of cytotoxic lymphocytes by nonprofessional antigen-presenting cells and tumors. J. Exp. Med. 205, 2965–2973 (2008).
  • Iguchi-Manaka, A.et al. Accelerated tumor growth in mice deficient in DNAM-1 receptor.  Exp. Med. 205, 2959–2964 (2008).

Johnston, R. J. et al. The immunoreceptor TIGIT regulates antitumor and antiviral CD8+ T cell effector function. Cancer Cell 26, 923–937 (2014).
This study shows that TIGIT is expressed by PD1+ exhausted tumour-infiltrating T cells and that targeting these receptors with monoclonal antibodies represents a promising strategy to restore CD8+ T cell functions in cancer or in chronic infectious disease.

Khakoo, S. I. et al. HLA and NK cell inhibitory receptor genes in resolving hepatitis C virus infection. Science 305, 872–874 (2004).

Fang, M. et al. CD94 is essential for NK cell-mediated resistance to a lethal viral disease.Immunity 34, 579–589 (2011).
This study using CD94-deficient mice shows that the activating receptor formed by CD94 and NKG2E is essential for the resistance of C57BL/6 mice to mousepox.

Pradeu, T., Jaeger, S. & Vivier, E. The speed of change: towards a discontinuity theory of immunity? Nature Rev. Immunol. 13, 764–769 (2013).
This is an outstanding review on the formulation of a new immune paradigm ‘the discontinuity theory’

Further Reading:

Vol 13, No 4 (2012): July – p. 330-469 Molecular Biology of Pancreatic Cancer: How Useful Is It in Clinical Practice? ABSTRACT  HTML  PDF
George H Sakorafas, Vasileios Smyrniotis
Vol 13, No 4 (2012): July – p. 330-469 Endoscopic Findings of Upper Gastrointestinal Lesions in Patients with Pancreatic Cancer ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Hiroyuki Watanabe, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Seiji Yano
Vol 13, No 5 (2012): September – p. 470-547 Two Avirulent, Lentogenic Strains of Newcastle Disease Virus Are Cytotoxic for Some Human Pancreatic Tumor Lines In Vitro ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Megan Delimata, Sooraj Tejaswi
Vol 14, No 3 (2013): May – p. 221-303 Duration of Diabetes and Pancreatic Cancer in a Case-Control Study in the Midwest and the Iowa Women’s Health Study (IWHS) Cohort ABSTRACT  HTML  PDF
Sarah A Henry, Anna E Prizment, Kristin E Anderson
Vol 16, No 1 (2015): January – p. 1-99 Endoscopic Management of Pain in Pancreatic Cancer ABSTRACT  HTML  PDF
Parit Mekaroonkamol, Field F Willingham, Saurabh Chawla
Vol 14, No 2 (2013): March – p. 109-220 Advancements in the Management of Pancreatic Cancer: 2013 ABSTRACT  HTML  PDF
Muhammad Wasif Saif
Vol 15, No 5 (2014): September – p. 413-540 New-onset Diabetes: A Clue to the Early Diagnosis of Pancreatic Cancer ABSTRACT  HTML  PDF
Suresh T Chari
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 2: Carcinogenesis Studies ABSTRACT  HTML  PDF
Fumiaki Nozawa, Mehmet Yalniz, Murat Saruc, Jens Standop, Hiroshi Egami, Parviz M Pour
Vol 14, No 5 (2013): September – p. 475-527 Synchronous Triple Cancers of the Pancreas, Stomach, and Cecum Treated with S-1 Followed by Pancrelipase Treatment of Pancreatic Exocrine Insufficiency ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Daisuke Ishikawa, Shigeki Nanjo, Shinji Takeuchi, Tadaaki Yamada, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Toshifumi Gabata, Osamu Matsui, Hiroko Ikeda, Yasushi Takamatsu, Sakae Iwakami, Seiji Yano
Vol 13, No 1 (2012): January – p. 1-123 Newcastle Disease Virus LaSota Strain Kills Human Pancreatic Cancer Cells in Vitro with High Selectivity ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Sooraj Tejaswi, Megan Delimata
Vol 13, No 3 (2012): May – p. 252-329 Rare Solid Tumors of the Pancreas as Differential Diagnosis of Pancreatic Adenocarcinoma ABSTRACT  HTML  PDF
Sabine Kersting, Monika S Janot, Johanna Munding, Dominique Suelberg, Andrea Tannapfel, Ansgar M Chromik, Waldemar Uhl, Uwe Bergmann
Vol 14, No 4 (2013): July – p. 304-474 A Proteomic Comparison of Formalin-Fixed Paraffin-Embedded Pancreatic Tissue from Autoimmune Pancreatitis, Chronic Pancreatitis, and Pancreatic Cancer ABSTRACT  HTML  PDF  SUPPL. TABLES 1-4 (PDF)
Joao A Paulo, Vivek Kadiyala, Scott Brizard, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 13, No 4 (2012): July – p. 330-469 Highlights on the First Line Treatment of Metastatic Pancreatic Cancer ABSTRACT  HTML  PDF
Krishna S Gunturu, Jamie Jarboe, Muhammad Wasif Saif
Vol 14, No 2 (2013): March – p. 109-220 Pancreatic Cancer: Updates on Translational Research and Future Applications ABSTRACT  HTML  PDF
Evangelos G Sarris, Konstantinos N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Pancreatic Cancer: What About Screening and Detection? ABSTRACT  HTML  PDF
Froso Konstantinou, Kostas N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Diabetes and Pancreatic Cancer ABSTRACT  HTML  PDF
Najla Hatem El-Jurdi, Muhammad Wasif Saif
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 1: Basic Studies ABSTRACT  HTML  PDF
Murat Saruc, Fumiaki Nozawa, Mehmet Yalniz, Atsushi Itami, Parviz M Pour
Vol 14, No 2 (2013): March – p. 109-220 Analysis of Endoscopic Pancreatic Function Test (ePFT)-Collected Pancreatic Fluid Proteins Precipitated Via Ultracentrifugation ABSTRACT  HTML  PDF  SUPPL.(XLS)  SUPPL.(PDF)
Joao A Paulo, Vivek Kadiyala, Aleksandr Gaun, John F K Sauld, Ali Ghoulidi, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 16, No 1 (2015): January – p. 1-99 Regulation Mechanisms of the Hedgehog Pathway in Pancreatic Cancer: A Review ABSTRACT  HTML  PDF
Kim Christin Honselmann, Moritz Pross, Carlo Maria Felix Jung, Ulrich Friedrich Wellner, Steffen Deichmann, Tobias Keck, Dirk Bausch
Vol 14, No 5S (2013): September (Suppl.) – p. 528-602 History of Previous Cancer in Patients Undergoing Resection for Pancreatic Adenocarcinoma ABSTRACT  PDF
Francesca Gavazzi, Maria Rachele Angiolini, Cristina Ridolfi, Maria Carla Tinti, Marco Madonini, Marco Montorsi, Alessandro Zerbi
Vol 13, No 4 (2012): July – p. 330-469 Molecular Biology of Pancreatic Cancer: How Useful Is It in Clinical Practice? ABSTRACT  HTML  PDF
George H Sakorafas, Vasileios Smyrniotis
Vol 13, No 4 (2012): July – p. 330-469 Endoscopic Findings of Upper Gastrointestinal Lesions in Patients with Pancreatic Cancer ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Hiroyuki Watanabe, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Seiji Yano
Vol 13, No 5 (2012): September – p. 470-547 Two Avirulent, Lentogenic Strains of Newcastle Disease Virus Are Cytotoxic for Some Human Pancreatic Tumor Lines In Vitro ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Megan Delimata, Sooraj Tejaswi
Vol 14, No 3 (2013): May – p. 221-303 Duration of Diabetes and Pancreatic Cancer in a Case-Control Study in the Midwest and the Iowa Women’s Health Study (IWHS) Cohort ABSTRACT  HTML  PDF
Sarah A Henry, Anna E Prizment, Kristin E Anderson
Vol 16, No 1 (2015): January – p. 1-99 Endoscopic Management of Pain in Pancreatic Cancer ABSTRACT  HTML  PDF
Parit Mekaroonkamol, Field F Willingham, Saurabh Chawla
Vol 14, No 2 (2013): March – p. 109-220 Advancements in the Management of Pancreatic Cancer: 2013 ABSTRACT  HTML  PDF
Muhammad Wasif Saif
Vol 15, No 5 (2014): September – p. 413-540 New-onset Diabetes: A Clue to the Early Diagnosis of Pancreatic Cancer ABSTRACT  HTML  PDF
Suresh T Chari
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 2: Carcinogenesis Studies ABSTRACT  HTML  PDF
Fumiaki Nozawa, Mehmet Yalniz, Murat Saruc, Jens Standop, Hiroshi Egami, Parviz M Pour
Vol 14, No 5 (2013): September – p. 475-527 Synchronous Triple Cancers of the Pancreas, Stomach, and Cecum Treated with S-1 Followed by Pancrelipase Treatment of Pancreatic Exocrine Insufficiency ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Daisuke Ishikawa, Shigeki Nanjo, Shinji Takeuchi, Tadaaki Yamada, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Toshifumi Gabata, Osamu Matsui, Hiroko Ikeda, Yasushi Takamatsu, Sakae Iwakami, Seiji Yano
Vol 13, No 1 (2012): January – p. 1-123 Newcastle Disease Virus LaSota Strain Kills Human Pancreatic Cancer Cells in Vitro with High Selectivity ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Sooraj Tejaswi, Megan Delimata
Vol 13, No 3 (2012): May – p. 252-329 Rare Solid Tumors of the Pancreas as Differential Diagnosis of Pancreatic Adenocarcinoma ABSTRACT  HTML  PDF
Sabine Kersting, Monika S Janot, Johanna Munding, Dominique Suelberg, Andrea Tannapfel, Ansgar M Chromik, Waldemar Uhl, Uwe Bergmann
Vol 14, No 4 (2013): July – p. 304-474 A Proteomic Comparison of Formalin-Fixed Paraffin-Embedded Pancreatic Tissue from Autoimmune Pancreatitis, Chronic Pancreatitis, and Pancreatic Cancer ABSTRACT  HTML  PDF  SUPPL. TABLES 1-4 (PDF)
Joao A Paulo, Vivek Kadiyala, Scott Brizard, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 13, No 4 (2012): July – p. 330-469 Highlights on the First Line Treatment of Metastatic Pancreatic Cancer ABSTRACT  HTML  PDF
Krishna S Gunturu, Jamie Jarboe, Muhammad Wasif Saif
Vol 14, No 2 (2013): March – p. 109-220 Pancreatic Cancer: Updates on Translational Research and Future Applications ABSTRACT  HTML  PDF
Evangelos G Sarris, Konstantinos N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Pancreatic Cancer: What About Screening and Detection? ABSTRACT  HTML  PDF
Froso Konstantinou, Kostas N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Diabetes and Pancreatic Cancer ABSTRACT  HTML  PDF
Najla Hatem El-Jurdi, Muhammad Wasif Saif
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 1: Basic Studies ABSTRACT  HTML  PDF
Murat Saruc, Fumiaki Nozawa, Mehmet Yalniz, Atsushi Itami, Parviz M Pour
Vol 14, No 2 (2013): March – p. 109-220 Analysis of Endoscopic Pancreatic Function Test (ePFT)-Collected Pancreatic Fluid Proteins Precipitated Via Ultracentrifugation ABSTRACT  HTML  PDF  SUPPL.(XLS)  SUPPL.(PDF)
Joao A Paulo, Vivek Kadiyala, Aleksandr Gaun, John F K Sauld, Ali Ghoulidi, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 16, No 1 (2015): January – p. 1-99 Regulation Mechanisms of the Hedgehog Pathway in Pancreatic Cancer: A Review ABSTRACT  HTML  PDF
Kim Christin Honselmann, Moritz Pross, Carlo Maria Felix Jung, Ulrich Friedrich Wellner, Steffen Deichmann, Tobias Keck, Dirk Bausch
Vol 14, No 5S (2013): September (Suppl.) – p. 528-602 History of Previous Cancer in Patients Undergoing Resection for Pancreatic Adenocarcinoma ABSTRACT  PDF
Francesca Gavazzi, Maria Rachele Angiolini, Cristina Ridolfi, Maria Carla Tinti, Marco Madonini, Marco Montorsi, Alessandro Zerbi

Patents

1.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week10/OG/html/1412-2/US08974784-20150310.html

Anti-pancreatic cancer antibodies: David M. Goldenberg, Mendham, NJ (US); Hans J. Hansen, Picayune, MS (US); Chien-Hsing Chang, Downingtown, PA (US); …

2.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week42/OG/html/1407-3/US08865413-20141021.html

A method of diagnosing pancreatic cancer in a human, the method comprising detecting the level of golgi apparatus protein 1 in a sample from the …

3.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week10/OG/html/1412-2/US08974802-20150310.html

A method for the treatment of pancreatic cancer, which comprises the administration to a human patient with pancreatic cancer of an effective …

4.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week50/OG/html/1409-3/US08912191-20141216.html

A method of treatment of melanoma, colorectal cancer, or pancreatic cancerwherein the treatment inhibits the progress of, reduces the rate of …

5.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week10/OG/html/1412-2/US08975401-20150310.html

A method of treating a cancer selected from breast cancer, hepatocellular carcinoma … gastric carcinoma, leukemia and pancreatic cancer in a subject …

6.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week42/OG/html/1407-3/US08865173-20141021.html

Treatments for pancreatic cancer metastases: Suzanne M. Spong, San Francisco, CA (US); Thomas B. Neff, Atherton, CA (US); and Stephen J. Klaus, San …

7.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week48/OG/html/1409-1/US08901093-20141202.html

Custom vectors for treating and preventing pancreatic cancer: Dennis L. Panicali, Acton, MA (US); Gail P. Mazzara, Winchester, MA (US); Linda R. …

8.       www.uspto.gov

http://www.uspto.gov/web/patents/patog/week09/OG/html/1412-1/US08969366-20150303.html

A method for treating a disease selected from the group consisting of melanoma, stomach cancer, liver cancer, colorectal cancer, pancreatic …

9.       Drug composition cytotoxic for pancreatic cancer cells

http://www.uspto.gov/web/patents/patog/week13/OG/html/1401-1/US08685941-20140401.html

Drug composition cytotoxic for pancreatic cancer cells: James Turkson, Orlando, Fla. (US) Assigned to University of Central Florida Research …

10.    [PDF] J. John Shimazaki, Esq. 1539 Lincoln Way, Suite 204

http://www.uspto.gov/web/offices/com/sol/foia/tac/2.66/74713131.pdf

  1. John Shimazaki, Esq. 1539 Lincoln Way, Suite 204 … containing the Of fice Action because Applicant™s president™s father was ill withpancreatic…

11.    [PDF] Written Comments on Genetic Diagnostic Testing Study

http://www.uspto.gov/aia_implementation/gen_e_lsi_20130207.pdf

Page 5 of 23 extracolonic cancers of LS include liver cancer, pancreatic cancer, gall bladder duct cancer, prostate cancer, sarcomas, thyroid cancer …

12.    Detection of digestive organ cancer, gastric cancer …

http://www.uspto.gov/web/patents/patog/week02/OG/html/1410-2/US08932990-20150113.html

Detection of digestive organ cancer, gastric cancer, colorectal cancer, pancreatic cancer, and biliary tract cancer by gene expression profiling

13.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week06/OG/html/1399-2/US08648112-20140211.html

wherein said cancer is selected from the group consisting of a sarcoma, … a nervous system cancer, prostate cancer, pancreatic cancer, and colon can …

14.    Treatment of hyperproliferative diseases with vinca …

http://www.uspto.gov/web/patents/patog/week45/OG/html/1408-2/US08883775-20141111.html

A method of treating or ameliorating a hyperproliferative disorder selected from the group consisting of glioblastoma, lung cancer, breast cancer . …

15.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week30/OG/html/1404-5/US08791125-20140729.html

A method for treating a Weel kinase mediated cancer selected from the group consisting of breast cancer, lung cancer, pancreatic cancer, colon …

16.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week08/OG/html/1411-4/US08962891-20150224.html

wherein said proliferative disorder is breast cancer or pancreatic cancer. …

17.    Immunoconjugates, compositions for making them, and …

http://www.uspto.gov/web/patents/patog/week40/OG/html/1407-1/US08852599-20141007.html

A method for treating a cancer in a subject suffering from such cancer, … pancreatic cancer, ovarian cancer, lymphoma, colon cancer, mesothelioma, …

18.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week11/OG/html/1400-3/US08673898-20140318.html

A method of treating cancer, … lung cancer, melanoma, neuroblastomas, oral cancer, ovarian cancer, pancreatic cancer, prostate cancer , rectal cance …

19.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week43/OG/html/1407-4/US08871744-20141028.html

A method for treating a subject having breast cancer, ovarian cancer, or pancreatic cancer in need of therapy thereof comprising administering to …

20.    [PDF] Pamela Scudder <pscudder@windstream.net> Sent: Saturday …

http://www.uspto.gov/sites/default/files/aia_implementation/gene-comment-scudder.pdf

My daughter died of ovarian cancer. My other daughter and many … (mutation) is known to cause a higher incidence of pancreatic (for instance) cancer …

21.    Methods of treating cancer using pyridopyrimidinone …

http://www.uspto.gov/web/patents/patog/week48/OG/html/1409-1/US08901137-20141202.html

A method of treating pancreatic cancer which method comprises administering to a patient a therapeutically effective amount of a compound that is:

22.    Heteroaryl substituted pyrrolo[2,3-B]pyridines and pyrrolo …

http://www.uspto.gov/web/patents/patog/week02/OG/html/1410-2/US08933086-20150113.html

A method of treating pancreatic cancer in a patient, comprising administering to said patient a therapeutically effective amount of a compound …

23.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week49/OG/html/1409-2/US08906934-20141209.html

… wherein the cell proliferative disorder is selected from the group consisting of cervical cancer, colon cancer, ovarian cancer, pancreatic cancer, …

24.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week32/OG/html/1405-2/US08802703-20140812.html

A method of inhibiting MEK in a cancer cell selected from the group consisting of human melanoma cells and human pancreatic cancer cells …

25.    Antibody-based arrays for detecting multiple signal …

http://www.uspto.gov/web/patents/patog/week08/OG/html/1399-4/US08658388-20140225.html

A method for performing a multiplex, high-throughput immunoassay for facilitating a cancer diagnosis, the method comprising:

26.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week48/OG/html/1409-1/US08901147-20141202.html

A method for the treatment of colorectal cancer, lung cancer, breast cancer, prostatecancer, urinary cancer, kidney cancer, and pancreatic …

27.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week16/OG/patentee/alphaY.htm

Yamaue, Hiroki; to Onco Therapy Science, Inc. Combination therapy for pancreatic cancer using an antigenic peptide and chemotherapeutic agent 08703713 …

28.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week48/OG/patentee/alphaP_Utility.htm

… The Custom vectors for treating and preventing pancreatic cancer … system and apparatus for control of pancreatic beta cell function to improve …

29.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week16/OG/patentee/alphaW.htm

Whatcott, Cliff; and Han, Haiyong, to Translational Genomics Research Institute, The Therapeutic target for pancreatic cancer cells 08703736 Cl. …

30.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week10/OG/patentee/alphaG.htm

Goldenberg, David M.; Hansen, Hans J.; Chang, Chien-Hsing; and Gold, David V., to Immunomedics, Inc. Anti-pancreatic cancer antibodies 08974784 Cl. …

31.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week42/OG/patentee/alphaD.htm

… Narayan, Vaibhav; and Patterson, Scott, to Celera Corporation Pancreatic cancertargets and uses thereof 08865413 Cl. 435-7.1. Domsch, Matthew L.; …

32.    [PDF] 15 March 2005 – United States Patent and Trademark Office

http://www.uspto.gov/web/trademarks/tmog/20050315_OG.pdf

15 March 2005 – United States Patent and Trademark Office

33.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week10/OG/html/1412-2/US08975248-20150310.html

Combinations of therapeutic agents for treating cancer: … myeloma, colorectal adenocarcinoma, cervical carcinoma and pancreatic carcinoma, …

34.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week05/OG/patentee/alphaG_Utility.htm

… Inc. Medium-chain length fatty acids, salts and triglycerides in combination with gemcitabine for treatment of pancreatic cancer 08946190 Cl. …

35.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week13/OG/patentee/alphaT_Utility.htm

Turkson, James; to University of Central Florida Research Foundation, Inc. Drug composition cytotoxic for pancreatic cancer cells 08685941 Cl. 514-49.

36.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week31/OG/patentee/alphaG_Utility.htm

… David M., to Immunomedics, Inc. Anti-mucin antibodies for early detection and treatment of pancreatic cancer 08795662 Cl. 424-130.1. Gold, …

37.    [PDF] www.uspto.gov

http://www.uspto.gov/web/trademarks/tmog/20110816_OG.pdf

http://www.uspto.gov

38.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week29/OG/patentee/alphaG.htm

Goggins, Michael G.; and Sato, Norihiro, to Johns Hopkins University, The Aberrantly methylated genes in pancreatic cancer 08785614 Cl. 536-24.3. …

39.    www.uspto.gov

http://www.uspto.gov/web/patents/patog/week46/OG/html/1408-3/US08889697-20141118.html

wherein said cancer is pancreatic cnacer, chronic myelogenous leukemia (CML), acute myelogenous leukemia (AML), acute lymphoblastic leukemia (ALL …

40.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week39/OG/patentee/alphaM_Utility.htm

Malafa, Mokenge P.; and Sebti, Said M., to University of South Florida Delta-tocotrienol treatment and prevention of pancreatic cancer 08846653 Cl. …

41.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week02/OG/patentee/alphaK_Utility.htm

… Taro, to National University Corporation Kanazawa University Detection of digestive organ cancer, gastric cancer, colorectal cancer, pancreatic …

42.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week11/OG/patentee/alphaK_Utility.htm

Kirn, David; to Sillajen Biotherapeutics, Inc. Oncolytic vaccinia virus cancer therapy 08980246 Cl. 424-93.2. Kirn, Larry J.; …

43.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week39/OG/patentee/alphaM_Utility.htm

Malafa, Mokenge P.; and Sebti, Said M., to University of South Florida Delta-tocotrienol treatment and prevention of pancreatic cancer 08846653 Cl. …

44.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week35/OG/patentee/alphaS_Utility.htm

list of patentees to whom patents were issued on the 2nd day of september, 2014 and to whom reexamination certificates were issued during the week …

45.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week42/OG/patentee/alphaS.htm

… Therapeutics Inc. Compounds and compositions for stabilizing hypoxia inducible factor-2 alpha as a method for treating cancer 08865748 Cl. …

46.    [PDF] Paper No. 12 UNITED STATES PATENT AND TRADEMARK OFFICE …

http://www.uspto.gov/sites/default/files/ip/boards/bpai/decisions/prec/bhide.pdf

high incidence of ras involvement, such as colon and pancreatic tumors. By … withcancer or pre-cancerous states will serve to treat or palliate the …

47.    CPC Scheme – C07K PEPTIDES – United States Patent and …

http://www.uspto.gov/web/patents/classification/cpc/html/cpc-C07K.html

PEPTIDES (peptides in … Cancer-associated SCM-recognition factor, CRISPP} [2013‑01] … Kazal type inhibitors, e.g. pancreatic secretory inhibitor, …

48.    Class Definition for Class 514 – DRUG, BIO-AFFECTING AND …

http://www.uspto.gov/web/patents/classification/uspc514/defs514.htm

… compound X useful as an anti-cancer … certain rules as to patent … Cystic fibrosis is manifested by faulty digestion due to a deficiency of pa …

49.    United States Patent and Trademark Office

http://www.uspto.gov/web/patents/classification/cpc/html/cpc-G01N_3.html

Cancer-associated SCM-recognition factor, CRISPP . G01N 2333/4748. . . . . … Bovine/basic pancreatic trypsin inhibitor (BPTI, aprotinin) G01N …

50.    Class Definition for Class 530 – CHEMISTRY: NATURAL RESINS …

http://www.uspto.gov/web/patents/classification/uspc530/defs530.htm

CLASS 530 , CHEMISTRY: NATURAL … Typically the processes of this subclass include solvent extraction of pancreatic … as well as with some forms of …

51.    CPC Definition – A61K PREPARATIONS FOR MEDICAL, DENTAL, OR …

http://www.uspto.gov/web/patents/classification/cpc/html/defA61K.html

PREPARATIONS FOR MEDICAL, DENTAL, OR TOILET PURPOSES … i.e. Pancreatic stem cells are classified in A61K 35/39, … preparations containing cancer a …

52.    Class 530: CHEMISTRY: NATURAL RESINS OR DERIVATIVES …

http://www.uspto.gov/web/offices/ac/ido/oeip/taf/def/530.htm

Typically the processes of this subclass include solvent extraction of pancreatic … 828 for cancer -associated proteins … provided for in Class …

53.    United States Patent and Trademark Office

http://www.uspto.gov/web/patents/classification/cpc/html/cpc-G01N_1.html

Home page of the United States Patent and … Pancreatic cells} G01N 33/5073 … – relevant features relating to a specifically defined cancer are …

54.    *****TBD***** – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/classification/shadowFiles/defs514sf.htm?514_971&S&10E&10F

class 514, drug, bio-affecting and body treating compositions …

55.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week47/OG/patentee/alphaN_Utility.htm

… Dale E., to Buck Institute for Age Research, The Reagents and methods for cancertreatment and … useful for diagnosis and treatment of pancreati …

56.    United States Patent and Trademark Office

http://www.uspto.gov/web/patents/classification/cpc/html/cpc-C12Y_2.html

Pancreatic ribonuclease (3.1.27.5) C12Y 301/27006. . Enterobacter ribonuclease (3.1.27.6) C12Y 301/27007. . Ribonuclease F (3.1.27.7) C12Y 301/27008. …

57.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week01/OG/patentee/alphaI_Utility.htm

Institute for Cancer Research: See … and Segev, Hanna, to Technion Research & Development Foundation Limited Populations of pancreatic …

58.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week53/OG/patentee/alphaC.htm

Cancer Research Technology Limited: See–Collins, Ian; Reader, John Charles; Klair, Suki; Scanlon, Jane; Addison, Glynn; and Cherry, Michael 08618121 …

59.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week12/OG/patentee/alphaP_Utility.htm

… to University Health Network Cyclic inhibitors of carnitine palmitoyltransferase and treating cancer … progenitor cells and pancreatic endocrine …

60.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week47/OG/patentee/alphaI.htm

… to King Fahd University of Petroleum and Minerals Cytotoxic compounds for treatingcancer … or preventing a pancreatic dysfunction 08894972 Cl …

61.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week50/OG/patentee/alphaC.htm

… and Taylor-Papadimitriou, Joyce, to Københavns Universitet Generation of a cancer-specific … to CuRNA, Inc. Treatment of pancreatic …

62.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week29/OG/patentee/alphaP_Utility.htm

… to Cedars-Sinai Medical Center Drug delivery of temozolomide for systemic based treatment of cancer … Pancreatic enzyme compositions and …

63.    Class 424: DRUG, BIO-AFFECTING AND BODY TREATING …

http://www.uspto.gov/web/offices/ac/ido/oeip/taf/def/424.htm

… a disclosed or even specifically claimed utility (i.e., compound X having an attached radionuclide useful as an anti-cancer diagnostic or …

64.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week25/OG/patentee/alphaT_Utility.htm

… Chang-Jer, to Gold Nanotech Inc. Physical nano-complexes for preventing and treating cancer and … and protective solution for protecting pancrea …

65.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week27/OG/patentee/alphaA_Utility.htm

… Thomas T., to Penn State Research Foundation, The In vivo photodynamic therapy ofcancer via a near infrared … of pancreatic beta-cells by …

66.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week32/OG/patentee/alphaB_Utility.htm

Birnie, Richard; to University of York, The Cancer vaccine 08802619 Cl. 514-1. Birtwhistle, Daniel P.; Long, James R.; and Reinke, Robert E., …

67.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week20/OG/patentee/alphaC_Utility.htm

… to Cornell University Method for treating cancer 08729133 Cl. 514-673 … methods for promoting the generation of PDX1+ pancreatic cells …

68.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week49/OG/patentee/alphaL_Utility.htm

… Kurt, to Abbvie Biotherapeutics Inc. Compositions against cancer antigen LIV-1 and uses … H., to Amylin Pharmaceuticals, LLC Pancreatic …

69.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week11/OG/patentee/alphaS_Utility.htm

… Kenji; and Matsuda, Hirokazu, to Kyoto University Molecular probe for imaging ofpancreatic islets and use … use in the treatment of cancer …

70.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week36/OG/patentee/alphaK.htm

… Emi; Matsumi, Chiemi; and Saitoh, Yukie, to Actgen Inc Antibody having anti-cancer … The Plectin-1 targeted agents for detection and treatment …

71.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week53/OG/patentee/alphaK.htm

list of patentees to whom patents were issued on the 31th day of december, 2013 and to whom reexamination certificates were issued during the week …

72.    Patentee Index – United States Patent and Trademark Office

http://www.uspto.gov/web/patents/patog/week40/OG/patentee/alphaK_Utility.htm

… Uemoto, Shinji; and Kawaguchi, Yoshiya, to Kyoto University Method of culturingpancreatic islet-like tissues by a … of breast cancer 08853183 …

Clinical Trials:

Region Name   Number of Studies
World 1824  
Africa   [map]   10  
Central America   [map]   4  
East Asia   [map]   179  
Japan 40   [studies]
Europe   [map]   444  
Middle East   [map]   46  
North America 1189  
Canada   [map]   102   [studies]
Mexico 11   [studies]
United States   [map]   1144   [studies]
Alabama 60   [studies]
Alaska 4   [studies]
Arizona 107   [studies]
Arkansas 23   [studies]
California 235   [studies]
Colorado 79   [studies]
Connecticut 51   [studies]
Delaware 15   [studies]
District of Columbia 36   [studies]
Florida 187   [studies]
Georgia 77   [studies]
Hawaii 15   [studies]
Idaho 11   [studies]
Illinois 139   [studies]
Indiana 94   [studies]
Iowa 51   [studies]
Kansas 39   [studies]
Kentucky 48   [studies]
Louisiana 46   [studies]
Maine 11   [studies]
Maryland 189   [studies]
Massachusetts 142   [studies]
Michigan 116   [studies]
Minnesota 114   [studies]
Mississippi 14   [studies]
Missouri 91   [studies]
Montana 27   [studies]
Nebraska 42   [studies]
Nevada 32   [studies]
New Hampshire 25   [studies]
New Jersey 64   [studies]
New Mexico 27   [studies]
New York 230   [studies]
North Carolina 111   [studies]
North Dakota 22   [studies]
Ohio 136   [studies]
Oklahoma 41   [studies]
Oregon 54   [studies]
Pennsylvania 180   [studies]
Rhode Island 23   [studies]
South Carolina 72   [studies]
South Dakota 23   [studies]
Tennessee 115   [studies]
Texas 212   [studies]
Utah 36   [studies]
Vermont 11   [studies]
Virginia 69   [studies]
Washington 83   [studies]
West Virginia 12   [studies]
Wisconsin 74   [studies]
Wyoming 9   [studies]
North Asia   [map]   24  
Pacifica   [map]   39  
South America   [map]   30  
South Asia   [map]   23  
Southeast Asia   [map]   25  

Search Results for ‘pancreas cancer’

Genomics and Epigenetics: Genetic Errors and Methodologies – Cancer and Other Diseases on March 25, 2015 |  Read Full Post »

@Mayo Clinic: Inhibiting the gene, protein kinase D1 (PKD1), and its protein could stop spread of this form of Pancreatic Cancer on February 24, 2015  Read Full Post »

The Changing Economics of Cancer Medicine: Causes for the Vanishing of Independent Oncology Groups in the US on November 26, 2014 | Read Full Post »

Autophagy-Modulating Proteins and Small Molecules Candidate Targets for Cancer Therapy: Commentary of Bioinformatics Approaches on September 18, 2014 |  Read Full Post »

New Immunotherapy Could Fight a Range of Cancers on June 4, 2014  Read Full Post »

Locally Advanced Pancreatic Cancer: Efficacy of FOLFIRINOX  on June 1, 2014  Read Full Post »

 

ipilimumab, a Drug that blocks CTLA-4 Freeing T cells to Attack Tumors @DM Anderson Cancer Center on May 28, 2014 | Read Full Post »

NIH Study Demonstrates that a New Cancer Immunotherapy Method could be Effective against a wide range of Cancers  on May 12, 2014 |

Cancer Research: Curations and Reporting Posted in on May 6, 2014 | Read Full Post »

Cancer Research: Curations and Reporting: Aviva Lev-Ari, PhD, RN  on April 20, 2014 | Read Full Post »

Prologue to Cancer – e-book Volume One – Where are we in this journey? on April 13, 2014 | Read Full Post »

 

Epilogue: Envisioning New Insights in Cancer Translational Biology on April 4, 2014 | Read Full Post »

 

A Synthesis of the Beauty and Complexity of How We View Cancer

on March 26, 2014 Read Full Post »

 

Pancreatic Cancer Diagnosis: Four Novel Histo-pathologies Screening Characteristics offers more Reliable Identification of Cellular Features associated with Cancer

on November 13, 2013 | Read Full Post »

 

What`s new in pancreatic cancer research and treatment?

on October 21, 2013 | Read Full Post »

 

Family History of Cancer may increase the Risk of Close Relatives developing the Same Type of Cancer as well as Different Types

on July 25, 2013 Read Full Post »

 

2013 Perspective on “War on Cancer” on December 23, 1971

on July 5, 2013 Read Full Post »

 

Mesothelin: An early detection biomarker for cancer (By Jack Andraka) on April 21, 2013 |  Read Full Post »

Pancreatic Cancer: Genetics, Genomics and Immunotherapy

on April 11, 2013 |  Read Full Post »

New methods for Study of Cellular Replication, Growth, and Regulation on March 25, 2015 Read Full Post »

Diet and Diabetes on March 2, 2015 |  Read Full Post »

Neonatal Pathophysiology on February 22, 2015 |  Read Full Post »

Endocrine Action on Midbrain on February 12, 2015 | Read Full Post »

Gastrointestinal Endocrinology on February 10, 2015 | Read Full Post »

Parathyroids and Bone Metabolism on February 10, 2015 | Read Full Post »

Pancreatic Islets on February 8, 2015 | Read Full Post »

Pituitary Neuroendocrine Axis on February 4, 2015 |Read Full Post »

Highlights in the History of Physiology on December 28, 2014 | Read Full Post »

Outline of Medical Discoveries between 1880 and 1980 on December 3, 2014 | Read Full Post »

Diagnostics Industry and Drug Development in the Genomics Era: Mid 80s to Present on November 21, 2014  Read Full Post »

Implantable Medical Devices to 2015 – Industry Market Research, Market Share, Market Size, Sales, Demand Forecast, Market Leaders, Company Profiles, Industry Trends on November 17, 2014 | Read Full Post »

Pharmacological Action of Steroid Hormones on October 27, 2014 | Read Full Post »

Metabolomics Summary and Perspective on October 16, 2014 | Read Full Post »

Pancreatic Tumors take nearly 20 years to become Lethal after the first Genetic Perturbations – Discovery @ The Johns Hopkins University  on October 15, 2014 |Read Full Post »

Isoenzymes in cell metabolic pathways on October 6, 2014 | Read Full Post »

Metformin, thyroid-pituitary axis, diabetes mellitus, and metabolism on September 28, 2014 | Read Full Post »

Carbohydrate Metabolism on August 13, 2014 | Read Full Post »

A Primer on DNA and DNA Replication on July 29, 2014 | Read Full Post »

The Discovery and Properties of Avemar – Fermented Wheat Germ Extract: Carcinogenesis Suppressor on June 7, 2014 | Read Full Post »

Previous Articles posted on Prostate Cancer

@Mayo Clinic: Inhibiting the gene, protein kinase D1 (PKD1), and its protein could stop spread of this form of Pancreatic Cancer 2012pharmaceutical 2015/02/24
Published
Thymoquinone, an extract of nigella sativa seed oil, blocked pancreatic cancer cell growth and killed the cells by enhancing the process of programmed cell death. larryhbern 2014/07/15
Published
Moringa Oleifera Kills 97% of Pancreatic Cancer Cells in Vitro larryhbern 2014/06/21
Published
The Gonzalez protocol: Worse than useless for pancreatic cancer sjwilliamspa 2014/06/17
Published
An alternative approach to overcoming the apoptotic resistance of pancreatic cancer 2012pharmaceutical 2014/06/03
Published
Locally Advanced Pancreatic Cancer: Efficacy of FOLFIRINOX 2012pharmaceutical 2014/06/01
Published
Consortium of European Research Institutions and Private Partners will develop a microfluidics-based lab-on-a-chip device to identify Pancreatic Cancer Circulating Tumor Cells (CTC) in blood 2012pharmaceutical 2014/04/10
Published
Pancreatic Cancer Diagnosis: Four Novel Histo-pathologies Screening Characteristics offers more Reliable Identification of Cellular Features associated with Cancer 2012pharmaceutical 2013/11/13
Published
What`s new in pancreatic cancer research and treatment? 2012pharmaceutical 2013/10/21
Published
Pancreatic Cancer: Genetics, Genomics and Immunotherapy tildabarliya 2013/04/11
Published
Pancreatic cancer genomes: Axon guidance pathway genes – aberrations revealed 2012pharmaceutical 2012/10/24
Published
Biomarker tool development for Early Diagnosis of Pancreatic Cancer: Van Andel Institute and Emory University 2012pharmaceutical 2012/10/24
Published
Personalized Pancreatic Cancer Treatment Option 2012pharmaceutical 2012/10/16
Published
Battle of Steve Jobs and Ralph Steinman with Pancreatic cancer: How we lost ritusaxena 2012/05/21
Published
Early Biomarker for Pancreatic Cancer Identified pkandala 2012/05/17
Published
Usp9x: Promising therapeutic target for pancreatic cancer ritusaxena 2012/05/14
Published
War on Cancer Needs to Refocus to Stay Ahead of Disease Says Cancer Expert sjwilliamspa 2015/03/27
Published
Antibiotics that target mitochondria effectively eradicate cancer stem cells, across multiple tumor types: Treating cancer like an infectious disease 2012pharmaceutical 2015/02/15
Published
Pancreatic Islets larryhbern 2015/02/08
Publ
Vol 13, No 4 (2012): July – p. 330-469 Molecular Biology of Pancreatic Cancer: How Useful Is It in Clinical Practice? ABSTRACT  HTML  PDF
George H Sakorafas, Vasileios Smyrniotis
Vol 13, No 4 (2012): July – p. 330-469 Endoscopic Findings of Upper Gastrointestinal Lesions in Patients with Pancreatic Cancer ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Hiroyuki Watanabe, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Seiji Yano
Vol 13, No 5 (2012): September – p. 470-547 Two Avirulent, Lentogenic Strains of Newcastle Disease Virus Are Cytotoxic for Some Human Pancreatic Tumor Lines In Vitro ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Megan Delimata, Sooraj Tejaswi
Vol 14, No 3 (2013): May – p. 221-303 Duration of Diabetes and Pancreatic Cancer in a Case-Control Study in the Midwest and the Iowa Women’s Health Study (IWHS) Cohort ABSTRACT  HTML  PDF
Sarah A Henry, Anna E Prizment, Kristin E Anderson
Vol 16, No 1 (2015): January – p. 1-99 Endoscopic Management of Pain in Pancreatic Cancer ABSTRACT  HTML  PDF
Parit Mekaroonkamol, Field F Willingham, Saurabh Chawla
Vol 14, No 2 (2013): March – p. 109-220 Advancements in the Management of Pancreatic Cancer: 2013 ABSTRACT  HTML  PDF
Muhammad Wasif Saif
Vol 15, No 5 (2014): September – p. 413-540 New-onset Diabetes: A Clue to the Early Diagnosis of Pancreatic Cancer ABSTRACT  HTML  PDF
Suresh T Chari
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 2: Carcinogenesis Studies ABSTRACT  HTML  PDF
Fumiaki Nozawa, Mehmet Yalniz, Murat Saruc, Jens Standop, Hiroshi Egami, Parviz M Pour
Vol 14, No 5 (2013): September – p. 475-527 Synchronous Triple Cancers of the Pancreas, Stomach, and Cecum Treated with S-1 Followed by Pancrelipase Treatment of Pancreatic Exocrine Insufficiency ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Daisuke Ishikawa, Shigeki Nanjo, Shinji Takeuchi, Tadaaki Yamada, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Toshifumi Gabata, Osamu Matsui, Hiroko Ikeda, Yasushi Takamatsu, Sakae Iwakami, Seiji Yano
Vol 13, No 1 (2012): January – p. 1-123 Newcastle Disease Virus LaSota Strain Kills Human Pancreatic Cancer Cells in Vitro with High Selectivity ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Sooraj Tejaswi, Megan Delimata
Vol 13, No 3 (2012): May – p. 252-329 Rare Solid Tumors of the Pancreas as Differential Diagnosis of Pancreatic Adenocarcinoma ABSTRACT  HTML  PDF
Sabine Kersting, Monika S Janot, Johanna Munding, Dominique Suelberg, Andrea Tannapfel, Ansgar M Chromik, Waldemar Uhl, Uwe Bergmann
Vol 14, No 4 (2013): July – p. 304-474 A Proteomic Comparison of Formalin-Fixed Paraffin-Embedded Pancreatic Tissue from Autoimmune Pancreatitis, Chronic Pancreatitis, and Pancreatic Cancer ABSTRACT  HTML  PDF  SUPPL. TABLES 1-4 (PDF)
Joao A Paulo, Vivek Kadiyala, Scott Brizard, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 13, No 4 (2012): July – p. 330-469 Highlights on the First Line Treatment of Metastatic Pancreatic Cancer ABSTRACT  HTML  PDF
Krishna S Gunturu, Jamie Jarboe, Muhammad Wasif Saif
Vol 14, No 2 (2013): March – p. 109-220 Pancreatic Cancer: Updates on Translational Research and Future Applications ABSTRACT  HTML  PDF
Evangelos G Sarris, Konstantinos N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Pancreatic Cancer: What About Screening and Detection? ABSTRACT  HTML  PDF
Froso Konstantinou, Kostas N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Diabetes and Pancreatic Cancer ABSTRACT  HTML  PDF
Najla Hatem El-Jurdi, Muhammad Wasif Saif
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 1: Basic Studies ABSTRACT  HTML  PDF
Murat Saruc, Fumiaki Nozawa, Mehmet Yalniz, Atsushi Itami, Parviz M Pour
Vol 14, No 2 (2013): March – p. 109-220 Analysis of Endoscopic Pancreatic Function Test (ePFT)-Collected Pancreatic Fluid Proteins Precipitated Via Ultracentrifugation ABSTRACT  HTML  PDF  SUPPL.(XLS)  SUPPL.(PDF)
Joao A Paulo, Vivek Kadiyala, Aleksandr Gaun, John F K Sauld, Ali Ghoulidi, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 16, No 1 (2015): January – p. 1-99 Regulation Mechanisms of the Hedgehog Pathway in Pancreatic Cancer: A Review ABSTRACT  HTML  PDF
Kim Christin Honselmann, Moritz Pross, Carlo Maria Felix Jung, Ulrich Friedrich Wellner, Steffen Deichmann, Tobias Keck, Dirk Bausch
Vol 14, No 5S (2013): September (Suppl.) – p. 528-602 History of Previous Cancer in Patients Undergoing Resection for Pancreatic Adenocarcinoma ABSTRACT  PDF
Francesca Gavazzi, Maria Rachele Angiolini, Cristina Ridolfi, Maria Carla Tinti, Marco Madonini, Marco Montorsi, Alessandro Zerbi
Vol 13, No 4 (2012): July – p. 330-469 Molecular Biology of Pancreatic Cancer: How Useful Is It in Clinical Practice? ABSTRACT  HTML  PDF
George H Sakorafas, Vasileios Smyrniotis
Vol 13, No 4 (2012): July – p. 330-469 Endoscopic Findings of Upper Gastrointestinal Lesions in Patients with Pancreatic Cancer ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Hiroyuki Watanabe, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Seiji Yano
Vol 13, No 5 (2012): September – p. 470-547 Two Avirulent, Lentogenic Strains of Newcastle Disease Virus Are Cytotoxic for Some Human Pancreatic Tumor Lines In Vitro ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Megan Delimata, Sooraj Tejaswi
Vol 14, No 3 (2013): May – p. 221-303 Duration of Diabetes and Pancreatic Cancer in a Case-Control Study in the Midwest and the Iowa Women’s Health Study (IWHS) Cohort ABSTRACT  HTML  PDF
Sarah A Henry, Anna E Prizment, Kristin E Anderson
Vol 16, No 1 (2015): January – p. 1-99 Endoscopic Management of Pain in Pancreatic Cancer ABSTRACT  HTML  PDF
Parit Mekaroonkamol, Field F Willingham, Saurabh Chawla
Vol 14, No 2 (2013): March – p. 109-220 Advancements in the Management of Pancreatic Cancer: 2013 ABSTRACT  HTML  PDF
Muhammad Wasif Saif
Vol 15, No 5 (2014): September – p. 413-540 New-onset Diabetes: A Clue to the Early Diagnosis of Pancreatic Cancer ABSTRACT  HTML  PDF
Suresh T Chari
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 2: Carcinogenesis Studies ABSTRACT  HTML  PDF
Fumiaki Nozawa, Mehmet Yalniz, Murat Saruc, Jens Standop, Hiroshi Egami, Parviz M Pour
Vol 14, No 5 (2013): September – p. 475-527 Synchronous Triple Cancers of the Pancreas, Stomach, and Cecum Treated with S-1 Followed by Pancrelipase Treatment of Pancreatic Exocrine Insufficiency ABSTRACT  HTML  PDF
Koushiro Ohtsubo, Daisuke Ishikawa, Shigeki Nanjo, Shinji Takeuchi, Tadaaki Yamada, Hisatsugu Mouri, Kaname Yamashita, Kazuo Yasumoto, Toshifumi Gabata, Osamu Matsui, Hiroko Ikeda, Yasushi Takamatsu, Sakae Iwakami, Seiji Yano
Vol 13, No 1 (2012): January – p. 1-123 Newcastle Disease Virus LaSota Strain Kills Human Pancreatic Cancer Cells in Vitro with High Selectivity ABSTRACT  HTML  PDF
Robert J Walter, Bashar M Attar, Asad Rafiq, Sooraj Tejaswi, Megan Delimata
Vol 13, No 3 (2012): May – p. 252-329 Rare Solid Tumors of the Pancreas as Differential Diagnosis of Pancreatic Adenocarcinoma ABSTRACT  HTML  PDF
Sabine Kersting, Monika S Janot, Johanna Munding, Dominique Suelberg, Andrea Tannapfel, Ansgar M Chromik, Waldemar Uhl, Uwe Bergmann
Vol 14, No 4 (2013): July – p. 304-474 A Proteomic Comparison of Formalin-Fixed Paraffin-Embedded Pancreatic Tissue from Autoimmune Pancreatitis, Chronic Pancreatitis, and Pancreatic Cancer ABSTRACT  HTML  PDF  SUPPL. TABLES 1-4 (PDF)
Joao A Paulo, Vivek Kadiyala, Scott Brizard, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 13, No 4 (2012): July – p. 330-469 Highlights on the First Line Treatment of Metastatic Pancreatic Cancer ABSTRACT  HTML  PDF
Krishna S Gunturu, Jamie Jarboe, Muhammad Wasif Saif
Vol 14, No 2 (2013): March – p. 109-220 Pancreatic Cancer: Updates on Translational Research and Future Applications ABSTRACT  HTML  PDF
Evangelos G Sarris, Konstantinos N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Pancreatic Cancer: What About Screening and Detection? ABSTRACT  HTML  PDF
Froso Konstantinou, Kostas N Syrigos, Muhammad Wasif Saif
Vol 14, No 4 (2013): July – p. 304-474 Diabetes and Pancreatic Cancer ABSTRACT  HTML  PDF
Najla Hatem El-Jurdi, Muhammad Wasif Saif
Vol 13, No 5 (2012): September – p. 470-547 Effects of Porcine Pancreatic Enzymes on the Pancreas of Hamsters. Part 1: Basic Studies ABSTRACT  HTML  PDF
Murat Saruc, Fumiaki Nozawa, Mehmet Yalniz, Atsushi Itami, Parviz M Pour
Vol 14, No 2 (2013): March – p. 109-220 Analysis of Endoscopic Pancreatic Function Test (ePFT)-Collected Pancreatic Fluid Proteins Precipitated Via Ultracentrifugation ABSTRACT  HTML  PDF  SUPPL.(XLS)  SUPPL.(PDF)
Joao A Paulo, Vivek Kadiyala, Aleksandr Gaun, John F K Sauld, Ali Ghoulidi, Peter A Banks, Hanno Steen, Darwin L Conwell
Vol 16, No 1 (2015): January – p. 1-99 Regulation Mechanisms of the Hedgehog Pathway in Pancreatic Cancer: A Review ABSTRACT  HTML  PDF
Kim Christin Honselmann, Moritz Pross, Carlo Maria Felix Jung, Ulrich Friedrich Wellner, Steffen Deichmann, Tobias Keck, Dirk Bausch
Vol 14, No 5S (2013): September (Suppl.) – p. 528-602 History of Previous Cancer in Patients Undergoing Resection for Pancreatic Adenocarcinoma ABSTRACT  PDF
Francesca Gavazzi, Maria Rachele Angiolini, Cristina Ridolfi, Maria Carla Tinti, Marco Madonini, Marco Montorsi, Alessandro Zerbi

Read Full Post »

The Delicate Connection: IDO (Indolamine 2, 3 dehydrogenase) and Cancer Immunology

Posted in Advanced Drug Manufacturing Technology, Biomarkers & Medical Diagnostics, CANCER BIOLOGY & Innovations in Cancer Therapy, Cancer Prevention: Research & Programs, Cell Biology, Chemical Genetics, Components and IRB related issues, Disease Biology, Genome Biology, Methods, Molecular Genetics & Pharmaceutical, Personalized and Precision Medicine & Genomic Research, Regulated Clinical Trials: Design, Methods, Components and IRB related issues, Signaling & Cell Circuits, Small Molecules in Development of Therapeutic Drugs, Stem Cells for Regenerative Medicine, tagged , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on August 4, 2013| 1 Comment »

The Delicate Connection:  IDO (Indolamine 2, 3 dehydrogenase) and Cancer Immunology

Author and Curator: Demet Sag, PhD, CRA, GCP      

Table of Contents:

  1. Abstract
  2. Dual role for IDO
  3. Immune System and IDO
  4. Autoimmune disorders and IDO
  5. Cancer and Ido
  6. Clinical Interventions
  7. Clinical Trials
  8. Future Actions for Molecular Dx and Targeted Therapies:
  9. Conclusion
  10. References

TABLE 1- IDO Clinical Trials

TABLE 2- Kyn induced Genes

TABLE 3 Possible biomarkers and molecular diagnostics targets

TABLE 4: Current Interventions ______________________________________________________________________________________________________________

ABSTRACT:

Overall purpose is to find a method to manipulate IDO for clinical applications, mainly the focus of this review is is cancer prevention and treatment.  The first study proving the connection between IDO and immune response came from, a very natural event, a protection of pregnancy in human. This led to discover that high IDO expression is a common factor in cancer tumors. Thus, attention promoted investigations on IDO’s role in various disease states, immune disorders, transplantation, inflammation, women health, mood disorders.
Many approaches, vaccines and adjuvants are underway to find new immunotherapies by combining the power of DCs in immune response regulation and specific direction of siRNA.  As a result, with this unique qualities of IDO, DCs and siRNA, we orchestrated a novel intervention for immunomodulation of IDO by inhibiting with small interference RNA, called siRNA-IDO-DCvax.  Proven that our DCvax created a delay and regression of tumor growth without changing the natural structure and characterization of DCs in melanoma and breast cancers in vivo. (** The shRNA IDO- DCvax is developed by Regen BioPhrama, San Diego, CA ,  Thomas Ichim, Ph.D, CSO. and David Koos, CEO)

______________________________________________________________________________________________________________

Double-Edged Sword of IDO: The Good and The Bad for Clinical intervention and Developments

IDO almost has a dual role. There is a positive side of high expression of IDO during pregnancy (29; 28; 114), transplants (115; 116; 117; 118; 119), infectious diseases (96) and but this tolerance is negative during autoimmune-disorders (120; 121; 122), tumors of cancer (123; 124; 117; 121; 125; 126; 127) (127), and mood disorders (46). The increased IDO expression has a double-edged sword in human physiology provides a positive role during protection of fetus and grafts after transplantations but becomes a negative factor during autoimmune disorders, cancer, sepsis and mood disorders.

Prevention of allogeneic fetal rejection is possible by tryptophan metabolism (26) rejecting with lack of IDO but allocating if IDO present (29; 28; 114). These studies lead to find “the natural regulation mechanism” for protecting the transplants from graft versus host disease GVHD (128) and getting rid of tumors.

The plasticity of  mammary and uterus during reproduction may hold some more answers to prevent GVHD and tumors of cancer with good understanding of IDO and tryptophan mechanism (129; 130). After allogeneic bone marrow transplants the risk of solid tumor development increased about 80% among 19,229 patients even with a greater risk among patients under 18 years old (117).  The adaptation of tolerance against host mechanism is connected to the IDO expression (131). During implantation and early pregnancy IDO has a role by making CD4+CD25+Foxp3+ regulatory T cells (Tregs) and expressing in DCs and  MQs  (114; 132; 133).

Clonal deletion mechanism prevents mother to react with paternal products since female mice accepted the paternal MHC antigen-expressing tumor graft during pregnancy and rejected three weeks after delivery (134). CTLA-4Ig gene therapy alleviates abortion through regulation of apoptosis and inhibition of spleen lymphocytes (135).  

 Immune System and IDO DCs are the orchestrator of the immune response (56; 57; 58) with list of functions in uptake, processing, and presentation of antigens; activation of effector cells, such as T-cells and NK-cells; and secretion of cytokines and other immune-modulating molecules to direct the immune response. The differential regulation of IDO in distinct DC subsets is widely studied to delineate and correct immune homeostasis during autoimmunity, infection and cancer and the associated immunological outcomes. Genesis of antigen presenting cells (APCs), eventually the immune system, require migration of monocytes (MOs), which is originated in bone marrow. Then, these MOs move from bloodstream to other tissues to become macrophages and DCs (59; 60).

Initiation of immune response requires APCs to link resting helper T-cell with the matching antigen to protect body. DCs are superior to MQs and MOs in their immune action model. When DCs are first described (61) and classified, their role is determined as a highly potent antigen-presenting cell (APC) subset with 100 to 1000-times more effective than macrophages and B-cells in priming T-cells. Both MQs and monocytes phagocytize the pathogen, and their cell structure contains very large nucleus and many internal vesicles. However, there is a nuance between MQ and DCs, since DCs has a wider capacity of stimulation, because MQs activates only memory T cells, yet DCs can activate both naïve and memory T cells.

DCs are potent activators of T cells and they also have well controlled regulatory roles. DC properties determine the regulation regardless of their origin or the subset of the DCs. DCs reacts after identification of the signals or influencers for their inhibitory, stimulatory or regulatory roles, before they express a complex repertoire of positive and negative cytokines, transmembrane proteins and other molecules. Thus, “two signal theory” gains support with a defined rule.  The combination of two signals, their interaction with types of cells and time are critical.

In short, specificity and time are matter for a proper response. When IDO mRNA expression is activated with CTL40 ligand and IFNgamma, IDO results inhibition of T cell production (4).  However, if DCs are inhibited by 1MT, an inhibitor of IDO, the response stop but IgG has no affect (10).  In addition, if the stimulation is started by a tryptophan metabolite, which is downstream of IDO, such as 3-hydroxyantranilic or quinolinic acids, it only inhibits Th1 but not Th2 subset of T cells (62).

Furthermore, inclusion of signal molecules, such as Fas Ligand, cytochrome c, and pathways also differ in the T cell differentiation mechanisms due to combination, time and specificity of two-signals.  The co-culture experiments are great tool to identify specific stimuli in disease specific microenvironment (63; 12; 64) for discovering the mechanism and interactions between molecules in gene regulation, biochemical mechanism and physiological function during cell differentiation.

As a result, the simplest differential cell development from the early development of DCs impact the outcome of the data. For example, collection of MOs from peripheral blood mononuclear cells (PBMCs) with IL4 and GM-CSF leads to immature DCs (iDCs). On next step, treatment of iDCs with tumor necrosis factor (TNF) or other plausible cytokines (TGFb1, IFNgamma, IFNalpha,  IFNbeta, IL6 etc.) based on the desired outcome differentiate iDCs  into mature DCs (mDCs). DCs live only up to a week but MOs and generated MQs can live up to a month in the given tissue. B cells inhibit T cell dependent immune responses in tumors (65).

AutoImmune Disorders:

The Circadian Clock Circuitry and the AHR

The balance of IDO expression becomes necessary to prevent overactive immune response self-destruction, so modulation in tryptophan and NDA metabolisms maybe essential.  When splenic IDO-expressing CD11b (+) DCs from tolerized animals applied, they suppressed the development of arthritis, increased the Treg/Th17 cell ratio, and decreased the production of inflammatory cytokines in the spleen (136).

The role of Nicotinamide prevention on type 1 diabetes and ameliorates multiple sclerosis in animal model presented with activities of  NDAs stimulating GPCR109a to produce prostaglandins to induce IDO expression, then these PGEs and PGDs converted to the anti-inflammatory prostaglandin, 15d-PGJ(2) (137; 138; 139).  Thus, these events promotes endogenous signaling mechanisms involving the GPCRs EP2, EP4, and DP1 along with PPARgamma. (137).

Modulating the immune response at non-canonical at canonocal pathway while keeping the non-canonical Nf-KB intact may help to mend immune disorders. As a result, the targeted blocking in canonical at associated kinase IKKβ and leaving non-canonocal Nf-kB pathway intact, DCs tips the balance towards immune supression. Hence, noncanonical NF-κB pathway for regulatory functions in DCs required effective IDO induction, directly or indirectly by endogenous ligand Kyn and negative regulation of proinflammatory cytokine production. As a result, this may help to treat autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, inflammatory bowel disease, and multiple sclerosis, or allergy or transplant rejection.

While the opposite action needs to be taken during prevention of tumors, that is inhibition of non-canonical pathway.  Inflammation induces not only relaxation of veins and lowering blood pressure but also stimulate coagulopathies that worsen the microenvironment and decrease survival rate of patients after radio or chemotherapies.Cancer Generating tumor vaccines and using adjuvants underway (140).

Clinical correlation and genetic responses also compared in several studies to diagnose and target the system for cancer therapies (127; 141; 131).  The recent surveys on IDO expression and human cancers showed that IDO targeting is a candidate for cancer therapy since IDO expression recruiting Tregs, downregulates MHC class I and creating negative immune microenvironment for protection of development of tumors (125; 27; 142).  Inhibition of IDO expression can make advances in immunotherapy and chemotherapy fields (143; 125; 131; 144).

IDO has a great importance on prevention of cancer development (126). There are many approaches to create the homeostasis of immune response by Immunotherapy.  However, given the complexity of immune regulations, immunomodulation is a better approach to correct and relieve the system from the disease.  Some of the current IDO targeted immunotherapy or immmunomodulations with RNA technology for cancer prevention (145; 146; 147; 148; 149; 150) or applied on human or animals  (75; 151; 12; 115; 152; 9; 125) or chemical, (153; 154) or  radiological (155).  The targeted cell type in immune system generally DCs, monocytes (94)T cells (110; 156)and neutrophils (146; 157). On this paper, we will concentrate on DCvax on cancer treatments.

T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

IDO and the downstream enzymes in tryptophan pathway produce a series of immunosuppressive tryptophan metabolites that may lead into Tregs proliferation or increase in T cell apoptosis (62; 16; 27; 158), and some can affect NK cell function (159).

The interesting part of the mechanism is even without presence of IDO itself, downstream enzymes of IDO in the kynurenine tryptophan degradation still show immunosuppressive outcome (160; 73) due to not only Kyn but also TGFbeta stimulated long term responses. DC vaccination with IDO plausible (161) due to its power in immune response changes and longevity in the bloodstream for reversing the system for Th17 production (162).

Clinical Interventions are taking advantage of the DC’s central role and combining with enhancing molecules for induction of immunity may overcome tolerogenic DCs in tumors of cancers (163; 164).

The first successful application of DC vaccine used against advanced melanoma after loading DCs with tumor peptides or autologous cell lysate in presence of adjuvants keyhole limpet hematocyanin (KLH) (165).  Previous animal and clinical studies show use of DCs against tumors created success (165; 166; 167) as well as some problems due to heterogeneity of DC populations in one study supporting tumor growth rather than diminishing (168).

DC vaccination applied onto over four thousand clinical trial but none of them used siRNA-IDO DC vaccination method. Clinical trials evaluating DCs loaded ex vivo with purified TAAs as an anticancer immunotherapeutic interventions also did not include IDO (Table from (169). This table presented the data from 30 clinical trials, 3 of which discontinued, evaluating DCs loaded ex vivo with TAAs as an anticancer immunotherapy for 12 types of cancer [(AML(1), Breast cancer (4), glioblastoma (1), glioma (2), hepatocellular carcinoma (1), hematological malignancies (1), melanoma (6), neuroblastoma sarcoma (2), NSCLC (1), ovarian cancer (3), pancreatic cancer (3), prostate cancer (10)] at phase I, II or I/II.

Tipping the balance between Treg and Th17 ratio has a therapeutic advantage for restoring the health that is also shown in ovarian cancer by DC vaccination with adjuvants (161).  This rebalancing of the immune system towards immunogenicity may restore Treg/Th17 ratio (162; 170) but it is complicated. The stimulation of IL10 and IL12 induce Treg produce less Th17 and inhibiting CTL activation and its function (76; 171; 172) while animals treated with anti-TGFb before vaccination increase the plasma levels of IL-15 for tumor specific T cell survival in vivo (173; 174) ovarian cancer studies after human papilloma virus infection present an increase of IL12 (175).

Opposing signal mechanism downregulates the TGFb to activate CTL and Th1 population with IL12 and IL15 expression (162; 173).  The effects of IL17 on antitumor properties observed by unique subset of CD4+ T cells (176) called also CD8+ T cells secrete even more IL17 (177).

Using cytokines as adjuvants during vaccination may improve the efficacy of vaccination since cancer vaccines unlike infections vaccines applied after the infection or disease started against the established adoptive immune response.  Adjuvants are used to improve the responses of the given therapies commonly in immunotherapy applications as a combination therapy (178).

Enhancing cancer vaccine efficacy via modulation of the microenvironment is a plausible solution if only know who are the players.  Several molecules can be used to initiate and lengthen the activity of intervention to stimulate IDO expression without compromising the mechanism (179).  The system is complicated so generally induction is completed ex-vivo stimulation of DCs in cell lysates, whole tumor lysates, to create the microenvironment and natural stimulatory agents. Introduction of molecules as an adjuvants on genetic regulation on modulation of DCs are critical, because order and time of the signals, specific location/ tissue, and heterogeneity of personal needs (174; 138; 180). These studies demonstrated that IL15 with low TGFb stimulates CTL and Th1, whereas elevated TGFb with IL10 increases Th17 and Tregs in cancer microenvironments.

IDO and signaling gene regulation

For example Ret-peptide antitumor vaccine contains an extracellular fragment of Ret protein and Th1 polarized immunoregulator CpG oligonucleotide (1826), with 1MT, a potent inhibitor of IDO, brought a powerful as well as specific cellular and humoral immune responses in mice (152).

The main idea of choosing Ret to produce vaccine in ret related carcinomas fall in two criterion, first choosing patients self-antigens for cancer therapy with a non-mutated gene, second, there is no evidence of genetic mutations in Ret amino acids 64-269. Demonstration of proliferating hemangiomas, benign endothelial tumors and often referred as hemangiomas of infancy appearing at head or neck, express IDO and slowly regressed as a result of immune mediated process.

After large scale of genomic analysis show insulin like growth factor 2 as the key regulator of hematoma growth (Ritter et al. 2003). We set out to develop new technology with our previous expertise in immunotherapy and immunomodulation (181; 182; 183; 184), correcting Th17/Th1 ratio (185), and siRNA technology (186; 187).  We developed siRNA-IDO-DCvax. Patented two technologies “Immunomodulation using Altered DCs (Patent No: US2006/0165665 A1) and Method of Cancer Treatments using siRNA Silencing (Patent No: US2009/0220582 A1).

In melanoma cancer DCs were preconditioned with whole tumor lysate but in breast cancer model pretreatment completed with tumor cell lysate before siRNA-IDO-DCvax applied. Both of these studies was a success without modifying the autanticity of DCs but decreasing the IDO expression to restore immunegenity by delaying tumor growth in breast cancer (147) and in melanoma (188).  Thus, our DCvax specifically interfere with Ido without disturbing natural structure and content of the DCs in vivo showed that it is possible to carry on this technology to clinical applications.

Furthermore, our method of intervention is more sophisticated since it has a direct interaction mechanism with ex-vivo DC modulation without creating long term metabolism imbalance in Trp/Kyn metabolite mechanisms since the action is corrective and non-invasive.

There were several reasons.

First, prevention of tumor development studies targeting non-enzymatic pathway initiated by pDCs conditioned with TGFbeta is specific to IDO1 (189).

Second, IDO upregulation in antigen presenting cells allowing metastasis show that most human tumors express IDO at high levels (123; 124).

Third, tolerogenic DCs secretes several molecules some of them are transforming growth factor beta (TGFb), interleukin IL10), human leukocyte antigen G (HLA-G), and leukemia inhibitory factor (LIF), and non-secreted program cell death ligand 1 (PD-1 L) and IDO, indolamine 2.3-dioxygenase, which promote tumor tolerance. Thus, we took advantage of DCs properties and Ido specificity to prevent the tolerogenicity with siRNA-IDO DC vaccine in both melanoma and breast cancer.

Fourth, IDO expression in DCs make them even more potent against tumor antigens and create more T cells against tumors. IDOs are expressed at different levels by both in broad range of tumor cells and many subtypes of DCs including monocyte-derived DCs (10), plasmacytoid DCs (142), CD8a+ DCs (190), IDO compotent DCs (17), IFNgamma-activated DCs used in DC vaccination.  These DCs suppress immune responses through several mechanisms for induction of apoptosis towards activated T cells (156) to mediate antigen-specific T cell anergy in vivo (142) and for enhancement of Treg cells production at sites of vaccination with IDO-positive DCs+ in human patients (142; 191; 192; 168; 193; 194). If DCs are preconditioned with tumor lysate with 1MT vaccination they increase DCvax effectiveness unlike DCs originated from “normal”, healthy lysate with 1MT in pancreatic cancer (195).  As a result, we concluded that the immunesupressive effect of IDO can be reversed by siRNA because Treg cells enhances DC vaccine-mediated anti-tumor-immunity in cancer patients.

Gene silencing is a promising technology regardless of advantages simplicity for finding gene interaction mechanisms in vitro and disadvantages of the technology is utilizing the system with specificity in vivo (186; 196).  siRNA technology is one of the newest solution for the treatment of diseases as human genomics is only producing about 25,000 genes by representing 1% of its genome. Thus, utilizing the RNA open the doors for more comprehensive and less invasive effects on interventions. Thus this technology is still improving and using adjuvants. Silencing of K-Ras inhibit the growth of tumors in human pancreatic cancers (197), silencing of beta-catenin in colon cancers causes tumor regression in mouse models (198), silencing of vascular endothelial growth factor (VGEF) decreased angiogenesis and inhibit tumor growth (199).

Combining siRNA IDO and DCvax from adult stem cell is a novel technology for regression of tumors in melanoma and breast cancers in vivo. Our data showed that IDO-siRNA reduced tumor derived T cell apoptosis and tumor derived inhibition of T cell proliferation.  In addition, silencing IDO made DCs more potent against tumors since treated or pretreated animals showed a delay or decreased the tumor growth (188; 147)

 

Clinical Trials:

First FDA approved DC-based cancer therapies for treatment of hormone-refractory prostate cancer as autologous cellular immunotherapy (163; 164).  However, there are many probabilities to iron out for a predictive outcome in patients.

Table 2 demonstrates the current summary of clinical trials report.  This table shows 38 total studies specifically Ido related function on cancer (16), eye (3), surgery (2), women health (4), obesity (1), Cardiovascular (2), brain (1), kidney (1), bladder (1), sepsis shock (1), transplant (1),  nervous system and behavioral studies (4), HIV (1) (Table 4).  Among these only 22 of which active, recruiting or not yet started to recruit, and 17 completed and one terminated.

Most of these studies concentrated on cancer by the industry, Teva GTC ( Phase I traumatic brain injury) Astra Zeneca (Phase IV on efficacy of CRESTOR 5mg for cardiovascular health concern), Incyte corporation (Phase II ovarian cancer) NewLink Genetics Corporation Phase I breast/lung/melanoma/pancreatic solid tumors that is terminated; Phase II malignant melanoma recruiting, Phase II active, not recruiting metastatic breast cancer, Phase I/II metastatic melanoma, Phase I advanced malignancies) , HIV (Phase IV enrolling by invitation supported by Salix Corp-UC, San Francisco and HIV/AIDS Research Programs).

Many studies based on chemotherapy but there are few that use biological methods completed study with  IDO vaccine peptide vaccination for Stage III-IV non-small-cell lung cancer patients (NCT01219348), observational study on effect of biological therapy on biomarkers in patients with untreated hepatitis C, metastasis melanoma, or Crohn disease by IFNalpha and chemical (ribavirin, ticilimumab (NCT00897312), polymorphisms of patients after 1MT drug application in treating patients with metastatic or unmovable refractory solid tumors by surgery (NCT00758537), IDO expression analysis on MSCs (NCT01668576), and not yet recruiting intervention with adenovirus-p53 transduced dendric cell vaccine , 1MT , radiation, Carbon C 11 aplha-methyltryptophan- (NCT01302821).

Among the registered clinical trials some of them are not interventional but  observational and evaluation studies on Trp/Kyn ratio (NCT01042847), Kyn/Trp ratio (NCT01219348), Kyn levels (NCT00897312, NCT00573300),  RT-PCR analysis for Kyn metabolism (NCT00573300, NCT00684736, NCT00758537), and intrinsic IDO expression of mesenchymal stem cells in lung transplant with percent inhibition of CD4+ and CD8+ T cell proliferation toward donor cells (NCT01668576), determining polymorphisms (NCT00426894). These clinical trials/studies are immensely valuable to understand the mechanism and route of intervention development with the data collected from human populations   

Future Actions for Molecular Dx and Targeted Therapies:

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors. (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors. (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Current survival or response rate is around 40 to 50 % range.  By using specific cell type, selected inhibition/activation sequence based on patient’s genomic profile may improve the efficacy of clinical interventions on cancer treatments. Targeted therapies for specific gene regulation through signal transduction is necessary but there are few studies with genomics based approach.

On the other hand, there are surveys, observational or evaluations (listed in clinical trials section) registered with www.clinicaltrials.gov that will provide a valuable short-list of molecules.  Preventing stimulation of Ido1 as well as Tgfb-1gene expression by modulating receptor mediated phosphorylation between TGFb/SMAD either at Mad-Homology 1 (MH1) or Mad-Homology 1 (MH2) domains maybe possible (79; 82; 80). Within Smads are the conserved Mad-Homology 1 (MH1) domain, which is a DNA binding module contains tightly bound Zinc atom.

Smad MH2 domain is well conserved and one the most diverse protein-signal interacting molecule during signal transduction due to two important Serine residues located extreme distal C-termini at Ser-Val-Ser in Smad 2 or at pSer-X-PSer in RSmads (80). Kyn activated orphan G protein–coupled receptor, GPR35 with unknown function with a distinct expression pattern that collides with IDO sites since its expression at high levels of the immune system and the gut (63) (200; 63).  

The first study to connect IDO with cancer shows that group (75).  The directly targeting to regulate IDO expression is another method through modulating ISREs in its promoter with RNA-peptide combination technology. Indirectly, IDO can be regulated through Bin1 gene expression control over IDO since Bin1 is a negative regulator of IDO and prevents IDO expression.  IDO is under negative genetic control of Bin1, BAR adapter–encoding gene Bin1 (also known as Amphiphysin2). Bin1 functions in cancer suppression since attenuation of Bin1 observed in many human malignancies (141; 201; 202; 203; 204; 205; 206) .  Null Bin-/- mice showed that when there is lack of Bin1, upregulation of IDO through STAT1- and NF-kB-dependent expression of IDO makes tumor cells to escape from T cell–dependent antitumor immunity.

This pathway lies in non-enzymatic signal transducer function of IDO after stimulation of DCs by TGFb1.  The detail study on Bin1 gene by alternative spicing also provided that Bin1 is a tumor suppressor.  Its activities also depends on these spliced outcome, such as  Exon 10, in muscle, in turn Exon 13 in mice has importance in role for regulating growth when Bin1 is deleted or mutated C2C12 myoblasts interrupted due to its missing Myc, cyclinD1, or growth factor inhibiting genes like p21WAF1 (207; 208).

On the other hand alternative spliced Exon12A contributing brain cell differentiation (209; 210). Myc as a target at the junction between IDO gene interaction and Trp metabolism.  Bin1 interacts with Myc either early-dependent on Myc or late-independent on Myc, when Myc is not present. This gene regulation also interfered by the long term signaling mechanism related to Kynurenine (Kyn) acting as an endogenous ligand to AHR in Trp metabolite and TGFb1 and/or IFNalpha and IFNbeta up regulation of DCs to induce IDO in noncanonical pathway for NF-kB and myc gene activations (73; 74).  Hence, Trp/Kyn, Kyn/Trp, Th1/Th17 ratios are important to be observed in patients peripheral blood. These direct and indirect gene interactions place Bin1 to function in cell differentiation (211; 212; 205).

Regulatory T-cel generation via reverse and non-canonical signaliing to pDCs

Table 3 contains the microarray analysis for Kyn affect showed that there are 25 genes affected by Kyn, two of which are upregulated and 23 of them downregulated (100). This list of genes and additional knowledge based on studies creating the diagnostics panel with these genes as a biomarker may help to analyze the outcomes of given interventions and therapies. Some of these molecules are great candidate to seek as an adjuvant or co-stimulation agents.  These are myc, NfKB at IKKA, C2CD2, CREB3L2, GPR115, IL2, IL8, IL6, and IL1B, mir-376 RNA, NFKB3, TGFb, RelA, and SH3RF1. In addition, Lip, Fox3P, CTLA-4, Bin1, and IMPACT should be monitored.

In addition, Table 4 presents the other possible mechanisms. The highlights of possible target/biomarkers are specific TLRs, conserved sequences of IDO across its homologous structures, CCR6, CCR5, RORgammat, ISREs of IDO, Jak, STAT, IRFs, MH1 and MH2 domains of Smads. Endothelial cell coagulation activation mechanism and pDC maturation or immigration from lymph nodes to bloodstream should marry to control not only IDO expression but also genesis of preferred DC subsets. Stromal mesenchymal cells are also activated by these modulation at vascular system and interferes with metastasis of cancer. First, thrombin (human factor II) is a well regulated protein in coagulation hemostasis has a role in cell differentiation and angiogenesis.

Protein kinase activated receptors (PARs), type of GPCRs, moderate the actions. Second, during hematopoietic response endothelial cells produce hematopoietic growth factors (213; 214). Third, components of bone marrow stroma cells include monocytes, adipocytes, and mesenchymal stem cells (215). As a result, addressing this issue will prevent occurrence of coagulapathologies, namely DIC, bleeding, thrombosis, so that patients may also improve response rate towards therapies. Personal genomic profiles are powerful tool to improve efficacy in immunotherapies since there is an influence of age (young vs. adult), state of immune system (innate vs. adopted or acquired immunity). Table 5 includes some of the current studies directly with IDO and indirectly effecting its mechanisms via gene therapy, DNA vaccine, gene silencing and adjuvant applications as an intervention method to prevent various cancer types.

CONCLUSION

IDO has a confined function in immune system through complex interactions to maintain hemostasis of immune responses. The genesis of IDO stem from duplication of bacterial IDO-like genes.  Inhibition of microbial infection and invasion by depleting tryptophan limits and kills the invader but during starvation of trp the host may pass the twilight zone since trp required by host’s T cells.  Thus, the host cells in these small pockets adopt to new microenvironment with depleted trp and oxygen poor conditions. Hence, the cell metabolism differentiate to generate new cellular structure like nodules and tumors under the protection of constitutively expressed IDO in tumors, DCs and inhibited T cell proliferation.

On the other hand, having a dichotomy in IDO function can be a potential limiting factor that means is that IDOs impact on biological system could be variable based on several issues such as target cells, IDO’s capacity, pathologic state of the disease and conditions of the microenvironment. Thus, close monitoring is necessary to analyze the outcome to prevent conspiracies since previous studies generated paradoxical results.

Current therapies through chemotherapies, radiotherapies are costly and effectiveness shown that the clinical interventions require immunotherapies as well as coagulation and vascular biology manipulations for a higher efficacy and survival rate in cancer patients. Our siRNA and DC technologies based on stem cell modulation will provide at least prevention of cancer development and hopefully prevention in cancer.

11.       References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. Induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA.  Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (http://dx.doi.org:/10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197. 33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223, http://dx.doi.org:/10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp. http://dx.doi.org:/10.1038/nature10491.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878. 78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40.
http://dx.doi.org:/10.1016/S0092-8674(00)81696-7.  PMID 9865691.

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810.
http://dx.doi.org:/10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.   http://dx.doi.org:/10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132–     http://dx.doi.org:/10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271,  http://dx.doi.org:/10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31.

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. http://dx.doi.org:/10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606.  http://dx.doi.org:/10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11.  http://dx.doi.org:/10.1126/scisignal.2002963.

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii: S0006-291X(13)00779-1. http://dx.doi.org:/10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

114. What is the role of regulatory T cells in the success of implantation and early pregnancy? Saito, S., Shima, T., Nakashima, A., Shiozaki, A., Ito, M., Sasaki, Y. 2007, J Assist Reprod Genet, pp. 24: 379-386.

115. Sleeping Beauty-based gene therapy with indoleamine 2,3-dioxygenase inhibits lung allograft fibrosis. Liu H, Liu L, Fletcher BS, Visner GA. 2006, FASEB J, pp. 20:2384-2386.

116. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

117. Solid Cancers after Bone Marrow Transplantatioin. Curtis, R.E., Rowlings, P.A., Deeg, J., Schirer, D.A. et al. 1997, The New England Journal of Medicine., pp. 336, No: 13: 897-904.

118. More ADO about IDO; GVHD (commentary). Curti, A., Trabanelli, S., Lemoli, M. 2008, Blood, p. 2950.

119. Jasperson, et al, . 2008, Blood, p. 3257.

120. Tolerance, DCs and tryptophan: much ado about IDO. Grohmann U, Fallarino F, Puccetti P. 2003, Trends Immunol, pp. 24:242-248.

121. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med , pp. 9:1269–74.

122. Indoleamine 2,3-dioxygenase is a critical regulator of acute graft-versus-host disease lethality. Lisa K. Jasperson, Christoph Bucher, Angela Panoskaltsis-Mortari, Patricia A. Taylor, Andrew L. Mellor, David H. Munn, and Bruce R. Blazar. 2008., Blood., pp. 111:3257-3265.

123. The metabolism of tryptophan. 2. The metabolism of tryptophan in patients suffering from cancer of the bladder. . Boyland, E. & Willliams, D.C. 1956, Biochem. J., pp. 64, 578−582 .

124. Tryptophan metabolism in carcinoma of the breast. . Rose, D. 1967, Lancet , pp. 1, 239−241. 

125. Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees? . Löb S, Königsrainer A, Rammensee HG, Opelz G, Terness P. 2009;, Nat Rev Cancer , pp. 9:445–52.  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

126. The hallmarks of cancer. . Hanahan, D. & Weinberg, R.A. 2000., Cell., pp. 100, 57−70.

127. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Godin-Ethier, J., Hanafi,L.A., Piccirillo,C.A. and Lapointe, R. 2011, Clin Cancer Res, pp. 17; 6985,  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

128. Dendritic cell modification as a route to inhibiting corneal graft rejection by the indirect pathway of allorecognition. Khan A, Fu H, Tan LA, Harper JE, Beutelspacher SC, Larkin DF, Lombardi G, McClure MO, George AJ. 2013, Eur J Immunol., pp. 43(3):734-46. http://dx.doi.org:/10.1002/eji.201242914. Epub 2013 Jan 18.

129. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. . Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int., pp. 37(2):105-8.  http://dx.doi.org:/10.1002/cbin.10023. Epub 2013 Jan 2.

130. Implication of indolamine 2,3 dioxygenase in the tolerance toward fetuses, tumors, and allografts. . Dürr S, Kindler V. 2013, J Leukoc Biol. , pp. 93(5):681-7.
http://dx.doi.org:/10.1189/jlb.0712347. Epub 2013 Jan 16.

131. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med, pp. 9:1269–74.

132. NAturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Sagaguchi, S. 2004, Annu. Rev. of Immunol., pp. 22: 531-562.

133. Regulatory T cells in transplantation tolerance. Wood, K.J., zZSakaguchi, S.,. 2003, Nat. Rev. Immunol., pp. 3; 199-210.

134. The cell awareness of paternal alloantigens during pregnancy. Tafuri, A., Alferink, J., Hammerling, G.J., Arnold, B. 1995, Science, pp. 270; 630-3.

135. Adenovirus mediated CTLA4Ig transgene therapy alleviates abortion by inhibiting spleen lymphocyte proliferation and regulating apoptosis in the feto-placental unit. Li W, Li B, Li S. 2013, J Reprod Immunol. , pp. 97(2):167-74.

136. A distinct tolerogenic subset of splenic IDO(+)CD11b(+) dendritic cells from orally tolerized mice is responsible for induction of systemic immune tolerance and suppression of collagen-induced arthritis. Park MJ, Park KS, Park HS, Cho ML, Hwang SY, Min SY, Park MK, Park SH, Kim HY. 2012, Cell Immunol. , pp. 278(1-2):45-54. http://dx.doi.org:/10.1016/j.cellimm.2012.06.009. Epub 2012 Jul 10.

137. Pharmacological targeting of IDO-mediated tolerance for treating autoimmune disease. Penberthy, W.T. 2007, Curr. Drug Metab., pp. 8:(3):245-266.

138. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

139. Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. . Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS. 2001., NeuroReport. , pp. 12(9):1841–1845.

140. Tumor vaccines in 2010: need for integration. Koos, D., Josephs, SF, Alexandrescu, DT et al. 2010, Cell Immunol, pp. 263: 138-147.

141. BIN1 is a novel MYC-interacting protein with features of a tumor suppressor. . Sakamuro, D., Elliott, K., Wechsler-Reya, R. & Prendergast, G.C. 1996, Nat. Genet. , pp. 14, 69−77.

142. Expression of Indolamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor draining nodes. Munn, S.H., Sharma, M.D., Hou, D., Baban, B. et al. 2004, J. Clin. Invest. , pp. 114: 280-290.

143. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Jessica Godin-Ethier, Laïla-Aïcha Hanafi, Ciriaco A. Piccirillo, and Réjean Lapointe. 2011 , Clin Cancer Res, pp. 17; 6985, http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

144. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. . Munn, D.H. et al. 2002, Science 297, 1867−1870, pp. 297, 1867−1870 .

145. An HDAC inhibitor enhances cancer therapeutic efficiency of RNA polymerase III promoter-driven IDO shRNA. Yen MC, Weng TY, Chen YL, Lin CC, Chen CY, Wang CY, Chao HL, Chen CS, Lai MD. 2013, Cancer Gene Ther. , p. http://dx.doi.org:/10.1038/cgt.2013.27. [Epub ahead of print].

146. Systemic delivery of Salmonella typhimurium transformed with IDO shRNA enhances intratumoral vector colonization and suppresses tumor growth. Blache CA, Manuel ER, Kaltcheva TI, Wong AN, Ellenhorn JD, Blazar BR, Diamond DJ. 2012, Cancer Res. , pp. 72(24):6447-56.
http://dx.doi.org:/ZZ1158/0008-5472.CAN-12-0193. Epub 2012 Oct 22.

147. Silencing IDO in dendritic cells: a novel approach to enhance cancer immunotherapy in a murine breast cancer model. Zheng X, Koropatnick J, Chen D, Velenosi T, Ling H, Zhang X, Jiang N, Navarro B, Ichim TE, Urquhart B, Min W. 2013, Int J Cancer., pp.132(4):967-77. http://dx.doi.org:/10.1002/ijc.27710. Epub 2012 Jul 20.

148. Immunosuppressive CD14+HLA-DRlow/neg IDO+ myeloid cells in patients following allogeneic hematopoietic stem cell transplantation. Mougiakakos D, Jitschin R, von Bahr L, Poschke I, Gary R, Sundberg B, Gerbitz A, Ljungman P, Le Blanc K. 2013, Leukemia. , pp. 27(2):377-88.
http://dx.doi.org:/10.1038/leu.2012.215. Epub 2012 Jul 25.

149. Upregulated expression of indoleamine 2, 3-dioxygenase in primary breast cancer correlates with increase of infiltrated regulatory T cells in situ and lymph node metastasis. Yu J, Sun J, Wang SE, Li H, Cao S, Cong Y, Liu J, Ren X. 2011, Clin Dev Immunol. , p. 11:469135.
http://dx.doi.org:/10.1155/2011/469135. Epub 2011 Oct 24.

150. Skin delivery of short hairpin RNA of indoleamine 2,3 dioxygenase induces antitumor immunity against orthotopic and metastatic liver cancer. Huang TT, Yen MC, Lin CC, Weng TY, Chen YL, Lin CM, Lai MD. 2011, Cancer Sci. , pp. 102(12):2214-20. http://dx.doi.org:/10.1111/j.1349-7006.2011.02094.x.

151. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. . Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

152. Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan. Zeng, J., Cai, S., Yi, Y., et al. 2009, Cancer Res., pp. 69: 3963-3970,  http://dx.doi.org:/10.1158/0008-5472.CAN-08-2476.

153. Medicinal electronomics bricolage design of hypoxia-targeting antineoplastic drugs and invention of boron tracedrugs as innovative future-architectural drugs. Hori H, Uto Y, Nakata E. 2010, Anticancer Res. , pp. 30(9):3233-42.

154. Synthesis of 4-cyano and 4-nitrophenyl 1,6-dithio-D-manno-, L-ido- and D-glucoseptanosides possessing antithrombotic activity. Bozó E, Gáti T, Demeter A, Kuszmann J. 2002, Carbohydr Res. , pp. 3;337(15):1351-65.

155. Radiopharmaceuticals XXVII. 18F-labeled 2-deoxy-2-fluoro-d-glucose as a radiopharmaceutical for measuring regional myocardial glucose metabolism in vivo: tissue distribution and imaging studies in animals. Gallagher BM, Ansari A, Atkins H, Casella V, Christman DR, Fowler JS, Ido T, MacGregor RR, Som P, Wan CN, Wolf AP, Kuhl DE, Reivich M. 1977, J Nucl Med. , pp. 18(10):990-6.

156. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology, pp. 107:452–460.

157. Induction of indoleamine 2,3-dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial infection. Loughman JA, Hunstad DA. 2012 , J Infect Dis. , pp. 205(12):1830-9.  http://dx.doi.org:/10.1093/infdis/jis280.

158. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. . Terness, P., et al. 2002, J. Exp. Med.196:447–457., pp. 196:447–457.

159. The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46- and NKG2D-activating receptors and regulates NK-cell function. . Chiesa, M.D., et al. 2006, Blood. , pp. 108:4118–4125.38.

160. Differential effects of the tryptophan metabolite 3-hydroxyanthranilic acid on the proliferation of human CD8+ T cells induced by TCR triggering or homeostatic cytokines. Weber, W.P., et al. 2006, Eur. J. Immunol. , pp. 36:296-304.

161. Dendritic cell vaccination against ovarian cancer–tipping the Treg/TH17 balance to therapeutic advantage? Cannon MJ, Goyne H, Stone PJ, Chiriva-Internati M. 2011, Expert Opin Biol Ther. , pp. 11(4):441-5. http://dx.doi.org:/10.1517/14712598.2011.554812.

162. Phenotype, distribution, generation, and functional and clinical relevance of Th17 cells in the human tumor environments. . Kryczek I, Banerjee M, Cheng P, et al. 2009, Blood., pp. 114:1141–1149.

163. The use of dendritic cells in cancer immunitherapy. Schuler, G., Schuker-Turner, B., Steinman, RM, 2003, Curr. Opin. Immunol., pp. 15: 138-147.

164. Clinical applications of dentritic cell vaccines. Morse, MA, Lyerly, HK. 2000, Curr. Opin. Mol Ther., pp. 2:20-28.

165. Vaccination of melanoma patients with peptide or tumor lysate-pulsed dendritic cells. Nestle, FO, Alijagic, S., Gillet, M. et al. 1998, Nat. Med., pp. 4: 328-332.

166. Dentritic cell based tumor vaccination in prostate and renal cell cancer: a systamatic review. Draube, A., Klein-Gonzales, Matheus, S et al. 2011, Plos One, p. 6:e1881.

167. [Online] http://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapy-Products/ApprovedProducts/ucm210215.htm.

168. Dendritic cell based antitumor vaccination: impact of functional indolamine 2,3-dioxygenase expression. Wobster, m., Voigt, H., Houben, R. et al. 2007, Cancer Immunol Immunother, pp. 56:1017-1024. 169. [Online] oncoimmunology.2012 October1; 1(17):1111-1134,  http://dx.doi.org:/10.4161/onci.21494.

170. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. 2007 , Nat Immunol. , pp. 8(9):942-9.

171. IFNgamma promotes generationof Il-10 secreting CD4+ T cells that suppress generationof CD8responses in an antigen-experienced host. Liu, X.S., Leerberg, J., MacDonald, K., Leggatt, G.R., Frazer, I.H. 2009, J. Immunol., pp. 183: 51-58.

172. Antigen, in the presence of TGF-beta, induces up-regulationof FoxP3gfp+ in CD4+ TCR transgenic T cells that mediate linked supressionof CD8+ T cell responses. . Kapp, J.A., Honjo, K., Kapp, L.M., Goldsmith, K., Bucy, R.P. 2007, J. Immunol., pp. 179: 2105-2114.

173. Opposing effects of TGF-beta and IL-15 cytokines control the number of short lived effecctor CD8+ T cells. Sanjabi, S, Mosaheb, M.M., Flavell, R.A. 2009, Immunity., pp. 31; 131-144.

174. Synergestic enhancement of CD8+ T cell mediated tumor vaccines efficacy by an anti-tumor forming growth factor-beta monoclonal antibody. . Terabe, M., Ambrosino, E., Takaku, S. et al. 2009, Clin. Cancer Res., pp. 15; 6560-9.

175. IL-12 enhances CTL synapse formationand induces self-reactivity. Markinewicz, MA, Wise, EL, Buchwald, ZS et al. 2009, J. Immunol., pp. 182: 1351-1362.

176. Tumor specific Th17-polarized cells eradicate large established melanoma. Muranski, P., Boni, A., Antony, PA, et al. 2008, Blood, pp. 112; 362-373.

177. Type17 CD8+ T cells dispplay enhanced antitumor immunity. Hinrichs, C.S., Kaiser, A., Paulos, C.M., et al. 2008, Blood., pp. 112:362-373.

178. Marying Immunotherapy with Chemotherapy: Why Say IDO? Muller, AJ, and Prendergrast, GC. 2005, Cancer Research, pp. 65: 8065-8068.

179. Enhancing Cancer Vaccine efficacy via Modulationof the Tumor Environment. Disis, ML. 2009, Clin Cancer Res, pp. 15: 6476-6478.

180. Systemic inhibition of transforming growth factor beta 1 in glioma bearing mice improves the therapeutic efficacy of glioma-associated antigen peptide vaccines. Ueda, R., Fujita, M., Zhu, X., et al. 2009, Clin. Cancer res., pp. 15: 6551-9.

181. Immune modulation by silencing IL-12 productionin dendritic cells using smal interfering RNA. Hill, JA, Ichim, TE, Kusznieruk, KP, et al. 2003, J. Immunol, pp. 171:809-813.

182. Immune modulation and tolerance induction by RelB-silenced dentritic cells through RNA interference. Li, M. Zang, X, Zheng, X, et al. 2007, J. Immunol, pp. 178: 5480-7.

183. RNAi mediated CD40-CD54 interruption promotes tolerance in autoimmune arthritis. . Zheng, X., Suzuki, M., Zhang, X., et al. 2010, Arthritis Res. Ther., p. 12:R13.

184. Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival. Min, WP. Gorczynki, R., huang, XY et al. 2000, J. Immunol., pp. 164:161-167.

185. LF15-0195 generates tolerogenic dendritic cells by supressionof NF-kappaB signaling through inhibitionof IKK activity. . Yang, J., Bernier, SM, Ichim, TE, et al. 2003, J Leukoc. Biol., pp. 74: 438-447.

186. RNA interfrence: A potent tool for gene specific therapeutics. . Ichim, TE, Li, M., Qian, H., Popov, HI, Rycerz, K., Zheng, X., White, D., Zhong, R., and Min, WP. 2004, Am. J. Transplant, pp. 4:1227-1236.

187. A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Zheng, X., Vladau, C., Zhang, X. et al. 2009, Blood, pp. 113:2646-2654.

188. Reinstalling Antitumor Immunity by Inhibiting Tumor derived ImmunoSupressive Molecule IDO through RNA interference. Zheng, X et al. 2006, Int. Journal of Immunology., pp. 177:5639-5646.

189. Roles of TGFbeta in metastasis. Padua, D., Massague, J. 2009, Cell Res., pp. 19;89-102.

190. Functional expression of indolamine2,3-dioxygenase by murine CDalpha+dendritic cells. Fallarino, F., Vacca, C, Orabona, C et al. 2002, Int Immunol., pp. 14:65-8.

191. Indolamine2,3-dioxygenase controls conversion of Fox3+ Tregs to TH17-like cells in tumor draining lymph nodes. Sharma, MD, Hou, DY, Liu, Y et al. 2009, Blood, pp.113: 6102-11.

192. IDO upregulates regulatory T cells via tryptoophan catabolite and supresses encephalitogenic T cell responses in experimental autoimmune encephalomyelitis. Yan, Y, Zhang, GX, Gran, B et al. 2010, J Immunol, pp. 185; 5953-61.

193. IDO activates regulatory T cells and blocks their conversion into Th-17-like T cells. Baban, B, Chandler, PR, Sharma, MD et al. 2009, J Immunol, pp. 183; 2475-83.

194. Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletionof regulatory T cells. Dannull, J., Farrand, KJ, Mathews, SA, et al. 2005, J Clin Invest, pp. 115: 3623-33.

195. 1-MT enhances potency of tumor cell lysate pulled dentritic cells against pancreatic adenocarcinoma by downregulating percentage of Tregs. Li, Y, Xu, J, Zhou, H. et al. 2010, J Huazhong Univ Sci Technol Med Sci , pp. 30: 344-8.

196. siRNA mediated antitumorigenesis for drug target validation and therapeutics. Lu, PY, Xie, FY and Woodle, MC. 2003, Curr Opin Mol. Ther., pp. 5:225-234.

197. Stable supression of tumorigenicity by virus-mediated RNA interference. Brumellkamp, TR, Bernards, R, Agami, R. 2002, Cancer Cell, pp. 2; 243-247.

198. Small interferring RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells. Verma, UN, Surabhi, RM, Schmaltieg, A., Becerra, C., Gaynor, RB. 2003, Clin. Cancer. Res., pp. 9:1291-1300.

199. siRNA mediated inhibition of vascular endothelial growth factor severely limits tumor resistance to antiangiogeneic thromboposdin-1 and slows tumor vascularization and growth. Filleur, S., Courtin, A, Ait-Si-Ali, S., Guglielmi, J., Merel, C., Harel-Bellan, A., CLezardin, P., and Cabon, F. 2003, Cancer Res, pp. 63; 3919-3922.

200. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. . Wang, J., et al. 2006, J. Biol.Chem. , pp. 281:22021–22028. 201. Bin1 functionally interacts with Myc in cells and inhibits cell proliferation by multiple mechanisms. Elliott, K. et al. 1999, Oncogene , pp. 18, 3564−3573 .

202. Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. . Ge, K. et al. 1999, Proc. Natl. Acad. Sci. USA, pp. 96, 9689−9694. 

203. Losses of the tumor suppressor Bin1 in breast carcinoma are frequent and reflect deficits in a programmed cell death capacity. Ge, K. et al. 2000, Int. J. Cancer , pp. 85, 376−383.

204. Loss of heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Ge, K. et al. 2000, Int. J. Cancer , pp. 86, 155−161.

205. Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. . Tajiri, T. et al. 2003, Clin. Cancer Res., pp. 9, 3345−3355.

206. Targeted deletion of the suppressor gene Bin1/Amphiphysin2 enhances the malignant character of transformed cells. Muller, A.J., DuHadaway, J.B., Donover, P.S., Sutanto-Ward, E. & Prendergast, G.C. 2004, Cancer Biol. Ther. , p. 3.

207. Interactions of myogenic factors and the retinoblastoma protein mediates muscle commitment and cell differentiation. Gu, WJ., Scheniider,W., Condrolli,G., Kaushal,, S, Mahdavi,V., Nadal-Gnard, B. 1993, Cell, pp. 72; 309-324.

208. Structural analysis of the human BIN1 gene: evidence of tissue-specific transcriptional regualtion and alternate splicing. Wechsler-Reya, R, Sakamuro, J., Zhang, J., DuHadaway, J., and Predengast. 1998, J of Biol Chem.

209. A role for th ePutative Tuimor Supressor Bin1 in Muscle Differentiation. Wechsler-Reya, R., Elliott, KJ, Prendergast, GC. 1998, Molecular and Cellular Biology, p. 18 (1) :566.

210. The putative tumor repressor BIN1 is a short lived nuclear phosphoprotein whose localization is altered in malignant cells. Wechsler-Reya, R., Elliot, K., Herlyn, M., Prendergast, GC. 1997, Cancer Res, pp. 57: 3258-3263.

211. Transformation selective apoptosis by farnesyltransferase inhibitors requires Bin1. DuHadaway, J.B. et al. 2003, Oncogene, pp. 22, 3578−3588 (2003).

212. The c-Myc-interacting adapter protein Bin1 activates a caspase-independent cell death program. Elliott, K., Ge, K., Du, W. & Prendergast, G.C. 2000., Oncogene , pp. 19, 4669−4684.

213. Growth stimulation of human bone marrow cells in agar culture by vascular cells. Knudtzon, S., and Mortensen, BT. 1975, Blood, pp. 46 (6) 937-943.

214. Exogenous endothelial cells as accelerators of hematopoietic reconstitution. Mizer, C., Ichim, TE, Alexandrescu, DT, DAsanu, CA, Ramos, F., Turner, A., Woods, EJ, Bogon, V., Murphy, MP, Koos, D., and Patel, A. 2013, J. Translational Medicine, p. 10: 231.

215. Dissecting the bone marrow microenvironment . Torok-Storb, B. et al. 1999, Annals of New York Academy of Science, pp. 872: 164-170. 217. Yuasa, XX and Ball YY. 2011.

218. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int. , pp. 37(2):105-8. http://dx.doi.org:/10.1002/cbin.10023.

219. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

220. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

Read Full Post »

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Posted in Cardiac and Cardiovascular Surgical Procedures, Cell Biology, Signaling & Cell Circuits, Coagulation Therapy and Internal Bleeding, tagged , , , , , , , , , , , , , , , , , , , , , on July 20, 2013| 3 Comments »

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Demet Sağ, Kamran Baig*, Steven Hanish*, Jeffrey Lawson

 

 

 

Running Foot:

Use of bovine thrombin induces the cell proliferation at anastomosis

Department of Surgery

Duke University Medical Center

Durham, NC 27710

United States of America

* Equally worked

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Box 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu

demet.sag@gmail.com

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Abstract:

Specific Aim:  The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.

Methods and Results:  Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery.    Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting.  Expression of PAR  (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR.  All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin.  These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK.  Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.

Conclusion:  Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.

Abbreviations: ERK, extracellular regulated kinase; ES, embryonic stem cells; JIP, JNK-interacting protein; JNK, c-Jun NH2-terminal kinase; JNKK, JNK kinase; JNKBP, JNK binding protein; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MEK, MAPK/ERK kinase; MEKK, MEK kinase; MKK, MAPK kinase.

Keywords: Hemostatics, Signal transduction; Thrombin, PTGF

————————————————————————————————————

Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4].  It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI  during various surgical procedures.  Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6].  Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].

Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin.  It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9].  Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10].  Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.

Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs.  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].

Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself.  There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs)   [24-27].

Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33].  To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure.  We had tested the impact of topical bovine thrombin affect at the anastomosis.

Materials and Methods:

Surgical Procedure:  We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency.  Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine.  Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days.  In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used.   Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.

Ki67 Immunostaining:  The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks.  The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0).  The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum.  The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast.  As a result, positive tissues became brown and negatives were red.

MAPKs Immunostaining:  The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody.  The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.

Immunoblotting:  Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h.  Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS.  The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).

RNA isolation and RT-PCR: The harvested vessels were kept in RNAlater (Ambion, Austin, TX).   The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.

The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler.  The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse); PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT  3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).

CTGF and Cyr61:  The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers.  For CTGF the primers were  forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.

RESULTS:

First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin.   Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs.   We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment.    These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr  treatment with BT.  This data  the hypothesis for the function of PAR receptors in vascular tissues that  they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.

 

TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:

Next question was to make linear correlation between the expressions of PARs  to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues.   Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes.  Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared.  If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min.  Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli.  The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls.    Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.

Proliferation of the tissue depends on pERK

PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen.   Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured.   As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.

First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues).  We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins.  The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls.  This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.

The next target was JNK that plays a role in the inflammation, stress, and differentiation.    In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application.  This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients.   The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots.  Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.

Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues.  The expression of p38 was higher than JNK but much lower than ERK.  Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.

In general, all MAPKs showed increased in their phosphorylation level.  The level of activated MAPK expression was increased 200% in the tested animal.  The order of expression from high to low would be  ERK, JNK, and p38.

The genetic expression change

The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement.   Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection.  The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment.  Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.

DISCUSSION:

The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access  that leads to the cell proliferation and inflammation  through MAPKs  as well as  downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.

From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues.  We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding.  This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.

It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions.  In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent.   Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.

The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used.  The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle.  In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase.  During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.

Next, level of evidence was the signaling pathway analysis from membrane to the nucleus.  As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK,  pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel.  Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK).  The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation.  In our data we had detected the elvation of ERK more than the other MAPKs.   In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.

Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis.  The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.  

Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered  thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.

 

 

 

 

 

 

 

REFERENCES:

1.         Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.

2.         Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.

3.         TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.

4.         Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.

5.         Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.

6.         Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.

7.         Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.

8.         Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.

9.         Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.

10.       Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.

11.       Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.

12.       Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.

13.       Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.

14.       Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.

15.       Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.

16.       Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.

17.       Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.

18.       Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.

19.       Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.

20.       Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.

21.       Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.

22.       Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.

23.       Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.

24.       Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.

25.       Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.

26.       Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.

27.       Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.

28.       Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.

29.       Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.

30.       Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.

31.       Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.

32.       Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.

33.       McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.

34.       Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.

35.       Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.

36.       Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.

37.       Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.

38.       Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.

39.       Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.

40.       Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.

41.       Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.

Figure Legends:

Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR.        PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr

Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation

Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues

Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues

Figure 5: The activity of p38. (A) Immunostaining of total and activated p38.  Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues

Figure 6: The Expression of CTGF and Cyr61 after Thrombin Treatment. (A)CTGF            (B) Cyr61 expressions of treated and un-treated with TBT veins at 24h and 7 days.Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment

Related articles From Leaders in Pharmaceutical Intelligence Open Access Journal:

Read Full Post »

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Posted in Abdominal Aorta, Advanced Drug Manufacturing Technology, Alzheimer's Disease, Biological Networks, Biomarkers & Medical Diagnostics, Biomedical Measurement Science, CABG, Cell Biology, Disease Biology, Drug Delivery Platform Technology, Etiology, Frontiers in Cardiology and Cardiovascular Disorders, Health Economics and Outcomes Research, Human Immune System in Health and in Disease, Human Sensation and Cellular Transduction: Physiology and Therapeutics, tagged , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on July 20, 2013| 2 Comments »

aprotinin-sequence.Par.0001.Image.260

aprotinin-sequence.Par.0001.Image.260 (Photo credit: redondoself)

English: Protein folding: amino-acid sequence ...

Protein folding: amino-acid sequence of bovine BPTI (basic pancreatic trypsin inhibitor) in one-letter code, with its folded 3D structure represented by a stick model of the mainchain and sidechains (in gray), and the backbone and secondary structure by a ribbon colored blue to red from N- to C-terminus. 3D structure from PDB file 1BPI, visualized in Mage and rendered in Raster3D. (Photo credit: Wikipedia)

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Author: Demet Sag, PhD

 

 

 

 

 

 

 

 

 

 

 

 

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Demet Sag, PhD*†, Kamran Baig, MBBS, MRCS; James Jaggers, MD, Jeffrey H. Lawson, MD, PhD

Departments of Surgery and Pathology (J.H.L.) Duke University Medical Center Durham, NC  27710

Correspondence and Reprints:

                             Jeffrey H. Lawson, M.D., Ph.D.

                              Departments of Surgery & Pathology

                              DUMC Box 2622

                              Durham, NC  27710

                              (919) 681-6432 – voice

                              (919) 681-1094 – fax

                              lawso006@mc.duke.edu

*Current Address: Demet SAG, PhD

                          3830 Valley Centre Drive Suite 705-223, San Diego, CA 92130

Support:

Word Count: 4101 Journal Subject Heads:  CV surgery, endothelial cell activation,  Aprotinin, Protease activated receptors,

Potential Conflict of Interest:         None

Abstract

Introduction:  Cardiopulmonary bypass is associated with a systemic inflammatory response syndrome, which is responsible for excessive bleeding and multisystem dysfunction. Endothelial cell activation is a key pathophysiological process that underlies this response. Aprotinin, a serine protease inhibitor has been shown to be anti-inflammatory and also have significant hemostatic effects in patients undergoing CPB. We sought to investigate the effects of aprotinin at the endothelial cell level in terms of cytokine release (IL-6), tPA release, tissue factor expression, PAR1 + PAR2 expression and calcium mobilization. Methods:  Cultured Human Umbilical Vein Endothelial Cells (HUVECS) were stimulated with TNFa for 24 hours and treated with and without aprotinin (200KIU/ml + 1600KIU/ml). IL-6 and tPA production was measured using ELISA. Cellular expression of Tissue Factor, PAR1 and PAR2 was measured using flow cytometry. Intracellular calcium mobilization following stimulation with PAR specific peptides and agonists (trypsin, thrombin, Human Factor VIIa, factor Xa) was measured using fluorometry with Fluo-3AM. Results: Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNFa stimulated HUVECS (p=0.043). Aprotinin treatment of TNFa activated endothelial cells significantly reduce the amount of tPA released in a dose dependent manner (A200 p=0.0018, A1600 p=0.033). Aprotinin resulted in a significant downregulation of TF expression to baseline levels. At 24 hours, we found that aprotinin treatment of TNFa stimulated cells resulted in a significant downregulation of PAR-1 expression. Aprotinin significantly inhibited the effects of the protease thrombin upon PAR1 mediated calcium release. The effects of PAR2 stimulatory proteases such as human factor Xa, human factor VIIa and trypsin on calcium release was also inhibited by aprotinin. Conclusion:  We have shown that aprotinin has direct anti-inflammatory effects on endothelial cell activation and these effects may be mediated through inhibition of proteolytic activation of PAR1 and PAR2. Abstract word count: 297

INTRODUCTION   Each year it is estimated that 350,000 patients in the United States, and 650,000 worldwide undergo cardiopulmonary bypass (CPB). Despite advances in surgical techniques and perioperative management the morbidity and mortality of cardiac surgery related to the systemic inflammatory response syndrome(SIRS), especially in neonates is devastatingly significant. Cardiopulmonary bypass exerts an extreme challenge upon the haemostatic system as part of the systemic inflammatory syndrome predisposing to excessive bleeding as well as other multisystem dysfunction (1). Over the past decade major strides have been made in the understanding of the pathophysiology of the inflammatory response following CPB and the role of the vascular endothelium has emerged as critical in maintaining cardiovascular homeostasis (2).

CPB results in endothelial cell activation and initiation of coagulation via the Tissue Factor dependent pathway and consumption of important clotting factors. The major stimulus for thrombin generation during CPB has been shown to be through the tissue factor dependent pathway. As well as its effects on the fibrin and platelets thrombin has been found to play a role in a host of inflammatory responses in the vascular endothelium. The recent discovery of the Protease-Activated Receptors (PAR), one of which through which thrombin acts (PAR-1) has stimulated interest that they may provide a vital link between inflammation and coagulation (3).

Aprotinin is a nonspecific serine protease inhibitor that has been used for its ability to reduce blood loss and preserve platelet function during cardiac surgery procedures requiring cardiopulmonary bypass and thus the need for subsequent blood and blood product transfusions. However there have been concerns that aprotinin may be pro-thrombotic, especially in the context of coronary artery bypass grafting, which has limited its clinical use. These reservations are underlined by the fact that the mechanism of action of aprotinin has not been fully understood. Recently aprotinin has been shown to exert anti-thrombotic effects mediated by blocking the PAR-1 (4). Much less is known about its effects on endothelial cell activation, especially in terms of Tissue Factor but it has been proposed that aprotinin may also exert protective effects at the endothelial level via protease-activated receptors (PAR1 and PAR2). In this study we simulated in vitro the effects of endothelial cell activation during CPB by stimulating Human Umbilical Vein Endothelial Cells (HUVECs) with a proinflammatory cytokine released during CPB, Tumor Necrosis Factor (TNF-a) and characterize the effects of aprotinin treatment on TF expression, PAR1 and PAR2 expression, cytokine release IL-6 and tPA secretion.  In order to investigate the mechanism of action of aprotinin we studied its effects on PAR activation by various agonists and ligands.

These experiments provide insight into the effects of aprotinin on endothelial related coagulation mechanisms in terms of Tissue Factor expression and indicate it effects are mediated through Protease-Activated Receptors (PAR), which are seven membrane spanning proteins called G-protein coupled receptors (GPCR), that link coagulant and inflammatory pathways. Therefore, in this study we examine the effects of aprotinin on the human endothelial cell coagulation biology by different-dose aprotinin, 200 and 1600units.  The data demonstrates that aprotinin appears to directly alter endothelial expression of inflammatory cytokines, tPA and PAR receptor expression following treatment with TNF.  The direct mechanism of action is unknown but may act via local protease inhibition directly on endothelial cells.  It is hoped that with improved understanding of the mechanisms of action of aprotinin, especially an antithrombotic effect at the endothelial level the fears of prothrombotic tendency may be lessened and its use will become more routine.  

METHODS Human Umbilical Vein Endothelial Cells (HUVECS) used as our model to study the effects of endothelial cell activation on coagulant biology. In order to simulate the effects of cardiopulmonary bypass at the endothelial cell interface we stimulated the cells with the proinflammatory cytokine TNFa. In the study group the HUVECs were pretreated with low (200kIU/mL) and high (1600kIU/mL) dosages of aprotinin prior to stimulation with TNFa and complement activation fragments. The effects of TNFa stimulation upon endothelial Tissue Factor expression, PAR1 and PAR2 expression, and tPA and IL6 secretion were determined and compared between control and aprotinin treated cells. In order to delineate whether aprotinin blocks PAR activation via its protease inhibition properties we directly activated PAR1 and PAR2 using specific agonist ligands such thrombin (PAR1), trypsin, Factor VIIa, Factor Xa (PAR2) in the absence and presence of aprotinin.

Endothelial Cell Culture HUVECs were supplied from Clonetics. The cells were grown in EBM-2 containing 2MV bullet kit, including 5% FBS, 100-IU/ml penicillin, 0.1mg/mL streptomycin, 2mmol/L L-glutamine, 10 U/ml heparin, 30µg/mL EC growth supplement (ECGS). Before the stimulation cells were starved in 0.1%BSA depleted with FBS and growth factors for 24 hours. Cells were sedimented at 210g for 10 minutes at 4C and then resuspended in culture media. The HUVECs to be used will be between 3 and 5 passages.

Assay of IL-6 and tPA production Levels of IL-6 were measured with an ELISA based kit (RDI, MN) according to the manufacturers instructions. tPA was measured using a similar kit (American Diagnostica).

  Flow Cytometry The expression of transmembrane proteins PAR1, PAR2 and tissue factor were measured by single color assay as FITC labeling agent. Prepared suspension of cells disassociated trypsin free cell disassociation solution (Gibco) to be labeled. First well washed, and resuspended into “labeling buffer”, phosphate buffered saline (PBS) containing 0.5% BSA plus 0.1% NaN3, and 5% fetal bovine serum to block Fc and non-specific Ig binding sites. Followed by addition of 5mcl of antibody to approx. 1 million cells in 100µl labeling buffer and incubate at 4C for 1 hour. After washing the cells with 200µl with wash buffer, PBS + 0.1% BSA + 0.1% NaN3, the cells were pelletted at 1000rpm for 2 mins. Since the PAR1 and PAR2 were directly labeled with FITC these cells were fixed for later analysis by flow cytometry in 500µl PBS containing 1%BSA + 0.1% NaN3, then add equal volume of 4% formalin in PBS. For tissue factor raised in mouse as monoclonal primary antibody, the pellet resuspended and washed twice more as before, and incubated at 4C for 1 hour addition of 5µl donkey anti-mouse conjugated with FITC secondary antibody directly to the cell pellets at appropriate dilution in labeling buffer. After the final wash three times, the cell pellets were resuspended thoroughly in fixing solution. These fixed and labeled cells were then stored in the dark at 4C until there were analyzed. On analysis, scatter gating was used to avoid collecting data from debris and any dead cells. Logarithmic amplifiers for the fluorescence signal were used as this minimizes the effects of different sensitivities between machines for this type of data collection.  

Intracellular Calcium Measurement

Measured the intracellular calcium mobilization by Fluo-3AM. HUVECs were grown in calcium and phenol free EBM basal media containing 2MV bullet kit. Then the cell cultures were starved with the same media by 0.1% BSA without FBS for 24 hour with or without TNFa stimulation presence or absence of aprotinin (200 and 1600KIU/ml). Next the cells were loaded with Fluo-3AM 5µg/ml containing agonists, PAR1 specific peptide SFLLRN-PAR1 inhibitor, PAR2 specific peptide SLIGKV-PAR2 inhibitor, human alpha thrombin, trypsin, factor VIIa, factor Xa for an hour at 37C in the incubation chamber. Finally the media was replaced by Flou-3AM free media and incubated for another 30 minutes in the incubation chamber. The readings were taken at fluoromatic bioplate reader. For comparison purposes readings were taken before and during Fluo-3AM loading as well.  

RESULTS Aprotinin reduces IL-6 production from activated/stimulated HUVECS The effects of aprotinin analyzed on HUVEC for the anti-inflammatory effects of aprotinin at cultured HUVECS with high and low doses.  Figure 1 shows that TNF-a stimulated a considerable increase in IL-6 production, 370.95 ± 109.9 mg/mL.   If the drug is used alone the decrease of IL-6 at the low dose is 50% that is 183.95 ng/ml and with the high dose of 20% that is 338.92 from 370.95ng/ml being compared value.  TNFa-aprotinin results in reduction of the IL-6 expression from 370.95ng/ml to 58.6 (6.4fold) fro A200 and 75.85 (4.9 fold) ng/ml, for A1600.  After the treatment the cells reach to the below baseline limit of IL-6 expression. Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNF-a stimulated HUVECS (p=0.043).  Therefore, the aprotinin prevents inflammation as well as loss of blood.  

Aprotinin reduces tPA production from stimulated HUVECS Whether aprotinin exerted part of its fibrinolytic effects through inhibition of tPA mediated plasmin generation examined by the effects on TNFa stimulated HUVECS. Figure 2 also demonstrates that the amount of tPA released from HUVECS under resting, non-stimulated conditions incubated with aprotinin are significantly different. Figure 2 represents that the resting level of tPA released from non-stimulated cells significantly, by 100%, increase following TNF-a stimulation for 24 hours.  After application of aprotinin alone at two doses the tPA level goes down 25% of TNFa stimulated cells.  However, aprotinin treatment of TNF-a activated endothelial cells significantly lower the amount of tPA release in a dose dependent manner that is low dose decreased 25 but high dose causes 50% decrease of tPA expression (A200 p=0.0018, A1600 p=0.033) This finding suggests that aprotinin exerts a direct inhibitory effect on endothelial cell tPA production.

Aprotinin and receptor expression on activated HUVECS

TF is expressed when the cell in under stress such as TNFa treatments. The stimulated HUVECs with TNF-a tested for the expression of PAR1, PAR2, and tissue factor by single color flow cytometry through FITC labeled detection antibodies at 1, 3, and 24hs.

 

Tissue Factor expression is reduced:

Figure 3 demonstrates that there is a fluctuation of TF expression from 1 h to 24h that the TF decreases at first hour after aprotinin application 50% and 25%, A1600 and A200 respectively.  Then at 3 h the expression come back up 50% more than the baseline.  Finally, at 24h the expression of TF becomes almost as same as baseline.  Moreover, TNFa stimulated cells remains 45% higher than baseline after at 3h as well as at 24h.

PAR1 decreased:
Figure 4 demonstrates that aprotinin reduces the PAR1 expression 80% at 24h but there is no affect at 1 and 3 h intervals for both doses.

During the treatment with aprotinin only high dose at 1 hour time interval decreases the PAR1 expression on the cells. This data explains that ECCB is affected due to the expression of PAR1 is lowered by the high dose of aprotinin.

PAR2 is decreased by aprotinin:

  Figure 5 shows the high dose of aprotinin reduces the PAR2 expression close to 25% at 1h, 50% at 3h and none at 24h.  This pattern is exact opposite of PAR1 expression.  Figure 5 demonstrates the 50% decrease at 3h interval only.  Does that mean aprotinin affecting the inflammation first and then coagulation?

This suggests that aprotinin may affect the PAR2 expression at early and switched to PAR1 reduction later time intervals.  This fluctuation can be normal because aprotinin is not a specific inhibitor for proteases.  This approach make the aprotinin work better the control bleeding and preventing the inflammation causing cytokine such as IL-6.

Aprotinin inhibits Calcium fluxes induced by PAR1/2 specific agonists

  The specificity of aprotinin’s actions upon PAR studied the effects of the agent on calcium release following proteolytic and non-proteolytic stimulation of PAR1 and PAR2. Figure 6A (Figure 6) shows the stimulation of the cells with the PAR1 specific peptide (SFLLRN) results in release of calcium from the cells. Pretreatment of the cells with aprotinin has no significant effect on PAR1 peptide stimulated calcium release. This suggests that aprotinin has no effect upon the non-proteolytic direct activation of the PAR 1 receptor. Yet, Figure 6B (Figure 6) demonstrates human alpha thrombin does interact with the drug as a result the calcium release drops below base line after high dose (A1600) aprotinin used to zero but low dose does not show significant effect on calcium influx. Figure 7 demonstrates the direct PAR2 and indirect PAR2 stimulation by hFVIIa, hFXa, and trypsin of cells.  Similarly, at Figure 7A aprotinin has no effect upon PAR2 peptide stimulated calcium release, however, at figures 7B, C, and D shows that PAR2 stimulatory proteases Human Factor Xa, Human Factor VIIa and Trypsin decreases calcium release. These findings indicate that aprotinin’s mechanism of action is directed towards inhibiting proteolytic cleavage and hence subsequent activation of the PAR1 and PAR2 receptor complexes.  The binding site of the aprotinin on thrombin possibly is not the peptide sequence interacting with receptors.

Measurement of calcium concentration is essential to understand the mechanism of aprotinin on endothelial cell coagulation and inflammation because these mechanisms are tightly controlled by presence of calcium.  For example, activation of PAR receptors cause activation of G protein q subunit that leads to phosphoinositol to secrete calcium from endoplasmic reticulum into cytoplasm or activation of DAG to affect Phospho Lipase C (PLC). In turn, certain calcium concentration will start the serial formation of chain reaction for coagulation.  Therefore, treatment of the cells with specific factors, thrombin receptor activating peptides (TRAPs), human alpha thrombin, trypsin, human factor VIIa, and human factor Xa, would shed light into the effect of aprotinin on the formation of complexes for pro-coagulant activity.    DISCUSSION   There are two fold of outcomes to be overcome during cardiopulmonary bypass (CPB):  mechanical stress and the contact of blood with artificial surfaces results in the activation of pro- and anticoagulant systems as well as the immune response leading to inflammation and systemic organ failure.  This phenomenon causes the “postperfusion-syndrome”, with leukocytosis, increased capillary permeability, accumulation of interstitial fluid, and organ dysfunction.  CPB is also associated with a significant inflammatory reaction, which has been related to complement activation, and release of various inflammatory mediators and proteolytic enzymes. CPB induces an inflammatory state characterized by tumor necrosis factor-alpha release. Aprotinin, a low molecular-weight peptide inhibitor of trypsin, kallikrein and plasmin has been proposed to influence whole body inflammatory response inhibiting kallikrein formation, complement activation and neutrophil activation (5, 6). But shown that aprotinin has no significant influence on the inflammatory reaction to CPB in men.  Understanding the endothelial cell responses to injury is therefore central to appreciating the role that dysfunction plays in the preoperative, operative, and postoperative course of nearly all cardiovascular surgery patients.  Whether aprotinin increases the risk of thrombotic complications remains controversial.   The anti-inflammatory properties of aprotinin in attenuating the clinical manifestations of the systemic inflammatory response following cardiopulmonary bypass are well known(15) 16)  However its mechanisms and targets of action are not fully understood. In this study we have investigated the actions of aprotinin at the endothelial cell level. Our experiments showed that aprotinin reduced TNF-a induced IL-6 release from cultured HUVECS. Thrombin mediates its effects through PAR-1 receptor and we found that aprotinin reduced the expression of PAR-1 on the surface of HUVECS after 24 hours incubation. We then demonstrated that aprotinin inhibited endothelial cell PAR proteolytic activation by thrombin (PAR-1), trypsin, factor VII and factor X (PAR-2) in terms of less release of Ca preventing the activation of coagulation.  So aprotinin made cells produce less receptor, PAR1, PAR2, and TF as a result there would be less Ca++ release.    Our findings provide evidence for anti-inflammatory as well as anti-coagulant properties of aprotinin at the endothelial cell level, which may be mediated through its inhibitory effects on proteolytic activation of PARs.   IL6   Elevated levels of IL-6 have been shown to correlate with adverse outcomes following cardiac surgery in terms of cardiac dysfunction and impaired lung function(Hennein et al 1992). Cardiopulmonary bypass is associated with the release of the pro-inflammatory cytokines IL-6, IL-8 and TNF-a.  IL-6 is produced by T-cells, endothelial cells as a result monocytes and plasma levels of this cytokine tend to increase during CPB (21, 22). In some studies aprotinin has been shown to reduce levels of IL-6 post CPB(23) Hill(5). Others have failed to demonstrate an inhibitory effect of aprotinin upon pro-inflammatory cytokines following CPB(24) (25).  Our experiments showed that aprotinin significantly reduced the release of IL-6 from TNF-a stimulated endothelial cells, which may represent an important target of its anti-inflammatory properties. Its has been shown recently that activation of HUVEC by PAR-1 and PAR-2 agonists stimulates the production of IL-6(26). Hence it is possible that the effects of aprotinin in reducing IL-6 may be through targeting activation of such receptors.   TPA   Tissue Plasminogen activator is stored, ready made, in endothelial cells and it is released at its highest levels just after commencing CPB and again after protamine administration. The increased fibrinolytic activity associated with the release of tPA can be correlated to the excessive bleeding postoperatively. Thrombin is thought to be the major stimulus for release of t-PA from endothelial cells. Aprotinin’s haemostatic properties are due to direct inhibition of plasmin, thereby reducing fibrinolytic activity as well as inhibiting fibrin degradation.  Aprotinin has not been shown to have any significant effect upon t-PA levels in patients post CPB(27), which would suggest that aprotinin reduced fibrinolytic effects are not the result of inhibition of t-PA mediated plasmin generation. Our study, however demonstrates that aprotinin inhibits the release of t-PA from activated endothelial cells, which may represent a further haemostatic mechanism at the endothelial cell level.   TF   Resting endothelial cells do not normally express tissue factor on their cell surface. Inflammatory mediators released during CPB such as complement (C5a), lipopolysaccharide, IL-6, IL-1, TNF-a, mitogens, adhesion molecules and hypoxia may induce the expression of tissue factor on endothelial cells and monocytes. The expression of TF on activated endothelial cells activates the extrinsic pathway of coagulation, ultimately resulting in the generation of thrombin and fibrin. Aprotinin has been shown to reduce the expression of TF on monocytes in a simulated cardiopulmonary bypass circuit (28).

We found that treatment of activated endothelial cells with aprotinin significantly reduced the expression of TF after 24 hours. This would be expected to result in reduced thrombin generation and represent an additional possible anticoagulant effect of aprotinin. In a previous study from our laboratory we demonstrated that there were two peaks of inducible TF activity on endothelial cells, one immediately post CPB and the second at 24 hours (29). The latter peak is thought to be responsible for a shift from the initial fibrinolytic state into a procoagulant state.  In addition to its established early haemostatic and coagulant effect, aprotinin may also have a delayed anti-coagulant effect through its inhibition of TF mediated coagulation pathway. Hence its effects may counterbalance the haemostatic derangements, i.e. first bleeding then thrombosis caused by CPB. The anti-inflammatory effects of aprotinin may also be related to inhibition of TF and thrombin generation. PARs  

It has been suggested that aprotinin may target PAR on other cells types, especially endothelial cells. We investigated the role of PARs in endothelial cell activation and whether they can be the targets for aprotinin.  In recent study by Day group(30) demonstrated that endothelial cell activation by thrombin and downstream inflammatory responses can be inhibited by aprotinin in vitro through blockade of protease-activated receptor 1. Our results provide a new molecular basis to help explain the anti-inflammatory properties of aprotinin reported clinically.    The finding that PAR-2 can also be activated by the coagulation enzymes factor VII and factor X indicates that PAR may represent the link between inflammation and coagulation.  PAR-2 is believed to play an important role in inflammatory response. PAR-2 are widely expressed in the gastrointestinal tract, pancreas, kidney, liver, airway, prostrate, ovary, eye of endothelial, epithelial, smooth muscle cells, T-cells and neutrophils. Activation of PAR-2 in vivo has been shown to be involved in early inflammatory processes of leucocyte recruitment, rolling, and adherence, possibly through a mechanism involving platelet-activating factor (PAF)   We investigated the effects of TNFa stimulation on PAR-1 and PAR-2 expression on endothelial cells. Through functional analysis of PAR-1 and PAR-2 by measuring intracellular calcium influx we have demonstrated that aprotinin blocks proteolytic cleavage of PAR-1 by thrombin and activation of PAR-2 by the proteases trypsin, factor VII and factor X.  This confirms the previous findings on platelets of an endothelial anti-thrombotic effect through inhibition of proteolysis of PAR-1. In addition, part of aprotinin’s anti-inflammatory effects may be mediated by the inhibition of serine proteases that activate PAR-2. There have been conflicting reports regarding the regulation of PAR-1 expression by inflammatory mediators in cultured human endothelial cells. Poullis et al first showed that thrombin induced platelet aggregation was mediated by via the PAR-1(4) and demonstrated that aprotinin inhibited the serine protease thrombin and trypsin induced platelet aggregation. Aprotinin did not block PAR-1 activation by the non-proteolytic agonist peptide, SFLLRN indicating that the mechanism of action was directed towards inhibiting proteolytic cleavage of the receptor. Nysted et al showed that TNF did not affect mRNA and cell surface protein expression of PAR-1 (35), whereas Yan et al showed downregulation of PAR-1 mRNA levels (36). Once activated PAR1 and PAR2 are rapidly internalized and then transferred to lysosomes for degradation.

Endothelial cells contain large intracellular pools of preformed receptors that can replace the cleaved receptors over a period of approximately 2 hours, thus restoring the capacity of the cells to respond to thrombin. In this study we found that after 1-hour stimulation with TNF there was a significant upregulation in PAR-1 expression. However after 3 hours and 24 hours there was no significant change in PAR-1 expression suggesting that cleaved receptors had been internalized and replenished. Aprotinin was interestingly shown to downregulate PAR-1 expression on endothelial cells at 1 hour and increasingly more so after 24 hours TNF stimulation. These findings may suggest an effect of aprotinin on inhibiting intracellular cycling and synthesis of PAR-1.    

Conclusions   Our study has identified the anti-inflammatory and coagulant effects of aprotinin at the endothelial cell level. All together aprotinin affects the ECCB by reducing the t-PA, IL-6, PAR1, PAR 2, TF expressions. Our data correlates with the previous foundlings in production of tPA (7, (8) 9) 10), and  decreased IL-6 levels (11) during coronary artery bypass graft surgery (12-14). We have importantly demonstrated that aprotinin may target proteolytic activation of endothelial cell associated PAR-1 to exert a possible anti-inflammatory effect. This evidence should lessen the concerns of a possible prothrombotic effect and increased incidence of graft occlusion in coronary artery bypass patients treated with aprotinin. Aprotinin may also inhibit PAR-2 proteolytic activation, which may represent a key mechanism for attenuating the inflammatory response at the critical endothelial cell level. Although aprotinin has always been known as a non-specific protease inhibitor we would suggest that there is growing evidence for a PAR-ticular mechanism of action.  

REFERENCES

1.         Levy, J. H., and Tanaka, K. A. Inflammatory response to cardiopulmonary bypass. Ann Thorac Surg. 75: S715-720, 2003.

2.         Verrier, E. D., and Morgan, E. N. Endothelial response to cardiopulmonary bypass surgery. Ann Thorac Surg. 66: S17-19; discussion S25-18, 1998.

3.         Cirino, G., Napoli, C., Bucci, M., and Cicala, C. Inflammation-coagulation network: are serine protease receptors the knot? Trends Pharmacol Sci. 21: 170-172, 2000. 4.         Poullis, M., Manning, R., Laffan, M., Haskard, D. O., Taylor, K. M., and Landis, R. C. The antithrombotic effect of aprotinin: actions mediated via the proteaseactivated receptor 1. J Thorac Cardiovasc Surg. 120: 370-378, 2000.

5.         Hill, G. E., Alonso, A., Spurzem, J. R., Stammers, A. H., and Robbins, R. A. Aprotinin and methylprednisolone equally blunt cardiopulmonary bypass-induced inflammation in humans. J Thorac Cardiovasc Surg. 110: 1658-1662, 1995.

6.         Hill, G. E., Pohorecki, R., Alonso, A., Rennard, S. I., and Robbins, R. A. Aprotinin reduces interleukin-8 production and lung neutrophil accumulation after cardiopulmonary bypass. Anesth Analg. 83: 696-700, 1996. 7.         Lu, H., Du Buit, C., Soria, J., Touchot, B., Chollet, B., Commin, P. L., Conseiller, C., Echter, E., and Soria, C. Postoperative hemostasis and fibrinolysis in patients undergoing cardiopulmonary bypass with or without aprotinin therapy. Thromb Haemost. 72: 438-443, 1994.

8.         de Haan, J., and van Oeveren, W. Platelets and soluble fibrin promote plasminogen activation causing downregulation of platelet glycoprotein Ib/IX complexes: protection by aprotinin. Thromb Res. 92: 171-179, 1998.

9.         Erhardtsen, E., Bregengaard, C., Hedner, U., Diness, V., Halkjaer, E., and Petersen, L. C. The effect of recombinant aprotinin on t-PA-induced bleeding in rats. Blood Coagul Fibrinolysis. 5: 707-712, 1994.

10.       Orchard, M. A., Goodchild, C. S., Prentice, C. R., Davies, J. A., Benoit, S. E., Creighton-Kemsford, L. J., Gaffney, P. J., and Michelson, A. D. Aprotinin reduces cardiopulmonary bypass-induced blood loss and inhibits fibrinolysis without influencing platelets. Br J Haematol. 85: 533-541, 1993.

11.       Tassani, P., Augustin, N., Barankay, A., Braun, S. L., Zaccaria, F., and Richter, J. A. High-dose aprotinin modulates the balance between proinflammatory and anti-inflammatory responses during coronary artery bypass graft surgery. J Cardiothorac Vasc Anesth.14: 682-686, 2000.

12.       Asehnoune, K., Dehoux, M., Lecon-Malas, V., Toueg, M. L., Gonieaux, M. H., Omnes, L., Desmonts, J. M., Durand, G., and Philip, I. Differential effects of aprotinin and tranexamic acid on endotoxin desensitization of blood cells induced by circulation through an isolated extracorporeal circuit. J Cardiothorac Vasc Anesth. 16: 447-451, 2002.

13.       Dehoux, M. S., Hernot, S., Asehnoune, K., Boutten, A., Paquin, S., Lecon-Malas, V., Toueg, M. L., Desmonts, J. M., Durand, G., and Philip, I. Cardiopulmonary bypass decreases cytokine production in lipopolysaccharide-stimulated whole blood cells: roles of interleukin-10 and the extracorporeal circuit. Crit Care Med. 28: 1721-1727, 2000.

14.       Greilich, P. E., Brouse, C. F., Rinder, C. S., Smith, B. R., Sandoval, B. A., Rinder, H. M., Eberhart, R. C., and Jessen, M. E. Effects of epsilon-aminocaproic acid and aprotinin on leukocyte-platelet adhesion in patients undergoing cardiac surgery. Anesthesiology. 100: 225-233, 2004.

15.       Mojcik, C. F., and Levy, J. H. Aprotinin and the systemic inflammatory response after cardiopulmonary bypass. Ann Thorac Surg. 71: 745-754, 2001.

16.       Landis, R. C., Asimakopoulos, G., Poullis, M., Haskard, D. O., and Taylor, K. M. The antithrombotic and antiinflammatory mechanisms of action of aprotinin. Ann Thorac Surg. 72: 2169-2175, 2001.

17.       Asimakopoulos, G., Kohn, A., Stefanou, D. C., Haskard, D. O., Landis, R. C., and Taylor, K. M. Leukocyte integrin expression in patients undergoing cardiopulmonary bypass. Ann Thorac Surg. 69: 1192-1197, 2000.

18.       Landis, R. C., Asimakopoulos, G., Poullis, M., Thompson, R., Nourshargh, S., Haskard, D. O., and Taylor, K. M. Effect of aprotinin (trasylol) on the inflammatory and thrombotic complications of conventional cardiopulmonary bypass surgery. Heart Surg Forum. 4 Suppl 1: S35-39, 2001.

19.       Asimakopoulos, G., Thompson, R., Nourshargh, S., Lidington, E. A., Mason, J. C., Ratnatunga, C. P., Haskard, D. O., Taylor, K. M., and Landis, R. C. An anti-inflammatory property of aprotinin detected at the level of leukocyte extravasation. J Thorac Cardiovasc Surg. 120: 361-369, 2000.

20.       Asimakopoulos, G., Lidington, E. A., Mason, J., Haskard, D. O., Taylor, K. M., and Landis, R. C. Effect of aprotinin on endothelial cell activation. J Thorac Cardiovasc Surg. 122: 123-128, 2001.

21.       Butler, J., Chong, G. L., Baigrie, R. J., Pillai, R., Westaby, S., and Rocker, G. M. Cytokine responses to cardiopulmonary bypass with membrane and bubble oxygenation. Ann Thorac Surg. 53: 833-838, 1992.

22.       Hennein, H. A., Ebba, H., Rodriguez, J. L., Merrick, S. H., Keith, F. M., Bronstein, M. H., Leung, J. M., Mangano, D. T., Greenfield, L. J., and Rankin, J. S. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg. 108: 626-635, 1994.

23.       Diego, R. P., Mihalakakos, P. J., Hexum, T. D., and Hill, G. E. Methylprednisolone and full-dose aprotinin reduce reperfusion injury after cardiopulmonary bypass. J Cardiothorac Vasc Anesth. 11: 29-31, 1997.

24.       Ashraf, S., Tian, Y., Cowan, D., Nair, U., Chatrath, R., Saunders, N. R., Watterson, K. G., and Martin, P. G. “Low-dose” aprotinin modifies hemostasis but not proinflammatory cytokine release. Ann Thorac Surg. 63: 68-73, 1997.

25.       Schmartz, D., Tabardel, Y., Preiser, J. C., Barvais, L., d’Hollander, A., Duchateau, J., and Vincent, J. L. Does aprotinin influence the inflammatory response to cardiopulmonary bypass in patients? J Thorac Cardiovasc Surg. 125: 184-190, 2003.

26.       Chi, L., Li, Y., Stehno-Bittel, L., Gao, J., Morrison, D. C., Stechschulte, D. J., and Dileepan, K. N. Interleukin-6 production by endothelial cells via stimulation of protease-activated receptors is amplified by endotoxin and tumor necrosis factor-alpha. J Interferon Cytokine Res. 21: 231-240, 2001.

27.       Ray, M. J., and Marsh, N. A. Aprotinin reduces blood loss after cardiopulmonary bypass by direct inhibition of plasmin. Thromb Haemost. 78: 1021-1026, 1997.

28.       Khan, M. M., Gikakis, N., Miyamoto, S., Rao, A. K., Cooper, S. L., Edmunds, L. H., Jr., and Colman, R. W. Aprotinin inhibits thrombin formation and monocyte tissue factor in simulated cardiopulmonary bypass. Ann Thorac Surg. 68: 473-478, 1999.

29.       Jaggers, J. J., Neal, M. C., Smith, P. K., Ungerleider, R. M., and Lawson, J. H. Infant cardiopulmonary bypass: a procoagulant state. Ann Thorac Surg. 68: 513-520, 1999.

30.       Day, J. R., Taylor, K. M., Lidington, E. A., Mason, J. C., Haskard, D. O., Randi, A. M., and Landis, R. C. Aprotinin inhibits proinflammatory activation of endothelial cells by thrombin through the protease-activated receptor 1. J Thorac Cardiovasc Surg. 131: 21-27, 2006.

31.       Vergnolle, N. Proteinase-activated receptor-2-activating peptides induce leukocyte rolling, adhesion, and extravasation in vivo. J Immunol. 163: 5064-5069, 1999.

32.       Vergnolle, N., Hollenberg, M. D., Sharkey, K. A., and Wallace, J. L. Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2)-activating peptides in the rat paw. Br J Pharmacol. 127: 1083-1090, 1999.

33.       McLean, P. G., Aston, D., Sarkar, D., and Ahluwalia, A. Protease-activated receptor-2 activation causes EDHF-like coronary vasodilation: selective preservation in ischemia/reperfusion injury: involvement of lipoxygenase products, VR1 receptors, and C-fibers. Circ Res. 90: 465-472, 2002.

34.       Maree, A., and Fitzgerald, D. PAR2 is partout and now in the heart. Circ Res. 90: 366-368, 2002.

35.       Nystedt, S., Ramakrishnan, V., and Sundelin, J. The proteinase-activated receptor 2 is induced by inflammatory mediators in human endothelial cells. Comparison with the thrombin receptor. J Biol Chem. 271: 14910-14915, 1996.

36.       Yan, W., Tiruppathi, C., Lum, H., Qiao, R., and Malik, A. B. Protein kinase C beta regulates heterologous desensitization of thrombin receptor (PAR-1) in endothelial cells. Am J Physiol. 274: C387-395, 1998.

37.       Shinohara, T., Suzuki, K., Takada, K., Okada, M., and Ohsuzu, F. Regulation of proteinase-activated receptor 1 by inflammatory mediators in human vascular endothelial cells. Cytokine. 19: 66-75, 2002.

FIGURES

Figure 1: IL-6 production following TNF-a stimulation Figure 1

Figure 2:  tPA production following TNF-a stimulation Figure 2

Figure 3:  Tissue Factor Expression on TNF-a stimulated HUVECS Figure 3

Figure 4:  PAR-1 Expression on TNF-a stimulated HUVECS Figure 4

Figure 5:  PAR-2 Expression on TNF-a stimulated HUVECS Figure 5

Figure 6:  Calcium Fluxes following PAR1 Activation Figure 6

Figure 7:  Calcium Fluxes following PAR2 Activation Figure 7

 

Read Full Post »

%d bloggers like this: