
Posts Tagged ‘San Diego’

The Delicate Connection:  IDO (Indolamine 2, 3 dehydrogenase) and Cancer Immunology

Author and Curator: Demet Sag, PhD, CRA, GCP      

Table of Contents:

  1. Abstract
  2. Dual role for IDO
  3. Immune System and IDO
  4. Autoimmune disorders and IDO
  5. Cancer and Ido
  6. Clinical Interventions
  7. Clinical Trials
  8. Future Actions for Molecular Dx and Targeted Therapies:
  9. Conclusion
  10. References

TABLE 1- IDO Clinical Trials

TABLE 2- Kyn induced Genes

TABLE 3 Possible biomarkers and molecular diagnostics targets

TABLE 4: Current Interventions ______________________________________________________________________________________________________________


Overall purpose is to find a method to manipulate IDO for clinical applications, mainly the focus of this review is is cancer prevention and treatment.  The first study proving the connection between IDO and immune response came from, a very natural event, a protection of pregnancy in human. This led to discover that high IDO expression is a common factor in cancer tumors. Thus, attention promoted investigations on IDO’s role in various disease states, immune disorders, transplantation, inflammation, women health, mood disorders.
Many approaches, vaccines and adjuvants are underway to find new immunotherapies by combining the power of DCs in immune response regulation and specific direction of siRNA.  As a result, with this unique qualities of IDO, DCs and siRNA, we orchestrated a novel intervention for immunomodulation of IDO by inhibiting with small interference RNA, called siRNA-IDO-DCvax.  Proven that our DCvax created a delay and regression of tumor growth without changing the natural structure and characterization of DCs in melanoma and breast cancers in vivo. (** The shRNA IDO- DCvax is developed by Regen BioPhrama, San Diego, CA ,  Thomas Ichim, Ph.D, CSO. and David Koos, CEO)


Double-Edged Sword of IDO: The Good and The Bad for Clinical intervention and Developments

IDO almost has a dual role. There is a positive side of high expression of IDO during pregnancy (29; 28; 114), transplants (115; 116; 117; 118; 119), infectious diseases (96) and but this tolerance is negative during autoimmune-disorders (120; 121; 122), tumors of cancer (123; 124; 117; 121; 125; 126; 127) (127), and mood disorders (46). The increased IDO expression has a double-edged sword in human physiology provides a positive role during protection of fetus and grafts after transplantations but becomes a negative factor during autoimmune disorders, cancer, sepsis and mood disorders.

Prevention of allogeneic fetal rejection is possible by tryptophan metabolism (26) rejecting with lack of IDO but allocating if IDO present (29; 28; 114). These studies lead to find “the natural regulation mechanism” for protecting the transplants from graft versus host disease GVHD (128) and getting rid of tumors.

The plasticity of  mammary and uterus during reproduction may hold some more answers to prevent GVHD and tumors of cancer with good understanding of IDO and tryptophan mechanism (129; 130). After allogeneic bone marrow transplants the risk of solid tumor development increased about 80% among 19,229 patients even with a greater risk among patients under 18 years old (117).  The adaptation of tolerance against host mechanism is connected to the IDO expression (131). During implantation and early pregnancy IDO has a role by making CD4+CD25+Foxp3+ regulatory T cells (Tregs) and expressing in DCs and  MQs  (114; 132; 133).

Clonal deletion mechanism prevents mother to react with paternal products since female mice accepted the paternal MHC antigen-expressing tumor graft during pregnancy and rejected three weeks after delivery (134). CTLA-4Ig gene therapy alleviates abortion through regulation of apoptosis and inhibition of spleen lymphocytes (135).  

 Immune System and IDO DCs are the orchestrator of the immune response (56; 57; 58) with list of functions in uptake, processing, and presentation of antigens; activation of effector cells, such as T-cells and NK-cells; and secretion of cytokines and other immune-modulating molecules to direct the immune response. The differential regulation of IDO in distinct DC subsets is widely studied to delineate and correct immune homeostasis during autoimmunity, infection and cancer and the associated immunological outcomes. Genesis of antigen presenting cells (APCs), eventually the immune system, require migration of monocytes (MOs), which is originated in bone marrow. Then, these MOs move from bloodstream to other tissues to become macrophages and DCs (59; 60).

Initiation of immune response requires APCs to link resting helper T-cell with the matching antigen to protect body. DCs are superior to MQs and MOs in their immune action model. When DCs are first described (61) and classified, their role is determined as a highly potent antigen-presenting cell (APC) subset with 100 to 1000-times more effective than macrophages and B-cells in priming T-cells. Both MQs and monocytes phagocytize the pathogen, and their cell structure contains very large nucleus and many internal vesicles. However, there is a nuance between MQ and DCs, since DCs has a wider capacity of stimulation, because MQs activates only memory T cells, yet DCs can activate both naïve and memory T cells.

DCs are potent activators of T cells and they also have well controlled regulatory roles. DC properties determine the regulation regardless of their origin or the subset of the DCs. DCs reacts after identification of the signals or influencers for their inhibitory, stimulatory or regulatory roles, before they express a complex repertoire of positive and negative cytokines, transmembrane proteins and other molecules. Thus, “two signal theory” gains support with a defined rule.  The combination of two signals, their interaction with types of cells and time are critical.

In short, specificity and time are matter for a proper response. When IDO mRNA expression is activated with CTL40 ligand and IFNgamma, IDO results inhibition of T cell production (4).  However, if DCs are inhibited by 1MT, an inhibitor of IDO, the response stop but IgG has no affect (10).  In addition, if the stimulation is started by a tryptophan metabolite, which is downstream of IDO, such as 3-hydroxyantranilic or quinolinic acids, it only inhibits Th1 but not Th2 subset of T cells (62).

Furthermore, inclusion of signal molecules, such as Fas Ligand, cytochrome c, and pathways also differ in the T cell differentiation mechanisms due to combination, time and specificity of two-signals.  The co-culture experiments are great tool to identify specific stimuli in disease specific microenvironment (63; 12; 64) for discovering the mechanism and interactions between molecules in gene regulation, biochemical mechanism and physiological function during cell differentiation.

As a result, the simplest differential cell development from the early development of DCs impact the outcome of the data. For example, collection of MOs from peripheral blood mononuclear cells (PBMCs) with IL4 and GM-CSF leads to immature DCs (iDCs). On next step, treatment of iDCs with tumor necrosis factor (TNF) or other plausible cytokines (TGFb1, IFNgamma, IFNalpha,  IFNbeta, IL6 etc.) based on the desired outcome differentiate iDCs  into mature DCs (mDCs). DCs live only up to a week but MOs and generated MQs can live up to a month in the given tissue. B cells inhibit T cell dependent immune responses in tumors (65).

AutoImmune Disorders:

The Circadian Clock Circuitry and the AHR

The balance of IDO expression becomes necessary to prevent overactive immune response self-destruction, so modulation in tryptophan and NDA metabolisms maybe essential.  When splenic IDO-expressing CD11b (+) DCs from tolerized animals applied, they suppressed the development of arthritis, increased the Treg/Th17 cell ratio, and decreased the production of inflammatory cytokines in the spleen (136).

The role of Nicotinamide prevention on type 1 diabetes and ameliorates multiple sclerosis in animal model presented with activities of  NDAs stimulating GPCR109a to produce prostaglandins to induce IDO expression, then these PGEs and PGDs converted to the anti-inflammatory prostaglandin, 15d-PGJ(2) (137; 138; 139).  Thus, these events promotes endogenous signaling mechanisms involving the GPCRs EP2, EP4, and DP1 along with PPARgamma. (137).

Modulating the immune response at non-canonical at canonocal pathway while keeping the non-canonical Nf-KB intact may help to mend immune disorders. As a result, the targeted blocking in canonical at associated kinase IKKβ and leaving non-canonocal Nf-kB pathway intact, DCs tips the balance towards immune supression. Hence, noncanonical NF-κB pathway for regulatory functions in DCs required effective IDO induction, directly or indirectly by endogenous ligand Kyn and negative regulation of proinflammatory cytokine production. As a result, this may help to treat autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, inflammatory bowel disease, and multiple sclerosis, or allergy or transplant rejection.

While the opposite action needs to be taken during prevention of tumors, that is inhibition of non-canonical pathway.  Inflammation induces not only relaxation of veins and lowering blood pressure but also stimulate coagulopathies that worsen the microenvironment and decrease survival rate of patients after radio or chemotherapies.Cancer Generating tumor vaccines and using adjuvants underway (140).

Clinical correlation and genetic responses also compared in several studies to diagnose and target the system for cancer therapies (127; 141; 131).  The recent surveys on IDO expression and human cancers showed that IDO targeting is a candidate for cancer therapy since IDO expression recruiting Tregs, downregulates MHC class I and creating negative immune microenvironment for protection of development of tumors (125; 27; 142).  Inhibition of IDO expression can make advances in immunotherapy and chemotherapy fields (143; 125; 131; 144).

IDO has a great importance on prevention of cancer development (126). There are many approaches to create the homeostasis of immune response by Immunotherapy.  However, given the complexity of immune regulations, immunomodulation is a better approach to correct and relieve the system from the disease.  Some of the current IDO targeted immunotherapy or immmunomodulations with RNA technology for cancer prevention (145; 146; 147; 148; 149; 150) or applied on human or animals  (75; 151; 12; 115; 152; 9; 125) or chemical, (153; 154) or  radiological (155).  The targeted cell type in immune system generally DCs, monocytes (94)T cells (110; 156)and neutrophils (146; 157). On this paper, we will concentrate on DCvax on cancer treatments.

 T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

IDO and the downstream enzymes in tryptophan pathway produce a series of immunosuppressive tryptophan metabolites that may lead into Tregs proliferation or increase in T cell apoptosis (62; 16; 27; 158), and some can affect NK cell function (159).

The interesting part of the mechanism is even without presence of IDO itself, downstream enzymes of IDO in the kynurenine tryptophan degradation still show immunosuppressive outcome (160; 73) due to not only Kyn but also TGFbeta stimulated long term responses. DC vaccination with IDO plausible (161) due to its power in immune response changes and longevity in the bloodstream for reversing the system for Th17 production (162).

Clinical Interventions are taking advantage of the DC’s central role and combining with enhancing molecules for induction of immunity may overcome tolerogenic DCs in tumors of cancers (163; 164).

The first successful application of DC vaccine used against advanced melanoma after loading DCs with tumor peptides or autologous cell lysate in presence of adjuvants keyhole limpet hematocyanin (KLH) (165).  Previous animal and clinical studies show use of DCs against tumors created success (165; 166; 167) as well as some problems due to heterogeneity of DC populations in one study supporting tumor growth rather than diminishing (168).

DC vaccination applied onto over four thousand clinical trial but none of them used siRNA-IDO DC vaccination method. Clinical trials evaluating DCs loaded ex vivo with purified TAAs as an anticancer immunotherapeutic interventions also did not include IDO (Table from (169). This table presented the data from 30 clinical trials, 3 of which discontinued, evaluating DCs loaded ex vivo with TAAs as an anticancer immunotherapy for 12 types of cancer [(AML(1), Breast cancer (4), glioblastoma (1), glioma (2), hepatocellular carcinoma (1), hematological malignancies (1), melanoma (6), neuroblastoma sarcoma (2), NSCLC (1), ovarian cancer (3), pancreatic cancer (3), prostate cancer (10)] at phase I, II or I/II.

Tipping the balance between Treg and Th17 ratio has a therapeutic advantage for restoring the health that is also shown in ovarian cancer by DC vaccination with adjuvants (161).  This rebalancing of the immune system towards immunogenicity may restore Treg/Th17 ratio (162; 170) but it is complicated. The stimulation of IL10 and IL12 induce Treg produce less Th17 and inhibiting CTL activation and its function (76; 171; 172) while animals treated with anti-TGFb before vaccination increase the plasma levels of IL-15 for tumor specific T cell survival in vivo (173; 174) ovarian cancer studies after human papilloma virus infection present an increase of IL12 (175).

Opposing signal mechanism downregulates the TGFb to activate CTL and Th1 population with IL12 and IL15 expression (162; 173).  The effects of IL17 on antitumor properties observed by unique subset of CD4+ T cells (176) called also CD8+ T cells secrete even more IL17 (177).

Using cytokines as adjuvants during vaccination may improve the efficacy of vaccination since cancer vaccines unlike infections vaccines applied after the infection or disease started against the established adoptive immune response.  Adjuvants are used to improve the responses of the given therapies commonly in immunotherapy applications as a combination therapy (178).

Enhancing cancer vaccine efficacy via modulation of the microenvironment is a plausible solution if only know who are the players.  Several molecules can be used to initiate and lengthen the activity of intervention to stimulate IDO expression without compromising the mechanism (179).  The system is complicated so generally induction is completed ex-vivo stimulation of DCs in cell lysates, whole tumor lysates, to create the microenvironment and natural stimulatory agents. Introduction of molecules as an adjuvants on genetic regulation on modulation of DCs are critical, because order and time of the signals, specific location/ tissue, and heterogeneity of personal needs (174; 138; 180). These studies demonstrated that IL15 with low TGFb stimulates CTL and Th1, whereas elevated TGFb with IL10 increases Th17 and Tregs in cancer microenvironments.

IDO and signaling gene regulation

For example Ret-peptide antitumor vaccine contains an extracellular fragment of Ret protein and Th1 polarized immunoregulator CpG oligonucleotide (1826), with 1MT, a potent inhibitor of IDO, brought a powerful as well as specific cellular and humoral immune responses in mice (152).

The main idea of choosing Ret to produce vaccine in ret related carcinomas fall in two criterion, first choosing patients self-antigens for cancer therapy with a non-mutated gene, second, there is no evidence of genetic mutations in Ret amino acids 64-269. Demonstration of proliferating hemangiomas, benign endothelial tumors and often referred as hemangiomas of infancy appearing at head or neck, express IDO and slowly regressed as a result of immune mediated process.

After large scale of genomic analysis show insulin like growth factor 2 as the key regulator of hematoma growth (Ritter et al. 2003). We set out to develop new technology with our previous expertise in immunotherapy and immunomodulation (181; 182; 183; 184), correcting Th17/Th1 ratio (185), and siRNA technology (186; 187).  We developed siRNA-IDO-DCvax. Patented two technologies “Immunomodulation using Altered DCs (Patent No: US2006/0165665 A1) and Method of Cancer Treatments using siRNA Silencing (Patent No: US2009/0220582 A1).

In melanoma cancer DCs were preconditioned with whole tumor lysate but in breast cancer model pretreatment completed with tumor cell lysate before siRNA-IDO-DCvax applied. Both of these studies was a success without modifying the autanticity of DCs but decreasing the IDO expression to restore immunegenity by delaying tumor growth in breast cancer (147) and in melanoma (188).  Thus, our DCvax specifically interfere with Ido without disturbing natural structure and content of the DCs in vivo showed that it is possible to carry on this technology to clinical applications.

Furthermore, our method of intervention is more sophisticated since it has a direct interaction mechanism with ex-vivo DC modulation without creating long term metabolism imbalance in Trp/Kyn metabolite mechanisms since the action is corrective and non-invasive.

There were several reasons.

First, prevention of tumor development studies targeting non-enzymatic pathway initiated by pDCs conditioned with TGFbeta is specific to IDO1 (189).

Second, IDO upregulation in antigen presenting cells allowing metastasis show that most human tumors express IDO at high levels (123; 124).

Third, tolerogenic DCs secretes several molecules some of them are transforming growth factor beta (TGFb), interleukin IL10), human leukocyte antigen G (HLA-G), and leukemia inhibitory factor (LIF), and non-secreted program cell death ligand 1 (PD-1 L) and IDO, indolamine 2.3-dioxygenase, which promote tumor tolerance. Thus, we took advantage of DCs properties and Ido specificity to prevent the tolerogenicity with siRNA-IDO DC vaccine in both melanoma and breast cancer.

Fourth, IDO expression in DCs make them even more potent against tumor antigens and create more T cells against tumors. IDOs are expressed at different levels by both in broad range of tumor cells and many subtypes of DCs including monocyte-derived DCs (10), plasmacytoid DCs (142), CD8a+ DCs (190), IDO compotent DCs (17), IFNgamma-activated DCs used in DC vaccination.  These DCs suppress immune responses through several mechanisms for induction of apoptosis towards activated T cells (156) to mediate antigen-specific T cell anergy in vivo (142) and for enhancement of Treg cells production at sites of vaccination with IDO-positive DCs+ in human patients (142; 191; 192; 168; 193; 194). If DCs are preconditioned with tumor lysate with 1MT vaccination they increase DCvax effectiveness unlike DCs originated from “normal”, healthy lysate with 1MT in pancreatic cancer (195).  As a result, we concluded that the immunesupressive effect of IDO can be reversed by siRNA because Treg cells enhances DC vaccine-mediated anti-tumor-immunity in cancer patients.

Gene silencing is a promising technology regardless of advantages simplicity for finding gene interaction mechanisms in vitro and disadvantages of the technology is utilizing the system with specificity in vivo (186; 196).  siRNA technology is one of the newest solution for the treatment of diseases as human genomics is only producing about 25,000 genes by representing 1% of its genome. Thus, utilizing the RNA open the doors for more comprehensive and less invasive effects on interventions. Thus this technology is still improving and using adjuvants. Silencing of K-Ras inhibit the growth of tumors in human pancreatic cancers (197), silencing of beta-catenin in colon cancers causes tumor regression in mouse models (198), silencing of vascular endothelial growth factor (VGEF) decreased angiogenesis and inhibit tumor growth (199).

Combining siRNA IDO and DCvax from adult stem cell is a novel technology for regression of tumors in melanoma and breast cancers in vivo. Our data showed that IDO-siRNA reduced tumor derived T cell apoptosis and tumor derived inhibition of T cell proliferation.  In addition, silencing IDO made DCs more potent against tumors since treated or pretreated animals showed a delay or decreased the tumor growth (188; 147)


Clinical Trials:

First FDA approved DC-based cancer therapies for treatment of hormone-refractory prostate cancer as autologous cellular immunotherapy (163; 164).  However, there are many probabilities to iron out for a predictive outcome in patients.

Table 2 demonstrates the current summary of clinical trials report.  This table shows 38 total studies specifically Ido related function on cancer (16), eye (3), surgery (2), women health (4), obesity (1), Cardiovascular (2), brain (1), kidney (1), bladder (1), sepsis shock (1), transplant (1),  nervous system and behavioral studies (4), HIV (1) (Table 4).  Among these only 22 of which active, recruiting or not yet started to recruit, and 17 completed and one terminated.

Most of these studies concentrated on cancer by the industry, Teva GTC ( Phase I traumatic brain injury) Astra Zeneca (Phase IV on efficacy of CRESTOR 5mg for cardiovascular health concern), Incyte corporation (Phase II ovarian cancer) NewLink Genetics Corporation Phase I breast/lung/melanoma/pancreatic solid tumors that is terminated; Phase II malignant melanoma recruiting, Phase II active, not recruiting metastatic breast cancer, Phase I/II metastatic melanoma, Phase I advanced malignancies) , HIV (Phase IV enrolling by invitation supported by Salix Corp-UC, San Francisco and HIV/AIDS Research Programs).

Many studies based on chemotherapy but there are few that use biological methods completed study with  IDO vaccine peptide vaccination for Stage III-IV non-small-cell lung cancer patients (NCT01219348), observational study on effect of biological therapy on biomarkers in patients with untreated hepatitis C, metastasis melanoma, or Crohn disease by IFNalpha and chemical (ribavirin, ticilimumab (NCT00897312), polymorphisms of patients after 1MT drug application in treating patients with metastatic or unmovable refractory solid tumors by surgery (NCT00758537), IDO expression analysis on MSCs (NCT01668576), and not yet recruiting intervention with adenovirus-p53 transduced dendric cell vaccine , 1MT , radiation, Carbon C 11 aplha-methyltryptophan- (NCT01302821).

Among the registered clinical trials some of them are not interventional but  observational and evaluation studies on Trp/Kyn ratio (NCT01042847), Kyn/Trp ratio (NCT01219348), Kyn levels (NCT00897312, NCT00573300),  RT-PCR analysis for Kyn metabolism (NCT00573300, NCT00684736, NCT00758537), and intrinsic IDO expression of mesenchymal stem cells in lung transplant with percent inhibition of CD4+ and CD8+ T cell proliferation toward donor cells (NCT01668576), determining polymorphisms (NCT00426894). These clinical trials/studies are immensely valuable to understand the mechanism and route of intervention development with the data collected from human populations   

Future Actions for Molecular Dx and Targeted Therapies:

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors.  (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors. (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Current survival or response rate is around 40 to 50 % range.  By using specific cell type, selected inhibition/activation sequence based on patient’s genomic profile may improve the efficacy of clinical interventions on cancer treatments. Targeted therapies for specific gene regulation through signal transduction is necessary but there are few studies with genomics based approach.

On the other hand, there are surveys, observational or evaluations (listed in clinical trials section) registered with www.clinicaltrials.gov that will provide a valuable short-list of molecules.  Preventing stimulation of Ido1 as well as Tgfb-1gene expression by modulating receptor mediated phosphorylation between TGFb/SMAD either at Mad-Homology 1 (MH1) or Mad-Homology 1 (MH2) domains maybe possible (79; 82; 80). Within Smads are the conserved Mad-Homology 1 (MH1) domain, which is a DNA binding module contains tightly bound Zinc atom.

Smad MH2 domain is well conserved and one the most diverse protein-signal interacting molecule during signal transduction due to two important Serine residues located extreme distal C-termini at Ser-Val-Ser in Smad 2 or at pSer-X-PSer in RSmads (80). Kyn activated orphan G protein–coupled receptor, GPR35 with unknown function with a distinct expression pattern that collides with IDO sites since its expression at high levels of the immune system and the gut (63) (200; 63).  

The first study to connect IDO with cancer shows that group (75).  The directly targeting to regulate IDO expression is another method through modulating ISREs in its promoter with RNA-peptide combination technology. Indirectly, IDO can be regulated through Bin1 gene expression control over IDO since Bin1 is a negative regulator of IDO and prevents IDO expression.  IDO is under negative genetic control of Bin1, BAR adapter–encoding gene Bin1 (also known as Amphiphysin2). Bin1 functions in cancer suppression since attenuation of Bin1 observed in many human malignancies (141; 201; 202; 203; 204; 205; 206) .  Null Bin-/- mice showed that when there is lack of Bin1, upregulation of IDO through STAT1- and NF-kB-dependent expression of IDO makes tumor cells to escape from T cell–dependent antitumor immunity.

This pathway lies in non-enzymatic signal transducer function of IDO after stimulation of DCs by TGFb1.  The detail study on Bin1 gene by alternative spicing also provided that Bin1 is a tumor suppressor.  Its activities also depends on these spliced outcome, such as  Exon 10, in muscle, in turn Exon 13 in mice has importance in role for regulating growth when Bin1 is deleted or mutated C2C12 myoblasts interrupted due to its missing Myc, cyclinD1, or growth factor inhibiting genes like p21WAF1 (207; 208).

On the other hand alternative spliced Exon12A contributing brain cell differentiation (209; 210). Myc as a target at the junction between IDO gene interaction and Trp metabolism.  Bin1 interacts with Myc either early-dependent on Myc or late-independent on Myc, when Myc is not present. This gene regulation also interfered by the long term signaling mechanism related to Kynurenine (Kyn) acting as an endogenous ligand to AHR in Trp metabolite and TGFb1 and/or IFNalpha and IFNbeta up regulation of DCs to induce IDO in noncanonical pathway for NF-kB and myc gene activations (73; 74).  Hence, Trp/Kyn, Kyn/Trp, Th1/Th17 ratios are important to be observed in patients peripheral blood. These direct and indirect gene interactions place Bin1 to function in cell differentiation (211; 212; 205).

Regulatory T-cel generation via reverse and non-canonical signaliing to pDCs

Table 3 contains the microarray analysis for Kyn affect showed that there are 25 genes affected by Kyn, two of which are upregulated and 23 of them downregulated (100). This list of genes and additional knowledge based on studies creating the diagnostics panel with these genes as a biomarker may help to analyze the outcomes of given interventions and therapies. Some of these molecules are great candidate to seek as an adjuvant or co-stimulation agents.  These are myc, NfKB at IKKA, C2CD2, CREB3L2, GPR115, IL2, IL8, IL6, and IL1B, mir-376 RNA, NFKB3, TGFb, RelA, and SH3RF1. In addition, Lip, Fox3P, CTLA-4, Bin1, and IMPACT should be monitored.

In addition, Table 4 presents the other possible mechanisms. The highlights of possible target/biomarkers are specific TLRs, conserved sequences of IDO across its homologous structures, CCR6, CCR5, RORgammat, ISREs of IDO, Jak, STAT, IRFs, MH1 and MH2 domains of Smads. Endothelial cell coagulation activation mechanism and pDC maturation or immigration from lymph nodes to bloodstream should marry to control not only IDO expression but also genesis of preferred DC subsets. Stromal mesenchymal cells are also activated by these modulation at vascular system and interferes with metastasis of cancer. First, thrombin (human factor II) is a well regulated protein in coagulation hemostasis has a role in cell differentiation and angiogenesis.

Protein kinase activated receptors (PARs), type of GPCRs, moderate the actions. Second, during hematopoietic response endothelial cells produce hematopoietic growth factors (213; 214). Third, components of bone marrow stroma cells include monocytes, adipocytes, and mesenchymal stem cells (215). As a result, addressing this issue will prevent occurrence of coagulapathologies, namely DIC, bleeding, thrombosis, so that patients may also improve response rate towards therapies. Personal genomic profiles are powerful tool to improve efficacy in immunotherapies since there is an influence of age (young vs. adult), state of immune system (innate vs. adopted or acquired immunity). Table 5 includes some of the current studies directly with IDO and indirectly effecting its mechanisms via gene therapy, DNA vaccine, gene silencing and adjuvant applications as an intervention method to prevent various cancer types.


IDO has a confined function in immune system through complex interactions to maintain hemostasis of immune responses. The genesis of IDO stem from duplication of bacterial IDO-like genes.  Inhibition of microbial infection and invasion by depleting tryptophan limits and kills the invader but during starvation of trp the host may pass the twilight zone since trp required by host’s T cells.  Thus, the host cells in these small pockets adopt to new microenvironment with depleted trp and oxygen poor conditions. Hence, the cell metabolism differentiate to generate new cellular structure like nodules and tumors under the protection of constitutively expressed IDO in tumors, DCs and inhibited T cell proliferation.

On the other hand, having a dichotomy in IDO function can be a potential limiting factor that means is that IDOs impact on biological system could be variable based on several issues such as target cells, IDO’s capacity, pathologic state of the disease and conditions of the microenvironment. Thus, close monitoring is necessary to analyze the outcome to prevent conspiracies since previous studies generated paradoxical results.

Current therapies through chemotherapies, radiotherapies are costly and effectiveness shown that the clinical interventions require immunotherapies as well as coagulation and vascular biology manipulations for a higher efficacy and survival rate in cancer patients. Our siRNA and DC technologies based on stem cell modulation will provide at least prevention of cancer development and hopefully prevention in cancer.

11.       References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. Induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA.  Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (http://dx.doi.org:/10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197. 33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223, http://dx.doi.org:/10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp. http://dx.doi.org:/10.1038/nature10491.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878. 78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40.
http://dx.doi.org:/10.1016/S0092-8674(00)81696-7.  PMID 9865691.

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810.
http://dx.doi.org:/10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.   http://dx.doi.org:/10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132–     http://dx.doi.org:/10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271,  http://dx.doi.org:/10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31.

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. http://dx.doi.org:/10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606.  http://dx.doi.org:/10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11.  http://dx.doi.org:/10.1126/scisignal.2002963.

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii: S0006-291X(13)00779-1. http://dx.doi.org:/10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

114. What is the role of regulatory T cells in the success of implantation and early pregnancy? Saito, S., Shima, T., Nakashima, A., Shiozaki, A., Ito, M., Sasaki, Y. 2007, J Assist Reprod Genet, pp. 24: 379-386.

115. Sleeping Beauty-based gene therapy with indoleamine 2,3-dioxygenase inhibits lung allograft fibrosis. Liu H, Liu L, Fletcher BS, Visner GA. 2006, FASEB J, pp. 20:2384-2386.

116. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

117. Solid Cancers after Bone Marrow Transplantatioin. Curtis, R.E., Rowlings, P.A., Deeg, J., Schirer, D.A. et al. 1997, The New England Journal of Medicine., pp. 336, No: 13: 897-904.

118. More ADO about IDO; GVHD (commentary). Curti, A., Trabanelli, S., Lemoli, M. 2008, Blood, p. 2950.

119. Jasperson, et al, . 2008, Blood, p. 3257.

120. Tolerance, DCs and tryptophan: much ado about IDO. Grohmann U, Fallarino F, Puccetti P. 2003, Trends Immunol, pp. 24:242-248.

121. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med , pp. 9:1269–74.

122. Indoleamine 2,3-dioxygenase is a critical regulator of acute graft-versus-host disease lethality. Lisa K. Jasperson, Christoph Bucher, Angela Panoskaltsis-Mortari, Patricia A. Taylor, Andrew L. Mellor, David H. Munn, and Bruce R. Blazar. 2008., Blood., pp. 111:3257-3265.

123. The metabolism of tryptophan. 2. The metabolism of tryptophan in patients suffering from cancer of the bladder. . Boyland, E. & Willliams, D.C. 1956, Biochem. J., pp. 64, 578−582 .

124. Tryptophan metabolism in carcinoma of the breast. . Rose, D. 1967, Lancet , pp. 1, 239−241. 

125. Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees? . Löb S, Königsrainer A, Rammensee HG, Opelz G, Terness P. 2009;, Nat Rev Cancer , pp. 9:445–52.  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

126. The hallmarks of cancer. . Hanahan, D. & Weinberg, R.A. 2000., Cell., pp. 100, 57−70.

127. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Godin-Ethier, J., Hanafi,L.A., Piccirillo,C.A. and Lapointe, R. 2011, Clin Cancer Res, pp. 17; 6985,  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

128. Dendritic cell modification as a route to inhibiting corneal graft rejection by the indirect pathway of allorecognition. Khan A, Fu H, Tan LA, Harper JE, Beutelspacher SC, Larkin DF, Lombardi G, McClure MO, George AJ. 2013, Eur J Immunol., pp. 43(3):734-46. http://dx.doi.org:/10.1002/eji.201242914. Epub 2013 Jan 18.

129. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. . Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int., pp. 37(2):105-8.  http://dx.doi.org:/10.1002/cbin.10023. Epub 2013 Jan 2.

130. Implication of indolamine 2,3 dioxygenase in the tolerance toward fetuses, tumors, and allografts. . Dürr S, Kindler V. 2013, J Leukoc Biol. , pp. 93(5):681-7.
http://dx.doi.org:/10.1189/jlb.0712347. Epub 2013 Jan 16.

131. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med, pp. 9:1269–74.

132. NAturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Sagaguchi, S. 2004, Annu. Rev. of Immunol., pp. 22: 531-562.

133. Regulatory T cells in transplantation tolerance. Wood, K.J., zZSakaguchi, S.,. 2003, Nat. Rev. Immunol., pp. 3; 199-210.

134. The cell awareness of paternal alloantigens during pregnancy. Tafuri, A., Alferink, J., Hammerling, G.J., Arnold, B. 1995, Science, pp. 270; 630-3.

135. Adenovirus mediated CTLA4Ig transgene therapy alleviates abortion by inhibiting spleen lymphocyte proliferation and regulating apoptosis in the feto-placental unit. Li W, Li B, Li S. 2013, J Reprod Immunol. , pp. 97(2):167-74.

136. A distinct tolerogenic subset of splenic IDO(+)CD11b(+) dendritic cells from orally tolerized mice is responsible for induction of systemic immune tolerance and suppression of collagen-induced arthritis. Park MJ, Park KS, Park HS, Cho ML, Hwang SY, Min SY, Park MK, Park SH, Kim HY. 2012, Cell Immunol. , pp. 278(1-2):45-54. http://dx.doi.org:/10.1016/j.cellimm.2012.06.009. Epub 2012 Jul 10.

137. Pharmacological targeting of IDO-mediated tolerance for treating autoimmune disease. Penberthy, W.T. 2007, Curr. Drug Metab., pp. 8:(3):245-266.

138. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

139. Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. . Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS. 2001., NeuroReport. , pp. 12(9):1841–1845.

140. Tumor vaccines in 2010: need for integration. Koos, D., Josephs, SF, Alexandrescu, DT et al. 2010, Cell Immunol, pp. 263: 138-147.

141. BIN1 is a novel MYC-interacting protein with features of a tumor suppressor. . Sakamuro, D., Elliott, K., Wechsler-Reya, R. & Prendergast, G.C. 1996, Nat. Genet. , pp. 14, 69−77.

142. Expression of Indolamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor draining nodes. Munn, S.H., Sharma, M.D., Hou, D., Baban, B. et al. 2004, J. Clin. Invest. , pp. 114: 280-290.

143. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Jessica Godin-Ethier, Laïla-Aïcha Hanafi, Ciriaco A. Piccirillo, and Réjean Lapointe. 2011 , Clin Cancer Res, pp. 17; 6985, http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

144. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. . Munn, D.H. et al. 2002, Science 297, 1867−1870, pp. 297, 1867−1870 .

145. An HDAC inhibitor enhances cancer therapeutic efficiency of RNA polymerase III promoter-driven IDO shRNA. Yen MC, Weng TY, Chen YL, Lin CC, Chen CY, Wang CY, Chao HL, Chen CS, Lai MD. 2013, Cancer Gene Ther. , p. http://dx.doi.org:/10.1038/cgt.2013.27. [Epub ahead of print].

146. Systemic delivery of Salmonella typhimurium transformed with IDO shRNA enhances intratumoral vector colonization and suppresses tumor growth. Blache CA, Manuel ER, Kaltcheva TI, Wong AN, Ellenhorn JD, Blazar BR, Diamond DJ. 2012, Cancer Res. , pp. 72(24):6447-56.
http://dx.doi.org:/ZZ1158/0008-5472.CAN-12-0193. Epub 2012 Oct 22.

147. Silencing IDO in dendritic cells: a novel approach to enhance cancer immunotherapy in a murine breast cancer model. Zheng X, Koropatnick J, Chen D, Velenosi T, Ling H, Zhang X, Jiang N, Navarro B, Ichim TE, Urquhart B, Min W. 2013, Int J Cancer., pp.132(4):967-77. http://dx.doi.org:/10.1002/ijc.27710. Epub 2012 Jul 20.

148. Immunosuppressive CD14+HLA-DRlow/neg IDO+ myeloid cells in patients following allogeneic hematopoietic stem cell transplantation. Mougiakakos D, Jitschin R, von Bahr L, Poschke I, Gary R, Sundberg B, Gerbitz A, Ljungman P, Le Blanc K. 2013, Leukemia. , pp. 27(2):377-88.
http://dx.doi.org:/10.1038/leu.2012.215. Epub 2012 Jul 25.

149. Upregulated expression of indoleamine 2, 3-dioxygenase in primary breast cancer correlates with increase of infiltrated regulatory T cells in situ and lymph node metastasis. Yu J, Sun J, Wang SE, Li H, Cao S, Cong Y, Liu J, Ren X. 2011, Clin Dev Immunol. , p. 11:469135.
http://dx.doi.org:/10.1155/2011/469135. Epub 2011 Oct 24.

150. Skin delivery of short hairpin RNA of indoleamine 2,3 dioxygenase induces antitumor immunity against orthotopic and metastatic liver cancer. Huang TT, Yen MC, Lin CC, Weng TY, Chen YL, Lin CM, Lai MD. 2011, Cancer Sci. , pp. 102(12):2214-20. http://dx.doi.org:/10.1111/j.1349-7006.2011.02094.x.

151. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. . Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

152. Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan. Zeng, J., Cai, S., Yi, Y., et al. 2009, Cancer Res., pp. 69: 3963-3970,  http://dx.doi.org:/10.1158/0008-5472.CAN-08-2476.

153. Medicinal electronomics bricolage design of hypoxia-targeting antineoplastic drugs and invention of boron tracedrugs as innovative future-architectural drugs. Hori H, Uto Y, Nakata E. 2010, Anticancer Res. , pp. 30(9):3233-42.

154. Synthesis of 4-cyano and 4-nitrophenyl 1,6-dithio-D-manno-, L-ido- and D-glucoseptanosides possessing antithrombotic activity. Bozó E, Gáti T, Demeter A, Kuszmann J. 2002, Carbohydr Res. , pp. 3;337(15):1351-65.

155. Radiopharmaceuticals XXVII. 18F-labeled 2-deoxy-2-fluoro-d-glucose as a radiopharmaceutical for measuring regional myocardial glucose metabolism in vivo: tissue distribution and imaging studies in animals. Gallagher BM, Ansari A, Atkins H, Casella V, Christman DR, Fowler JS, Ido T, MacGregor RR, Som P, Wan CN, Wolf AP, Kuhl DE, Reivich M. 1977, J Nucl Med. , pp. 18(10):990-6.

156. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology, pp. 107:452–460.

157. Induction of indoleamine 2,3-dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial infection. Loughman JA, Hunstad DA. 2012 , J Infect Dis. , pp. 205(12):1830-9.  http://dx.doi.org:/10.1093/infdis/jis280.

158. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. . Terness, P., et al. 2002, J. Exp. Med.196:447–457., pp. 196:447–457.

159. The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46- and NKG2D-activating receptors and regulates NK-cell function. . Chiesa, M.D., et al. 2006, Blood. , pp. 108:4118–4125.38.

160. Differential effects of the tryptophan metabolite 3-hydroxyanthranilic acid on the proliferation of human CD8+ T cells induced by TCR triggering or homeostatic cytokines. Weber, W.P., et al. 2006, Eur. J. Immunol. , pp. 36:296-304.

161. Dendritic cell vaccination against ovarian cancer–tipping the Treg/TH17 balance to therapeutic advantage? Cannon MJ, Goyne H, Stone PJ, Chiriva-Internati M. 2011, Expert Opin Biol Ther. , pp. 11(4):441-5. http://dx.doi.org:/10.1517/14712598.2011.554812.

162. Phenotype, distribution, generation, and functional and clinical relevance of Th17 cells in the human tumor environments. . Kryczek I, Banerjee M, Cheng P, et al. 2009, Blood., pp. 114:1141–1149.

163. The use of dendritic cells in cancer immunitherapy. Schuler, G., Schuker-Turner, B., Steinman, RM, 2003, Curr. Opin. Immunol., pp. 15: 138-147.

164. Clinical applications of dentritic cell vaccines. Morse, MA, Lyerly, HK. 2000, Curr. Opin. Mol Ther., pp. 2:20-28.

165. Vaccination of melanoma patients with peptide or tumor lysate-pulsed dendritic cells. Nestle, FO, Alijagic, S., Gillet, M. et al. 1998, Nat. Med., pp. 4: 328-332.

166. Dentritic cell based tumor vaccination in prostate and renal cell cancer: a systamatic review. Draube, A., Klein-Gonzales, Matheus, S et al. 2011, Plos One, p. 6:e1881.

167. [Online] http://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapy-Products/ApprovedProducts/ucm210215.htm.

168. Dendritic cell based antitumor vaccination: impact of functional indolamine 2,3-dioxygenase expression. Wobster, m., Voigt, H., Houben, R. et al. 2007, Cancer Immunol Immunother, pp. 56:1017-1024. 169. [Online] oncoimmunology.2012 October1; 1(17):1111-1134,  http://dx.doi.org:/10.4161/onci.21494.

170. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. 2007 , Nat Immunol. , pp. 8(9):942-9.

171. IFNgamma promotes generationof Il-10 secreting CD4+ T cells that suppress generationof CD8responses in an antigen-experienced host. Liu, X.S., Leerberg, J., MacDonald, K., Leggatt, G.R., Frazer, I.H. 2009, J. Immunol., pp. 183: 51-58.

172. Antigen, in the presence of TGF-beta, induces up-regulationof FoxP3gfp+ in CD4+ TCR transgenic T cells that mediate linked supressionof CD8+ T cell responses. . Kapp, J.A., Honjo, K., Kapp, L.M., Goldsmith, K., Bucy, R.P. 2007, J. Immunol., pp. 179: 2105-2114.

173. Opposing effects of TGF-beta and IL-15 cytokines control the number of short lived effecctor CD8+ T cells. Sanjabi, S, Mosaheb, M.M., Flavell, R.A. 2009, Immunity., pp. 31; 131-144.

174. Synergestic enhancement of CD8+ T cell mediated tumor vaccines efficacy by an anti-tumor forming growth factor-beta monoclonal antibody. . Terabe, M., Ambrosino, E., Takaku, S. et al. 2009, Clin. Cancer Res., pp. 15; 6560-9.

175. IL-12 enhances CTL synapse formationand induces self-reactivity. Markinewicz, MA, Wise, EL, Buchwald, ZS et al. 2009, J. Immunol., pp. 182: 1351-1362.

176. Tumor specific Th17-polarized cells eradicate large established melanoma. Muranski, P., Boni, A., Antony, PA, et al. 2008, Blood, pp. 112; 362-373.

177. Type17 CD8+ T cells dispplay enhanced antitumor immunity. Hinrichs, C.S., Kaiser, A., Paulos, C.M., et al. 2008, Blood., pp. 112:362-373.

178. Marying Immunotherapy with Chemotherapy: Why Say IDO? Muller, AJ, and Prendergrast, GC. 2005, Cancer Research, pp. 65: 8065-8068.

179. Enhancing Cancer Vaccine efficacy via Modulationof the Tumor Environment. Disis, ML. 2009, Clin Cancer Res, pp. 15: 6476-6478.

180. Systemic inhibition of transforming growth factor beta 1 in glioma bearing mice improves the therapeutic efficacy of glioma-associated antigen peptide vaccines. Ueda, R., Fujita, M., Zhu, X., et al. 2009, Clin. Cancer res., pp. 15: 6551-9.

181. Immune modulation by silencing IL-12 productionin dendritic cells using smal interfering RNA. Hill, JA, Ichim, TE, Kusznieruk, KP, et al. 2003, J. Immunol, pp. 171:809-813.

182. Immune modulation and tolerance induction by RelB-silenced dentritic cells through RNA interference. Li, M. Zang, X, Zheng, X, et al. 2007, J. Immunol, pp. 178: 5480-7.

183. RNAi mediated CD40-CD54 interruption promotes tolerance in autoimmune arthritis. . Zheng, X., Suzuki, M., Zhang, X., et al. 2010, Arthritis Res. Ther., p. 12:R13.

184. Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival. Min, WP. Gorczynki, R., huang, XY et al. 2000, J. Immunol., pp. 164:161-167.

185. LF15-0195 generates tolerogenic dendritic cells by supressionof NF-kappaB signaling through inhibitionof IKK activity. . Yang, J., Bernier, SM, Ichim, TE, et al. 2003, J Leukoc. Biol., pp. 74: 438-447.

186. RNA interfrence: A potent tool for gene specific therapeutics. . Ichim, TE, Li, M., Qian, H., Popov, HI, Rycerz, K., Zheng, X., White, D., Zhong, R., and Min, WP. 2004, Am. J. Transplant, pp. 4:1227-1236.

187. A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Zheng, X., Vladau, C., Zhang, X. et al. 2009, Blood, pp. 113:2646-2654.

188. Reinstalling Antitumor Immunity by Inhibiting Tumor derived ImmunoSupressive Molecule IDO through RNA interference. Zheng, X et al. 2006, Int. Journal of Immunology., pp. 177:5639-5646.

189. Roles of TGFbeta in metastasis. Padua, D., Massague, J. 2009, Cell Res., pp. 19;89-102.

190. Functional expression of indolamine2,3-dioxygenase by murine CDalpha+dendritic cells. Fallarino, F., Vacca, C, Orabona, C et al. 2002, Int Immunol., pp. 14:65-8.

191. Indolamine2,3-dioxygenase controls conversion of Fox3+ Tregs to TH17-like cells in tumor draining lymph nodes. Sharma, MD, Hou, DY, Liu, Y et al. 2009, Blood, pp.113: 6102-11.

192. IDO upregulates regulatory T cells via tryptoophan catabolite and supresses encephalitogenic T cell responses in experimental autoimmune encephalomyelitis. Yan, Y, Zhang, GX, Gran, B et al. 2010, J Immunol, pp. 185; 5953-61.

193. IDO activates regulatory T cells and blocks their conversion into Th-17-like T cells. Baban, B, Chandler, PR, Sharma, MD et al. 2009, J Immunol, pp. 183; 2475-83.

194. Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletionof regulatory T cells. Dannull, J., Farrand, KJ, Mathews, SA, et al. 2005, J Clin Invest, pp. 115: 3623-33.

195. 1-MT enhances potency of tumor cell lysate pulled dentritic cells against pancreatic adenocarcinoma by downregulating percentage of Tregs. Li, Y, Xu, J, Zhou, H. et al. 2010, J Huazhong Univ Sci Technol Med Sci , pp. 30: 344-8.

196. siRNA mediated antitumorigenesis for drug target validation and therapeutics. Lu, PY, Xie, FY and Woodle, MC. 2003, Curr Opin Mol. Ther., pp. 5:225-234.

197. Stable supression of tumorigenicity by virus-mediated RNA interference. Brumellkamp, TR, Bernards, R, Agami, R. 2002, Cancer Cell, pp. 2; 243-247.

198. Small interferring RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells. Verma, UN, Surabhi, RM, Schmaltieg, A., Becerra, C., Gaynor, RB. 2003, Clin. Cancer. Res., pp. 9:1291-1300.

199. siRNA mediated inhibition of vascular endothelial growth factor severely limits tumor resistance to antiangiogeneic thromboposdin-1 and slows tumor vascularization and growth. Filleur, S., Courtin, A, Ait-Si-Ali, S., Guglielmi, J., Merel, C., Harel-Bellan, A., CLezardin, P., and Cabon, F. 2003, Cancer Res, pp. 63; 3919-3922.

200. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. . Wang, J., et al. 2006, J. Biol.Chem. , pp. 281:22021–22028. 201. Bin1 functionally interacts with Myc in cells and inhibits cell proliferation by multiple mechanisms. Elliott, K. et al. 1999, Oncogene , pp. 18, 3564−3573 .

202. Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. . Ge, K. et al. 1999, Proc. Natl. Acad. Sci. USA, pp. 96, 9689−9694. 

203. Losses of the tumor suppressor Bin1 in breast carcinoma are frequent and reflect deficits in a programmed cell death capacity. Ge, K. et al. 2000, Int. J. Cancer , pp. 85, 376−383.

204. Loss of heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Ge, K. et al. 2000, Int. J. Cancer , pp. 86, 155−161.

205. Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. . Tajiri, T. et al. 2003, Clin. Cancer Res., pp. 9, 3345−3355.

206. Targeted deletion of the suppressor gene Bin1/Amphiphysin2 enhances the malignant character of transformed cells. Muller, A.J., DuHadaway, J.B., Donover, P.S., Sutanto-Ward, E. & Prendergast, G.C. 2004, Cancer Biol. Ther. , p. 3.

207. Interactions of myogenic factors and the retinoblastoma protein mediates muscle commitment and cell differentiation. Gu, WJ., Scheniider,W., Condrolli,G., Kaushal,, S, Mahdavi,V., Nadal-Gnard, B. 1993, Cell, pp. 72; 309-324.

208. Structural analysis of the human BIN1 gene: evidence of tissue-specific transcriptional regualtion and alternate splicing. Wechsler-Reya, R, Sakamuro, J., Zhang, J., DuHadaway, J., and Predengast. 1998, J of Biol Chem.

209. A role for th ePutative Tuimor Supressor Bin1 in Muscle Differentiation. Wechsler-Reya, R., Elliott, KJ, Prendergast, GC. 1998, Molecular and Cellular Biology, p. 18 (1) :566.

210. The putative tumor repressor BIN1 is a short lived nuclear phosphoprotein whose localization is altered in malignant cells. Wechsler-Reya, R., Elliot, K., Herlyn, M., Prendergast, GC. 1997, Cancer Res, pp. 57: 3258-3263.

211. Transformation selective apoptosis by farnesyltransferase inhibitors requires Bin1. DuHadaway, J.B. et al. 2003, Oncogene, pp. 22, 3578−3588 (2003).

212. The c-Myc-interacting adapter protein Bin1 activates a caspase-independent cell death program. Elliott, K., Ge, K., Du, W. & Prendergast, G.C. 2000., Oncogene , pp. 19, 4669−4684.

213. Growth stimulation of human bone marrow cells in agar culture by vascular cells. Knudtzon, S., and Mortensen, BT. 1975, Blood, pp. 46 (6) 937-943.

214. Exogenous endothelial cells as accelerators of hematopoietic reconstitution. Mizer, C., Ichim, TE, Alexandrescu, DT, DAsanu, CA, Ramos, F., Turner, A., Woods, EJ, Bogon, V., Murphy, MP, Koos, D., and Patel, A. 2013, J. Translational Medicine, p. 10: 231.

215. Dissecting the bone marrow microenvironment . Torok-Storb, B. et al. 1999, Annals of New York Academy of Science, pp. 872: 164-170. 217. Yuasa, XX and Ball YY. 2011.

218. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int. , pp. 37(2):105-8. http://dx.doi.org:/10.1002/cbin.10023.

219. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

220. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

Read Full Post »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and PathologyDuke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation


crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130



Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.




The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.


Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.


Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).


The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.


In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.


1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8


Read Full Post »

Cloning the Vaccinia Virus Genome as a Bacterial Artificial Chromosome

Curator: Larry H Bernstein, MD, FCAP

Cloning the vaccinia virus genome as a bacterial artificial chromosome in Escherichia coli and recovery of infectious virus in mammalian cells

A Domi and B Moss
PNAS  Sep 17, 2002; 99(19):12415–12420     http://www.pnas.org/dx.cgi.doi/10.1073/pnas.192420599
The ability to manipulate the vaccinia virus (VAC) genome,
  • as a plasmid in bacteria,
  • would greatly facilitate genetic studies and
  • provide a powerful alternative method of making recombinant viruses.
VAC, like other poxviruses, has a linear, double-stranded DNA genome with covalently closed hairpin ends that are resolved
  • from transient head-to-head and tail-to-tail concatemers
  • during replication in the cytoplasm of infected cell.
Our strategy to construct a nearly 200,000-bp VAC-bacterial artificial chromosome (BAC) was based on
  • circularization of head-to-tail concatemers of VAC DNA.
Cells were infected with a recombinant VAC containing inserted sequences for plasmid replication and maintenance in Escherichia coli; DNA concatemer resolution was inhibited
  • leading to formation and accumulation of head-to-tail concatemers,
in addition to the usual head-to-head and tail-to-tail forms;
  • the concatemers were circularized
    • by homologous or Cre–loxP-mediated recombination; and
  • E. coli were transformed with DNA from the infected cell lysates.
Stable plasmids containing the entire VAC genome, with an intact concatemer junction sequence, were identified. Rescue of infectious VAC was consistently achieved
  • by transfecting the VAC–BAC plasmids into mammalian cells that were infected with a helper nonreplicating fowlpox virus.
The plasmids used to implement the repressilat...

The plasmids used to implement the repressilator in Escherichia coli. (Photo credit: Wikipedia)

There are two types of plasmid integration int...

There are two types of plasmid integration into a host bacteria: Non-integrating plasmids replicate as with the top instance, whereas episomes, the lower example, integrate into the host chromosome. (Photo credit: Wikipedia)

Read Full Post »

%d bloggers like this: