Advertisements
Feeds:
Posts
Comments

Posts Tagged ‘Pulmonary hypertension’


Ralph’s Story: An Entertainer at Heart

Patient was diagnosed with heart disease and pulmonary hypertension in January 2016 and had a triple-bypass operation at age 69. Interview was conducted six months post-surgery.

Author: Gail S. Thornton, M.A.

Co-Editor: The VOICES of Patients, HealthCare Providers, Caregivers and Families: Personal Experience with Critical Care and Invasive Medical Procedures

 

Evergreen, Colorado, an idyllic, peaceful community with an elevation of 8,000 feet west of Denver, offers its residents and visitors a beautiful place for arts and culture, summer and winter sporting activities, and scenic beauty. In fact, Ralph Nichols has lived in the town for more than 20 years.

“This past September [2015] was, particularly, challenging for me, where winter begins quite early for us. It became increasingly painful and difficult to breathe in the freezing temperatures. It seemed that my lungs were inflamed and I couldn’t even stand the cold weather. I thought it might be the beginning of a bad cold, and I wasn’t overly concerned that there was anything terribly wrong.”

At that time, Ralph went to his family physician who performed the usual routine examination with no significant results.

“Many years ago, I developed a mild case of scleroderma, a chronic connective tissue disease. I thought that perhaps my symptoms were the result of some type of inflammation in my body that could be managed with prescription medications.”

Scleroderma is known as an autoimmune disease, which adds an inappropriate amount of collagen to various parts of the body, such as the joints, skin, and later stages, various organs, such as the lungs, in Ralph’s case. Scleroderma can cause the organs to shut down and, eventually, cause death.

“I never let this condition stop me from doing anything as it is life-long condition. It was always something I had to tolerate and work through.”

http://www.scleroderma.org/site/PageNavigator/patients_whatis.html#.V5Zrm84luKo

 

Image SOURCE: Photographs courtesy of Ralph Nichols and Gabriela Contreras.  Top left: Ralph today. Top right: Ralph recovering one month after surgery. Bottom left and center: Ralph with his medical team. Bottom right: Ralph in rehabilitation center.

Over the brutal Colorado winter, Ralph’s symptoms were getting worse. He had no idea that his life would dramatically change over the next few months. He went to see his family physician again. During this physical examination, Ralph was referred to pulmonary and cardiovascular specialists for a routine electrocardiogram, echocardiogram and stress test in order to further diagnose his symptoms. He had always been relatively healthy and fit and never been seriously ill or hospitalized.

“On the outside, Ralph was the picture of good health,” said his wife, Gabriela. “On the inside, his body was telling him that something was wrong.”

Three months later in December 2015, Ralph met with Dr. Alexandra Smart, a pulmonologist, who ordered a chest x-ray and other diagnostic tests, including a right heart catheterization. At that point, Ralph’s medical team grew. It was then determined that Ralph needed to see other cardiovascular specialists and undergo more tests. In January 2016, he met with Dr. Sameer Mehta, cardiologist at Cardiac & Thoracic Surgery Associates, in Lakewood, Colorado, who reviewed his tests to date, listened to Ralph’s symptoms, and told him he needed both a right and left heart cardiac catheterization.

 “They gave me sedation for the catheterization procedure and went through my neck with a camera to see what was going on with my lungs and heart. We were all singing together on the way to the operating room. During the procedure, my cardiologist found more than he had anticipated.”

The result was not good. Ralph had major blockages in two main arteries that supply blood to his heart muscle compounded by the fact that his lungs were affected by scleroderma.

“The catheterization was alarming. It showed that my arteries were in bad shape. They were both clogged with atherosclerotic plaque; one of them was 99 percent blocked and the other was 85 percent blocked.”

His cardiologist believed that the blockages would not respond to medications quickly or a stent.

“Even though my father had major heart disease and died two years later of cancer at the age of 56, I thought that I would be immune to this particular experience. After all, I was in good health, exercised regularly, lived a reasonable lifestyle and had a great diet.”

 Preparing for Life-Saving and Life-Changing Surgery

Unfortunately, surgery was the next step. Ralph was referred to Dr. Mehta’s colleague, Dr. Patrick D. Rudersdorf, cardiothoracic surgeon at Cardiac & Thoracic Surgery Associates.

“I didn’t leave the hospital that day as expected. Instead, I got a visit from Dr. Rudersdorf and couldn’t believe what he was telling me. My only chance to live was having triple bypass surgery which needed to be done immediately. The doctor met with me that same day to explain the procedure, answer my questions and talk through the details of the rehabilitation period after the surgery.”

Dr. Rudersdorf reassured Ralph that he was doing the right thing and calmed my fears.

“He said that I needed this life-saving surgery because I was at high risk for having a major heart attack. I was shocked, at first, at the thought of the intensity of surgery on my body. It’s a situation that no one likes to be in, but I had to make a decision about alleviating the ongoing pain and pressure in my chest along with shortness of breath due to diseased heart arteries. Coronary bypass surgery was my answer to feeling better — and it essentially gave me my life back.”

Dr. Rudersdorf moved his previously planned morning surgery to another day to accommodate me first thing in the morning. Ralph underwent triple bypass surgery at St. Anthony Hospital in Lakewood, Colorado. The procedure was complex and took eight hours. He was in the hospital for a total of 31 days.

“It was an ordeal that I thought I’d never have to experience. I had no time to call anyone, or time to even contemplate life and death…or even being scared.  My wife Gabriela spent the entire time in the hospital, supported by our dearest friends, Norma Delaney and Garret Annofsky, in addition to keeping family and friends in other parts of the United States and Mexico updated as well. Once the surgery was over, the medical team woke me up and said the procedure was successful, but I was far from being out of the woods.”

Ralph had some complications because of a condition called pulmonary hypertension, a type of high blood pressure that affects the arteries in the lungs and the right side of the heart. According to the Mayo Clinic’s web site, in one form of pulmonary hypertension, tiny arteries in the lungs, called pulmonary arterioles, and capillaries become narrowed, blocked or destroyed. This makes it harder for blood to flow through the lungs, and raises pressure within the lungs’ arteries. As the pressure builds, the heart’s lower right chamber (right ventricle) must work harder to pump blood through the lungs, eventually causing the heart muscle to weaken and fail. http://www.mayoclinic.org/diseases-conditions/pulmonary-hypertension/home/ovc-20197480

“The pulmonary hypertension limited some of the medications that the doctors would have used during my recovery. It was a tough few days for me in intensive care, hooked up to about 18 monitors. The medical team had to stop and re-start my heart four different times because of atrial fibrillation — finally getting both parts of the heart to dance together in the same rhythm.”

Ralph’s heart was beating abnormally fast and irregular and not functioning the way it should. The doctors restore regular rhythm to the heart by sending an electrical shock to the heart, which is called electrical cardioversion or chemically using antiarrhythmia medications, which is called pharmacologic or chemical cardioversion.

“The doctors shocked my heart first chemically with medications when I was awake. This procedure was the scariest. I was sitting up in bed and felt my heart stop, then the medical team flushed the medication out with saline in order to restart my heart. That procedure was not successful, so that is why the doctors had to shock my heart three more times electrically.

“The reason the doctors stopped my heart was to correct the atrial fibrillation and to get my heart into regular sinus rhythm, which is a wave mode of the heart where everything is synchronized. The doctors did not want me to continue to experience atrial fibrillation because if continued, I would not be able to regain my strength.”

Ralph was finally moved from intensive care to intermediate care after five days and the medical team kept him in intermediate care another 12 days until his heart and lungs got stronger.

“From there, I didn’t go home but instead went to Evergreen Life Center for rehabilitation for two weeks to learn how to walk, climb stairs so that I could access my home on my own, and develop my strength again. The rehab team would let me leave only after making sure I had oxygen in my home.”

After that, Ralph started another phase of his rehabilitation at St. Anthony Cardiac Rehabilitation and Wellness Center. For the next three months, he took part in cardiac rehabilitation three days a week. He passed that with flying colors. Now, he is in another phase of rehabilitation, building his lung capacity two days a week.

Ralph didn’t have the means or even the will to communicate with friends during this tumultuous time, except Gabriela and several close friends who were always at the hospital and rehabilitation center who gave him the strength to continue.

“I finally returned home after many weeks with an enormous feeling of gratitude for each and every one of my friends, as well as the St. Anthony’s hospital team of doctors, nurses, and therapists, who supported me and Gabriela during this exceptional adventure that has certainly changed my life.”

Surely, this experience has been a life-changing experience for Ralph.

 Coronary Artery Bypass Facts

 Coronary artery bypass grafting (CABG, often pronounced “cabbage”) is a surgical treatment for blocked coronary arteries. Coronary arteries supply blood to the heart muscle and when blockages in these arteries form, chest pain, shortness of breath and heart attacks can occur. Catheter procedures performed by interventional cardiologists address the blockages themselves with stents. Coronary bypass surgery performed by cardiac surgeons reroutes the blood around the blockages to supply better blood supply to the heart muscle and is a better treatment option, although more invasive, for certain patients and more durable for most patients.

http://ctsurgery.com/conditions-procedures/heart-aorta/cardiac-surgery/coronary-artery-bypass-grafting-cabg/

Life for Ralph Today

Today, Ralph is regaining his strength both in mind and body. He visits the cardiovascular and pulmonary rehabilitation center three times a week for the past few months and walks on their treadmill, lifts weights and pedals the bicycle for one hour, supervised by the therapists. He also sees his medical team for regular check-ups every month, eats healthier with no fat and no salt, and takes a cocktail of medicines daily for his heart and lungs, including amiodarone, furosemide, pitavastatin, and aspirin.

“Almost six months after my surgery, although I am not in the best shape of my life, however, I am in the best spiritual place than ever before. This is a huge milestone for me. I continue to improve my strength, which will make my heart more resilient. There is nothing that I can’t do now, and I am doing everything I can to experience a normal life as far as work and regaining my strength. I find it necessary to move to a warmer climate and lower altitude in order to continue to improve.”

Ralph also is the former lead singer of The Letterman and The Sandpipers, two American easy-listening bands during the 1960-70-80s. He is an entertainer at heart with over 3,000 professional appearances to his credit. He has been performing and recording for over 50 years, traveled the world extensively and performed before members of the Vatican with Pope Pius XII and Royalty with Prince Rainier and Princess Grace Kelly, as well as notables such as Frank and Nancy Sinatra, Tony Bennett, Ronald Reagan, Merv Griffin, Danny Thomas, Shirley Bassey, Rosalind Russell and Bob Hope.

Ralph and his vocal group were dubbed by Billboard Magazine as “the greatest romantic vocal group of all time.” He is also a member of the Vocal Group Hall of Fame, a prestigious honor. He is a true legend as his group has sold more than 20 million recordings, performed live thousands of times, and whose recording of the song “Love” was left by NASA astronauts in a time capsule on the moon.

“I enjoy each and every day and appreciate all that life has to offer.”

Ralph’s next step is to get back to singing and his solo entertainment business, which he holds dear to his heart. That should be a task that he can easily accomplish.

 

Editor’s note:

We would like to thank Gabriela Contreras, a global communications consultant and patient advocate, for the tremendous help and support that she provided in scheduling time to talk with Ralph Nichols.

Ralph Nichols provided his permission to publish this interview on July 30, 2016.

 

REFERENCES/SOURCES

http://www.scleroderma.org/site/PageNavigator/patients_whatis.html#.V5Zrm84luKo

http://www.mayoclinic.org/diseases-conditions/pulmonary-hypertension/home/ovc-20197480

http://ctsurgery.com/conditions-procedures/heart-aorta/cardiac-surgery/coronary-artery-bypass-grafting-cabg/

 

Other related articles:

Retrieved from http://www.sunset.com/travel/rockies/evergreen-colorado-day-trip-travel-planner

Retrieved from http://www.secondscount.org/heart-condition-centers/info-detail-2/benefits-risks-of-coronary-bypass-surgery-2#.V5dkK_krKUk

Other related articles were published in this Open Access Online Scientific Journal include the following: 

2016

People with blood type O have been reported to be protected from coronary heart disease, cancer, and have lower cholesterol levels.

https://pharmaceuticalintelligence.com/2016/01/11/people-with-blood-type-o-have-been-reported-to-be-protected-from-coronary-heart-disease-cancer-and-have-lower-cholesterol-levels/

2015

A Patient’s Perspective: On Open Heart Surgery from Diagnosis and Intervention to Recovery

https://pharmaceuticalintelligence.com/2015/05/10/a-patients-perspective-on-open-heart-surgery-from-diagnosis-and-intervention-to-recovery/

No evidence to change current transfusion practices for adults undergoing complex cardiac surgery: RECESS evaluated 1,098 cardiac surgery patients received red blood cell units stored for short or long periods

https://pharmaceuticalintelligence.com/2015/04/08/no-evidence-to-change-current-transfusion-practices-for-adults-undergoing-complex-cardiac-surgery-recess-evaluated-1098-cardiac-surgery-patients-received-red-blood-cell-units-stored-for-short-or-lon/

2013

ACC/AHA Guidelines for Coronary Artery Bypass Graft Surgery

https://pharmaceuticalintelligence.com/2013/11/05/accaha-guidelines-for-coronary-artery-bypass-graft-surgery/

On Devices and On Algorithms: Arrhythmia after Cardiac SurgeryPrediction and ECG Prediction of Paroxysmal Atrial Fibrillation Onset

https://pharmaceuticalintelligence.com/2013/05/07/on-devices-and-on-algorithms-arrhythmia-after-cardiac-surgery-prediction-and-ecg-prediction-of-paroxysmal-atrial-fibrillation-onset/

 

Editor’s note:

I wish to encourage the e-Reader of this Interview to consider reading and comparing the experiences of other Open Heart Surgery Patients, voicing their private-life episodes in the ER that are included in this volume.

I also wish to encourage the e-Reader to consider, if interested, reviewing additional e-Books on Cardiovascular Diseases from the same Publisher, Leaders in Pharmaceutical Business Intelligence (LPBI) Group, on Amazon.com.

  •  Perspectives on Nitric Oxide in Disease Mechanisms, on Amazon since 6/2/12013

http://www.amazon.com/dp/B00DINFFYC

  • Cardiovascular, Volume Two: Cardiovascular Original Research: Cases in Methodology Design for Content Co-Curation, on Amazon since 11/30/2015

http://www.amazon.com/dp/B018Q5MCN8

  • Cardiovascular Diseases, Volume Three: Etiologies of Cardiovascular Diseases: Epigenetics, Genetics and Genomics, on Amazon since 11/29/2015

http://www.amazon.com/dp/B018PNHJ84

  • Cardiovascular Diseases, Volume Four: Regenerative and Translational Medicine: The Therapeutics Promise for Cardiovascular Diseases, on Amazon since 12/26/2015

http://www.amazon.com/dp/B019UM909A

onepagecvdseriesaflyervol1-4

 

Advertisements

Read Full Post »


Heart-Lung-Kidney: Essential Ties

Writer and Curator: Larry H. Bernstein, MD, FCAP 

 

Introduction

The basic functioning of the heart, and the kidney have been covered in depth elsewhere, and pulmonary function less, except in this series.  The relationship between them on the basis of endocrine, signaling, and metabolic balance is the focus in this piece.

Other elated articles can be found in http://pharmaceuticalintelligence.com:

The Amazing Structure and Adaptive Functioning of the Kidneys: Nitric Oxide – Part I
https://pharmaceuticalintelligence.com/2012/11/26/the-amazing-structure-and-adaptive-functioning-of-the-kidneys/

Nitric Oxide and iNOS have Key Roles in Kidney Diseases – Part II
https://pharmaceuticalintelligence.com/2012/11/26/nitric-oxide-and-inos-have-key-roles-in-kidney-diseases/

Stroke and Bleeding in Atrial Fibrillation with Chronic Kidney Disease
https://pharmaceuticalintelligence.com/2012/08/16/stroke-and-bleeding-in-atrial-fibrillation-with-chronic-kidney-disease/

Risks of Hypoglycemia in Diabetics with Chronic Kidney Disease (CKD)
https://pharmaceuticalintelligence.com/2012/08/01/risks-of-hypoglycemia-in-diabetics-with-ckd/

Acute Lung Injury
https://pharmaceuticalintelligence.com/2015/02/26/acute-lung-injury/

Neonatal Pathophysiology
https://pharmaceuticalintelligence.com/2015/02/22/neonatal-pathophysiology/

Altitude Adaptation
https://pharmaceuticalintelligence.com/2015/02/24/altitude-adaptation/

Action of Hormones on the Circulation
https://pharmaceuticalintelligence.com/2015/02/17/action-of-hormones-on-the-circulation/

Innervation of Heart and Heart Rate
https://pharmaceuticalintelligence.com/2015/02/15/innervation-of-heart-and-heart-rate/

Neural Activity Regulating Endocrine Response
https://pharmaceuticalintelligence.com/2015/02/13/neural-activity-regulating-endocrine-response/

Adrenal Cortex
https://pharmaceuticalintelligence.com/2015/02/07/adrenal-cortex/

Thyroid Function and Disorders
https://pharmaceuticalintelligence.com/2015/02/05/thyroid-function-and-disorders/

Highlights in the History of Physiology
https://pharmaceuticalintelligence.com/2014/12/28/highlights-in-the-history-of-physiology/

The Evolution of Clinical Chemistry in the 20th Century
https://pharmaceuticalintelligence.com/2014/12/13/the-evolution-of-clinical-chemistry-in-the-20th-century/

Complex Models of Signaling: Therapeutic Implications
https://pharmaceuticalintelligence.com/2014/10/31/complex-models-of-signaling-therapeutic-implications/

Cholesterol and Regulation of Liver Synthetic Pathways
https://pharmaceuticalintelligence.com/2014/10/25/cholesterol-and-regulation-of-liver-synthetic-pathways/

A Brief Curation of Proteomics, Metabolomics, and Metabolism
https://pharmaceuticalintelligence.com/2014/10/03/a-brief-curation-of-proteomics-metabolomics-and-metabolism/

Natriuretic Peptides in Evaluating Dyspnea and Congestive Heart Failure
https://pharmaceuticalintelligence.com/2014/09/08/natriuretic-peptides-in-evaluating-dyspnea-and-congestive-heart-failure/

Omega-3 fatty acids, depleting the source, and protein insufficiency in renal disease
https://pharmaceuticalintelligence.com/2014/07/06/omega-3-fatty-acids-depleting-the-source-and-protein-insufficiency-in-renal-disease/

Summary – Volume 4, Part 2: Translational Medicine in Cardiovascular Diseases
https://pharmaceuticalintelligence.com/2014/05/10/summary-part-2-volume-4-translational-medicine-in-cardiovascular-diseases/

More on the Performance of High Sensitivity Troponin T and with Amino Terminal Pro BNP in Diabetes
https://pharmaceuticalintelligence.com/2014/01/20/more-on-the-performance-of-high-sensitivity-troponin-t-and-with-amino-terminal-pro-bnp-in-diabetes/

Diagnostic Value of Cardiac Biomarkers
https://pharmaceuticalintelligence.com/2014/01/04/diagnostic-value-of-cardiac-biomarkers/

Erythropoietin (EPO) and Intravenous Iron (Fe) as Therapeutics for Anemia in Severe and Resistant CHF: The Elevated N-terminal proBNP Biomarker
https://pharmaceuticalintelligence.com/2013/12/10/epo-as-therapeutics-for-anemia-in-chf/

The Young Surgeon and The Retired Pathologist: On Science, Medicine and HealthCare Policy – Best writers Among the WRITERS
https://pharmaceuticalintelligence.com/2013/12/10/the-young-surgeon-and-the-retired-pathologist-on-science-medicine-and-healthcare-policy-best-writers-among-the-writers/

Renal Function Biomarker, β-trace protein (BTP) as a Novel Biomarker for Cardiac Risk Diagnosis in Patients with Atrial Fibrillation
https://pharmaceuticalintelligence.com/2013/11/13/renal-function-biomarker-%CE%B2-trace-protein-btp-as-a-novel-biomarker-for-cardiac-risk-diagnosis-in-patients-with-atrial-fibrilation/

Leptin signaling in mediating the cardiac hypertrophy associated with obesity
https://pharmaceuticalintelligence.com/2013/11/03/leptin-signaling-in-mediating-the-cardiac-hypertrophy-associated-with-obesity/

The Role of Tight Junction Proteins in Water and Electrolyte Transport
https://pharmaceuticalintelligence.com/2013/10/07/the-role-of-tight-junction-proteins-in-water-and-electrolyte-transport/

Selective Ion Conduction
https://pharmaceuticalintelligence.com/2013/10/07/selective-ion-conduction/

Translational Research on the Mechanism of Water and Electrolyte Movements into the Cell
https://pharmaceuticalintelligence.com/2013/10/07/translational-research-on-the-mechanism-of-water-and-electrolyte-movements-into-the-cell/

Landscape of Cardiac Biomarkers for Improved Clinical Utilization
https://pharmaceuticalintelligence.com/2013/09/22/landscape-of-cardiac-biomarkers-for-improved-clinical-utilization/

Calcium-Channel Blocker, Calcium as Neurotransmitter Sensor and Calcium Release-related Contractile Dysfunction (Ryanopathy)
https://pharmaceuticalintelligence.com/2013/09/16/calcium-channel-blocker-calcium-as-neurotransmitter-sensor-and-calcium-release-related-contractile-dysfunction-ryanopathy/

Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism
https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease
https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Cardiac Contractility & Myocardium Performance: Therapeutic Implications for Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses
https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Advanced Topics in Sepsis and the Cardiovascular System at its End Stage
https://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-sepsis-and-the-cardiovascular-system-at-its-end-stage/

The Cardio-Renal Syndrome (CRS) in Heart Failure (HF)
https://pharmaceuticalintelligence.com/2013/06/30/the-cardiorenal-syndrome-in-heart-failure/

More…

Sodium homeostasis

Icariin attenuates angiotensin IIinduced hypertrophy and apoptosis in H9c2 cardiomyocytes by inhibiting reactive oxygen speciesdependent JNK and p38 pathways

H Zhou, Y Yuan, Y Liu, Wei Deng, Jing Zong, Zhou‑Yan Bian, Jia Dai and Qi‑Zhu Tang
Exper and Therapeutic Med 7: 1116-1122, 2014
http://dx.doi.org:/10.3892/etm.2014.1598

Icariin, the major active component isolated from plants of the Epimedium family, has been reported to have potential protective effects on the cardiovascular system. However, it is not known whether icariin has a direct effect on angiotensin II (Ang II)‑induced cardiomyocyte enlargement and apoptosis. In the present study, embryonic rat heart‑derived H9c2 cells were stimulated by Ang II, with or without icariin administration. Icariin treatment was found to attenuate the Ang II‑induced increase in mRNA expression levels of hypertrophic markers, including atrial natriuretic peptide and B‑type natriuretic peptide, in a concentration‑dependent manner. The cell surface area of Ang II‑treated H9c2 cells also decreased with icariin administration. Furthermore, icariin repressed Ang II‑induced cell apoptosis and protein expression levels of Bax and cleaved‑caspase 3, while the expression of Bcl‑2 was increased by icariin. In addition, 2′,7’‑dichlorofluorescein diacetate incubation revealed that icariin inhibited the production of intracellular reactive oxygen species (ROS), which were stimulated by Ang II. Phosphorylation of c‑Jun N‑terminal kinase (JNK) and p38 in Ang II‑treated H9c2 cells was blocked by icariin. Therefore, the results of the present study indicated that icariin protected H9c2 cardiomyocytes from Ang II‑induced hypertrophy and apoptosis by inhibiting the ROS‑dependent JNK and p38 pathways.

Short-term add-on therapy with angiotensin receptor blocker for end-stage inotrope-dependent heart failure patients: B-type natriuretic peptide reduction in a randomized clinical trial

Marcelo E. Ochiai, ECO Brancalhao, RSN Puig, KRN Vieira, et al.
Clinics. 2014; 69(5):308-313
http://dx.doi.org:/10.6061/clinics/2014(05)02

OBJECTIVE: We aimed to evaluate angiotensin receptor blocker add-on therapy in patients with low cardiac output during decompensated heart failure. METHODS: We selected patients with decompensated heart failure, low cardiac output, dobutamine dependence, and an ejection fraction ,0.45 who were receiving an angiotensin-converting enzyme inhibitor. The patients were randomized to losartan or placebo and underwent invasive hemodynamic and B-type natriuretic peptide measurements at baseline and on the seventh day after intervention. ClinicalTrials.gov: NCT01857999. RESULTS: We studied 10 patients in the losartan group and 11 patients in the placebo group. The patient characteristics were as follows: age 52.7 years, ejection fraction 21.3%, dobutamine infusion 8.5 mcg/kg.min, indexed systemic vascular resistance 1918.0 dynes.sec/cm5.m2, cardiac index 2.8 L/min.m2, and B-type natriuretic peptide 1,403 pg/mL. After 7 days of intervention, there was a 37.4% reduction in the B-type natriuretic peptide levels in the losartan group compared with an 11.9% increase in the placebo group (mean difference, – 49.1%; 95% confidence interval: -88.1 to -9.8%, p = 0.018). No significant difference was observed in the hemodynamic measurements. CONCLUSION: Short-term add-on therapy with losartan reduced B-type natriuretic peptide levels in patients hospitalized for decompensated severe heart failure and low cardiac output with inotrope dependence.

Development of a Novel Heart Failure Risk Tool: The Barcelona Bio-Heart Failure Risk Calculator (BCN Bio-HF Calculator)

Josep Lupon, Marta de Antonio, Joan Vila, Judith Penafiel, et al.
PLoS ONE 9(1): e85466. http://dx.doi.org:/10.1371/journal.pone.0085466

Background: A combination of clinical and routine laboratory data with biomarkers reflecting different pathophysiological pathways may help to refine risk stratification in heart failure (HF). A novel calculator (BCN Bio-HF calculator) incorporating N-terminal pro B-type natriuretic peptide (NT-proBNP, a marker of myocardial stretch), high-sensitivity cardiac troponin T (hs-cTnT, a marker of myocyte injury), and high-sensitivity soluble ST2 (ST2), (reflective of myocardial fibrosis and remodeling) was developed. Methods: Model performance was evaluated using discrimination, calibration, and reclassi-fication tools for 1-, 2-, and 3-year mortality. Ten-fold cross-validation with 1000 bootstrapping was used. Results: The BCN Bio-HF calculator was derived from 864 consecutive outpatients (72% men) with mean age 68.2612 years (73%/27% New York Heart Association (NYHA) class I-II/III-IV, LVEF 36%, ischemic etiology 52.2%) and followed for a median of 3.4 years (305 deaths). After an initial evaluation of 23 variables, eight independent models were developed. The variables included in these models were age, sex, NYHA functional class, left ventricular ejection fraction, serum sodium, estimated glomerular filtration rate, hemoglobin, loop diuretic dose, β-blocker, Angiotensin converting enzyme inhibitor/Angiotensin-2 receptor blocker and statin treatments, and hs-cTnT, ST2, and NT-proBNP levels. The calculator may run with the availability of none, one, two, or the three biomarkers. The calculated risk of death was significantly changed by additive biomarker data. The average C-statistic in cross-validation analysis was 0.79. Conclusions: A new HF risk-calculator that incorporates available biomarkers reflecting different pathophysiological pathways better allowed individual prediction of death at 1, 2, and 3 years.

TNF and angiotensin type 1 receptors interact in the brain control of blood pressure in heart failure

Tymoteusz Zera, Marcin Ufnal, Ewa Szczepanska-Sadowska
Cytokine 71 (2015) 272–277
http://dx.doi.org/10.1016/j.cyto.2014.10.019

Accumulating evidence suggests that the brain renin-angiotensin system and proinflammatory cytokines, such as TNF-α, play a key role in the neuro-hormonal activation in chronic heart failure (HF). In this study we tested the involvement of TNF-α and angiotensin type 1 receptors (AT1Rs) in the central control of the cardiovascular system in HF rats. Methods: we carried out the study on male Sprague–Dawley rats subjected to the left coronary artery ligation (HF rats) or to sham surgery (sham-operated rats). The rats were pretreated for four weeks with intracerebroventricular (ICV) infusion of either saline (0.25 µl/h) or TNF-α inhibitor etanercept (0.25 µg/0.25 µl/h). At the end of the pretreatment period, we measured mean arterial blood pressure (MABP) and heart rate (HR) at baseline and during 60 min of ICV administration of either saline (5 µl/h) or AT1Rs antagonist losartan (10 µg/5 µl/h). After the experiments, we measured the left ventricle end-diastolic pressure (LVEDP) and the size of myocardial scar. Results: MABP and HR of sham-operated and HF rats were not affected by pretreatments with etanercept or saline alone. In sham-operated rats the ICV infusion of losartan did not affect MABP either in saline or in etanercept pretreated rats. In contrast, in HF rats the ICV infusion of losartan significantly decreased MABP in rats pretreated with saline, but not in those pretreated with etanercept. LVEDP was significantly elevated in HF rats but not in sham-operated ones. Surface of the infarct scar exceeded 30% of the left ventricle in HF groups, whereas sham-operated rats did not manifest evidence of cardiac scarring. Conclusions: our study provides evidence that in rats with post-infarction heart failure the regulation of blood pressure by AT1Rs depends on centrally acting endogenous TNF-α.

Statins in heart failure—With preserved and reduced ejection fraction. An update

Dimitris Tousoulis , E Oikonomou, G Siasos, C Stefanadis
Pharmacology & Therapeutics 141 (2014) 79–91
http://dx.doi.org/10.1016/j.pharmthera.2013.09.001

HMG-CoA reductase inhibitors or statins beyond their lipid lowering properties and mevalonate inhibition exert also their actions through a multiplicity of mechanisms. In heart failure (HF) the inhibition of isoprenoid intermediates and small GTPases, which control cellular function such as cell shape, secretion and proliferation, is of clinical significance. Statins share also the peroxisome proliferator-activated receptor pathway and inactivate extracellular-signal-regulated kinase phosphorylation suppressing inflammatory cascade. By down-regulating Rho/Rho kinase signaling pathways, statins increase the stability of eNOS mRNA and induce activation of eNOS through phosphatidylinositol 3-kinase/Akt/eNOS pathway restoring endothelial function. Statins change also myocardial action potential plateau by modulation of Kv1.5 and Kv4.3 channel activity and inhibit sympathetic nerve activity suppressing arrhythmogenesis. Less documented evidence proposes also that statins have antihypertrophic effects – through p21ras/mitogen activated protein kinase pathway – which modulate synthesis of matrix metalloproteinases and procollagen 1 expression affecting interstitial fibrosis and diastolic dysfunction. Clinical studies have partly confirmed the experimental findings and despite current guidelines new evidence supports the notion that statins can be beneficial in some cases of HF. In subjects with diastolic HF, moderately impaired systolic function, low B-type natriuretic peptide levels, exacerbated inflammatory response and mild interstitial fibrosis evidence supports that statins can favorably affect the outcome. Under the lights of this evidence in this review article we discuss the current knowledge on the mechanisms of statins’ actions and we link current experimental and clinical data to further understand the possible impact of statins’ treatment on HF syndrome.

Since 1980 when the first 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase inhibitor or statin was introduced in clinical practice, statins have been extensively used in the treatment of patients with dyslipidemia as well as of those with coronary artery disease (CAD). Importantly, large scale trials and metanalysis have documented their significant benefits in terms of primary and secondary CAD prevention which out-weigh any potential side effects. Statins’ benefits extend, according to recent studies, even in patients with normal or low cholesterol levels and beyond their lipid lowering effects, indicating their multiple protective mechanisms.

Heart failure (HF) is a complex syndrome with different definitions and its diagnosis is based on a combination of symptoms, clinical signs and imaging or laboratory data. different categorization schemes have been used dividing HF in acute or chronic, in systolic or diastolic, and in ischemic or dilated simply reflecting the complexity of the syndrome and the multiplicity of the pathophysiologic mechanisms implicated in the disease development and progression. In addition to the diverse pathophysiology of HF the syndrome is also characterized by high morbidity and mortality. Recent treatment advantages such as angiotensin converting enzyme inhibitors and beta blockers have not yet proven their clinical benefit in subjects with diastolic HF.

As the most common cause of HF is CAD and statins have proven their benefits in a wide spectrum of diseases directly or indirectly associated with atherosclerotic cardiovascular disease, HMG-CoA reductase inhibitors have been tested in subjects with HF. Interestingly, non-randomized, observational and retrospective early studies in subjects with HF of ischemic and non-ischemic etiology have suggested that statins are associated with improved outcomes. Thereafter, two large scale randomized control trials failed to demonstrate any benefits in mortality of HF patients treated with rosuvastatin and subsequently current HF guidelines do not include recommendations for statin use except from when they are indicated for comorbidities, such as established CAD.

Statins inhibit HMG-CoA reductase. This enzyme catalyzes the conversion of 3-hydroxy-3-methylglutaryl-coenzyme A to L-mevalonic acid, which is the rate-limiting step in the cholesterol synthesis pathway. Inhibition of the mevalonate pathway and of cholesterol synthesis triggers an increase in LDL receptor activity by stimulating production of mRNA for LDL receptor in liver. The induction of LDL receptors is responsible for the observed increase in plasma clearance of LDL cholesterol. CAD is the cause of approximately two-thirds of cases of systolic HF. The beneficial effects of statins-induced LDL reduction are well established in patients with atherosclerosis and CAD. Nevertheless, the results from statin treatment, even in ischemic HF cases, are not straightforward and several mechanisms have been proposed for this paradox.

multiplicity of HMG CoA reductase inhibitors mechanisms and their effects

multiplicity of HMG CoA reductase inhibitors mechanisms and their effects

The figure demonstrates the multiplicity of HMG CoA reductase inhibitors mechanisms and their effects. ↓: decrease; ↑ increase; FPP: farnesyl pyrophosphate: GGPP: geranylgeranyl pyrophosphate; Ras, Rac, Rho; small GTPases; eNOS: endothelial nitric oxide synthase; ATP: adenosine triphosphate; PI-3 kinase: phosphatidylinositol 3-kinase; AMPK: AMP activated protein kinase; GTP: Guanosine triphosphate; NADPH: Nicotinamide adenine dinucleotide phosphate; ERK: extracellular-signal-regulated kinase; Shadow box represents adverse mechanism and actions of HGM CoA reductase inhibitors.

The anti-inflammatory effects of HMG CoA reductase inhibitors in atherosclerosis have been early recognized. Statins also have a potent anti-inflammatory effect in HF models. Importantly, there is a link between inflammation and HF pathogenesis and is now widely accepted that pro-inflammatory cytokines cause systolic dysfunction, myocardial hypertrophy, activate a fetal gene program in cardiac myocytes, disturb extracellular matrix structure, cause cardiac cachexia etc. In addition, data from the Vesnarinone trial (VEST) in 384 patients with HF demonstrate a decline in survival with increasing TNFα levels confirming the notion that circulating cytokines are associated with adverse prognosis of HF patients.

The proposed, by the aforementioned mechanisms, anti-inflammatory effects of statins have been confirmed experimentally. Indeed, in a rat HF model with preserved ejection fraction (EF), treatment with rosuvastatin resulted in a significant additional improvement in HF and cardiac remodeling, partly due to decreased myocardial inflammation. In rats after acute myocardial infarction simvastatin treatment for 4 weeks beneficially modified the levels of TNFα, interleukin (IL)-1, 6 and 10 in the infarct regions. Importantly, in 446 patients with systolic HF, followed up for a period of 24 months, statins’ treatment was associated with a decrease in serum levels of C-reactive protein (CRP), IL-6 and tumor necrosis factor-alpha receptor II. Recently, in a randomized study of 22 subjects with ischemic HF short term atorvastatin treatment achieved a significant decrease in serum levels of intracellular adhesion molecule-1.

Taken together we can conclude that HMG CoA reductase inhibitors can modify inflammatory status by modulation of PRAP and ERK pathways by down regulating Toll like receptor 4 mRNA expressions and LDL oxidation and by reducing soluble lipoprotein-associated phospholipase A2 mass and activity. Importantly, the theoretical anti-inflammatory properties were confirmed in experimental and clinical HF models.

Endothelial dysfunction contributes to the pathogenesis of HF and can enhance adverse left ventricle (LV) remodeling and increase afterload in subjects with HF. Interestingly, statins have been constantly associated with improved endothelial function in subjects with a variety of cardiovascular diseases. Endothelium derived nitric oxide (NO) is an important determinant of endothelial function and HMG-CoA reductase inhibitors can up regulate endothelial NO synthase (eNOS) by different mechanisms.

Statins induce down regulation of Rho/Rho kinase signaling pathways, increasing the stability of eNOS mRNA and its expression . In addition, in human endothelial cells the Rho-kinase inhibitor, hydroxyfasudil leads to the activation of the phosphatidylinositol 3-kinase/Akt/eNOS pathway. Statins also induce activation of eNOS through the rapid activation of the serine–threonine protein kinase Akt. The beneficial effects of Akt activation are not limited to eNOS phoshorylation but extend to the promotion of new blood vessels growth. HMG CoA reductase inhibitors can further affect endothelial function through their effect on caveolin-1. Caveolin-1 binds to eNOS inhibiting NO production. Incubation of endothelial cells with atorvastatin promotes NO production by decreasing caveolin-1 expression, regardless of the level of extracellular LDL-cholesterol. These effects were reversed with mevalonate highlighting the therapeutic potential of inhibiting cholesterol synthesis in peripheral cells to correct NO-dependent endothelial dysfunction associated with hypercholesterolemia and possibly other diseases.

Although the experimentally confirmed benefits of HMG CoA reductase inhibitors in diastolic dysfunction and left ventricle stiffness, few data exist concerning the underlying mechanisms. As diastolic dysfunction precedes myocardial hypertrophy the anti-hypertrophic pathways mentioned in the previous section (inhibition of RhoA/Ras/ERK, PRAPγ pathways, inhibition of a large G(h) protein-coupled pathway etc.), may also contribute to the restoration of diastolic function. Moreover, in angiotensin II induced diastolic dysfunction in hypertensive mice, pravastatin not only improved diastolic function but also down-regulated collagen I, transforming growth factor-beta, matrix metalloproteinases (MMPs)-2 and -3, atrial natriuretic factor, IL-6 TNFα, Rho kinase 1 gene expression, and upregulated eNOS gene expression. These findings suggest the potential involvement of Rho kinase 1 in the beneficial effects of pravastatin in diastolic HF. Taken together data suggest that HMG CoA reductase inhibitors might be beneficial in patients with diastolic HF, a hypothesis that remains to be confirmed by clinical studies. Nevertheless, mechanistic studies have not fully explored the pathways affecting diastolic function and most data until now are indirect. Therefore efforts should be focus on the underline mechanisms affecting collagen synthesis, MMPs activity extracellular matrix synthesis and overall diastolic function in HF subjects under statin treatment.

Statins through inhibition of small GTPases can modulate MMPs activity in several cell types such as endothelial cells and human macrophages. In rat and human cardiac fibroblasts, stimulated with either transforming growth factor β1 or angiotensin II, atorvastatin reduced collagen synthesis and α1-procollagen mRNA as well as gene expression of the profibrotic peptide connective tissue growth factor 4. This antifibrotic action may contribute to the anti-remodelling effect of statins. In mouse cardiac fibroblasts treated with angiotensin II, the combination of pravastatin and pioglitazone blocked angiotensin II p38 MAPK and p44/42 MAPK activation and procollagen expression-1.

Several studies have documented the impact of statin treatment on arrhythmia potential. The arrhythmic protective effects of statins can be attributed not only to anti-inflammatory properties but also to changes in myocardial action potential plateau by modulation of Kv1.5 and Kv4.3 channel activity. Atorvastatin and simvastatin block Kv1.5 and Kv4.3 channels shifting the inactivation curve to more negative potentials following a complex mechanism that does not imply the binding of the drug to the channel pore. Moreover, in hypertrophied neonatal rat ventricular myocytes simvastatin alleviated the reduction of Kv4.3 expression, I(to) currents in subepicardial myocardium from the hypertrophied left ventricle. Furthermore, pravastatin in an animal model attenuated reperfusion induced lethal ventricular arrhythmias by inhibition of calcium overload.

Taking together experimental and cellular evidence supporting an effect of statin treatment in myocardial contractility is spare and for the time being we cannot definitively conclude on the clinical impact of HMG CoA reductase inhibitors in myocardial systolic performance.

Half of the cases of HF are attributed to diastolic dysfunction and the prognosis of HF with preserved EF is as ominous as the prognosis of HF with systolic dysfunction. Unfortunately, no treatment has yet been shown, convincingly, to reduce morbidity and mortality in patients with HF and preserved EF, while this group of patients is usually excluded from large prospective randomized trials and accordingly few data exist for the role of statins in this heterogeneous population.

As there is substantially lack of evidence concerning the effects of HMG CoA reductase inhibitors in subjects with HF and preserved EF the first indirect hypothesis was extrapolated from observational prospective studies in subjects with ischemic heart disease and no evidence of congestive HF. Indeed, in a cohort of 430 consecutive patients with ischemic heart disease and a mean EF of 57% Okura et al. observed that subjects under HMG CoA reductase inhibitors treatment had decreased E/E′ ratio—corresponding to a better diastolic function—and a significantly higher survival rate (Okura et al., 2007). According to the authors those beneficially effects can be attributed to improved endothelial function and vasodilatory response to reactive hyperemia, attenuation of myocardial hypertrophy, and interstitial fibrosis.

Despite the positive results from mechanistic and experimental studies clinical studies have failed to confirm a definitive role of HMG CoA reductase inhibitors in HF. Nevertheless, by extrapolating experimental and mechanistic data in clinical settings we further understand how HMG-CoA reductase inhibitors can beneficially affect subgroups of HF subjects such as those with preserved EF, low B-type natriuretic peptide levels, exacerbated inflammatory response and limited interstitial fibrosis. Nevertheless, as a definitive mechanism is lacking, there is uncertainty about the decisive mode of action and further mechanistic studies are needed to reveal how HMG-CoA reductase inhibitors act in HF substrate.

Pro- A-Type Natriuretic Peptide, Proadrenomedullin, and N-Terminal Pro-B-Type Natriuretic Peptide Used in a Multimarker Strategy in Primary Health Care in Risk Assessment of Patients with Symptoms of Heart Failure

Urban Alehagen, Ulf Dahlstr€Om,  Jens F. Rehfeld, And Jens P. Goetze
J Cardiac Fail 2013; 19(1):31-39. http://dx.doi.org/10.1016/j.cardfail.2012.11.002

Use of new biomarkers in the handling of heart failure patients has been advocated in the literature, but most often in hospital-based populations. Therefore, we wanted to evaluate whether plasma measurement of N-terminal pro-B-type natriuretic peptide (NT-proBNP), midregional pro-A-type  atriuretic peptide (MR-proANP), and midregional proadrenomedullin (MR-proADM), individually or combined, gives prognostic information regarding cardiovascular and all-cause mortality that could motivate use in elderly patients presenting with symptoms suggestive of heart failure in primary health care. Methods and Results: The study included 470 elderly patients (mean age 73 years) with symptoms of heart failure in primary health care. All participants underwent clinical examination, 2-dimenstional echocardiography, and plasma measurement of the 3 propeptides and were followed for 13 years. All mortality was registered during the follow-up period. The 4th quartiles of the biomarkers were applied as cutoff values. NT-proBNP exhibited the strongest prognostic information with 4-fold increased risk for cardiovascular mortality within 5 years. For all-cause mortality MR-proADM exhibited almost 2-fold and NTproBNP 3-fold increased risk within 5 years. In the 5e13-year perspective, NT-proBNP and MR-proANP showed significant and independent cardiovascular prognostic information. NT-proBNP and MR-proADM showed significant prognostic information regarding all-cause mortality during the same time. In those with ejection fraction (EF) !40%, MR-proADM exhibited almost 5-fold increased risk of cardiovascular mortality with 5 years, whereas in those with EF O50% NT-proBNP exhibited 3-fold increased risk if analyzed as the only biomarker in the model. If instead the biomarkers were all below the cutoff value, the patients had a highly reduced mortality risk, which also could influence the handling of patients. Conclusions: The 3 biomarkers could be integrated in a multimarker strategy for use in primary health care.

Novel Biomarkers in Heart Failure with Preserved Ejection Fraction

Kevin S. Shah, Alan S. Maisel
Heart Failure Clin 10 (2014) 471–479
http://dx.doi.org/10.1016/j.hfc.2014.04.005

KEY POINTS

  • Heart failure with preserved ejection fraction (HFPEF) is a common subtype of congestive heart failure for which therapies to improve morbidity and mortality have been limited thus far.
  • Numerous biomarkers have emerged over the past decade demonstrating prognostic significance in HFPEF, including natriuretic peptides, galectin-3, soluble ST2, and high-sensitivity troponins.
  • These markers reflect the multiple mechanisms implicated in the pathogenesis of HFPEF, and future research will likely use these markers to not only help determine heart failure phenotypes but also target specific therapies.

Heart failure (HF) is a global epidemic, defined as an abnormality of cardiac function leading to the inability to deliver oxygen at a rate adequate to meet the requirements of tissues. It is truly a clinical syndrome of symptoms and signs resulting from this cardiac abnormality. Over the past decade, further characterization into 2 entities has occurred: HF with preserved ejection fraction (HFPEF) and HF with reduced ejection fraction (HFREF). HFPEF, previously termed diastolic HF, encompasses the syndrome of HF with a preserved ejection fraction. Cutoffs for this ejection fraction typically are from 45% to 50%. The prevalence of HF is upward of 1% to 2% of the adult population, with an increased prevalence found in elderly and female patients. Multiple studies have shown that the prevalence of HFPEF is actually comparable with the number of patients with HFREF. As expected, most deaths from HFPEF are cardiovascular, comprising 51% to 70% of mortality.

The pathophysiology of HFPEF is controversial and remains poorly understood. Originally, HFPEF was thought to be a primary manifestation of diastolic dysfunction of the left ventricle. However, patients with HFREF are known to also commonly have impaired ventricular relaxation. The primary mechanism of left ventricular (LV) dysfunction is based on structural remodeling and endothelial dysfunction, lending itself to LV stiffness, and increased left atrial pressure. This pressure change is what drives pulmonary venous congestion and subsequent symptomatology. The ventricular stiffness commonly seen in HFPEF is attributed to multiple mechanisms, including fibrosis, excessive collagen deposition, cardiomyocyte stiffness, and slow LV relaxation.

The natriuretic peptides (NPs) are the cornerstone biomarker in congestive HF (CHF). Many of the details of the role of NPs are covered in an article – Florea VG, Anand IS. Biomarkers. Heart Fail Clin 2012;8(2):207–24. The Breathing Not Properly trial originally helped establish the role of B-type natriuretic peptide (BNP) in the diagnosis of CHF. BNP and the N-terminal prohormone BNP (NT-proBNP) have been shown in numerous trials to be an excellent tool for ruling out CHF as a cause of acute dyspnea. Aside from a strong negative predictive value, NPs correlate with HF severity, prognostication, outpatient CHF management, and screening. When attempting to use NPs specifically to distinguish between HFPEF and HFREF, results have shown that NPs do not have a particular cutoff, but are typically elevated in HFPEF in comparison with patients without HF. These levels of NPs in HFPEF are typically lower than levels in patients with HFREF.

Although the role of novel renal biomarkers has not been fully explored specifically in HFPEF, they likely have an impactful role in the assessment and management of acute kidney injury (AKI) and the cardiorenal syndrome. Two biomarkers are briefly discussed here: neutrophil gelatinase-associated lipocalin (NGAL) and cystatin C. NGAL is a 25-kDa protein in the lipocalin family of proteins with a role in inflammation and immune modulation.

The future of biomarkers and their utility in HF is very promising, starting with the potential for using biomarkers as end points in trials. Biomarkers serve as surrogates for various pathophysiologic mechanisms, and there are potential benefits in using them as trial end points. Advantages include the ability to obtain quick and early data, as well as possibly better understand the nature of the disease. However, the counterargument against using biomarkers as trial end points includes whether treatment effects on a biomarker reliably predict effects on a clinically meaningful end point.
Reduced cGMP signaling activates NF-κB in hypertrophied hearts of mice lacking natriuretic peptide receptor-A

Elangovan Vellaichamy, Naveen K. Sommana, Kailash N. Pandey
Biochemical and Biophysical Research Communications 327 (2005) 106–111
http://dx.doi.org:/10.1016/j.bbrc.2004.11.153

Mice lacking natriuretic peptide receptor-A (NPRA) develop progressive cardiac hypertrophy and congestive heart failure. However, the mechanisms responsible for cardiac hypertrophic growth in the absence of NPRA signaling are not yet known. We sought to determine the activation of nuclear factor-κB (NF-κB) in Npr1 (coding for NPRA) gene-knockout (Npr1-/-) mice exhibiting cardiac hypertrophy and fibrosis. NF-κB binding activity was 4-fold greater in the nuclear extract of Npr1-/-mutant mice hearts as compared with wild-type (Npr1+/+) mice hearts. In parallel, inhibitory κB kinase-b activity and IκB-α protein phosphorylation were also increased 3- and 4-fold, respectively, in hypertrophied hearts of mutant mice. cGMP levels were significantly reduced 5-fold in plasma and 10-fold in ventricular tissues of mutant mice hearts  relative to wild-type controls. The present findings provide direct evidence that ablation of NPRA/cGMP signaling activates NF-κB binding activity associated with hypertrophic growth of mutant mice hearts.

Regulation of guanylyl cyclase/natriuretic peptide receptor-A gene expression

Renu Garg, Kailash N. Pandey
Peptides 26 (2005) 1009–1023
http://dx.doi.org:/10.1016/j.peptides.2004.09.022

Natriuretic peptide receptor-A (NPRA) is the biological receptor of the peptide hormones atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP). The level and activity of this receptor determines the biological effects of ANP and BNP in different tissues mainly directed towards the maintenance of salt and water homeostasis. The core transcriptional machinery of the TATA-less Npr1 gene, which encodes NPRA, consists of three SP1 binding sites and the inverted CCAAT box. This promoter region of Npr1 gene has been shown to contain several putative binding sites for the known transcription factors, but the functional significance of most of these regulatory sequences is yet to be elucidated. The present review discusses the current knowledge of the functional significance of the promoter region of Npr1 gene and its transcriptional regulation by a number of factors including different hormones, growth factors, changes in extracellular osmolarity, and certain physiological and patho-physiological conditions.

Atrial natriuretic peptide (ANP), a member of natriuretic peptide family is a polypeptide consisting of 28 amino acids and was discovered as a potent vasodilator and diuretic hormone produced in granules of the atrium. The natriuretic peptide family consists of the peptide hormones ANP, brain natriuretic peptide (BNP) and C-type natriuretic peptide (CNP), each of which is derived from a separate gene. ANP and BNP are cardiac derived peptides, which are secreted and up-regulated in myocardium in response to different patho-physiological stimuli, while CNP is an endothelium-derived mediator that plays an important paracrine role in the vasculature. All of these natriuretic peptides elicit a number of vascular, renal, and endocrine effects mainly directed towards the maintenance of blood pressure and extracellular fluid volume by binding to their specific cell surface receptors. ANP exerts its effects at a number of sites including the kidney, where it produces natriuretic and diuretic responses; the adrenal gland, where it inhibits aldosterone synthesis and secretion; vascular smooth muscle cells, where it produces vasorelaxation; the endothelial cells, where it may regulate vascular permeability; gonadal cells, where it affects synthesis of androgen and estradiol. Each of these target sites of ANP activity has been shown to possess specific high affinity receptors for ANP. To date, three different subtypes of natriuretic peptide receptors have been characterized, purified, and cloned, i.e. natriuretic peptide receptors A, B, and C also designated as NPRA, NPRB, and NPRC, respectively. ANP and BNP specifically bind to NPRA, which contains guanylyl cyclase catalytic activity and produces intracellular secondary messenger cGMP in response to hormone binding.

NPRA is considered the biological receptor of ANP and BNP because most of the physiological effects of these hormones are triggered by generation of cGMP or its cell permeable analogs. Recent studies with mice lacking the Npr1 gene, demonstrated that genetic disruption of NPRA increases the blood pressure and causes hypertension in these animals. On the other hand, the effect of ANP was found to be increased linearly in Npr1 gene-duplicated mice
in a manner consistent with gene copy number. All this clearly indicates that the level of NPRA expression determines the extent of the biological effects of ANP and BNP. But the intervention strategies aimed at controlling NPRA expression are limited by the paucity of studies in this area. The cDNA and gene encoding NPRA designated as Npr1 has been cloned and characterized in mouse, rat, bull frog, euryhaline eel, and medaka fish. The primary structure of this gene is essentially same in all the different species and contains 22 exons interrupted by 21 introns.  The Npr1 gene sequence has been found to be interspersed with a number of repetitive elements including (SINES), (MER2), and tandem repeat elements in all the different species.

Although the Npr1 gene transcriptional regulation is only poorly understood, the activity and expression of NPRA assessed primarily through ANP stimulated cGMP accumulation are found to be regulated by a number of factors including auto-regulation by natriuretic peptides themselves, other hormones such as endothelin, glucocorticoids, and angiotensin II (ANG II), growth factors, changes in extracellular ion composition, and certain physiological and patho-physiological conditions.

The core molecular machinery of the TATA-less Npr1 gene consisting of SP1 binding sites and the inverted CCAAT box has been authenticated to be indeed functional in rat promoter element. It has been shown that the molecular machinery that regulates the basal expression of Npr1 gene consists of three SP1 binding sites in conjunction with an inverted CCAAT box present in the proximal promoter region. Mutation in any of these SP1 binding sites which
are located within 350 bp upstream of transcription start site in rat Npr1 promoter inhibited SP1 and SP3 binding and decreased the promoter activity by 50–75%, while simultaneous mutation of all the three led to a >90% reduction in promoter activity. The proximal SP1 binding site was much more effective than the distal sites in inducing the expression implying that the proximity to the core transcriptional machinery contributes to the magnitude of the observed effect. The over-expression of either SP1 or SP3 resulted in the induction of the wild type Npr1 promoter, confirming that these transcription factors serve as positive regulators of the Npr1 gene expression.

A number of natriuretic peptides such as ANP, BNP, CNP, and urodilatin (i.e. ANP95–126) can down-regulate ligand dependent NPRA activity after as little as 2 h prior exposure to the ligand, which remains suppressed until 48 h of exposure in cultured cells. The early reduction of NPRA activity is independent of changes in Npr1 gene expression as the pretreatment of cultured cells with actinomycin D (an inhibitor of transcription) for 1 h failed to block the response to ANP implying that ligand acts, at least early on, through a post transcriptional mechanism in reducing NPRA activity. The sustained reduction of NPRA activity, on the other hand, has been shown in fact due to reduction in NPRA mRNA levels (∼50%) by treatment with 100nM ANP for 48 h. This reduction could also be affected by treatment of cultured cells with 8-Br-cGMP with similar kinetic response and was amplified by phosphodiesterase inhibitors, but was not shared by NPRC-selective ligand cANF, suggesting that the down regulation of Npr1 gene expression is mediated by elevations of intracellular cGMP involving either NPRA or NPRB. .. The cGMP regulatory region was pinpointed to position−1372 to−1354 bp from the transcription start site of Npr1 by gel shift assays and footprinting analysis, which indicated its interaction with transcriptional factor(s). Further cross-competition experiments with mutated oligonucleotides led to the definition of a consensus sequence (−1372 bp AaAtRKaNTTCaAcAKTY −1354 bp) for the novel cGMP-RE, which is conserved in the human (75% identity) and mouse (95% identity) Npr1 promoters. The combination of these transcriptional and post-transcriptional ligand-dependent regulatory mechanisms provides the cells with greater flexibility in both initiating and maintaining the suppression of NPRA activity.

The peptide hormone Ang II is an important component of renin-angiotensin system (RAS) and exerts its biological effects such as blood pressure regulation, vasoconstriction, and cell proliferation in many tissues including the kidney, adrenal glands, brain, and vasculature. The two vasoactive peptide hormones, Ang II (vasoconstrictive) and ANP (vasodilatory), interact and mutually antagonize the biological effects of each other at various levels. ANP has been shown to inhibit Ang II-induced contraction of isolated glomeruli and cultured mesangial cells, as well as Ang II-stimulated activation of protein kinase C and mitogen activated protein kinase in vascular smooth muscle cells in a cGMP-dependent manner. Inversely, Ang II has been shown to down-regulate guanylyl cyclase activity of the biological receptor of ANP, NPRA, by activating protein kinase C and/or by stimulating protein tyrosine phosphatase activity, thereby inhibiting the ANP stimulated cGMP accumulation. Ang II also reduces the ANP dependent cGMP levels by stimulating cGMP hydrolysis, apparently
via a calcium dependent cGMP phosphodiesterase.

Endothelin is a vasoconstrictor peptide that was originally isolated from porcine endothelial cells. It is produced as three isoforms (ET1-3) that bind to two receptor subtypes (ETA and ETB). ET is produced in the kidney and subject to regulation by a number of local and systemic factors including immune cytokines and extracellular tonicity. Since, endothelin is avidly expressed in the nephron segment, where NPRA is up-regulated by osmotic stimulus, it was investigated whether endothelin plays a role in the control of basal or osmotically regulated Npr1 gene expression in these cells. The endogenous endothelin and not the exogeneously administered endothelin inhibit the basal but not osmotically stimulated expression of Npr1. The type A (BQ610) and type B (IRL 1038) endothelin receptor antagonists increased the level of NPRA mRNA by two to three-fold, whereas co-administration of exogenous endothelin resulted in partial reversal of this stimulatory effect of receptor antagonists. The increase in extracellular tonicity reduces the endothelin mRNA accumulation (∼15% of control levels) in inner medullary collecting duct cells but this reduction is not found to be linked to the stimulation of NPRA activity/expression in response to osmotic stress.

Glucocorticoids influence the cardiovascular system and induce a rapid increase in blood pressure. Glucocorticoids are known to regulate
transcription in many systems, possibly by interacting with glucocorticoid responsive elements and associated chromatin proteins. These have been shown to affect the atrial endocrine system by regulating both the synthesis and secretion of ANP in vitro and in vivo. Thus, it seems plausible that glucocorticoid may also interact with the atrial endocrine system by modulating ANP receptor levels. The stimulation of vascular smooth muscle cells from rat mesenteric artery with dexa-methasone (a highly specific synthetic glucocorticoid agonist) caused an increase in NPRA mRNA levels in a time dependent manner which reached a plateau after 48 h of glucocorticoid administration. This mRNA increase was mimicked by cortisol and inhibited by glucocorticoid receptor antagonists RU38486. Also cGMP generated by NPRA in dexamethasone treated cells was higher than in control cells and this production was mimicked by cortisol and blocked by RU 38486. These results suggest that glucocorticoids exert a positive effect on NPRA transcription in rat mesenteric arteries.

Previous studies have shown that guanylyl cyclase activity of NPRA is either activated, or inhibited by an increase in extracellular tonicity. Though none of these studies were definitive in terms of elucidating the mechanisms involved, they suggested that the activation predominates with longer exposure (∼24 h), while the inhibition with short-term exposure (minutes) to the osmotic stimulus. More recently, the mechanism(s) underlying the activation of NPRA expression by osmotic stimulus has been investigated. The NaCl (75 mM) or sucrose (150 mM), but not osmotically inert solute, urea (150 mM) increased NPRA activity, gene expression, and promoter activity after as early as 4 h reaching a maximum at 24 h in inner medullary collecting duct cells. The osmotic stimulus also activated extracellular signal regulated kinase (ERK), c-Jun-NH2-terminal kinase (JNK), and p38 mitogen activated protein kinase- (p38 MAPK-β). The inhibition of p38 MAPK-βwith SB20580 completely  blocked the osmotic stimulation of receptor activity and expression, and caused a dose-dependent reduction in promoter activity, whereas inhibition of ERK with PD98059 had no effect.

The expression of NPRB, the biological receptor of CNP, has been shown to be regulated by a number of factors including natriuretic peptide ligands, intracellular cAMP levels, water deprivation, TGF-1, dexamethasone treatment, as well as renal sodium status, as its mRNA levels were upregulated in the renal cortex of sodium depleted animals. NPRB expression has also been found to be regulated by alternative splicing. Three isoforms of NPRB have been identified of which NPRB1 is the full length form and responds maximally to CNP, NPRB2 isoform contains a 25 amino acid deletion in protein kinase homology domain and NPRB3 contains a partial extracellular ligand binding domain and fails to bind the ligand. The relative expression levels of the three isoforms vary across different tissues. Since, the smaller splice variants of NPRB act as dominant negative isoforms by blocking formation of active NPRB1 homodimers, these isoforms might play important role in the tissue specific regulation of receptor, NPRB.

The NPRC expression has also been found to be down-regulated by its ligands and their secondary messenger, cGMP, hormones, growth factors, dietary salt supplementation, β-adrenergic blocker, and physiological as well as patho-physiological conditions. On the other hand, NPRC expression gets augmented by TGF-β1, 1,25-dihydroxy VitaminD3 and during conditions like chronic heart failure.

Hypertension is the leading cause of human deaths in today’s world. The natriuretic peptide system plays a well defined role in the regulation of blood pressure and fluid volume. The cellular and physiological effects of natriuretic peptides (ANP, BNP, and CNP) are mediated by their specific receptors NPRA, NPRB, and NPRC. The transcriptional regulation of these receptors has been studied since their identification, but still remains poorly understood. Better understanding and the elucidation of different molecular mechanisms responsible for the regulation of NPRA expression would provide us the framework to develop the therapeutic strategies to manipulate the expression levels of this receptor and to control the biological actions of ANP and BNP during different patho-physiological conditions.

Inhibition of Heat Shock Protein 90 (Hsp90) in Proliferating Endothelial Cells Uncouples Endothelial Nitric Oxide Synthase Activity

Jingsong Ou, Zhijun Ou, AW Ackerman, KT Oldham, & KA Pritchard, Jr.
Free Radical Biol Med 2003; 34(2):269–276
PII S0891-5849(02)01299-6

Dual increases in nitric oxide (•NO) and superoxide anion (O2•-) production are one of the hallmarks of endothelial cell proliferation. Increased expression of endothelial nitric oxide synthase (eNOS) has been shown to play an important role in maintaining high levels of •NO generation to offset the increase in O2•- that occurs during proliferation. Although recent reports indicate that heat shock protein 90 (hsp90) associates with eNOS to increase •NO generation, the role of hsp90 association with eNOS during endothelial cell proliferation remains unknown. In this report, we examine the effects of endothelial cell proliferation on eNOS expression, hsp90 association with eNOS, and the mechanisms governing eNOS generation of •NO and O2•-. Western analysis revealed that endothelial cells not only increased eNOS expression during proliferation but also hsp90 interactions with the enzyme. Pretreatment of cultures with radicicol (RAD, 20 µM), a specific inhibitor that does not redox cycle, decreased A23187-stimulated •NO production and increased Lω-nitroargininemethylester (L-NAME)-inhibitable O2•-generation. In contrast, A23187 stimulation of controls in the presence of L-NAME increased O2•- generation, confirming that during proliferation eNOS generates •NO. Our findings demonstrate that hsp90 plays an important role in maintaining •NO generation during proliferation. Inhibition of hsp90 in vascular endothelium provides a convenient mechanism for uncoupling eNOS activity to inhibit •NO production. This study provides new understanding of the mechanisms by which ansamycin antibiotics inhibit endothelial cell proliferation. Such information may be useful in the development and design of new antineoplastic agents in the future.

Natriuretic Peptides, Ejection Fraction, and Prognosis – Parsing the Phenotypes of Heart Failure

James L. Januzzi, JR
J Amer Coll Cardiol 2013; 61(14): 1507-9
http://dx.doi.org/10.1016/j.jacc.2013.01.039

Since the first pivotal studies introduced the natriuretic peptides as biomarkers for the diagnosis of heart failure (HF), use of both B-type natriuretic peptide (BNP) and its N-terminal equivalent (NT-proBNP) has grown not only for this indication, but also for establishing HF prognosis as well. Indeed, a vast array of studies has established the natriuretic peptides as the biomarker gold standard to prognosticate risk for a wide array of relevant complications in HF (ranging from ventricular arrhythmias to pump failure). In these studies, the prognostic information provided by BNP and NT-proBNP in HF was independent of a number of relevant covariates, including left ventricular ejection fraction (LVEF).

It has been known for quite a while that patients with heart failure and preserved ejection fraction (HFpEF) typically have lower natriuretic peptide values than do those with heart failure and reduced ejection fraction (HFrEF). A conundrum is thus present: whereas both BNP and NTproBNP tend to be lower in HFpEF, when these peptides are elevated in this setting, they remain prognostic; this intriguing circumstance has been relatively poorly studied. It is in this setting that van Veldhuisen et al. examined the impact of LVEF on the prognostic merits of BNP in the COACH (Coordinating Study Evaluating Outcomes of Advising and Counseling in Heart Failure) study in the present issue of the Journal. The investigators found—as expected—that BNP levels were lower in HFpEF, but for a given BNP concentration, prognosis of those with HFpEF in COACH was just as poor as those with HFrEF at matched BNP values. Stated differently, a high BNP in a patient with HFpEF imparted similar prognostic information as it would in someone with HFrEF. Actually, whereas LVEF was not obviously prognostically impactful, when considered across the range of ventricular function, an elevated BNP concentration in the most normal range of LVEF seemed to be associated with a higher risk than at the lower ranges of pump function. Although it is previously established that BNP or NT-proBNP are prognostic independently of LVEF, the well-executed analysis by van Veldhuisen et al. (van Veldhuisen DJ, Linssen GCM, Jaarsma T, et al. B-type natriuretic peptide and prognosis in heart failure patients with preserved and reduced ejection fraction. J Am Coll Cardiol 2013;61:1498–506.) allows for a more in-depth examination of this phenomenon and raises some important questions.

Phenotypic Definition of the Patient With Heart Failure

Phenotypic Definition of the Patient With Heart Failure

Phenotypic Definition of the Patient With Heart Failure

Natriuretic Peptides in Heart Failure with Preserved Ejection Fraction

Mark Richards, James L. Januzzi Jr, Richard W. Troughton
Heart Failure Clin 10 (2014) 453–470
http://dx.doi.org/10.1016/j.hfc.2014.04.006

KEY POINTS

  • Threshold values of B-type natriuretic peptide (BNP) and N-terminal prohormone B-type natriuretic peptide (NT-proBNP) validated for diagnosis of undifferentiated acutely decompensated heart failure (ADHF) remain useful in patients with heart failure with preserved ejection fraction (HFPEF), with minor loss of diagnostic performance.
  • BNP and NT-proBNP measured on admission with ADHF are powerfully predictive of in-hospital mortality in both HFPEF and heart failure with reduced EF (HFREF), with similar or greater risk in HFPEF as in HFREF associated with any given level of either peptide.
  • In stable treated heart failure, plasma natriuretic peptide concentrations often fall below cut-point values used for the diagnosis of ADHF in the emergency department; in HFPEF, levels average approximately half those in HFREF.
  • BNP and NT-proBNP are powerful independent prognostic markers in both chronic HFREF and chronic HFPEF, and the risk of important clinical adverse outcomes for a given peptide level is similar regardless of left ventricular ejection fraction.
  • Serial measurement of BNP or NT-proBNP to monitor status and guide treatment in chronic heart failure may be more applicable in HFREF than in HFPEF.

 

The bioactivity of atrial NP (ANP) and B-type NP (BNP) encompasses short-term and longterm hemodynamic, renal, neurohormonal, and trophic effects. The relationship between cardiac hemodynamic load, plasma concentrations of ANP and BNP, and the cardioprotective profile of NP bioactivity have led to investigation of both biomarker and therapeutic potential of

NPs in HF.

PlasmaBNPandNT-proBNP thresholds (100pg/mL and 300 pg/mL, respectively) used in the diagnosis of undifferentiated ADHF retain good diagnosticperformance for acute HFPEF

 

Plasma NPs are related to multiple echo indicators of cardiac structure and function in both HFREF and HFPEF.
Box 1Causes of increased plasma cardiac natriuretic peptides

Cardiac

Heart failure, acute and chronic

Acute coronary syndromes

Atrial fibrillation

Valvular heart disease

Cardiomyopathies

Myocarditis

Cardioversion

Left ventricular hypertrophy

Noncardiac

Age

Female sex

Renal impairment

Pulmonary embolism

Pneumonia (severe)

Obstructive sleep apnea

Critical illness

Bacterial sepsis

Severe burns

Cancer chemotherapy

Toxic and metabolic insults

 

BNP and NT-proBNP fall below ADHF thresholds in stable HFREF in approximately 50% and 20% of cases, respectively. Levels in stable HFPEF are even lower, approximately half those in HFREF.
Whereas BNPs have 90% sensitivity for asymptomatic LVEF of less than 40% in the community (a precursor state for HFREF), they offer no clear guide to the presence of early community based HFPEF.
Guidelines recommend BNP and NT-proBNP as adjuncts to the diagnosis of acute and chronic HF and for risk stratification. Refinements for application to HFPEF are needed.
The prognostic power of NPs is similar in HFREF and HFPEF. Defined levels of BNP and NT-proBNP correlate with similar short-term and long-term risks of important clinical adverse outcomes in both HFREF and HFPEF.
Diagnostic algorithm for suspected heart failure presenting either acutely or nonacutely

Diagnostic algorithm for suspected heart failure presenting either acutely or nonacutely

Diagnostic algorithm for suspected heart failure presenting either acutely or nonacutely. a In the acute setting, mid-regional pro–atrial natriuretic peptide may also be used (cutoff point 120 pmol/L; ie, <120 pmol/L 5 heart failure unlikely). b Other causes of elevated natriuretic peptide levels in the acute setting are an acute coronary syndrome, atrial or ventricular arrhythmias, pulmonary embolism, and severe chronic obstructive pulmonary disease with elevated right heart pressures, renal failure, and sepsis. Other causes of an elevated natriuretic level in the nonacute setting are old age (>75 years), atrial arrhythmias, left ventricular hypertrophy, chronic obstructive pulmonary disease, and chronic kidney disease. c Exclusion cutoff points for natriuretic peptides are chosen to minimize the false-negative rate while reducing unnecessary referrals for echocardiography. d Treatment may reduce natriuretic peptide concentration, and natriuretic peptide concentrations may not be markedly elevated in patients with heart failure with preserved ejection fraction. BNP, B-type natriuretic peptide; ECG, electrocardiogram; NT-proBNP, N-terminal prohormone of B-type natriuretic peptide. (From McMurray JJ, Adamopoulos S, Anker SD, et al. The task force for the diagnosis and treatment of acute and chronic heart failure 2012 of the European Society of Cardiology. ESC guidelines for the diagnosis and treatment of acute and chronic heart failure 2012. Eur Heart J 2012;33:1787–847; with permission.)

Natriuretic Peptide Receptor-A Negatively Regulates Mitogen-Activated Protein Kinase and Proliferation of Mesangial Cells: Role of cGMP-Dependent Protein Kinase

Kailash N. Pandey, Houng T. Nguyen, Ming Li, and John W. Boyle
Biochem Biophys Res Commun 271, 374–379 (2000)
http://dx.doi.org:/10.1006/bbrc.2000.2627

peptide (ANP) and its guanylyl cyclase/natriuretic peptide receptor-A (NPRA) on mitogen-activated protein kinase/extracellular signal-regulated kinase 2 (MAPK/ERK2) activity in rat mesangial cells overexpressing NPRA. Agonist hormones such as platelet-derived growth factor (PDGF), fibroblast growth factor (FGF), angiotensin II (ANG II), and endothelin-1 (ET-1) stimulated 2.5- to 3.5-fold immunoreactive MAPK/ERK2 activity in these cells. ANP inhibited agonist-stimulated activity of MAPK/ERK2 by 65–75% in cells overexpressing NPRA, whereas in vector transfected cells, its inhibitory effect was only 18–20%. NPRA antagonist A71915 and KT5823, a specific inhibitor of cGMP-dependent protein kinase (PKG) completely reversed the inhibitory effect of ANP on MAPK/ERK2 activity. ANP also inhibited the PDGF stimulated [3H]thymidine uptake by almost 70% in cells overexpressing NPRA, as compared with only 20–25% inhibition in vector-transfected cells. These
results demonstrate that ANP/NPRA system negatively regulates MAPK/ERK2 activity and proliferation of mesangial cells in a PKG-dependent manner.

 

Regulation of lipoprotein lipase by Angptl4

Wieneke Dijk and Sander Kersten
Trends in Endocrin and Metab, Mar2014; 25(3):146-155
http://dx.doi.org/10.1016/j.tem.2013.12.005

Triglyceride (TG)-rich chylomicrons and very low density lipoproteins (VLDL) distribute fatty acids (FA) to various tissues by interacting with the enzyme lipoprotein lipase (LPL). The protein angiopoietin-like 4 (Angptl4) is under sensitive transcriptional control by FA and the FA-activated peroxisome proliferator activated receptors (PPARs), and its tissue expression largely overlaps with that of LPL. Growing evidence indicates that Angptl4 mediates the physiological fluctuations in LPL activity, including the decrease in
adipose tissue LPL activity during fasting. This review focuses on the major ambiguities concerning the mechanism of LPL inhibition by Angptl4, as well as on the physiological role of Angptl4 in lipid metabolism, highlighting its function in a variety of tissues, and uses this information to make suggestions for further research.

Box 1. LPL and TG metabolism

LPL belongs to a family of lipases that also includes hepatic lipase, pancreatic lipase, and endothelial lipase. Because LPL is essential in the lipolytic processing of chylomicrons and VLDL, LPL is primarily expressed in tissues that either require large amounts of FA as fuel or are responsible for TG storage, which include heart, skeletal muscle, and adipose tissue. Upon production by the underlying parenchymal cells, LPL is released into the subendothelial space and is transported to the luminal side of the capillary endothelium by the GPI-anchored protein GPIHBP1, which after transport continues to anchor LPL to the capillary endothelium. The essential role for LPL in the clearance of plasma TG is well-demonstrated by the severe hypertriglyceridemia of patients carrying homozygous mutations in the LPL gene. Generalized deletion of LPL in mice results in severe hypertriglycer-idemia, resulting in the premature death of pups within 24 h after birth. Analogous to the deletion of LPL, the mislocalization of LPL to the subendothelial spaces due the absence or misfolding of GPIHBP1 also results in severe chylomicronemia and hypertriglyceridemia. The LPL enzyme is catalytically active as a non-covalent head-to-tail dimer with a catalytic N-terminal domain and a non-catalytic C terminal domain. Folding of LPL into its dimer conformation occurs in the endoplasmic reticulum, chaperoned by lipase maturation factor 1, calreticulin, and calnexin. In its active 3D conformation, the catalytic site of LPL is postulated to be covered by a lid, which can be opened by the binding of chylomicrons and VLDL to the C terminus. The active LPL dimers rapidly exchange subunits, indicating that a dynamic equilibrium exists between LPL dimers and dimerization-competent monomers. Dimerization-competent monomers have, however, not yet been isolated, and it is unclear whether this monomer is catalytically active. The enzymatic activity of LPL is lost when the LPL dimer is converted into inactive, folded monomers. This conversion to inactive monomers is mainly regulated via post-translational mechanisms and is dependent on nutritional state. Enzymatic activity of inactive monomers can be regained in vitro by the addition of calcium, indicating that inactivation of LPL is a reversible process.

One of the key questions is whether (patho)physiological variations in LPL activity are mediated via regulation of Angptl4 cleavage and/or oligomerization, and which factors are involved in modulating Angptl4 in vivo. Recent biochemical evidence suggests that FA may be able to promote dissociation of oligomers, which, by destabilizing the protein, would impair its ability to inhibit LPL. Destabilization of Angptl4 by FA is, however, seemingly at odds with the marked stimulatory effect of FA on Angptl4 production observed in vitro and in vivo.

The currently accepted molecular model for the inhibition of LPL by Angptl4 is that Angptl4 stimulates the conversion of catalytically active LPL dimers into inactive monomers – following in vitro studies showing that coincubation of LPL and Angptl4 increases the abundance of LPL monomers. Subsequent studies revealed that the proportion of LPL dimers is reduced in post-heparin plasma of mice that overexpress Angptl4 in favor of LPL monomers, providing in vivo support for the dimer-to monomer conversion. The elucidation of the purported biochemical mechanism has strengthened the status of Angptl4 as a LPL inhibitor, but several questions related to the in vivo mechanism remain unanswered. Whereas the original in vitro experiments favored the hypothesis that Angptl4 enzymatically and irreversibly catalyzes the LPL dimer-to-monomer conversion, an in vivo study of Angptl4 transgenic mice suggested that Angptl4 is physically bound to LPL monomers, thereby driving the LPL dimer–monomer equilibrium towards inactive monomers. The latter study also revealed that the relative decrease in post-heparin plasma LPL activity upon Angptl4 overexpression is much more pronounced than the relative decrease in heparin-releasable LPL dimers, pointing to an additional or alternative mechanism. In support, a recently published study suggests that Angptl4, instead of acting as a catalyst, functions as a conventional, non-competitive inhibitor that binds to LPL to prevent the hydrolysis of substrate LPL and Angptl4 are regulated by changes in nutritional state in a tissue-specific manner, reflecting the different functions of these tissues and the corresponding variations in physiological requirements for lipids. Below, we discuss current knowledge on the regulation of Angptl4 and LPL in response to various physiological stimuli and address the importance of Angptl4 in lipid uptake. An overview of the role of Angptl4 in physiological regulation of lipid metabolism is presented in Figure 2.

model for mechanisms of lipoprotein lipase (LPL) inhibition by Angptl4.

model for mechanisms of lipoprotein lipase (LPL) inhibition by Angptl4.

Figure 1. Hypothetical model for mechanisms of lipoprotein lipase (LPL) inhibition by Angptl4. Angiopoietin-like 4 (Angptl4) and LPL are expressed in the parenchymal cells of muscle, heart, and adipose tissue. Following secretion of LPL and Angptl4 into the subendothelial space, transport of LPL to the capillary lumen is mediated by two mechanisms. The principal transport mechanism (1) relies on GPIHBP1 [glycosylphosphatidylinositol (GPI)-anchored high density lipoprotein-binding protein] picking up LPL from the subendothelial space and transporting it to the capillary lumen. This action by GPIHBP1 is opposed by Angptl4, which is bound to extracellular matrix (ECM) proteins and which retains and inhibits LPL. In the presence of GPIHBP1, high expression levels of Angptl4 are needed to overcome the competition with GPIHBP1. Angptl4 secreted into the capillary lumen, primarily as N-terminal truncation fragment generated by cleavage by proprotein convertases (PCs), inhibits LPL activity on the endothelium by promoting the irreversible conversion of LPL dimers into inactive monomers and/or via a reversible mechanism that requires binding of Angptl4 to LPL. The second transport mechanism involves a so far unidentified carrier and can be disrupted by Angptl4. In the absence of GPIHBP1, Angptl4 fully retains LPL in the subendothelial space (a). The additional loss of Angptl4 liberates LPL and allows it to be transported to the endothelial surface via the unidentified carrier (b). This model suggests that Angptl4 and LPL start interacting before arrival in the capillary lumen, either in the parenchymal cells or in the subendothelial space. Abbreviation: HSPG, heparan sulfate proteoglycan.

Regulation and role of angiopoietin-like 4 (Angptl4)

Regulation and role of angiopoietin-like 4 (Angptl4)

Figure 2. Regulation and role of angiopoietin-like 4 (Angptl4) in lipid metabolism. Angptl4 is expressed in parenchymal cells of white adipose tissue (WAT), liver, intestine, heart and muscle, as well as in macrophages, where it is subject to cell- and tissue-specific regulation. Angptl4 is a sensitive target of peroxisome proliferator-activated receptor (PPAR) transcription factors in several tissues. In WAT the expression of Angptl4 is induced during fasting and by the transcription factors PPARg, glucocorticoid receptor (GR), and hypoxia inducible factor 1a (HIF1a). In WAT Angptl4 stimulates lipolysis of stored triglycerides (TG) and inhibits lipoprotein lipase (LPL) activity. Expression of Angptl4 in liver is stimulated by PPARa, PPARd, and GR. Because the liver does not express LPL, Angptl4 is mainly released into the blood, affecting LPL activity in peripheral tissues. Angptl4 may also impact upon hepatic lipase activity in liver. Expression of Angptl4 in heart and skeletal muscle is potently induced by fatty acids (FA) via PPARd activation. Angptl4 inhibits LPL activities in cardiac and likely skeletal muscle. FA also stimulate Angptl4 expression in macrophages via PPARd, leading to local inhibition of LPL activity. We hypothesize that macrophage LPL enables uptake of remnant particles containing lipid antigens, which are subsequently presented to natural killer T cells. In the intestine, FA stimulate Angptl4 expression via one of the PPARs. Angptl4 produced by enterocytes may be released towards the lumen and inhibit pancreatic lipase activity. Angptl4 produced by enteroendocrine cells is released towards the blood and may inhibit LPL in distant tissues.

Box 2. Outstanding questions

  1. What is the importance of Angptl4 cleavage and oligomerization to Angptl4 function in vivo?
  2. What is the precise biochemical mechanism behind the inhibition of LPL activity by Angptl4?
  3. At which cellular location(s) does the inhibition of LPL by Angptl4 occur and, if at multiple locations, what is the relative contribution of both tissue-produced Angptl4 compared to circulating Angptl4 with respect to inhibition of tissue LPL activity.
  4. What is the interplay between GPIHBP1 and Angptl4 in the regulation of LPL activity?
  5. What is the protein structure of Angptl4 and LPL?
  6. Does Angptl4 also regulate LPL activity in brown adipose tissue and skeletal muscle and, if so, how is the expression of Angptl4 regulated in these tissues?
  7. What is the potential of Angptl4 as a biomarker in the context of disorders of lipid metabolism?

In the past decade, angiopoietin-like proteins have been demonstrated to regulate plasma TG levels powerfully in mice and humans. The elucidation of these proteins as inhibitors of LPL activity has led to a paradigm shift in how clearance of circulating TG and thereby tissue uptake of FA are regulated. Most of our understanding of angiopoietin-like proteins has resulted from detailed study of Angptl4.

A major portion of the physiological variation in LPL activity in various tissues can be attributed to regulation of Angptl4 production. We predict that Angptl4 will turn out to be equally important for governing LPL activity in muscle during exercise, in brown adipose tissue during cold, and in several tissues during fasting.

Besides the increasing recognition of the pivotal role of Angptl4 in lipid metabolism as an inhibitor of LPL, major insight has been gained into the molecular mechanism of action of Angptl4. Key questions remain, however, especially related to the interaction between LPL, GPIHBP1, and Angptl4 on the endothelium and in the subendothelial space. Several points of interest have been highlighted throughout the text; these include the elucidation of the molecular structure for LPL and Angptl4 by X-ray crystallography and the clarification of in vivo Angptl4 cleavage and oligomerization.

Native Low-Density Lipoprotein Induces Endothelial Nitric Oxide Synthase Dysfunction: Role of Heat Shock Protein 90 And Caveolin-1

Kirkwood A. Pritchard, Jr., Allan W. Ackerman, Jingsong Ou, et al.
Free Radical Biol & Med 2002; 33(1):52–62 PII S0891-5849(02)00851-1

Although native LDL (n-LDL) is well recognized for inducing endothelial cell (EC) dysfunction, the mechanisms remain unclear. One hypothesis is n-LDL increases caveolin-1 (Cav-1), which decreases nitric oxide (•NO) production by binding endothelial nitric oxide synthase (eNOS) in an inactive state. Another is n-LDL increases superoxide anion (O2•-), which inactivates •NO. To test these hypotheses, EC were incubated with n-LDL and then analyzed for •NO, O2•-, phospho-eNOS (S1179), eNOS, Cav-1, calmodulin (CaM), and heat shock protein 90 (hsp90). n-LDL increased NOx by more than 4-fold while having little effect on A23187-stimulated nitrite production. In contrast, n-LDL decreased cGMP under basal and A23187-stimulated conditions and increased O2•-by a mechanism that could be inhibited by L-nitroargininemethylester (L-NAME) and BAPTA/AM. n-LDL increased phospho-eNOS by 149%, eNOS by [1]34%, and Cav-1 by 28%, and decreased the association of hsp90 with eNOS by 49%. n-LDL did not appear to alter eNOS distribution between membrane fractions (-85%) and cytosol (-15%). Only 3–6% of eNOS in membrane fractions was associated with Cav-1. These data support the hypothesis that n-LDL increases O2•-, which scavenges •NO, and suggest that n-LDL uncouples eNOS activity by decreasing the association of hsp90 as an initial step in signaling eNOS to generate O2•-.

In conclusion, n-LDL decreases the association of hsp90 with eNOS, increases phospho-eNOS levels, and increases eNOS-dependent O2•-generation. These findings suggest that activation of eNOS without adequate levels of hsp90 may signal eNOS to switch from •NO to O2•-generation. Such changes in eNOS radical product generation may play an important role in impairing endothelial and vascular function.

New insights into IGF-1 signaling in the heart

Rodrigo Troncoso, C Ibarra, JM Vicencio, E Jaimovich, and S Lavandero
Trends in Endocrin and Metab, Mar 2014; 25(3):128-131
http://dx.doi.org/10.1016/j.tem.2013.12.002

Insulin-like growth factor 1 (IGF-1) signaling regulates contractility, metabolism, hypertrophy, autophagy, senescence, and apoptosis in the heart. IGF-1 deficiency is associated with an increased risk of cardiovascular disease, whereas cardiac activation of IGF-1 receptor (IGF-1R) protects from the detrimental effects of a high-fat diet and myocardial infarction. IGF-1R activates multiple pathways through its intrinsic tyrosine kinase activity and through coupling to heterotrimeric G protein. These pathways involve classic second messengers, phosphorylation cascades, lipid signaling, Ca2+ transients, and gene expression. In addition, IGF-1R triggers signaling in different subcellular locations including the plasma membrane, perinuclear T tubules, and also in internalized vesicles. In this review, we provide a fresh and updated view of the complex IGF-1 scenario in the heart, including a critical focus on therapeutic strategies.

The hormone insulin-like growth factor 1 (IGF-1) is a small peptide of 7.6 kDa, which is composed of 70 amino acids and shares 50% homology with insulin. IGF-1 plays key roles in regulating proliferation, differentiation, metabolism, and cell survival. It is mainly synthesized and secreted by the liver in response to hypothalamic growth hormone (GH); its plasma concentration is finely regulated (Box 1). However, other tissues also produce IGF-1, which acts locally as an autocrine and paracrine hormone. IGF-1 exhibits pleiotropic effects in many organs and is also involved in the development of several pathologies.

Box 1. IGF-1 synthesis and biodisponibilityInsulin-like growth factor 1 (IGF-1) is a 70 amino acid peptide

hormone with endocrine, paracrine, and autocrine effects. It shares

>60% structure homology with IGF-2 and 50% with pro-insulin. IGF-

1 is mainly synthesized in the liver in response to hypothalamic

growth hormone (GH). In the peripheral circulation it exerts negative

feedback on the somatotrophic axis suppressing pituitary GH

release. IGF-1 can also be generated in almost all tissues, but liver

synthesis accounts for nearly 75% of circulating IGF-1 levels. As a

hormone with a wide range of physiological roles, IGF-1 circulating

levels must be strictly controlled. Around 98% of circulating IGF-1 is

bound to insulin-like growth factor binding protein (IGFBP). Six

forms of high affinity IGFBP have been described, with IGFBP3

binding approximately 90% of circulating IGF-1. Also, IGFBP1–6 and

their fragments have significant intrinsic biological activity independent

of IGF-1 interaction.

Canonical and noncanonical IGF-1 signaling pathways Activation of IGF-1R requires the sequential phosphorylation of three conserved tyrosine residues within the activation loop of the catalytic domain. From these phosphorylated motifs, tyrosine 950 contained in an NPXY motif provides a docking site for the recruitment of adaptor proteins, such as insulin receptor substrate-1 (IRS-1) and Shc, as an obligatory step to initiate signaling cascades. Two canonical pathways are activated by IGF-1R in cardiomyocytes – the phosphatidylinositol-3 kinase (PI3K)/Akt pathway and the extracellular signal-regulated kinase (ERK) pathway. Both pathways have been extensively studied, and their involvement in the pro-hypertrophic and pro-survival actions in cardiomyocytes is well established. Interestingly, a noncanonical signaling mechanism for IGF-1R in cardiomyocytes has been described in several recent studies. These studies show that some of the effects of IGF-1 are inhibited by the heterotrimeric Gi protein blocker Pertussis toxin (PTX) in several cell lines, suggesting that IGF-1R is a dual-activity receptor that triggers tyrosine-kinase-dependent responses as well as Gi-protein-dependent pathways. This duality has been reported in cultured neonatal cardiomyocytes; IGF-1R can activate ERK and Akt but also phospholipase C (PLC), which increases inositol 1,4,5 triphosphate (InsP3; IP3) leading to nuclear Ca2+ signals.

The cardiac effects of IGF-1 are mediated by activation of the plasma membrane IGF-1R, which belongs to the receptor tyrosine kinase (RTK) family. IGF-1R comprises a α2β2 heterotetrameric complex of approximately 400 kDa. Structurally, IGF-1R has two extracellular a-subunits that contain the ligand-binding sites. Each α-subunit couples to one of two membrane-spanning β-subunits, which contain an intracellular domain with intrinsic tyrosine kinase activity. Both subunits of IGF-1R are the product of one single gene, which is synthesized as a 180 kDa precursor. The immature IGF-1R full peptide is further glycosylated, dimerized, and proteolytically processed for assembly of the mature receptor isoforms a and b. In neonatal and adult rat cardiomyocytes, the IGF-1R precursor peptide and the processed α and β receptor subunits have been detected. Binding of IGF-1 to its receptor initiates a complex signaling cascade in cardiomyocytes.

Figure 1. not shown. Canonical and noncanonical signaling pathways activated by insulin-like growth factor 1 (IGF-1) in cardiomyocytes. Binding of IGF-1 to plasma membrane IGF-1 receptor (IGF-1R) leads to receptor autophosphorylation in the intracellular β-subunits. Docking of Grβ2 to the phosphorylated IGF-1Rβ subunits leads to extracellular signal-regulated kinase (ERK) phosphorylation through the Ras/Raf/Mitogen-activated protein kinase (MEK) axis. Phosphorylated ERK can translocate to the nucleus to control gene expression. Phosphorylated β-subunits also provide docking sites for insulin receptor substrate-1 (IRS-1), which mediates phosphatidylinositol-3 kinase (PI3K) activation and Akt phosphorylation. Downstream targets of activated Akt are mechanistic target of rapamycin (mTOR), which suppresses autophagy and promotes protein synthesis by activating S6K and eukaryotic translation initiation factor 4E binding protein 1 (4EBP1). Akt also phosphorylates and inactivates Bad, thus inhibiting apoptosis. IGF-1R activation also promotes its interaction with a Pertussis-toxin-sensitive heterotrimeric Gi protein, which mediates the activation of phospholipase C (PLC) and hydrolysis of plasma membrane phosphatidylinositol 4,5 biphosphate (PIP2) to form inositol 1,4,5 triphosphate (InsP3; IP3) which activates InsP3 receptors located at the endoplasmin reticulum (ER)/nuclear envelope Ca2+ store, producing nucleoplasmic and cytoplasmic Ca2+ increases. The former is involved in the regulation of specific target genes and the latter promotes mitochondrial Ca2+ uptake, which increases mitochondrial respiration and metabolism, further preventing apoptosis and regulating autophagy. Canonical signaling pathways include the ERK and Akt axes, and are shown in red, whereas the noncanonical G protein pathway is shown in blue. Both pathways interact as Ca2+ contributes to ERK activation and additionally both Akt and ERK can compensate each other’s activation. Abbreviations: MEK, Mitogen-activated protein kinase; mTOR, mechanistic target of rapamycin; 4EBP1, eukaryotic translation initiation factor 4E binding protein 1; PIP2, phosphatidylinositol 4,5 biphosphate.

Figure 2. not shown. Classical versus proposed models of nuclear Ca2+ signaling in cardiomyocytes. The insulin-like growth factor 1 receptor (IGF-1R) can specifically regulate nuclear Ca2+ signaling independently of the role of Ca2+ on excitation–contraction coupling. On the classic model, inositol 1,4,5 triphosphate (InsP3; IP3) produced after IGF-1R activation travels from the peripheral plasma membrane to the nucleus, where it activates InsP3 receptors. In this model InsP3 bypasses its receptors present on the sarcoplasmic reticulum, which would lead to cytosolic Ca2+ signals. The novel model that we propose is based on recent findings, where the IGF-1R signaling complex is present in T-tubule invaginations toward the nucleus. In these compartments, IGF-1R activation leads to locally restricted InsP3 production that allows nuclear Ca2+ signals to regulate gene expression of genes associated with the development of cardiomyocyte hypertrophy. Abbreviations: RyR, ryanodine receptor; ECC, excitation–contraction coupling; PLC, phospholipase C; DHPR, dihydropyridine receptor.

The beneficial roles of IGF-1 in the cardiovascular system largely explain the interest in the development of new IGF-1-based treatments for cardiovascular disease. So far the FDA has approved two drugs for the treatment of IGF-1 deficiency: mecasermin (Increlex1), a human recombinant IGF-1 analog; and mecasermin rinfabate (IPLEX1), a binary protein complex of human recombinant IGF-1 and human recombinant IGBP-3. The safety of a chronic systemic IGF-1 therapy is open to question because it could promote severe adverse effects, such as an increased risk of cancer. To avoid these problems, several researchers have selectively overexpressed IGF-1 and IGF-1R in the heart.

Box 2. Outstanding questionsInsulin-like growth factor 1 (IGF-1) is an old friend of the heart. Despite the well-known protective effects of IGF-1 on cardiac function and the antiapoptotic effects of this peptide, novel evidence opens new questions to this longstanding relationship.

·       How do the multiple signaling pathways triggered by IGF-1 receptor (IGF-1R) interact with each other?

·       What lies further than extracellular signal-regulated kinase (ERK)/Akt/Ca2+ activation toward heart function?

·       Do these signaling pathways regulate cardiac fibroblast or endothelial cell function?

·       Which are the specific downstream signaling pathways of the different pools of IGF-1R and their role in regulating cardiomyocyte survival, hypertrophy, metabolism, proliferation?

·       What drives IGF-1R to such specific subcellular compartments?

·       What is the relevance of the hybrid IGF-1R/insulin receptors on cardiovascular disease?

·       Does a crosstalk exist between insulin receptor and IGF-1R in the heart under physiological and pathological conditions?

·       Is one pathway more beneficial than the other?

·       Will stem cell therapy of cardiac progenitors be able to provide concrete treatment opportunities?

·       Is IGF-1 a key regulator of this outcome?

Abundant evidence supports the key physiological roles of IGF-1 in the heart. In cardiomyocytes, IGF-1 activates multiple downstream signaling pathways for controlling cell death, metabolism, autophagy, differentiation, transcription, and protein synthesis (Figure 1). Of great interest are the findings that the entire IGF-1R complex is strategically located in perinuclear sarcolemmal invaginations that locally control nuclear Ca2+ signaling and transcriptional upregulation (Figure 2). This novel evidence changesmthe classical paradigm of IGF-1 signaling and adds a new level of complexity that may be relevant for other signaling receptors in the heart: interorganelle communication between plasma membrane invaginations and the nucleus.
The strategic localization of IGF-1R in these structures and the association with heterotrimeric G proteins may explain the differences in the phenotypic response induced by IGF-1 and others agonists, like endothelin-1 and angiotensin II, that also signal through intracellular Ca2+. By activating a noncanonical, selective mechanism of nuclear Ca2+ release, IGF-1 can regulate the expression of a specific set of cardiac genes via the generation of a particular signal-encoding pattern, leading to adaptive cardiac hypertrophy, antiapoptotic effects, and metabolic adaptation.

Pulmonary Hypertension in Heart Failure with Preserved Ejection Fraction – any Pathophysiological Role of Mitral Regurgitation

Marco Guazzi
http://dx.doi.org:/10.1016/j.jacc.2009.04.088

read with interest the study by Lam et al. (1) as an important contribution to the pathophysiological and clinical impact of pulmonary hypertension (PH) in hypertensive patients with heart failure and preserved left ventricular ejection fraction (HFpEF). Recent guidelines on arterial PH recognize HFpEF as a growing cause of left-sided PH, but a definitive appreciation of its true prevalence and prognostic relevance is lacking. The present study provides some new important information on this subject.

It is noteworthy that HFpEF was associated, in a high rate of cases (83%), with a typical hemodynamic pattern of precapillary PH, and a strong correlation was found between pulmonary artery systolic pressure and pulmonary capillary wedge pressure. Most important, pulmonary artery systolic pressure, rather than other echocardiography-derived measures of diastolic dysfunction, was the only significant multivariate predictor of mortality, a finding that was confirmed even when combined comorbid diseases potentially contributing to PH development, such as chronic obstructive pulmonary disease, were taken into account.

In patients with systolic heart failure, a major determinant of PH development is mitral regurgitation. Whether mitral regurgitation could be a putative factor in the pathogenesis of PH in HFpEF patients remains an open and intriguing question.

Accordingly, it would be of interest if the authors could provide some details on how many HFpEF patients exhibited mitral regurgitation, especially in comparison with control hypertensive patients without HFpEF.

Lam CSP, Roger VL, Rodeheffer RJ, Borlaug BA, Enders FT, Redfield MM. Pulmonary hypertension in heart failure with preserved ejection fraction: a community-based study. J Am Coll Cardiol 2009; 53:1119–23.

Midregion Prohormone Adrenomedullin and Prognosis in Patients Presenting with Acute Dyspnea Results from the BACH (Biomarkers in Acute Heart Failure) Trial

Alan Maisel, MD, Christian Mueller, Richard M. Nowak,W. Frank Peacock, et al.
J Am Coll Cardiol 2011; 58(10):1057–67
http://dx.doi.org:/10.1016/j.jacc.2011.06.006

Objectives The aim of this study was to determine the prognostic utility of midregion proadrenomedullin (MR-proADM) in all patients, cardiac and noncardiac, presenting with acute shortness of breath.
Background
The recently published BACH (Biomarkers in Acute Heart Failure) study demonstrated that MR-proADM had superior accuracy for predicting 90-day mortality compared with B-type natriuretic peptide (area under the curve: 0.674 vs. 0.606, respectively, p < 0.001) in acute heart failure.
Methods The BACH trial was a prospective, 15-center, international study of 1,641 patients presenting to the emergency department with dyspnea. Using this dataset, the prognostic accuracy of MR-proADM was evaluated in all patients enrolled for predicting 90-day mortality with respect to other biomarkers, the added value in addition to clinical variables, as well as the added value of additional measurements during hospital admission.
Results Compared with B-type natriuretic peptide or troponin, MR-proADM was superior for predicting 90-day all-cause mortality in patients presenting with acute dyspnea (c index = 0.755, p < 0.0001). Furthermore, MR-proADM added significantly to all clinical variables (all adjusted hazard ratios: HR=3.28), and it was also superior to all other biomarkers. MRproADM added significantly to the best clinical model (bootstrap-corrected c index increase: 0.775 to 0.807; adjusted standardized hazard ratio: 2.59; 95% confidence interval: 1.91 to 3.50; p < 0.0001). Within the model, MR-proADM was the biggest contributor to the predictive performance, with a net reclassification improvement of 8.9%. Serial evaluation of MR-proADM performed in patients admitted provided a significant added value compared with a model with admission values only (p< 0.0005). More than one-third of patients originally at high risk could be identified by the biomarker evaluation at discharge as low-risk patients. Conclusions MR-proADM identifies patients with high 90-day mortality and adds prognostic value to natriuretic peptides in patients presenting with acute shortness of breath. Serial measurement of this biomarker may also prove useful for monitoring, although further studies will be required. (Biomarkers in Acute Heart Failure [BACH]; NCT00537628)

Invasive Hemodynamic Characterization of Heart Failure with Preserved Ejection Fraction

Mads J. Andersen, Barry A. Borlaug
Heart Failure Clin 10 (2014) 435–444
http://dx.doi.org/10.1016/j.hfc.2014.03.001

KEY POINTS

  • Invasive hemodynamic assessment in heart failure with preserved ejection fraction (HFpEF) was originally a primary research tool to advance the understanding of the pathophysiology of HFpEF.
  • The role of invasive hemodynamic assessment in HFpEF is expanding to the diagnostic arena where invasive assessment offers a robust, sensitive, and specific way to diagnose or exclude HFpEF in patients with unexplained dyspnea and normal ejection fraction.
  • In future years, invasive hemodynamic profiling may more rigorously phenotype patients to individualized therapy and, potentially, deliver novel device-based structural interventions.

The circulatory system serves to deliver substrates to the body via the bloodstream while removing the byproducts of cellular metabolism. Hemodynamics broadly refers to the study of the forces involved in the circulation of blood, which are governed by to the physical properties of the heart and vasculature and their dynamic regulation by the autonomic nervous system.

Afterload represents the forces opposing ventricular ejection and can be quantified by systolic left ventricular (LV) wall stress and aortic input impedance or its individual components (resistance, compliance, characteristic impedance). Wall stress is inconvenient because it depends on heart size and geometry, whereas impedance is cumbersome because it is a frequency-domain parameter that cannot be easily coupled with time-domain measures of ventricular function. Effective arterial elastance (Ea), defined by the ratio of LV end-systolic pressure (ESP) to stroke volume, provides a robust measure of total arterial load. Ea is not a directly measured parameter but, instead, a net or lumped stiffness of the vasculature that incorporates both mean and oscillatory components of afterload (Fig. 1). Preload reflects the degree of myofiber stretch before the onset of contraction, which, in turn, dictates the force and velocity of contraction according to the Frank-Starling principle. In everyday practice, preload is often conceptualized as equivalent to LV filling pressures. However, in fact, preload is most accurately reflected by the LV volume at end-diastole volume (EDV). Filling pressures are related to EDV by the LV diastolic chamber stiffness, which differs in healthy volunteers and subjects with HFpEF.

Fig. 1. Not shown. Ventricular-arterial coupling in the pressure-volume plane. Pressure volume loop at steady state is shown in dark black. The area subtended by the loop (shaded) represents the stroke work. Stroke volume is the difference between end-diastolic volume (EDV) and end-systolic volume (ESV). Ea is defined by the negative slope connecting the ESP and ESV coordinates with EDV and pressure = 0. With acute preload reduction (dotted line loops) there is progressive reduction in EDV, ESV, and ESP. The linear slope of the endsystolic pressure volume relationship (ESPVR) is LV end-systolic elastance (Ees). The curvilinear slope of the end diastolic pressure–volume relationship (EDVPR) is derived by fitting pressure volume coordinates measured during diastasis to the equation shown. The exponential power or stiffness constant (b) obtained is a measure of LV diastolic stiffness. (Adapted from Borlaug BA, Kass DA. Invasive hemodynamic assessment in heart failure. Heart Fail Clin 2009;5(2):217–28; with permission.)

Fig. 3. Not shown. Left ventricular diastolic reserve in HFpEF. In the normal healthy adult, the rate of LV pressure decay during isovolumic contraction (t) is rapid and increases markedly during exercise in association with a reduction in LVmin, allowing for suction of blood into the LV, with no increase in left atrial pressure or LV end-diastolic pressure (LVEDP) despite an increase in LV end-diastolic volume and marked shortening of the cycle length. In HFpEF, relaxation is prolonged at baseline (increased t) with inadequate hastening (shortening of t) during exercise, contributing to an inability to reduce LVmin and, consequently, a complete lack of suction effects. LV filling then completely depends on left atrial hypertension, which develops in tandem with marked elevation in LVEDP. (Data from Borlaug BA, Jaber WA, Ommen SR, et al. Diastolic relaxation and compliance reserve during dynamic exercise in heart failure with preserved ejection fraction. Heart 2011;97(12):964–9.)

Fig. 4. Preload and filling pressures in HFpEF. (A) Cumulative distribution plot shows that acute changes in stroke volume with nitroprusside infusion are lower in HFpEF (black) compared with HFrEF (red). Because afterload (Ea) is lowered, any acute reduction in SV must be related to reduction in preload volume (EDV) and nearly 40% of HFpEF patients experienced stroke volume reduction with nitroprusside, despite high filling pressures (PCWP 20–25 mm Hg), indicating increased reliance on high pressures to achieve adequate EDV. *p<0.0001 compared with HFrEF. (B) LVEDP in a healthy adult (blue) and in a HFpEF patient with increased LV diastolic stiffness (green). At the same preload (EDV), pressure is more than twofold higher in HFpEF. In contrast, at the same LV diastolic pressure (15 mm Hg), LV volume is much lower in HFpEF, indicating decreased LV diastolic capacitance. V15, volume at end-diastolic pressure = 15 mm Hg; LVEDP. (Adapted from Schwartzenberg S, Redfield MM, From AM, et al. Effects of vasodilation in heart failure with preserved or reduced ejection fraction implications of distinct pathophysiologies on response to therapy. J Am Coll Cardiol 2012;59(5):442–51; with permission.)

Updated Clinical Classification of Pulmonary Hypertension

Gérald Simonneau, Ivan M. Robbins, Maurice Beghetti, et al.
J Am Coll of Cardiol   2009; 54(1), Suppl S
http://dx.doi.org:/10.1016/j.jacc.2009.04.012

The aim of a clinical classification of pulmonary hypertension (PH) is to group together different manifestations of disease sharing similarities in pathophysiologic mechanisms, clinical presentation, and therapeutic approaches. In 2003, during the 3rd World Symposium on Pulmonary Hypertension, the clinical classification of PH initially adopted in 1998 during the 2nd World Symposium was slightly modified. During the 4th World Symposium held in 2008, it was decided to maintain the general architecture and philosophy of the previous clinical classifications. The modifications adopted during this meeting principally concern Group 1, pulmonary arterial hypertension (PAH). This subgroup includes patients with PAH with a family history or patients with idiopathic PAH with germline mutations (e.g., bone morphogenetic protein receptor-2, activin receptor-like kinase type 1, and endoglin). In the new classification, schistosomiasis and chronic hemolytic anemia appear as separate entities in the subgroup of PAH associated with identified diseases. Finally, it was decided to place pulmonary venoocclusive disease and pulmonary capillary hemangiomatosis in a separate group, distinct from but very close to Group 1 (now called Group 1=). Thus, Group 1 of PAH is now more homogeneous. (J Am Coll Cardiol 2009; 54: S43–54)
Updated Evidence-Based Treatment Algorithm in Pulmonary Arterial Hypertension

Robyn J. Barst,  J. Simon R. Gibbs, Hossein A. Ghofrani, et al.
J Am Coll Cardiol 2009; 54(1), Suppl S,

Uncontrolled and controlled clinical trials with different compounds and procedures are reviewed to define the risk benefit profiles for therapeutic options in pulmonary arterial hypertension (PAH). A grading system for the level of evidence of treatments based on the controlled clinical trials performed with each compound is used to propose an evidence-based treatment algorithm. The algorithm includes drugs approved by regulatory agencies for the treatment of PAH and/or drugs available for other indications. The different treatments have been evaluated mainly in idiopathic PAH, heritable PAH, and in PAH associated with the scleroderma spectrum of diseases or with anorexigen use. Extrapolation of these recommendations to other PAH subgroups should be done with caution. Oral anticoagulation is proposed for most patients; diuretic treatment and supplemental oxygen are indicated in cases of fluid retention and hypoxemia, respectively. High doses of calcium-channel blockers are indicated only in the minority of patients who respond to acute vasoreactivity testing. Nonresponders to acute vasoreactivity testing or responders who remain in World Health Organization (WHO) functional class III, should be considered candidates for treatment with either an oral phosphodiesterase-5 inhibitor or an oral endothelin-receptor antagonist. Continuous intravenous administration of epoprostenol remains the treatment of choice in WHO functional class IV patients. Combination therapy is recommended for patients treated with PAH monotherapy who remain in WHO functional class III. Atrial septostomy and lung transplantation are indicated for refractory patients or where medical treatment is unavailable. (J Am Coll Cardiol 2009;54:S78–84)

Inhibition and down-regulation of gene transcription and guanylyl cyclase activity of NPRA by angiotensin II involving protein kinase C

Kiran K. Arise, Kailash N. Pandey
Biochem and Biophys Res Commun 349 (2006) 131–135
http://dx.doi.org:/10.1016/j.bbrc.2006.08.003

The objective of this study was to investigate the role of protein kinase C (PKC) in the angiotensin II (Ang II)-dependent repression of Npr1 (coding for natriuretic peptide receptor-A, NPRA) gene transcription. Mouse mesangial cells (MMCs) were transfected with Npr1 gene promoter-luciferase construct and treated with Ang II and PKC agonist or antagonist. The results showed that the treatment of MMCs with 10 nM Ang II produced a 60% reduction in the promoter activity of Npr1 gene. MMCs treated with 10 nM Ang II exhibited 55% reduction in NPRA mRNA levels, and subsequent stimulation with 100 nM ANP resulted in 50% reduction in guanylyl cyclase (GC) activity. Furthermore, the treatment of MMCs with Ang II in the presence of PKC agonist phorbol ester (100 nM) produced an almost 75% reduction in NPRA mRNA and 70% reduction in the intracellular accumulation of cGMP levels. PKC antagonist staurosporine completely reversed the effect of Ang II and phorbol ester. This is the first report to demonstrate that ANG II-dependent transcriptional repression of Npr1 gene promoter activity and down-regulation of GC activity of translated protein, NPRA is regulated by PKC pathways.

Transcriptional regulation of guanylyl cyclase/natriuretic peptide receptor-A gene

Prerna Kumar, Kiran K. Arise, Kailash N. Pandey
peptides 27 (2006) 1762–1769
http://dx.doi.org:/10.1016/j.peptides.2006.01.004

Activation of natriuretic peptide receptor-A (NPRA) produces the second messenger cGMP, which plays a pivotal role in maintaining blood pressure and cardiovascular homeostasis. In the present study, we have examined the role of trans-acting factor Ets-1 in transcriptional regulation of Npr1 gene (coding for NPRA).Using deletional analysis of the Npr1 promoter, we have defined a 400 base pair (bp) region as the core promoter, which contains consensus binding sites for transcription factors including: Ets-1, Lyf-1, and GATA-1/2. Over-expression of Ets-1 in mouse mesangial cells (MMCs) enhanced Npr1 gene transcription by 12-fold. However, overexpression of GATA-1 or Lyf-1 repressed Npr1 basal promoter activity by 50% and 80%, respectively. The constructs having a mutant Ets-1 binding site or lacking this site failed to respond to Ets-1 activation of Npr1 gene transcription. Collectively, the present results demonstrate that Ets-1 greatly stimulates Npr1 gene promoter activity, implicating its critical role in the regulation and function of NPRA at the molecular level.

Several agents that are known to upregulate Ets-1 transcription, include RA, TNF-alpha, VEGF, and TPA. Ets-1 is upregulated at exposure to agonists such as serum in vitro and is expressed in injured vasculature. MAPK-mediated phosphorylation positively regulates the transcriptional activation functions of Ets-1 by recruiting CBP/p300. Not much is known about Ets-1 expression or regulation in mesangial cells. A temporal increase of mesangial cell Ets-1 expression has been reported which correlates with mesangial cell activation
in mesangioproliferative glomerulonephritis suggesting involvement of PDGF-B. There might be a possibility that during glomerulonephritis increased Ets-1 expression upregulates Npr1 gene as a protective mechanism. Npr1 gene has been shown to negatively regulate mitogen-activated protein kinase and proliferation of mesangial cells.

In conclusion, our results demonstrate that the precise control of Npr1 gene transcriptional activity is achieved through a synergy of activators and repressors in which Ets-1 plays an integral role as a transcriptional activator. Comparatively, Lyf-1 and GATA-1 act as repressors, inhibiting and regulating the transcriptional activity of Npr1 gene promoter. The present findings suggest that Ets-1 plays a critical role in enhancing Npr1 gene transcription and may have an important influence in hypertension and cardiovascular homeostasis at the molecular level.

Krüppel-like transcription factor 11 (KLF11) overexpression inhibits cardiac hypertrophy and fibrosis in mice

Yue Zheng, Ye Kong, Feng Li
Biochem and Biophys Res Commun 443 (2014) 683–688
http://dx.doi.org/10.1016/j.bbrc.2013.12.024

The Krüppel-like factors (KLFs) belong to a subclass of Cys2/His2 zinc-finger DNA-binding proteins. The KLF family member KLF11 is originally identified as a transforming growth factor b (TGF-b)-inducible gene and is one of the most studied in this family. KLF11 is expressed ubiquitously and participates  in diabetes and regulates hepatic lipid metabolism. However, the role of KLF11 in cardiovascular system is largely unknown. Here in this study, we reported that KLF11 expression is down-regulated in failing human hearts and hypertrophic murine hearts. To evaluate the roles of KLF11 in cardiac hypertrophy, we generated cardiac-specific KLF11 transgenic mice. KLF11 transgenic mice do not show any difference from their littermates at baseline. However, cardiac-specific KLF11 overexpression protects mice from TAC-induced cardiac hypertrophy, with reduced radios of heart weight (HW)/body weight (BW), lung weight/BW and HW/tibia length, decreased left ventricular wall thickness and increased fractional shortening. We also observe lower expression of hypertrophic fetal genes in TAC-challenged KLF11 transgenic mice compared with WT mice. In addition, KLF11 reduces cardiac fibrosis in mice underwent hypertrophy. The expression of fibrosis markers are also down-regulated when KLF11 is overexpressed in TAC-challenged mice. Taken together, our findings identify a novel anti-hypertrophic and anti-fibrotic role of KLF11, and KLF11 activator may serve as candidate drug for heart failure patients.

Read Full Post »

Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD


Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Curator: Aviva Lev-Ari, PhD, RN

This article is Part VI in a Series of articles on Calcium Release Mechanism, the series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IXCalcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

This article has THREE parts:

Part I: Scientific Leader in Cardiology, Contributions by Roger J. Hajjar, MD to Gene Therapy

Part II: Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension

Part III: Cardiac Gene Therapy: Percutaneous Intra-coronary Artery Infusion for Heart Failure

The following two discoveries in Cardiac Gene Therapies represent the FRONTIER IN CARDIOLOGY for 2012 – 2013: Solution Advancement for Improving Myocardial Contractility

Part I: Scientific Leader in Cardiology, Contributions by Roger J. Hajjar, MD to Gene Therapy

Roger J. Hajjar, MD, a pioneering Mount Sinai researcher who has published cutting-edge studies on heart failure, has been named the recipient of the 2013 BCVS Distinguished Achievement Award by theAmerican Heart Association and the Council on Basic Cardiovascular Sciences. Dr. Hajjar, who is The Arthur and Janet C. Ross Professor of Medicine and Director of The Helmsley Trust Translational Research Center, will be honored at the American Heart Association’s Scientific Sessions Annual Conference later this year.

“Dr. Hajjar will receive the award for his groundbreaking contributions to developing gene therapy treatments for cardiac disease,” says Joshua Hare, MD, who is President-elect of the Council on Basic Cardiovascular Sciences. He will also be recognized for his work on behalf of the Council.

Over the years, Dr. Hajjar’s laboratory has made important basic science discoveries that were translated into clinical trials. Most recently, Dr. Hajjar and his researchers identified a possible new drug target for treating or preventing heart failure. Says Mark A. Sussman, PhD, a former president of the Council, “Dr. Hajjar was among the first, and certainly the most successful, in combining gene therapy and treatment of heart failure. He shows a relentless pursuit of translating basic science into real-world treatment of heart disease.”

This article was first published in Inside Mount Sinai.

http://blog.mountsinai.org/blog/roger-j-hajjar-md-to-be-honored-for-research/

John Hopkins, Distinguished Alumnus Award 2011

Roger J. Hajjar, Engr ’86
Dr. Roger Hajjar received his bachelor’s degree in biomedical engineering from Johns Hopkins University in 1986. A cardiologist and translational scientist, he is a leader in gene therapy techniques and model testing for cardiovascular diseases. Dr. Hajjar is professor of medicine and cardiology, and professor of gene and cell medicine at Mount Sinai Medical Center in New York, as well as research director of Mount Sinai’s Wiener Family Cardiovascular Research Laboratories. Dr. Hajjar was recruited to Mt. Sinai from Harvard Medical School where he was assistant professor of medicine and staff cardiologist in the Heart Failure & Cardiac Transplantation Center. He received his medical degree from Harvard Medical School and trained in internal medicine and cardiology at Massachusetts General Hospital in Boston. Dr. Hajjar has concentrated his research efforts on understanding the basic mechanisms of heart failure. He has developed gene transfer methods and techniques in the heart to improve contractility. Dr. Hajjar’s laboratory focuses on targeting signaling pathways in cardiac myocytes to improve contractile function in heart failure and to block signaling pathways in hypertrophy and apoptosis. Dr. Hajjar has significant expertise in gene therapy. In 1996, he won the Young Investigator Award of the American Heart Association (Council on Circulation). In 1999, Dr. Hajjar was awarded the prestigious Doris Duke Clinical Scientist award and won first prize at the Astra Zeneca Young Investigator Forum. Dr. Hajjar holds a number of NIH grants.

http://alumni.jhu.edu/distinguishedalumni2011

Dr Hajjar is the Director of the Cardiovascular Research Center, and the Arthur & Janet C. Ross Professor of Medicine at Mount Sinai School of Medicine, New York, NY. He received his BS in Biomedical Engineering from Johns Hopkins University and his MD from Harvard Medical School and the Harvard-MIT Division of Health Sciences & Technology. He completed his training in internal medicine, cardiology and research fellowships at Massachusetts General Hospital in Boston.

Dr. Hajjar is an internationally renowned scientific leader in the field of cardiac gene therapy for heart failure. His laboratory focuses on molecular mechanisms of heart failure and has validated the cardiac sarcoplasmic reticulum calcium ATPase pump, SERCA2a, as a target in heart failure, developed methodologies for cardiac directed gene transfer that are currently used by investigators throughout the world, and examined the functional consequences of SERCA2a gene transfer in failing hearts. His basic science laboratory remains one of the preeminent laboratories for the investigation of calcium cycling in failing hearts and targeted gene transfer in various animal models. The significance of Dr Hajjar’s research has been recognized with the initiation and recent successful completion of phase 1 and phase 2 First-in-Man clinical trials of SERCA2a gene transfer in patients with advanced heart failure under his guidance.

Prior to joining Mount Sinai, Dr. Hajjar served as Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging at Massachusetts General Hospital and Associate Professor of Medicine at Harvard Medical School. Dr. Hajjar has also been a staff cardiologist in the Heart Failure & Cardiac Transplantation Center at Massachusetts General Hospital.

Dr. Hajjar has won numerous awards and distinctions, including the Young Investigator Award of the American Heart Association. He was awarded a Doris Duke Clinical Scientist award and has won first prize at the Astra Zeneca Young Investigator Forum. He is a member of the American Society for Clinical Investigation. He was recently awarded the Distinguished Alumnus Award from Johns Hopkins University and the Mount Sinai Dean’s award for Excellence in Translational Science. He has authored over 260 peer-reviewed publications.

http://heart.sdsu.edu/~website/IRRI/Pages/faculty/roger-hajjar-md.html

Meet the Director of Mount Sinai’s Cardiovascular Research Center

“Cardiovascular diseases are the number one cause of death globally. In order to tackle them in all aspects, we must unite improved diagnostic techniques with more refined therapies.”

Roger J. Hajjar, MD, Director of the Cardiovascular Research Center, the Arthur & Janet C. Ross Professor of Medicine, Professor of Gene & Cell Medicine, Director of the Cardiology Fellowship Program, and Co-Director of the Transatlantic Cardiovascular Research Center, which combines Mount Sinai Cardiology Laboratories with those of the Universite de Paris – Madame Curie.

In the late 1990s, the possibility that discoveries in genetics and genomics could have a positive impact on the diagnosis, treatment, and prevention of cardiovascular diseases seemed to be just a distant promise. Today, a little more than a decade later, the promise is beginning to take shape. Roger J. Hajjar, MD and his multidisciplinary team of investigators are beginning to translate scientific findings into real therapies for cardiovascular diseases. As Director of the Cardiovascular Research Institute and a cardiologist by training, Dr. Hajjar guides the growth of a cutting-edge translational research laboratory, which is positioning Mount Sinai as the leader in cardiovascular genomics.

An internationally recognized scientific leader in the field of cardiac gene therapy for heart failure, Dr. Hajjar is expanding studies of the basic mechanisms of cardiac diseases and identification of high-risk groups and genomic predictors so that they can be part of the daily clinical care of patients. Unique biorepositories combined with cardiovascular areas of excellence across Mount Sinai make possible crucial genetic studies.

First Gene Therapy for Heart Failure

Under Dr. Hajjar’s leadership, the Cardiovascular Research Center has already developed the world’s first potential gene therapy for heart failure. Known as AAV1.SERCA2a, this therapy actually revives heart tissue that has stopped working properly. It has led to new treatment possibilities for patients with advanced heart failure, whose options used to be severely limited. The significance of this research has been recognized with the initiation and successful completion Phase 1 and Phase 2 First-in-Man clinical trials of SERCA2a gene transfer in patients with advanced heart failure. Phase 3 validation begins in 2011.

The Cardiovascular Research Center’s next research projects, already underway, focus on using novel gene therapy vectors to target diastolic heart failure, ventricular arrhythmias, pulmonary hypertension, and myocardial infarctions.

In addition to targeting signaling pathways to aid failing heart cells, ongoing work at the Cardiovascular Research Center involves studying how to block signaling pathways in cardiac hypertrophy as well as apoptosis. The laboratory team is also targeting a number of signaling pathways in the aging heart to improve dystolic function.

Prior to joining Mount Sinai in 2007, Dr. Hajjar served as Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging at Massachusetts General Hospital and Associate Professor of Medicine at Harvard Medical School. Dr. Hajjar has also been a staff cardiologist in the Heart Failure & Cardiac Transplantation Center at Massachusetts General Hospital. After earning a bachelors of science degree in Biomedical Engineering from Johns Hopkins University and a medical degree from Harvard Medical School and the Harvard-MIT Division of Health Sciences and Technology, he completed his training in internal medicine, cardiology and research fellowships at Massachusetts General Hospital in Boston.

Scientific Advisors

Roger J. Hajjar, MD, Co-Founder and a Scientific Advisor of Celladon Co, plans to commercialize AAV1.SERCA2a for the treatment of heart failure.
Dr. Roger J. Hajjar is the Director of the Cardiovascular Research Center at the Mt. Sinai School of Medicine. Previously, he was the Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging at Massachusetts General Hospital (MGH) and Associate Professor of Medicine at Harvard Medical School. Dr. Hajjar has an active basic science laboratory and concentrates his research efforts on understanding the basic mechanisms of heart failure. He has developed gene transfer methods and techniques targeting the heart as a therapeutic modality to improve contractility in heart failure. Dr. Hajjar’s laboratory focuses on targeting signaling pathways in cardiac myocytes to improve contractile function in heart failure and to block signaling pathways in hypertrophy and apoptosis.

Gene Therapy: Volume 19, Issue 6 (June 2012)

Special Issue: Cardiovascular Gene Therapy

Guest Editor

Roger J Hajjar MD, Mount Sinai School of Medicine, New York, NY Director, Cardiovascular Research Institute, Arthur & Janet C Ross Professor of Medicine

SDF-1 in myocardial repair  

M S Penn, J Pastore, T Miller and R Aras

Gene Ther 19: 583-587; doi:10.1038/gt.2012.32

Abstract | Full Text | PDF

Gene- and cell-based bio-artificial pacemaker: what basic and translational lessons have we learned?  

R A Li

Gene Ther 19: 588-595; doi:10.1038/gt.2012.33

Abstract | Full Text | PDF

Sarcoplasmic reticulum and calcium cycling targeting by gene therapy  

J-S Hulot, G Senyei and R J Hajjar

Gene Ther 19: 596-599; advance online publication, May 17, 2012; doi:10.1038/gt.2012.34

Abstract | Full Text | PDF

Gene therapy for ventricular tachyarrhythmias  

J K Donahue

Gene Ther 19: 600-605; advance online publication, April 26, 2012; doi:10.1038/gt.2012.35

Abstract | Full Text | PDF

Prospects for gene transfer for clinical heart failure  

T Tang, M H Gao and H Kirk Hammond

Gene Ther 19: 606-612; advance online publication, April 26, 2012; doi:10.1038/gt.2012.36

Abstract | Full Text | PDF

Targeting S100A1 in heart failure  

J Ritterhoff and P Most

Gene Ther 19: 613-621; advance online publication, February 16, 2012; doi:10.1038/gt.2012.8

Abstract | Full Text | PDF

VEGF gene therapy: therapeutic angiogenesis in the clinic and beyond  

M Giacca and S Zacchigna

Gene Ther 19: 622-629; advance online publication, March 1, 2012; doi:10.1038/gt.2012.17

Abstract | Full Text | PDF

Vein graft failure: current clinical practice and potential for gene therapeutics  

S Wan, S J George, C Berry and A H Baker

Gene Ther 19: 630-636; advance online publication, March 29, 2012; doi:10.1038/gt.2012.29

Abstract | Full Text | PDF

Percutaneous methods of vector delivery in preclinical models  

D Ladage, K Ishikawa, L Tilemann, J Müller-Ehmsen and Y Kawase

Gene Ther 19: 637-641; advance online publication, March 15, 2012; doi:10.1038/gt.2012.14

Abstract | Full Text | PDF

Lentiviral vectors and cardiovascular diseases: a genetic tool for manipulating cardiomyocyte differentiation and function  

E Di Pasquale, M V G Latronico, G S Jotti and G Condorelli

Gene Ther 19: 642-648; advance online publication, March 1, 2012; doi:10.1038/gt.2012.19

Abstract | Full Text | PDF

Intracellular transport of recombinant adeno-associated virus vectors  

M Nonnenmacher and T Weber

Gene Ther 19: 649-658; advance online publication, February 23, 2012; doi:10.1038/gt.2012.6

Abstract | Full Text | PDF

Gene delivery technologies for cardiac applications  

M G Katz, A S Fargnoli, L A Pritchette and C R Bridges

Gene Ther 19: 659-669; advance online publication, March 15, 2012; doi:10.1038/gt.2012.11

Abstract | Full Text | PDF

Cardiac gene therapy in large animals: bridge from bench to bedside  

K Ishikawa, L Tilemann, D Ladage, J Aguero, L Leonardson, K Fish and Y Kawase

Gene Ther 19: 670-677; advance online publication, February 2, 2012; doi:10.1038/gt.2012.3

Abstract | Full Text | PDF

Progress in gene therapy of dystrophic heart disease  

Y Lai and D Duan

Gene Ther 19: 678-685; advance online publication, February 9, 2012; doi:10.1038/gt.2012.10

Abstract | Full Text | PDF

Targeting GRK2 by gene therapy for heart failure: benefits above β-blockade  

J Reinkober, H Tscheschner, S T Pleger, P Most, H A Katus, W J Koch and P W J Raake

Gene Ther 19: 686-693; advance online publication, February 16, 2012; doi:10.1038/gt.2012.9

Abstract | Full Text | PDF

Directed evolution of novel adeno-associated viruses for therapeutic gene delivery  

M A Bartel, J R Weinstein and D V Schaffer

Gene Ther 19: 694-700; advance online publication, March 8, 2012; doi:10.1038/gt.2012.20

Abstract | Full Text | PDF

http://www.nature.com/gt/journal/v19/n6/index.html

Part II: Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension

Public release date: 30-Jul-2013

Contact: Lauren Woods
lauren.woods@mountsinai.org
212-241-2836
The Mount Sinai Hospital / Mount Sinai School of Medicine

Inhalable gene therapy may help pulmonary arterial hypertension patients

Gene therapy when inhaled may restore function of a crucial enzyme in the lungs to reverse deadly PAH

The deadly condition known as pulmonary arterial hypertension (PAH), which afflicts up to 150,000 Americans each year, may be reversible by using an inhalable gene therapy, report an international team of researchers led by investigators at the Cardiovascular Research Center at Icahn School of Medicine at Mount Sinai.

In their new study, reported in the July 30 issue of the journal Circulation, scientists demonstrated that gene therapy administered through a nebulizer-like inhalation device can completely reverse PAH in rat models of the disease. In the lab, researchers also showed in pulmonary artery PAH patient tissue samples reduced expression of the SERCA2a, an enzyme critical for proper pumping of calcium in calcium compartments within the cells. SERCA2a gene therapy could be sought as a promising therapeutic intervention in PAH.

“The gene therapy could be delivered very easily to patients through simple inhalation — just like the way nebulizers work to treat asthma,” says study co-senior investigator Roger J. Hajjar, MD, Director of the Cardiovascular Research Center and the Arthur & Janet C. Ross Professor of Medicine and Professor of Gene & Cell at Icahn School of Medicine at Mount Sinai. “We are excited about testing this therapy in PAH patients who are in critical need of intervention.”

This same SERCA2a dysfunction also occurs in heart failure. This new study utilizes the same gene therapy currently being tested in patients to reverse congestive heart failure in a large phase III clinical trial in the United States and Europe.

“What we have shown is that gene therapy restores function of this crucial enzyme in diseased lungs,” says Dr. Hajjar. “We are delighted with these new findings because it suggests that a gene therapy that is already showing great benefit in congestive heart failure patients may be able to help PAH patients who currently have no good treatment options — and are in critical need of a life sustaining therapy.”

When SERCA2a is down-regulated, calcium stays longer in the cells than it should, and it induces pathways that lead to overgrowth of new and enlarged cells. According to researchers, the delivery of the SERCA2a gene produces SERCA2a enzymes, which helps both heart and lung cells restore their proper use of calcium.

“We are now on a path toward PAH patient clinical trials in the near future,” says Dr. Hajjar, who developed the gene therapy approach. Studies in large animal models are now underway. SERCA2a gene therapy has already been approved by the National Institutes of Health for human study.

A Simple Inhalation Corrects Deadly Dysfunction

PAH most commonly results from heart failure in the left side of the heart or from a pulmonary embolism, when clots in the legs travel to the lungs and cause blockages. When the lung is damaged from these conditions, the tissue starts to quickly produce new and enlarged cells, which narrows pulmonary arteries. This increases the pressure inside them. The high pressure in these arteries resists the heart’s effort to pump through them and the blood flow between the heart and lungs is reduced. The right side of the heart then must overcome the resistance and work harder to push the blood through the pulmonary arteries into the lungs. Over time, the right ventricle becomes thickened and enlarged and heart failure develops.

The gene therapy that Dr. Hajjar developed uses a modified adeno-associated viral-vector that is derived from a parvovirus. It works by introducing a healthy SERCA2a gene into cells, but this gene does not incorporate into a patient’s chromosome, according to the study’s lead author, Lahouaria Hadri, PhD, an Instructor of Medicine in Cardiology at Icahn School of Medicine at Mount Sinai.

“The clinical trials in congestive heart failure have shown already that the gene therapy is very safe,” says Dr. Hadri. Between 40-50 percent of individuals have antecedent antibodies to the adeno-associated vectors, so potential patients need to be screened before gene therapy to make sure they are eligible to receive the vectors. In patients without antibodies, the restorative enzyme gene therapy does not cause an immune response, according to Dr. Hadri.

The clinical application of the gene therapy for patients with PAH will most likely differ from those with heart failure. The replacement gene needs to be injected through the coronary arteries of heart failure patients using catheters, while in PAH patients, the gene will need to be administered through inhalation.

This study was supported by National Institutes of Health grants (K01HL103176, K08111207, R01 HL078691, HL057263, HL071763, HL080498, HL083156, and R01 HL105301).

Other study co-authors include Razmig G. Kratlian, MD, Ludovic Benard, PhD, Kiyotake Ishikawa, MD, Jaume Aguero, MD, Dennis Ladage, MD, Irene C.Turnbull, MD, Erik Kohlbrenner, BA, Lifan Liang, MD, Jean-Sébastien Hulot, MD, PhD, and Yoshiaki Kawase, MD, from Icahn School of Medicine at Mount Sinai; Bradley A. Maron, MD and the study’s co-senior author Jane A. Leopold, MD, from Brigham and Women’s Hospital and Harvard Medical School in Boston, MA; Christophe Guignabert, PhD, from Hôpital Antoine-Béclère, Clamart, France; Peter Dorfmüller, MD, PhD, and Marc Humbert, MD, PhD, both of the Hôpital Antoine-Béclère and INSERM U999, Centre Chirurgical Marie-Lannelongue, Le Plessis-Robinson, France; Borja Ibanez, MD, from Fundación Centro Nacional de Investigaciones Cardiovasculares, Carlos III (CNIC), Madrid, Spain; and Krisztina Zsebo, PhD, of Celladon Corporation, San Diego, CA.

  • Dr. Hajjar and co-author Dr. Zsebo, have ownership interest in Celladon Corporation, which is developing AAV1.SERCA2a for the treatment of heart failure. Also,
  • Dr. Hajjar and co-authors Dr. Kawase and Dr. Ladage hold intellectual property around SERCA2a gene transfer as a treatment modality for PAH. In addition,
  • co-author Dr. Maron receives funding from Gilead Sciences, Inc. to study experimental pulmonary hypertension.
  • Other study co-authors have no financial interests to declare.

Therapeutic Efficacy of AAV1.SERCA2a in Monocrotaline-Induced Pulmonary Arterial Hypertension

  1. Lahouaria Hadri, PhD;
  2. Razmig G. Kratlian, MD;
  3. Ludovic Benard, PhD;
  4. Bradley A. Maron, MD;
  5. Peter Dorfmüller, MD, PhD;
  6. Dennis Ladage, MD;
  7. Christophe Guignabert, PhD;
  8. Kiyotake Ishikawa, MD;
  9. Jaume Aguero, MD;
  10. Borja Ibanez, MD;
  11. Irene C. Turnbull, MD;
  12. Erik Kohlbrenner, BA;
  13. Lifan Liang, MD;
  14. Krisztina Zsebo, PhD;
  15. Marc Humbert, MD, PhD;
  16. Jean-Sébastien Hulot, MD, PhD;
  17. Yoshiaki Kawase, MD;
  18. Roger J. Hajjar, MD*;
  19. Jane A. Leopold, MD*

+Author Affiliations


  1. From the Cardiovascular Research Center, Icahn School of Medicine at Mount Sinai, New York, NY (L.H., R.G.K., L.B., D.L., K.I., J.A., I.C.T., E.K., L.L., J.-S.H., Y.K., R.J.H.); Cardiovascular Medicine Division, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA (B.A.M., J.A.L.); Hôpital Antoine-Béclère, Clamart, France (P.D., C.G., M.H.); INSERM U999, Centre Chirurgical Marie-Lannelongue, Le Plessis-Robinson, France (P.D., M.H.); Fundación Centro Nacional de Investigaciones Cardiovasculares, Carlos III (CNIC), Madrid, Spain (B.I.); and Celladon Corporation, San Diego, CA (K.Z.).
  1. Correspondence to Lahouaria Hadri, PhD, Cardiovascular Research Center, Box 1030, Icahn School of Medicine at Mount Sinai, 1470 Madison Ave, New York, NY 10029. E-mail lahouaria.hadri@mssm.edu

Abstract

Background—Pulmonary arterial hypertension (PAH) is characterized by dysregulated proliferation of pulmonary artery smooth muscle cells leading to (mal)adaptive vascular remodeling. In the systemic circulation, vascular injury is associated with downregulation of sarcoplasmic reticulum Ca2+-ATPase 2a (SERCA2a) and alterations in Ca2+homeostasis in vascular smooth muscle cells that stimulate proliferation. We, therefore, hypothesized that downregulation of SERCA2a is permissive for pulmonary vascular remodeling and the development of PAH.

Methods and Results—SERCA2a expression was decreased significantly in remodeled pulmonary arteries from patients with PAH and the rat monocrotaline model of PAH in comparison with controls. In human pulmonary artery smooth muscle cells in vitro, SERCA2a overexpression by gene transfer decreased proliferation and migration significantly by inhibiting NFAT/STAT3. Overexpresion of SERCA2a in human pulmonary artery endothelial cells in vitro increased endothelial nitric oxide synthase expression and activation. In monocrotaline rats with established PAH, gene transfer of SERCA2a via intratracheal delivery of aerosolized adeno-associated virus serotype 1 (AAV1) carrying the human SERCA2a gene (AAV1.SERCA2a) decreased pulmonary artery pressure, vascular remodeling, right ventricular hypertrophy, and fibrosis in comparison with monocrotaline-PAH rats treated with a control AAV1 carrying β-galactosidase or saline. In a prevention protocol, aerosolized AAV1.SERCA2a delivered at the time of monocrotaline administration limited adverse hemodynamic profiles and indices of pulmonary and cardiac remodeling in comparison with rats administered AAV1 carrying β-galactosidase or saline.

Conclusions—Downregulation of SERCA2a plays a critical role in modulating the vascular and right ventricular pathophenotype associated with PAH. Selective pulmonary SERCA2a gene transfer may offer benefit as a therapeutic intervention in PAH.

Key Words:

  • Received January 24, 2013.
  • Accepted June 13, 2013.

http://circ.ahajournals.org/content/128/5/512.abstract?sid=9b3b4fcc-e158-4e5d-bb8b-125586e2ec12

Circulation.2013; 128: 512-523 Published online before print June 26, 2013,doi: 10.1161/​CIRCULATIONAHA.113.001585

Part III: Cardiac Gene Therapy: Percutaneous Intra-coronary Artery Infusion for Heart Failure

Etiology of Heart Failure

  • Alcoholic
  • Hypertensive
  • Idiopathic
  • Inflammatory
  • Ischemic
  • Pregnancy-related
  • Toxic
  • Valvular Heart DIsease

Administration of Cardiac Gene Therapy for Heart Failure: via Percutaneous Intra-coronary Artery Infusion

  • Gene delivery to viable myocardium

dominance and coronary artery anatomy from angiography determines infusion scenario

  • Antegrade epicardial coronary artery infusion over 10 minutes

60 mL divided into 1,2,3 infusions depending on anatomy

Delivered via commercially available angiographic injection system & guide or diagnostic catheters

Dr. Roger J. Hajjar of the Mount Sinai School of Medicine will present at the ASGCT 15th Annual Meeting during a Scientific Symposium entitled: Cell and Gene Therapy in Cardiovascular Disease on Wednesday, May 16, 2012 at 8:00 am. Below is a brief preview of his presentation.

Roger J. Hajjar, MD

Mount Sinai School of Medicine

New York, NY

Novel Developments in Gene Therapy for Cardiovascular Diseases

Chronic heart failure is a leading cause of hospitalization affecting nearly 6 million people in the U.S. with 670,000 new cases diagnosed every year. Heart failure leads to about 280,000 deaths annually.

Congestive heart failure remains a progressive disease with a desperate need for innovative therapies to reverse the course of ventricular dysfunction. The most common symptoms of heart failure are shortness of breath, feeling tired and swelling in the ankles, feet, legs and sometimes the abdomen. Recent advances in understanding the molecular basis of myocardial dysfunction, together with the evolution of increasingly efficient gene transfer technology have placed heart failure within reach of gene-based therapies.

One of the key abnormalities in both human and experimental HF is a defect in sarcoplasmic reticulum (SR) function, which controls Ca2+ handling in cardiac myocytes on a beat to beat basis. Deficient SR Ca2+ uptake during relaxation has been identified in failing hearts from both humans and animal models and has been associated with a decrease in the activity of the SR Ca2+-ATPase (SERCA2a).

Over the last ten years we have undertaken a program of targeting important calcium cycling proteins in experimental models of heart by somatic gene transfer. This has led to the completion of a first-in-man phase 1 clinical trial of gene therapy for heart failure using adeno-associated vector (AAV) type 1 carrying SERCA2a. In this Phase I trial, there was evidence of clinically meaningful improvements in functional status and/or cardiac function which were observed in the majority of patients at various time points. The safety profile of AAV gene therapy along with the positive biological signals obtained from this phase 1 trial has led to the initiation and recent completion of a phase 2 trial of AAV1.SERCA2a in NYHA class III/IV patients. In the phase 2 trial, gene transfer of SERCA2a was found to be safe and associated with benefit in clinical outcomes, symptoms, functional status, NT-proBNP and cardiac structure.

The 12 month data presented showed that heart failure, which is a progressive disease, became stabilized in high dose AAV1.SERCA2a-treated patients: heart failure symptoms, exercise tolerance, serum biomarkers and cardiac function essentially improved or remained the same while these parameters deteriorated substantially in patients treated with placebo and concurrent optimal drug and device therapy. More recently, the 2-year CUPID data from long-term follow-up demonstrate a durable benefit in preventing major cardiovascular events.

The recent successful and safe completion of the CUPID trial along with the start of more recent phase 1 trials usher a new era for gene therapy for the treatment of heart failure. Furthermore, novel AAV derivatives with high cardiotropism and resistant to neutralizing antibodies are being developed to target a large number of cardiovascular diseases.

http://www.execinc.com/hosted/emails/asgct/file/Hajjar2(1).pdf

Power Point Presentation on Cardiac Gene Therapy –

VIEW SLIDE SHOW

http://my.americanheart.org/idc/groups/heart-public/@wcm/@global/documents/downloadable/ucm_311680.pdf

Gene Therapy for Heart Failure

  1. Lisa Tilemann,
  2. Kiyotake Ishikawa,
  3. Thomas Weber,
  4. Roger J. Hajjar

+Author Affiliations


  1. From the Cardiovascular Research Center, Mount Sinai Medical Center, New York, NY.
  1. Correspondence to Roger J. Hajjar, MD, Mount Sinai Medical Center, One Gustave Levy Place, Box 1030, New York, NY 10029. E-mail roger.hajjar@mssm.edu

Abstract

Congestive heart failure accounts for half a million deaths per year in the United States. Despite its place among the leading causes of morbidity, pharmacological and mechanic remedies have only been able to slow the progression of the disease. Today’s science has yet to provide a cure, and there are few therapeutic modalities available for patients with advanced heart failure. There is a critical need to explore new therapeutic approaches in heart failure, and gene therapy has emerged as a viable alternative. Recent advances in understanding of the molecular basis of myocardial dysfunction, together with the evolution of increasingly efficient gene transfer technology, have placed heart failure within reach of gene-based therapy. The recent successful and safe completion of a phase 2 trial targeting the sarcoplasmic reticulum calcium ATPase pump (SERCA2a), along with the start of more recent phase 1 trials, opens a new era for gene therapy for the treatment of heart failure.

Circulation Research.2012; 110: 777-793 doi: 10.1161/​CIRCRESAHA.111.252981

Key Words:

  • Received December 8, 2011.
  • Revision received January 29, 2012.
  • Accepted January 30, 2012.

Conclusions 

With a better understanding of the molecular mechanisms associated with heart failure and improved vectors with cardiotropic properties, gene therapy can now be considered as a viable adjunctive treatment to mechanical and pharmacological therapies for heart failure. In the coming years, more targets will emerge that are amenable to genetic manipulations, along with more advanced vector systems, which will undoubtedly lead to safer and more effective clinical trials in gene therapy for heart failure.

http://circres.ahajournals.org/content/110/5/777.full.pdf+html

Hijjar1
Figure 1.

AAV entry. 1 indicates receptor binding and endocytosis; 2, escape into cytoplasm; 3, nuclear import; 4, capsid disassembly; 5, double-strand synthesis; and 6, transcription.

Hijjar2

Figure 2.

Generation of mutant AAV library and directed evolution to identify cardiotropic AAVs. A, Creation of a library of AAVs through DNA shuffling.B, Selection of cardiotropic AAVs through directed evolution.

Hijjar3

Figure 3.

Antegrade coronary artery infusion. A, Coronary artery infusion. The vector is injected through a catheter without interruption of the coronary flow. B, Coronary artery infusion with occlusion of a coronary artery: The vector is injected through the lumen of an inflated angioplasty catheter. C, Coronary artery infusion with simultaneous blocking of a coronary artery and a coronary vein: The vector is injected through an inflated angioplasty catheter and resides in the coronary circulation until both balloons are deflated.

Hijjar4

Figure 4.

V-Focus system and retrograde coronary venous infusion. A, Recirculating antegrade coronary artery infusion: The vector is injected into a coronary artery, collected from the coronary sinus and after oxygenation readministered into the coronary artery. B, Retrograde coronary venous infusion with simultaneous blocking of a coronary artery and a coronary vein: The vector is injected into a coronary vein and resides in the coronary circulation until both balloons are deflated.

Hijjar5

Figure 5.

Direct myocardial injection and pericardial injection. A, Percutaneous myocardial injection: The vector is injected with an injection catheter via an endocardial approach.B, Surgical myocardial injection: The vector is injected via an epicardial approach. C, Percutaneous pericardial injection: The vector is injected via a substernal approach.

Hijjar6

Figure 6.

Excitation-contraction coupling in cardiac myocytes provides multiple targets for gene therapy.

SOURCE

http://circres.ahajournals.org/content/110/5/777.figures-only

Articles citing this article

  • ‘Ryanopathy’: causes and manifestations of RyR2 dysfunction in heart failureCardiovasc Res. 2013;98:240-247,
  • Up-regulation of sarcoplasmic reticulum Ca2+ uptake leads to cardiac hypertrophy, contractile dysfunction and early mortality in mice deficient in CASQ2Cardiovasc Res. 2013;98:297-306,
  • Myocardial Delivery of Stromal Cell-Derived Factor 1 in Patients With Ischemic Heart Disease: Safe and PromisingCirc. Res.. 2013;112:746-747,
  • Circulation Research Thematic Synopsis: Cardiovascular GeneticsCirc. Res.. 2013;112:e34-e50,
  • Gene and cytokine therapy for heart failure: molecular mechanisms in the improvement of cardiac functionAm. J. Physiol. Heart Circ. Physiol.. 2012;303:H501-H512,
  • Ryanodine Receptor Phosphorylation and Heart Failure: Phasing Out S2808 and “Criminalizing” S2814Circ. Res.. 2012;110:1398-1402,

http://circres.ahajournals.org/content/110/5/777.figures-only

For 154 References on Cardiac Gene Therapy

http://circres.ahajournals.org/content/110/5/777.full.pdf+html

Read Full Post »


The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and PathologyDuke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »


This content is password protected. To view it please enter your password below:

Read Full Post »


Curator: Aviva Lev-Ari, PhD, RN

Clinical Indications for Use of Inhaled Nitric Oxide (iNO) in the Adult Patient Market: Clinical Outcomes after Use of iNO in the Institutional Market,  Therapy Demand and Cost of Care vs. Existing Supply Solutions

 

Introduction  to Inhaled Nitric Oxide Therapy in Adults

Part 1:             Clinical Indications for Use of Inhaled Nitric Oxide (iNO) in the Adult Patient Market

Part 2:            Clinical Outcomes after Use of iNO in the Institutional Market

Part 3:            Therapy Demand and Cost of Care vs. Existing Supply Solutions

Part 4:            Product Development Concepts for New Medical Devices to Deliver Inhaled Nitric Oxide

Introduction  to Inhaled Nitric Oxide Therapy in Adults: Evidence-based Medicine 

This Introduction section of the article is based on research results and literature survey in:

Mark J.D. Griffiths, M.R.C.P., Ph.D., and Timothy W. Evans, M.D., Ph.D.

Inhaled Nitric Oxide Therapy in Adults, n engl j med 353;25 http://www.nejm.org December 22, 2005

http://www.nejm.org/doi/full/10.1056/NEJMra051884

  • On the basis of the evidence, inhaled nitric oxide is not an effective therapeutic intervention in patients with acute lung injury or ARDS, and its routine use to achieve this end is inappropriate. However, inhaled nitric oxide may be useful as a short-term adjunct to cardiorespiratory support in patients with acute hypoxemia, life-threatening pulmonary hypertension, or both.
  • Inhaled nitric oxide is a selective pulmonary vasodilator that improves ventilation–perfusion matching at low doses in patients with acute respiratory failure, potentially improving oxygenation and lowering pulmonary vascular resistance.
  • Large clinical trials have indicated that physiologic benefits are short-lived in adults with acute lung injury or ARDS, and no associated improvement in mortality rates has been demonstrated. However, clinical trials involving patients with acute lung injury or ARDS have been statistically underpowered to show a decrease in mortality rates and have not considered recent insights into the effect of continuous inhalation on the dose– response relationship of this agent. In patients with acute respiratory failure, the potential toxicity or protective effects of inhaled nitric oxide, particularly any effects on cell survival and inflammation, are poorly understood.
  • Ideal Treatment Goals for Inhaled Nitric Oxide
  1. Improved oxygenation
  2. Decreased pulmonary vascular resistance
  3. Decreased pulmonary edema
  4. Reduction or prevention of inflammation – rebound phenomena may be avoided by withdrawing inhaled nitric oxide gradually. Despite these concerns, in large clinical studies of patients with ARDS, the abrupt discontinuation of inhaled nitric oxide has not caused a deterioration in oxygenation
  5. Cytoprotection
  6. Protection against infection
  • Administration of Inhaled Nitric Oxide to Adults: Routes and Safety Monitoring

Nitric oxide is most commonly administered to patients receiving mechanical ventilation, although it may also be given through a face mask or nasal cannulae. Limiting the mixing of nitric oxide and high concentrations of inspired oxygen reduces the risk of adverse effects resulting from the formation of nitrogen dioxide. This is minimized further by introducing the mixture of nitric oxide and nitrogen into the inspiratory limb of the ventilator tubing as near to the patient as possible and synchronizing injection of the mixture with inspiration

  • Electrochemical analyzers can be used to monitor the concentrations of nitric oxide and nitrogen dioxide in the inspired gas mixture to an accuracy of 1 ppm.
  • More sensitive Chemiluminescence monitors can detect nitric oxide and its oxidative derivatives in parts per billion.
  • Dose-Response for Respiratory Failure in the Adult Patient – a response is defined as a 20 percent increase in oxygenation. For example, a 10 percentage point improvement in hemoglobin saturation in a patient with hypoxemia who is breathing 100 percent oxygen may be clinically very important.
  • Dose-Response for Pulmonary Hypertension in the Adult Patient – a 30 percent decrease in pulmonary vascular resistance during the inhalation of nitric oxide (10 ppm for 10 minutes) has been used to identify an association with vascular responsiveness to agents that can be helpful in the long term. A positive response to nitric oxide was associated with a favorable response to calcium-channel blockers in a small cohort of patients with primary pulmonary hypertension
  • Time-dependent variation in the dose–response relationship of inhaled nitric oxide in patients with severe ARDS – Observations imply that the optimal dose of inhaled nitric oxide must be determined by titration against the therapeutic target in each patient at least every two days, and probably more frequently.
  • Other Inhaled Vasodilators – Alternatives and Adjuncts to Inhaled Nitric Oxide
  1. Aerosolized sodium nitrite caused potent, selective, nitric oxide–dependent pulmonary vasodilatation through its reaction with deoxyhemoglobin at a low pH, suggesting that nitrite may be a cheap and stable alternative to inhaled nitric oxide
  2. Epoprostenol, the most extensively studied alternative to inhaled nitric oxide, is also an endothelium- derived vasodilator with antithrombotic effects. Inhaled epoprostenol has an effect on hemodynamics and oxygenation similar to that of nitric oxide in patients with ARDS, sepsis, or severe heart failure. Nebulized epoprostenol has been studied less frequently than inhaled nitric oxide, but at therapeutic doses (10 to 50 ng per kilogram per minute), the rates of predicted side effects, such as systemic hypotension and bleeding after surgery, have not been clinically important.
  3. Iloprost, a long-acting prostacyclin analogue (half-life, 20 to 30 minutes), improves the exercise tolerance of patients with severe pulmonary hypertension when administered by intermittent rather than by continuous nebulization. Inhaled prostaglandin E1 (6 to 15 ng per kilogram of body weight per minute) has effects similar to those of inhaled nitric oxide (2 to 10 ppm) in patients with ARDS
  • Agonists to Nitric Oxide – Adjunctive Therapies That Increase the Effectiveness of Inhaled Nitric Oxide

1. Orally administered sildenafil, an inhibitor of phosphodiesterase type 5, is a selective pulmonary vasodilator, partially because phosphodiesterase type 5 is highly expressed in the lung. Sildenafil has augmented pulmonary vasodilatation induced by inhaled nitric oxide,  although a second inhibitor of phosphodiesterase type 5, zaprinast, predictably worsened oxygenation through the attenuation of hypoxic pulmonary vasoconstriction in an ovine model of acute lung injury.  Such agents may therefore be most useful when pulmonary hypertension rather than respiratory failure is the chief concern.

2. Almitrine, an agonist at peripheral arterial chemoreceptors, is a selective pulmonary vasoconstrictor that specifically enhances hypoxic pulmonary vasoconstriction. The addition of almitrine to low-dose inhaled nitric oxide improves oxygenation in patients with ARDS, but concern about the effects of long-term infusion has hampered the wider investigation of this combination. In patients with acute respiratory failure, the effect of nitric oxide depends on the degree of recruitment of injured lung units by — for example — positive end-expiratory pressure, prone positioning, or ventilatory maneuvers designed to inflate collapsed lung, which may explain how the response to nitric oxide varies over short periods. Partial liquid ventilation with perfluorocarbons facilitates the delivery of dissolved gases to alveoli by enhancing recruitment of the injured lung units. Inhaled nitric oxide has enhanced the effects of partial liquid ventilation on gas exchange in animal models, demonstrating the potential benefit of combining therapeutic strategies in patients with ARDS.

For 2005 – 2013 List of References on Inhaled Nitric Oxide Therapy in Adults, see the list of article that has cited  at the bottom of the following seminal paper:

http://circ.ahajournals.org/content/109/25/3106.full

 

Part 1:

Clinical Indications for Use of Inhaled Nitric Oxide (iNO) in the Adult Patient Market:

SOURCE:

George, Isaac, Xydas, Steve, Topkara, Veli K., Ferdinando, Corrina, Barnwell, Eileen C., Gableman, Larissa, Sladen, Robert N., Naka, Yoshifumi, Oz, Mehmet C.
Clinical Indication for Use and Outcomes After Inhaled Nitric Oxide Therapy
Ann Thorac Surg 2006 82: 2161-2169

Abbreviations and Acronyms

ARDS  adult respiratory distress syndrome

iNO  inhaled nitric oxide

OHT  orthotopic heart transplantation

OLT  orthotopic lung transplantation

PAP  pulmonary artery pressure

PVR  pulmonary vascular resistance

ROC  receiver operating curve

RV  right ventricular

VAD  ventricular assist device

Institutional Guidelines for Inhaled Nitric Oxide Administration – Table 1 in the Study

1. Heart transplantation with evidence of pulmonary hypertension

2. Complicated coronary surgery with evidence of right ventricular failure based on at least one of the following

criteria

  • Mean pulmonary artery pressure 25 mm Hg
  • Echocardiographic evidence of moderate to severe right
  • ventricular dysfunction; severe right atrial or ventricular enlargement
  • Cardiac index 2.2 L · min1 · m2

3. Precapillary pulmonary hypertension diagnosis

4. Congenital cardiac disease

5. Acute chest syndrome in sickle cell disease

6. The starting dose for all above indications was 10 to 20 ppm, with an initial trial for 60 minutes before up-titration.

Indication for inhaled nitric oxide (iNO) use – Surgical Patient

1.  orthotopic heart transplantation [OHT] with pulmonary hypertension;

2. precapillary pulmonary hypertension;

3. coronary surgery with right ventricular failure;

4. congenital cardiac disease;

  • OLT – orthotopic lung transplantation- patients received iNO for treatment of pulmonary hypertension, 
  • OHT – orthotopic heart transplant  –  right ventricular failure was the most common indication for patients undergoing cardiac surgery and ventricular assist device (VAD) implantation.

Indication for inhaled nitric oxide (iNO) use – Medical Patients in ICU

5. hypoxemia                                                                                                                                                                                                    

  • Other surgical and medical patients received iNO predominantly for hypoxemia use.

A trend toward a lower average duration of iNO use was seen:

  • after OHT (n 67) and OLT (n 45)

versus

  • cardiac surgery (n 105),
  • VAD (n 66),
  • other surgery (n 34), and
  • medical patients (n 59; p 0.09).

Primary Surgical Procedure –  Table 4. in the Study – All Patients in the Study

Abbreviations and Acronyms

BiVAD biventricular assist device;

CABG coronary artery bypass grafting;

LVAD left ventricular assist device;

MVR mitral valve replacement or repair;

OHT orthotopic heart transplantation;

OLT orthotopic lung transplanatation;

RVAD right ventricular assist device;

Txp transplant;

VAD ventricular assist device.

AVR aortic valve replacement;

OHT = 67 OLT = 45 Cardiac Surgery = 105  VAD = 66  Other Surgery = 34  Medical (No Surgery) = 59

N (%)

OHT – Heart Txp – 67 (100)

OLT – Lung Txp – 45 (100)

Cardiac Surgery = 105

  • AVR, 10 (9.5) 59 (100)
  • AVR/MVR, 10 (9.5)
  • CABG, 23 (21.9)
  • CABG/Valve, 23 (21.9)
  • MVR, 22 (20.9)
  • Other cardiac, 11 (10.5)
  • Other valve, 3 (2.9)

VAD = 66

  • LVAD, 54 (81.8)
  • BiVAD, 12 (18.2)
  • RVAD, 0

Other surgery = 34

  • Other surgery 21 (61.8)
  • Thoracic surgery, 8 (23.5)
  • Other Txp. 5 (14.7)

Medical =59 in ICU

  • No Surgery, 59 (100)

 

Part 2:

Clinical Outcomes after Use of iNO in the Institutional Market

Use of iNO for pulmonary hypertension in patients undergoing

  • OHT and orthotopic lung transplantation was associated with a significantly lower overall mortality rate compared with its use after cardiac surgery or for hypoxemia in medical patients.
  • Inhaled nitric oxide does not appear to be cost effective when treating hypoxemia in medical patients with high-risk scores and irreversible disease.

In conclusion,

  • the present study reports comprehensive long-term survival data from a critically ill adult population receiving iNO therapy.
  • Inhaled nitric oxide treatment is a valuable pharmacologic adjunct in OHT and OLT for short-term hemodynamic improvements, and long-term data from the present study suggest a translation into long-term survival benefits.
  • Mortality outcomes after iNO are directly related to the clinical indication for use, and prolonged therapy for patients with irreversible systemic disease processes, such as hypoxemia or respiratory failure in medical patients, is not warranted.
  • Poor outcomes and high cost for medical patients with respiratory failure and hypoxemia in this study require further investigation to determine the appropriate duration of iNO use based on clinical response and appropriate endpoints of treatment.
  • A prospective clinical study controlling for severity of illness and addressing clinical efficacy in both surgical and medical populations is needed to definitively answer these questions, and may help reduce the burden of intensive care expenses.

Comment

Inhaled nitric oxide therapy has been shown to lead to reductions in PAP and PVR and improvement in oxygenation in several populations, including neonates and adult patients with ARDS and RV dysfunction, and after OHT or OLT [3, 6, 9, 10, 14]. These effects may improve short-term outcomes, but a study of long-term outcomes, costs, and clinical use of iNO use in other populations has not been conducted to date. This study is the first to describe outcomes and cost of iNO therapy in an unselected population of critically ill adult patients in a tertiary care center. These study results demonstrate that (1) outcomes after iNO vary substantially based on clinical indication of use, (2) iNO may benefit transplant patients more than other patients, and (3) iNO does not appear to alter the natural history or long-term clinical course of hypoxemic respiratory failure. This study also identifies the medical patient population with respiratory failure as one with substantial morbidity whose high mortality after iNO precludes prolonged therapy.

In the present study, OHT and OLT patients had a 1-year survival rate four times greater than medical patients not undergoing surgery, as well as higher survival rates compared with patients undergoing other types of surgery. The large differences in mortality after iNO therapy may be attributed to differences in the underlying etiology of the cardiac or respiratory failure (pulmonary hypertension versus hypoxemia) and the reversibility of pulmonary hypertension versus respira- tory failure.

In OHT, acutely elevated PAP, which accounts for 19% of early deaths after heart transplantation [24], may be secondary to both increases in flow (increased backward transmission of elevated left ventricular pressure) and increases in resistance in the pulmonary bed. With iNO use, PVR and PAP are reduced [25], decreasing RV afterload, ameliorating the wean from cardiopulmonary bypass, and preventing RV failure without affecting systemic vascular resistance. By providing temporary support, iNO therapy after transplant allows for the stabilization of hemodynamics until PVR returns to normal levels, which is attained in 80% of patients 1 year after OHT [26], reinforcing its reversible nature after cardiac transplantation. Short-term use of iNO after OHT has been demonstrated to improve RV function, PVR, and mean PAP after 12 to 76 hours of iNO use in 16 OHT patients, although there were no statistically significant differences in survival [9]. In 23 OLT patients, iNO therapy has been shown to reduce reimplantation edema, increase PaO2/FIO2, decrease the need for mechanical ventilation, and reduce the 2-month mortality rate [10].

The observed improvement in pulmonary hypertension also predicts significant outcome benefits, as OHT patients with reversible preoperative PVR have a much lower mortality than do those with a fixed elevated PVR [27, 28]. Survival at 4 years after iNO therapy was 68% in the transplant cohort in the present study, comparing favorably to reported 5-year survival rates of 71% for OHT [29] and 63% for OLT [30]. This study confirms prior studies that have shown acute benefits with iNO therapy after transplantation and shows that long-term survival in OHT and OLT after iNO therapy is comparable to that of patients not requiring iNO. In addition, although mortality in the VAD group was not appreciably different than that in the cardiac surgery group, a likely benefit of iNO in these patients was the avoidance of right ventricular assist device placement, as evidenced by the low rate of left ventricular assist device patients requiring a right ventricular assist device (5 of 66, 7.6%).

Furthermore, iNO therapy has not been shown to lead to long-term benefits in the treatment of severe respiratory failure, which was present in 80% of the medical cohort in this study, or hypoxemia, which was the primary indication in 85% of the medical patients. No benefit beyond 1 day of therapy was seen in indices of lung function in a randomized controlled clinical trial of 30 medical patients with severe respiratory failure and ARDS, yielding a 30-day mortality rate of 60% in iNOtreated patients and 53% in nontreated patients (p _ 0.71) [31]. More importantly, nonresponders had a 30-day mortality rate of 80%, whereas responders had a 50% mortality rate. The lack of short-term mortality benefit was confirmed by Michael and colleagues [32] in a randomized controlled trial of iNO in ARDS patients that showed transient improvements after 1 hour but no sustained improvements after 72 hours in PaO2, FIO2, and PaO2/FIO2. These two studies highlight important findings that iNO initially improves indices of lung function but does not produce lasting effects on oxygenation.

The inability to produce sustained effects on hypoxia and respiratory failure may explain the striking 1-year survival of only 17.3% and 4-year survival of 0% in our medical cohort, rates higher than the 90-day mortality rates of 40% to 50% that have been previously reported [33, 34]. Medical patients with severe cardiac or respiratory failure requiring iNO therapy represent a critically ill, challenging population with numerous comorbidities.

Judicious use of iNO is warranted for such patients if the immediate mortality risk is estimated to be high. The risk-scoring model reported here allows stratification of patients based on clinical history and provides prognostic information on mortality outcomes. The model predicted a mortality of 76.5% versus 37.2% (p _ 0.001) for a risk score greater than 1, with a sensitivity of 60%, specificity of 79%, and area under ROC of 0.731.

For cases in which the benefit is likely to be limited with a risk score greater than 1 (namely, respiratory failure in any non-OHT patient), efforts should be made to determine whether a patient responds to iNO therapy before prolonged administration is undertaken. As expected, hours of iNO use were highest in the medical group at 133 hours, and lowest after OHT and OLT at 71 and 57 hours, respectively. However, longer average duration of use did not produce higher iNO costs using the 2000 to 2003 charging practice, as many patients in all subgroups reached the maximal monthly charge after the first 4 days of therapy. This cap on iNO charges served to equalize costs in surgical and nonsurgical groups, and healthcare providers may continue iNO use in nonresponders as salvage therapy, given that it may not increase iNO-associated charges. However, the cost difference was more pronounced for OLT patients compared with medical and VAD patients using the current hourly charging practice, which was intended to reduce the overall cost of iNO therapy through more precise hourly billing. These findings confirm that prolonged iNO use is associated with higher cost and provides a financial rationale for limiting therapy for patients without expected survival benefit.

The study limitations include those inherent to an observational study. The lack of a randomized design and a control cohort not receiving iNO therapy precludes any definitive conclusions regarding the long-term clinical efficacy or cost effectiveness of iNO use, as long-term hemodynamics were unable to be measured and costeffectiveness measurements were not calculated. The transient but clinically important appearance of RV dysfunction in the operating room may only be apparent on hemodynamic analysis rather than on echocardiography, and RV dysfunction may be underreported using our echocardiographic definition. The poor survival rates observed in the medical cohort may be attributed to late initiation of iNO therapy in this group; it cannot, therefore, be excluded that earlier iNO administration may have led to higher survival rates. Finally, the absence of indirect hospital costs is a major limiting factor in the description of iNO costs, which may be significant.

Ann Thorac Surg 2006;82:2161-2169

 

Part 3:

Therapy Demand and Cost of Care vs. Existing Supply Solutions

Acquisition Cost of Inhaled Nitric Oxide Therapy

Charges for each iNO therapy encounter were calculated based on the charging practice of INO Therapeutics (AGA Healthcare, Clinton, New Jersey) between 2000 and 2003, and recalculated using the current 2005 charging practice. For the years 2000 to 2003, the charge to hospitals was $3,000 per 24 hours of therapy, up to a maximum charge of $12,000 per month, independent of  total hourly usage. Using the current 2005 charging practice, the charge for iNO was changed to an hourly rate of $125, with a maximum charge of $12,000 per month, independent of hourly usage. Indirect costs associated with iNO administration, including those for respiratory personnel, intensive care unit care, and daily monitoring were not included in this analysis.

Estimated Cost of iNO Therapy

The cost for iNO therapy is summarized in Table 6 using the 2000 to 2003 charging practice and current 2005 charging practice, demonstrating a higher cost of therapy in VAD and medical patients. Under the current 2005 pricing, a significantly lower proportion of OHT and OLT patients reached the maximal charge versus medical patients (23% versus 51%, 0.001).

Acquisition Cost of Inhaled Nitric Oxide Therapy – Table 6 in the Study

2000–2003 Charge Scale ($) || Current Charge Scale ($)

OHT 9,121 + or – 4,226  ||  7,010 + or – 5,072

OLT 8,040 + or – 3,659a  ||  5,710 + or – 4,132b

Cardiac surgery 9,179  + or – 5,319   ||  7,349 + or – 6,543

VAD 10,726 + or – 4,121   ||  8,722 + or – 4,966

Other surgery 9,324 + or – 4,110 ||  7,056 + or – 4,826

Medical 10,075 + or – 5,215  || 8,867 + or – 7,233

a p 0.05 versus VAD. b p 0.05 versus VAD, medical.

OHT orthotopic heart transplantation; OLT orthotopic lung transplantation; VAD ventricular assist device.

Ann Thorac Surg 2006;82:2161-2169

Present Market Demand for inhaled Nitric Oxide Gas

Clinical Policy Bulletin: Nitric Oxide, Inhalational (INO) Number: 0518

Aetna Policy

  • Aetna considers inhaled nitric oxide (INO) therapy medically necessary as a component of the treatment of hypoxic respiratory

failure in term and near-term (born at 34 or more weeks of gestation) neonates when both of the following criteria are met:

Neonates do not have congenital diaphragmatic hernia; and  When conventional therapies such as administration of high concentrations of oxygen, hyperventilation, high-frequency ventilation, the induction of alkalosis, neuromuscular blockade, and sedation have failed or are expected to fail.

Note: Use of INO therapy for more than 4 days is subject to medical necessity review.

  • Aetna considers the diagnostic use of INO medically necessary as a method of assessing pulmonary vaso-reactivity in persons

with pulmonary hypertension.

  • Aetna considers INO therapy experimental and investigational for all other indications because of insufficient evidence in the

peer-reviewed literature, including any of the following:

  • Acute bronchiolitis; or
  • Acute hypoxemic respiratory failure in children (other than those who meet the medical necessity criteria above) and in adults; or
  • Adult respiratory distress syndrome or acute lung injury; or
  • Post-operative management of pulmonary hypertension in infants and children with congenital heart disease; or
  • Premature neonates (less than 34 weeks of gestation); or
  • Prevention of ischemia-reperfusion injury/acute rejection following lung transplantation; or
  • Treatment of persons with congenital diaphragmatic hernia; or
  • Treatment of vaso-occlusive crises or acute chest syndrome in persons with sickle cell disease (sickle cell vasculopathy).

Part 4:

Product Development Concepts

A. Institutional Applications – Adult Patient Market

Dr. Pearlman’s Flywheel Concept, presents a solution in this Space, with potential NEW product design for POC for the Institutional Market and the HomeCare Market

Protected: Flywheel iNO, Three Novel Adult Patient Inhaled Nitric Oxide Product Concepts by Justin D. Pearlman MD ME PhD FACC

INDICATIONS for Flywheel

a.                  Hypoxic respiratory failure (HRF)

Aa.1      Neonatal market – Solution in Existence, [NOT COVERED BY LPBI]

Aa.2     Adult market hypoxic respiratory failure (HRF) associated with pulmonary hypertension or from other etiologies

b.                  Pulmonary Arterial Hypertension (PAH)

Ab.1    Neonatal market [NOT COVERED BY LPBI]

Ab.2   Adult market

c.                  Diagnostic Use of inhaled Nitric Oxide

Ac.1 Pulmonary Vasoreactivity Testing in the Cardiac Catheterization Laboratory

Ac2 Treatment of Perioperative Pulmonary Hypertension With Inhaled NO for  Congenital Heart Disease

Ac3 Cardiac Transplantation

Ac4 Insertion of Left Ventricular Assist Device

Ac5 Inhaled NO to Treat Ischemia-Reperfusion Injury

Ac6 Inhaled NO and Acute Respiratory Distress Syndrome

Ac7 Lung Transplantation

Ac8 Sickle Cell Disease

Ac9 Airway chronic inflammation: Nebulized epoprostenol, Iloprost, a long acting prostacyclin analogue, inhaled prostaglandin E1, Adjuctive therapy with inhaled Nitric Oxide

B. Home Care Applications –

Applications for the HomeCare Segment, as the POC is the Home – Types of Products:

For the Institutional Market:

A1. PiNO
A2. SiNO

For the HomeCare Market

Bx. HiNO –   Dr. Pearlman’s solution

B1. HiNO –    LPBI’s PORTABLE inspiratory pulsing device with option to turn off pulsing feature

B2. HiNO –   LPBI’s Home Care Facial Inhaling Device

a.                 COPD

b                  Unstable Angina

Present Market Supply for inhaled Nitric Oxide gas

The market supply of inhaled Nitric Oxide gas experience the structure of a Monopoly. No competition, one product type very expensive in use by Institutions, i.e., Hospitals, only AND Pediatric population, primarily

The Massachusetts General Hospital owns patents covering the use of nitric oxide inhalation, which it has licensed to INO Therapeutics, a division of AGA Linde, and Dr Zapol receives a portion of the royalties.

Dr Roberts is a member of the Scientific Advisory Board of INOTherapeutics, a company that sells inhaled nitric oxide gas. Dr Roberts is not compensated for this activity by the company.

http://inomax.com/

Clinical Trials – Newborns, full-term and nearly full-term infants

Hypoxic Respiratory Failure (HRF)

Clinical trials have shown that INOMAX is effective and well tolerated in the treatment of HRF associated with pulmonary hypertension.3 Its safety has been demonstrated in clinical trials and through post-marketing experience.

NINOS
Neonatal Inhaled Nitric Oxide Study Group (NINOS). Inhaled nitric oxide in full-term and nearly full-term infants with hypoxic respiratory failure. N Engl J Med. 1997;336:597-604. Detailed description.

CINRGI
Clark RH, Kuesser RJ, Walker MW, et al. Clinical Inhaled Nitric Oxide Research Group (CINRGI). Low-dose nitric oxide therapy for persistent pulmonary hypertension of the newborn. N Engl J Med. 2000;342:469-474. Detailed description.

I-NO/PPHN 
Davidson D, Barefield ES, Kattwinkel J, et al. Inhaled nitric oxide for the early treatment of persistent pulmonary hypertension of the term newborn: a randomized, double-masked, placebo-controlled, dose-response, multicenter study. Pediatrics. 1998;101:325-334.

Wessel DL, Adatia I, Van Marter LJ, Thompson JE, Kane JW, Stark AR, Kourebanas S. Improved oxygenation in a randomized trial of inhaled nitric oxide for persistent pulmonary hypertension of the newborn. J Pediatr. 1997;100:E7. [PubMed]

Neonatal Inhaled Nitric Oxide Group. Inhaled nitric oxide in full term and nearly full term infants with hypoxic respiratory failure. N Engl J Med. 1997;336:597–604. [PubMed]

Roberts JD, Fineman JR, Morin FC, Shaul PW, Rimer S, Schreiber MD, et al. Inhaled nitric oxide and persistent pulmonary hypertension of the newborn. The Inhaled Nitric Oxide Group. N Engl J Med. 1997;336:605–610. [PubMed]

Wessel DL, Adatia I, Giglia TM, Thompson JE, Kulik TJ. Use of inhaled nitric oxide and acetylcholine in the evaluation of pulmonary hypertension and endothelial function after cardiopulmonary bypass. Circulation. 1993;88:2128–2138. [PubMed]

Petros AJ, Turner SC, Nunn AJ. Cost implications of using inhaled nitric oxide compared with epoprostenol for pulmonary hypertension. J Pharm Technol. 1995;11:163–166. [PubMed]

 

Industry LEADER for the Neonatal Market : INOMAX®

http://inomax.com/about-inomax/

Nitric oxide delivery systems designed for critical care

With the INOMAX® delivery systems, you can be confident that you have continual innovative devices.

Dedication to developing next-generation technologies.

Continuous innovation supports evolving information and technology needs

Compatible with 60 ventilation systems, including HFOV and noninvasive modalities

Allow for operator-determined concentrations of nitric oxide (NO) in the breathing unit

Provide for a concentration that is constant throughout the respiratory cycle

Monitor for NO, oxygen (FiO2), and nitrogen dioxide (NO2)

Prevent generation of excessive inhaled NO2

INOMAX® demostrates safety and efficacy in the treatment of hypoxic respiratory failure (HRF)

Clinical trials have shown that INOMAX is effective and well tolerated in the treatment of HRF associated with pulmonary hypertension.3 Its safety has been demonstrated in clinical trials and through post-marketing experience.

INOMAX has a well-established safety profile

More than 530,000 patients treated worldwide*2

Meet all FDA-required specifications

In the US in 2013 – Inhaled Nitric Oxide is NOT a FDA approved Drug  Therapy for the Adult Patient

CLINICAL TRIALS on the Use of Inhaled Nitric Oxide by Adult Patients, include:

Inhaled Nitric Oxide for Acute Respiratory Distress Syndrome and Acute Lung Injury in Adults and Children: A Systematic Review with Meta-Analysis and Trial Sequential Analysis

  1. Arash Afshari, MD*,
  2. Jesper Brok, MD, PhD§,
  3. Ann M. Møller, MD, MSDC and
  4. Jørn Wetterslev, MD, PhD§

Published online before print March 3, 2011, doi:10.1213/​ANE.0b013e31820bd185A & A June 2011 vol. 112 no. 6 1411-1421

http://www.anesthesia-analgesia.org/content/112/6/1411.short

CONCLUSION: iNO cannot be recommended for patients with acute hypoxemic respiratory failure. iNO results in a transient improvement in oxygenation but does not reduce mortality and may be harmful.

Michael JR, Barton RG, Saffle JR, Mone M, Markewitz BA. Inhaled nitric oxide versus conventional therapy: effect on oxygenation in ARDS Am J Resp Crit Care Med 1998;157:1361-1362. [Free Full Text]

Abstract  A randomized, controlled clinical trial was performed with patients with acute respiratory distress syndrome (ARDS) to compare the effect of conventional therapy or inhaled nitric oxide (iNO) on oxygenation. Patients were randomized to either conventional therapy or conventional therapy plus iNO for 72 h. We tested the following hypotheses: (1) that iNO would improve oxygenation during the 72 h after randomization, as compared with conventional therapy; and (2) that iNO would increase the likelihood that patients would improve to the extent that the FI(O2) could be decreased by > or = 0.15 within 72 h after randomization. There were two major findings. First, That iNO as compared with conventional therapy increased Pa(O2)/FI(O2) at 1 h, 12 h, and possibly 24 h. Beyond 24 h, the two groups had an equivalent improvement in Pa(O2)/FI(O2). Second, that patients treated with iNO therapy were no more likely to improve so that they could be managed with a persistent decrease in FI(O2) > or = 0.15 during the 72 h following randomization (11 of 20 patients with iNO versus 9 of 20 patients with conventional therapy, p = 0.55). In patients with severe ARDS, our results indicate that iNO does not lead to a sustained improvement in oxygenation as compared with conventional therapy.

Dellinger RPZimmerman JLTaylor RWStraube RCHauser DLCriner GJDavis K JrHyers TMPapadakos PEffects of inhaled nitric oxide in patients with acute respiratory distress syndrome: results of a randomized phase II trial. Inhaled Nitric Oxide in ARDS Study Group.

Conclusions: From this placebo-controlled study, inhaled NO appears to be well tolerated in the population of ARDS patients studied. With mechanical ventilation held constant, inhaled NO is associated with a significant improvement in oxygenation compared with placebo over the first 4 hrs of treatment. An improvement in oxygenation index was observed over the first 4 days. Larger phase III studies are needed to ascertain if these acute physiologic improvements can lead to altered clinical outcome.

Conclusions: Inhaled nitric oxide at a dose of 5 ppm in patients with acute lung injury not due to sepsis and without evidence of nonpulmonary organ system dysfunction results in short-term oxygenation improvements but has no substantial impact on the duration of ventilatory support or mortality.

Lundin S, Mang H, Smithies M, Stenqvist O, Frostell C. Inhalation of nitric oxide in acute lung injury: results of a European multicentre study. Intensive Care Med 1999;25:911-9.

Conclusions: Improvement of oxygenation by INO did not increase the frequency of reversal of ALI. Use of inhaled NO in early ALI did not alter mortality although it did reduce the frequency of severe respiratory failure in patients developing severe hypoxaemia.

Inhaled Nitric Oxide as Drug Therapy continue to be a very HOT research subject as 2004 article was cited by the following studies, 2004-2013:

The Pharmacological Treatment of Pulmonary Arterial Hypertension 
Pharmacol. Rev.. 2012;64:583-620,

AbstractFull TextPDF

Transpulmonary Flux of S-Nitrosothiols and Pulmonary Vasodilation during Nitric Oxide Inhalation: Role of Transport 
Am. J. Respir. Cell Mol. Bio.. 2012;47:37-43,

AbstractFull TextPDF

Stimulation of soluble guanylate cyclase reduces experimental dermal fibrosis 
Ann Rheum Dis. 2012;71:1019-1026,

AbstractFull TextPDF

Inhaled Nitric Oxide for Elevated Cavopulmonary Pressure and Hypoxemia After Cavopulmonary Operations 
World Journal for Pediatric and Congenital Heart Surgery. 2012;3:26-31,

AbstractFull TextPDF

Inhaled Nitric Oxide Improves Outcomes After Successful Cardiopulmonary Resuscitation in Mice 
Circulation. 2011;124:1645-1653,

AbstractFull TextPDF

Nitrite Potently Inhibits Hypoxic and Inflammatory Pulmonary Arterial Hypertension and Smooth Muscle Proliferation via Xanthine Oxidoreductase-Dependent Nitric Oxide Generation 
Circulation. 2010;121:98-109,

AbstractFull TextPDF

Soluble guanylate cyclase stimulation: an emerging option in pulmonary hypertension therapy 
Eur Respir Rev. 2009;18:35-41,

AbstractFull TextPDF

Intravenous Magnesium Sulphate vs. Inhaled Nitric Oxide for Moderate, Persistent Pulmonary Hypertension of the Newborn. A Multicentre, Retrospective Study 
J Trop Pediatr. 2008;54:196-199,

AbstractFull TextPDF

RETRACTED: Treating pulmonary hypertension post cardiopulmonary bypass in pigs: milrinone vs. sildenafil analog 
Perfusion. 2008;23:117-125,

AbstractPDF

Inhaled Agonists of Soluble Guanylate Cyclase Induce Selective Pulmonary Vasodilation 
Am. J. Respir. Crit. Care Med.. 2007;176:1138-1145,

AbstractFull TextPDF

Nitric Oxide in the Pulmonary Vasculature 
Arterioscler. Thromb. Vasc. Bio.. 2007;27:1877-1885,

AbstractFull TextPDF

Soluble Guanylate Cyclase-{alpha}1 Deficiency Selectively Inhibits the Pulmonary Vasodilator Response to Nitric Oxide and Increases the Pulmonary Vascular Remodeling Response to Chronic Hypoxia 
Circulation. 2007;116:936-943,

AbstractFull TextPDF

Nitric Oxide and Peroxynitrite in Health and Disease 
Physiol. Rev.. 2007;87:315-424,

AbstractFull TextPDF

Sleeping Beauty-mediated eNOS gene therapy attenuates monocrotaline-induced pulmonary hypertension in rats 
FASEB J.. 2006;20:2594-2596,

AbstractFull TextPDF

Inhaled nitric oxide decreases infarction size and improves left ventricular function in a murine model of myocardial ischemia-reperfusion injury 
Am. J. Physiol. Heart Circ. Physiol.. 2006;291:H379-H384,

AbstractFull TextPDF

Inhaled nitric oxide does not reduce systemic vascular resistance in mice 
Am. J. Physiol. Heart Circ. Physiol.. 2006;290:H1826-H1829,

AbstractFull TextPDF

Inhibition of phosphodiesterase 1 augments the pulmonary vasodilator response to inhaled nitric oxide in awake lambs with acute pulmonary hypertension 
Am. J. Physiol. Lung Cell. Mol. Physiol.. 2006;290:L723-L729,

AbstractFull TextPDF

Treatment with phosphodiesterase inhibitors type III and V: milrinone and sildenafil is an effective combination during thromboxane-induced acute pulmonary hypertension 
Br J Anaesth. 2006;96:317-322,

AbstractFull TextPDF

Extrapulmonary effects of inhaled nitric oxide: role of reversible s-nitrosylation of erythrocytic hemoglobin. 
Proc Am Thorac Soc. 2006;3:153-160,

AbstractFull TextPDF

Soluble Guanylate Cyclase Activator Reverses Acute Pulmonary Hypertension and Augments the Pulmonary Vasodilator Response to Inhaled Nitric Oxide in Awake Lambs 
Circulation. 2004;110:2253-2259,

AbstractFull TextPDF

REFERENCES for the Introduction, Part 1,2,3,4

http://circ.ahajournals.org/content/109/25/3106.full

http://www.nejm.org/doi/full/10.1056/NEJMra051884

Ann Thorac Surg 2006;82:2161-2169
© 2006 The Society of Thoracic Surgeons

Clinical Indication for Use and Outcomes After Inhaled Nitric Oxide Therapy

Isaac George, MDa,*, Steve Xydas, MDa, Veli K. Topkara, MDa, Corrina Ferdinando, MDa, Eileen C. Barnwell, MS, RRTb,Larissa Gablemana, Robert N. Sladen, MDc, Yoshifumi Naka, MD, PhDa, Mehmet C. Oz, MDa

a Department of Surgery, Division of Cardiothoracic Surgery, Columbia University College of Physicians and Surgeons, New York, New York
b Department of Respiratory Therapy, Columbia-Presbyterian Medical Center, New York, New York
c Department of Anesthesia and Critical Care, Columbia-Presbyterian Medical Center, New York, New York 

References in this article

  1. Steudel W, Hurford WE, Zapol WM. Inhaled nitric oxide: basic biology and clinical applications Anesthesiology 1999;91:1090-1121.[Medline]
  2. Gianetti J, Bevilacqua S, De Caterina R. Inhaled nitric oxide: more than a selective pulmonary vasodilator Eur J Clin Invest 2002;32:628-635.[Medline]
  3. Roberts JD, Polaner DM, Lang P, Zapol WM. Inhaled nitric oxide in persistent pulmonary hypertension of the newborn Lancet 1992;340:818-820.[Medline]
  4. Kinsella JP, Neish SR, Shaffer E, Abman SH. Low-dose inhalational nitric oxide in persistent pulmonary hypertension of the newborn Lancet 1992;340:819-820.[Medline]
  5. Ashutosh K, Phadke K, Jackson JF, Steele D. Use of NO inhalation in chronic obstructive pulmonary disease Thorax 2000;55:109-113.[Abstract/Free Full Text]
  6. Rossaint R, Falke KJ, Lopez F, Slama K, Pison U, Zapol WM. Inhaled nitric oxide for the adult respiratory distress syndrome N Engl J Med 2004;328:399-405.
  7. Gladwin MT, Schecter AN, Shelhamer JH, Pannell LK, Conway DA. Inhaled NO augments NO transport on sickle cell hemoglobin without affecting oxygen affinity J Clin Invest 1999;104:847-848.[Medline]
  8. Stobierska-Dzierzek B, Awad H, Michler RE. The evolving management of acute right-sided heart failure in cardiac transplant recipients J Am Coll Card 2001;38:923-931.[Medline]
  9. Ardehali A, Hughes K, Sadeghi A, Esmailian F, Marelli D, Moriguchi J. Inhaled NO for pulmonary hypertension after heart transplantation Transplantation 2001;72:638-641.[Medline]
  10. Thabut G, Brugiere O, Leseche G, Stern JB, Fradj K. Preventive effect of inhaled NO and pentoxyfylline on ischemia-reperfusion injury after lung transplantation Transplantation 2001;71:1295-1300.[Medline]
  11. Sitbon O, Brunet B, Denjan A, et al. Inhaled nitric oxide as a screening vasodilator agent in primary pulmonary hypertension Am J Respir Crit Care Med 1995;151:384-389.[Abstract/Free Full Text]
  12. Semigran MJ, Cockrill BA, Kacmarek R, et al. Hemodynamic effects of inhaled nitric oxide in heart failure J Am Coll Cardiol 1994;24:982-988.[Medline]
  13. Girard C, Lehot J, Pannetier J, Filley S, Ffrench P, Estenove S. Inhaled nitric oxide after mitral valve replacement in patients with chronic pulmonary artery hypertension Anesthesiology 1992;77:880-883.[Medline]
  14. Bhorade S, Christenson J, O’Connor M, Lavoie A, Pohman A, Hall JB. Response to inhaled nitric oxide in patients with acute right heart syndrome Am J Respir Crit Care Med 1999;159:571-579.[Abstract/Free Full Text]
  15. Radermacher P, Santak B, Wust HJ, Tarnon J, Falke KJ. Prostacyclin and right ventricular function in patients with pulmonary hypertension associated with ARDS Intens Care Med 1990;16:227-232.[Medline]
  16. Neonatal Inhaled Nitric Oxide Study Group Inhaled nitric oxide in full-term and nearly full-term infants with hypoxic respiratory failure N Engl J Med 1997;336:597-604.[Medline]
  17. Roberts JD, Fineman JR, Morin FC, et al. Inhaled nitric oxide and persistent pulmonary hypertension in the newborn N Engl J Med 1997;336:605-610.[Medline]
  18. Lonnquist PA. Efficacy and economy of inhaled nitric oxide in neonates accepted for extra-corporeal membrane oxygenation Acta Physiol Scand 1999;167:175-179.[Medline]
  19. Baigorri F, Joseph D, Artigas A, Blanch L. Inhaled NO does not improve cardiac or pulmonary function in patients with an exacerbation of chronic obstructive pulmonary disease Crit Care Med 1999;27:2153-2158.[Medline]
  20. Kaisers U, Busch T, Deja M, Donaubauer B, Falke K. Selective pulmonary vasodilatation in acute respiratory distress syndrome Crit Care Med 2003;31(Suppl):337-342.[Medline]
  21. Abman AH, Griebel JL, Parker DK, et al. Acute effects of inhaled nitric oxide in children with severe hypoxemic respiratory failure J Pediatr 1994;124:881-888.[Medline]
  22. Dellinger RP, Zimmerman JL, Taylor RW, et al. Effects of inhaled nitric oxide in patients with acute respiratory distress syndrome Crit Care Med 1998;26:15-23.[Medline]
  23. Jacobs PD, Finer NN, Robertson CMT, Etches P, Hall E, Saunders LD. A cost-effectiveness analysis of the application of nitric oxide versus oxygen gas for near-term newborns with respiratory failure: results from a Canadian randomized clinical trial Crit Care Med 2000;28:872-878.[Medline]
  24. Hosenpud JD, Bennett LE, Keck BM, Boucek MM, Novick RJ. The Registry of the International Society for Heart and Lung Transplantation: seventeeth official report–2000 J Heart Lung Transplant 2000;19:909-931.[Medline]
  25. Doyle AR, Dhir AK, Moors AH, Latimer RD. Treatment of perioperative low cardiac output syndrome Ann Thorac Surg 1995;59(Suppl 2):3-11.
  26. Bhatia SJ, Kirshenbaum JM, Shemin RJ, et al. Time course of resolution of pulmonary hypertension and right ventricular remodeling after orthotopic cardiac transplantation Circulation 1987;76:819-826.[Abstract/Free Full Text]
  27. Chen JM, Levin HR, Micheler RE, et al. Reevaluating the significance of pulmonary hypertension before cardiac transplantation: determination of optimal thresholds and quantification of the effect of reversibility on perioperative mortality J Thorac Cardiovasc Surg 1997;114:627-634.[Abstract/Free Full Text]
  28. Tenderich G, Koerner MM, Stuettgen B, et al. Does preexisting elevated pulmonary vascular resistance (transpulmonary gradient >15 mmHg or >5 Wood) predict early and long-term results after othotopic heart transplantation? Transplant Proc 1998;30:1130-1131.[Medline]
  29. Bennett LE, Keck BM, Hertz MI, Trulock EP, Taylor DO. Worldwide thoracic organ transplantation: a report from the UNO/ISHLT international registry for thoracic organ transplantation Clin Transplant 2001;15:25-40.
  30. Harringer W, Wiebe K, Struber M, et al. Lung transplantation—10 year experience Eur J CardioThorac Surg 1999;16:546-554.[Abstract/Free Full Text]
  31. Troncy E, Collet JP, Shapiro S, et al. Should we treat acute respiratory distress syndrome with inhaled nitric oxide? Lancet 1997;350:111-118.[Medline]
  32. Michael JR, Barton RG, Saffle JR, Mone M, Markewitz BA. Inhaled nitric oxide versus conventional therapy: effect on oxygenation in ARDS Am J Resp Crit Care Med 1998;157:1361-1362.[Free Full Text]
  33. Luhr OR, Antonsen K, Karlsson M, et al. Incidence and mortality after acute respiratory failure and acute respiratory distress syndrome in Sweden, Denmark, and Iceland Am J Resp Crit Care Med 1999;159:1849-1861.[Abstract/Free Full Text]
  34. Krafft P, Fridrich P, Pernerstorfer T, et al. The acute respiratory distress syndrome: definitions, severity, and clinical outcome Intens Care Med 1996;22:519-529.[Medline]

This article has been cited by other articles:

M. M. Hoeper and J. Granton
Intensive Care Unit Management of Patients with Severe Pulmonary Hypertension and Right Heart Failure
, November 15, 2011; 184(10): 1114 – 1124.
[Abstract] [Full Text] [PDF]

A. N. Tavare and T. Tsakok
Does prophylactic inhaled nitric oxide reduce morbidity and mortality after lung transplantation?
Interact CardioVasc Thorac Surg, November 1, 2011; 13(5): 516 – 520.
[Abstract] [Full Text] [PDF]

A. Hoskote, C. Carter, P. Rees, M. Elliott, M. Burch, and K. Brown
Acute right ventricular failure after pediatric cardiac transplant: Predictors and long-term outcome in current era of transplantation medicine
J. Thorac. Cardiovasc. Surg., January 1, 2010; 139(1): 146 – 153.
[Abstract] [Full Text] [PDF]

 

RESOURCES on this Open Access Online Scientific Journal

1. electronic Book on Nitric Oxide by Nitric Oxide Team @ Leaders in Pharmaceutical Business Intelligence (LPBI), Amazon-Kindle, 2013

Perspectives on Nitric Oxide in Disease Mechanisms

 The Nitric Oxide Discovery, Function, and Targeted Therapy  Opportunities

From Discovery to Innovation

     From Innovation to Therapeutic Targets

From Therapeutic Targets to Clinical Applications

Aviral Vatsa, PhD, Editor

Larry H Bernstein, MD, Editor

2. The rationale and use of inhaled NO in Pulmonary Artery Hypertension and Right Sided Heart Failure Larry H. Bernstein 8/20/2012

3. Inhaled Nitric Oxide in Adults: Clinical Trials and Meta Analysis Studies – Recent Findings Aviva Lev-Ari, PhD, RN, 6/2/2013

Read Full Post »


Curator: Aviva Lev-Ari, PhD, RN

iNO – Clinical Trials and Meta Analysis Studies: Recent Findings

Clinical perspectives with long-term pulsed inhaled nitric oxide for the treatment of pulmonary arterial hypertension

1Department of Pediatrics and Medicine, Columbia University, New York, New York, US
2Department of Pediatrics and Medicine, Massachusetts General Hospital, Boston, Massachusetts, US
3Department of Pediatrics, University of Colorado School of Medicine, Children’s Hospital Colorado, Aurora, Colorado, US
4Ikaria, Inc., Hampton, New Jersey, USA
Address correspondence to: Dr. Robyn J. Barst, 31 Murray Hill Road, Scarsdale, NY 10583, USA ; Email: robyn.barst@gmail.com
This article has been corrected. See Pulm Circ. 2012; 2(3): iv.

Abstract

Pulmonary arterial hypertension (PAH) is a chronic, progressive disease of the pulmonary vasculature with a high morbidity and mortality. Its pathobiology involves at least three interacting pathways –
  • prostacyclin (PGI2),
  • endothelin, and
  • nitric oxide (NO).
Current treatments target these three pathways utilizing PGI2 and its analogs, endothelin receptor antagonists, and phosphodiesterase type-5 (PDE-5) inhibitors.
Inhaled nitric oxide (iNO) is approved for the treatment of hypoxic respiratory failure associated with pulmonary hypertension in term/near-term neonates. As a selective pulmonary vasodilator, iNO can acutely decrease pulmonary artery pressure and pulmonary vascular resistance without affecting cardiac index or systemic vascular resistance. In addition to delivery via the endotracheal tube, iNO can also be administered as continuous inhalation via a facemask or a pulsed nasal delivery. Consistent with a deficiency in endogenously produced NO, long-term pulsed iNO dosing appears to favorably affect hemodynamics in PAH patients, observations that appear to correlate with benefit in uncontrolled settings. Clinical studies and case reports involving patients receiving long-term continuous pulsed iNO have shown minimal risk in terms of adverse events, changes in methemoglobin levels, and detectable exhaled or ambient NO or NO2. Advances in gas delivery technology and strategies to optimize iNO dosing may enable broad-scale application to long-term treatment of chronic diseases such as PAH.
Keywords: drug, hypertension, inhalation administration, nitric oxide, pulmonary arterial hypertension, pulmonary circulation, pulmonary hypertension, pulmonary/physiopathology, pulse therapy, vasodilator agents

CONCLUSIONS AND FUTURE DIRECTIONS

In summary, uncontrolled observational studies of long-term use (>1 month) of continuous pulsed iNO (as monotherapy or as part of combination therapy) in a total of 14 patients with PAH across five studies [Ref 46-48, 54,55]

have reported no significant adverse events, no elevated metHb levels, and no detectable exhaled or ambient NO or NO2. In one study, a patient experienced three episodes of severe epistaxis over two years while on a combination of pulsed iNO and epoprostenol.[46]

In a case report of a patient awaiting heart-lung transplantation, the patient experienced hypotensive bradycardia upon an attempt to wean from iNO therapy. In addition, a recurrence in hypotensive bradycardia resulted in the increase of iNO dose (40–106 ppm), followed by a decrease to 70 ppm (along with administration of bicarbonate and reintroduction of prostacyclin) after increasing metabolic acidosis.[55]

There is evidence that pulsed delivery may allow utilization of lower NO concentrations compared with continuous face mask administration, potentially minimizing the risk of associated adverse events as well as resulting in a more practical delivery system.[49]

The consensus on treatment for PAH encompasses numerous goals, the most important being to improve overall quality of life by decreasing symptoms while minimizing treatment-related side effects.[2]

Additional goals include enhancing functional capacity, i.e., exercise capacity, improving hemodynamic derangements (lowering PVR and PAP, and normalizing RAP and CO), and preventing, if not reversing, disease progression. Finally, improving survival, although certainly desirable, is rarely an end point in trials examining PAH treatment.[2]

The availability of novel treatments and the improvement in survival rates have allowed the goals of PAH therapy to expand from improving survival and preventing disease progression to also improving HRQOL.[71]

Potential advances in long-term PAH treatment, such as ambulatory iNO administration, may allow for greater improvements in HRQOL. Pérez–Peñate et al. observed that ambulatory pulsed iNO treatment did not diminish quality of life beyond the consequences of the disease itself.[47]

Eight of eleven patients who led a nonsedentary life were able to leave their home daily, with four returning to work while on long-term iNO therapy.

An ideal drug-device for long-term PAH treatment should emphasize portability and safety features for outpatient use. Advances in iNO gas delivery technology and strategies to optimize dosing should allow for randomized controlled trials of iNO and, hopefully, may lead to broad-scale application of iNO in the treatment of chronic diseases such as PAH.[45]

REFERENCES

http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3401867/

Anesth Analg. 2011 Jun;112(6):1411-21. doi: 10.1213/ANE.0b013e31820bd185.
Epub 2011 Mar 3.

Inhaled nitric oxide for acute respiratory distress syndrome and acute lung injury in adults and children: a systematic review with meta-analysis and trial sequential analysis.

Afshari ABrok JMøller AMWetterslev J.

Source

Department of Anesthesiology, Rigshospitalet, University of Copenhagen, Anestheisa, Juliane Marie Centre, Copenhagen, 2100, Denmark.

Abstract

BACKGROUND:

Acute hypoxemic respiratory failure, defined as acute lung injury and acute respiratory distress syndrome, are critical conditions associated with frequent mortality and morbidity in all ages. Inhaled nitric oxide (iNO) has been used to improve oxygenation, but its role remains controversial. We performed a systematic review with meta-analysis and trial sequential analysis of randomized clinical trials (RCTs). We searched CENTRAL, Medline, Embase, International Web of Science, LILACS, the Chinese Biomedical Literature Database, and CINHAL (up to January 31, 2010). Additionally, we hand-searched reference lists, contacted authors and experts, and searched registers of ongoing trials. Two reviewers independently selected all parallel group RCTs comparing iNO with placebo or no intervention and extracted data related to study methods, interventions, outcomes, bias risk, and adverse events. All trials, irrespective of blinding or language status were included. Retrieved trials were evaluated with Cochrane methodology. Disagreements were resolved by discussion. Our primary outcome measure was all-cause mortality. We performed subgroup and sensitivity analyses to assess the effect of iNO in adults and children and on various clinical and physiological outcomes. We assessed the risk of bias through assessment of trial methodological components. We assessed the risk of random error by applying trial sequential analysis.

RESULTS:

We included 14 RCTs with a total of 1303 participants; 10 of these trials had a high risk of bias. iNO showed no statistically significant effect on overall mortality (40.2%versus 38.6%) (relative risks [RR] 1.06, 95% confidence interval [CI] 0.93 to 1.22; I² = 0) and in several subgroup and sensitivity analyses, indicating robust results. Limited data demonstrated a statistically insignificant effect of iNO on duration of ventilation, ventilator-free days, and length of stay in the intensive care unit and hospital. We found a statistically significant but transient improvement in oxygenation in the first 24 hours, expressed as the ratio of Po₂ to fraction of inspired oxygen (mean difference [MD] 15.91, 95% CI 8.25 to 23.56; I² = 25%). However, iNO appears to increase the risk of renal impairment among adults (RR 1.59, 95% CI 1.17 to 2.16; I² = 0) but not the risk of bleeding or methemoglobin or nitrogen dioxide formation.

CONCLUSION:

iNO cannot be recommended for patients with acute hypoxemic respiratory failure. iNO results in a transient improvement in oxygenation but does not reduce mortality and may be harmful.

 SOURCE:
 

Clinical Policy Bulletin:

Nitric Oxide, Inhalational (INO) Number: 0518

Aetna Policy

      Aetna considers inhaled nitric oxide (INO) therapy medically necessary as a component of the treatment of hypoxic respiratory

      failure in term and near-term (born at 34 or more weeks of gestation) neonates when both of the following criteria are met:

  •                         Neonates do not have congenital diaphragmatic hernia; and
  •                         When conventional therapies such as administration of high concentrations of oxygen, hyperventilation, high-frequency
  •                         ventilation, the induction of alkalosis, neuromuscular blockade, and sedation have failed or are expected to fail.

      Note: Use of INO therapy for more than 4 days is subject to medical necessity review.

      Aetna considers the diagnostic use of INO medically necessary as a method of assessing pulmonary vaso-reactivity in persons

      with pulmonary hypertension.

      Aetna considers INO therapy experimental and investigational for all other indications because of insufficient evidence in the

      peer-reviewed literature, including any of the following:

                        Acute bronchiolitis; or

                        Acute hypoxemic respiratory failure in children (other than those who meet the medical necessity criteria above) and in adults; or

Adult respiratory distress syndrome or acute lung injury; or

Post-operative management of pulmonary hypertension in infants and children with congenital heart disease; or

Premature neonates (less than 34 weeks of gestation); or

Prevention of ischemia-reperfusion injury/acute rejection following lung transplantation; or

Treatment of persons with congenital diaphragmatic hernia; or

Treatment of vaso-occlusive crises or acute chest syndrome in persons with sickle cell disease (sickle cell vasculopathy).

http://www.aetna.com/cpb/medical/data/500_599/0518.html

 

Discussion

NO is naturally produced in the body by the enzyme NO synthase, which converts L-arginine to L-citrulline and NO in the presence of oxygen and certain cofactors. Both constitutive and inducible forms of NO synthase are present in endothelium and various other tissues.39–,41 NO has several important physiological roles, including involvement in smooth muscle relaxation, neurotransmission, host defense responses, and platelet function. NO produced by the vascular endothelium causes local vasodilatation, thereby regulating vasomotor tone. Circulating NO is present in only picomolar amounts and is rapidly inactivated by reaction with hemoglobin. Because of this short circulating half-life (3–5 seconds), inhalation of subtoxic levels of NO causes vasodilatation of the pulmonary vasculature with little or no systemic vasodilatation. Therapeutic administration of NO by inhalation thus provides a means of selectively lowering pulmonary arterial blood pressure, potentially improving hemodynamic status and gas exchange.11–13,15,17,18,23

Inhaled NO has been widely studied in adults with pulmonary hypertension and acute lung injury, and it is currently approved by the Food and Drug Administration for treatment of hypoxic respiratory failure in neonates with pulmonary hypertension. Three potential hazards associated with inhaled NO therapy are recognized:

(1) direct pulmonary toxic effects of NO,

(2) pulmonary toxic effects due to NO2 produced by oxidation of NO, and

(3) development of methemoglobinemia.

Studies of exposure to toxic levels of NO and NO2 in various species indicated that high concentrations of these gases can be lethal. Pulmonary edema, hypoxemia, acidosis, and hypotension developed in dogs exposed to 0.5% to 2% NO or NO2, and most animals died within 7 to 50 minutes of exposure.42 In rats, inhaled NO2 concentrations of 127 ppm were lethal within 30 minutes in 50% of animals (LC50).43 The LC50 in primates exposed to NO2 for 30 to 60 minutes is 100 to 200 ppm.43 Methemoglobinemia is detectable by measurement of blood levels of methemoglobin and is manifested clinically as cyanosis and hypoxia. Methemoglobinemia developed in animals exposed to high concentrations of NO or NO2, although not uniformly. In one instance, a methemoglobin level of 1.00 developed in a dog exposed to 2% NO for 50 minutes.42

In humans, NO at 10 to 20 ppm can cause irritation of the eyes and nose, 25 ppm can be irritating to the respiratory tract and cause chest pain, 50 ppm can cause pulmonary edema, and 100 ppm can be fatal.1,4

Legally permissible exposure limits for NO and NO2 have been issued by the Occupational Safety and Health Administration. For NO, this threshold is 25 ppm (30 mg/m3), averaged over an 8-hour work shift.10 This value corresponds to the threshold limit value promulgated by the American Conference of Governmental Industrial Hygienists.2 Adherence to this limit is thought to provide adequate protection against methemoglobinemia and other toxic effects. Concentrations of 100 ppm and higher (30-minute mean) are deemed to be an immediate threat to life and health by the National Institute for Occupational Safety and Health.44 The Occupational Safety and Health Administration ceiling limit for NO2 is 1 ppm (1.8 mg/m3), and this limit is not to be exceeded at any time during the work shift.10 The threshold limit for TWA concentration of NO2 issued by the American Conference of Governmental Industrial Hygienists is 3 ppm,2 and the National Institute for Occupational Safety and Health requires that NO2exposures not exceed 1 ppm.10,44

These threshold values are thought to represent maximum concentrations to which nearly all workers can be exposed on a regular basis without adverse effects. Nevertheless, evidence suggests that lower levels of exposure can have deleterious effects. For example, irreversible emphysematous changes to the lungs occurred in beagles exposed to 0.6 ppm NO2 for 16 h/d for 68 months and then to clean air for 32 to 36 months.45 In a study of exposure of humans to NO at 1.0 ppm, small but significant increases in airway resistance occurred in half the subjects.46 Similarly, inhalation of NO2 at 0.7 to 2 ppm for 10 minutes increased airflow resistance in healthy subjects.1 Exposure to NO2 at 2.3 ppm for 5 hours reportedly altered alveolar permeability in humans.47 Brief exposure to NO2 levels as low as 0.4 ppm may augment the response to challenge with specific allergens, and exposure to 0.1 to 0.5 ppm may affect pulmonary function in patients with asthma or chronic obstructive lung disease.1,5,7,48,49

Limited information is available on occupational exposure to NO in the healthcare setting. Using stationary chemiluminescence monitoring, Mourgeon et al50 determined ambient concentrations of NO and NO2 in the main corridor of an ICU. They found that mean ambient NO concentrations within the ICU were 0.237 ppm (SD 0.147 ppm) during the therapeutic use of inhaled NO at 5 ppm or less in 1 or more patients and 0.289 ppm (SD 0.147 ppm) during times when inhaled NO therapy was not used. The institution where this study50 was performed is located on a main street in Paris, and Mourgeon et al concluded that the ICU corridor values were entirely dependent on prevailing outdoor concentrations. Markhorst et al51 examined ambient levels of NO and NO2 in well-ventilated and poorly ventilated pediatric ICU rooms in which administration of inhaled NO at 20 ppm was simulated. As in the study by Mourgeon et al, sampling was done from a stationary position (in the study by Markhorst et al, 65 cm from the high-frequency oscillator used) at a height of 150 cm. During the simulation, maximum NO and NO2levels were 0.462 and 0.064 ppm, respectively. Phillips et al52 used occupational hygiene techniques similar to those we used to examine exposure levels in medical personnel during administration of inhaled NO to 6 patients in a pediatric ICU. In all instances, TWA concentrations were less than the limits of detection for the assay used. The patients’ sizes and minute volumes were not specified, although 3 of the patients were classified as neonatal.

▪ Nitric oxide therapy does not appear to expose nurses to excessive levels of nitric oxide or nitrogen dioxide during routine patient care in the ICU.

We examined the occupational exposure of ICU nurses to NO during NO therapy at delivery levels of 5 and 20 ppm in adult patients with acute respiratory distress syndrome. The maximum TWA exposures in our study were 0.45 ppm for NO and 0.28 ppm for NO2, well below the legally permissible exposure limits mandated by the Occupational Safety and Health Administration, and the involved nurses reported no respiratory or other signs or symptoms. The maximum outdoor background concentrations of NO and NO2 in our county during the periods of study ranged from 0.006 to 0.030 ppm for NO and 0.018 to 0.090 ppm for NO2. For comparison, the primary national ambient air quality standard issued by the Environmental Protection Agency is 0.053 ppm (100 μg/m3), calculated as an annual arithmetic mean.53 We did not assess methemoglobin levels in the nurses; however, methemoglobinemia did not develop in the treated patients. Marked methemoglobinemia is uncommon in patients treated with inhaled NO at concentrations similar to those used in our study.11,12,15,16,18,23

In the simulation study of Markhorst et al,51 ambient NO concentrations were measured at distances of 15 to 200 cm from a high-frequency oscillator, yielding levels ranging from 1.2 to 0.4 ppm. Our measurements yielded similar results (see Figure); however, in our study, NO levels at the ventilator exhaust port were nearly 10 times higher (9.2 ppm) than those 15 cm away (1.0 ppm). NO concentrations decreased rapidly; the mean was about 0.030 ppm in the area between 0.6 m from the ventilator and 0.6 m outside the patient’s room. For comparison, in homes with gas cooking stoves, ambient NOx levels of 0.025 to 0.075 ppm are typical.9

A number of factors determine the concentrations of NO and NO2 to which personnel are exposed during the therapeutic use of inhaled NO. These include the concentration of NO delivered to the patient, the patient’s minute volume, room size, room ventilation, and whether special ventilator exhaust routing or chemical scavenging devices are used. Baseline ambient levels of NO and NO2 depend on outdoor environmental factors such as proximity to motor vehicle traffic or heavy industry, climate, wind, and sky clarity.50Depending on the mode of administration, the actual concentration of NO delivered to a patient can fluctuate from the intended level. Continuous delivery during the entire respiratory cycle can produce more atmospheric contamination than does sequential administration limited to the inspiratory phase.54 The amount of NO2 formed during NO therapy varies according to the concentrations of oxygen and NO delivered, the time the 2 gases remain in contact, total gas flow, and minute volume.55 Thus, higher fractions of inspired oxygen will lead to increased formation of NO2 during inhaled NO therapy.

Because of differences in minute volume, therapeutic administration of inhaled NO to adult patients will result in substantially greater release of NO than will administration to infants or children. For example, to achieve a delivered NO concentration of 20 ppm, the required flow from a 1000-ppm NO source varies from 20 mL/min for a minute volume of 1 L/min to more than 200 mL/min for a minute volume of 11 L/min19 (our patients’ minute volumes exceeded 11 L/min). Simultaneous treatment of multiple patients in the same room or unit might increase exposure levels. The time spent by healthcare providers in the patient’s room and their average exposure distance from the ventilator exhaust port are also important factors. Room ventilation is clearly a factor. Ventilation in our negative-pressure isolation rooms exceeded that mandated by the Centers for Disease Control and Prevention (ie, ≥6 air changes per hour for existing rooms and ≥12 air changes per hour where possible and in new hospital construction).56 Our study design did not allow analysis of the effects of any of these factors; however, the methods we used provide data for real-world examples of ICU nurses caring for typical adult patients receiving inhaled NO. These techniques also constitute the standard method for evaluations of occupational exposure to toxic gases. Studies in which these methods are used, but involving larger samples of nurses and patients in various settings, would allow better definition of variance and the effects that factors such as room ventilation have on exposure to ambient NO and NO2.

In summary, we found that inhaled NO therapy at doses up to 20 ppm does not appear to pose a risk of excessive occupational exposure to NO or NO2 to healthcare workers during the routine delivery of critical care nursing in typical adult ICU settings. These findings lend support to the occupational safety of this therapeutic modality.

REFERENCES

  1. Beard RR. Inorganic compounds of oxygen, nitrogen, and carbon. In: Clayton GD, Clayton FE, eds. Patty’s Industrial Hygiene and Toxicology. 3rd ed. Vol. 2C. New York, NY: John Wiley & Sons; 1982:4053–4139.
  2. Documentation of the Threshold Limit Values for Chemical Substances in the Workroom Environment. 4th ed. Cincinnati, Ohio: American Conference of Governmental Industrial Hygienists Inc; 1980.
  3. Budavari S, O’Neil MJ, Smith A, Heckelman PE, Kinneary JF, eds. The Merck Index: An Encyclopedia of Chemicals, Drugs, and Biologicals. 12th ed. Whitehouse Station, NJ: Merck; 1996:1131.
  4. Sittig M. Handbook of Toxic and Hazardous Chemicals and Carcinogens. 3rd ed. Park Ridge, NJ: Noyes Publications; 1991:1201–1203, 1217–1219.
  5. Lipsett M. Oxides of nitrogen and sulfur. In: Sullivan JB Jr, Krieger GR, eds.Hazardous Materials Toxicology: Clinical Principles of Environmental Health.Baltimore, Md: Williams & Wilkins; 1992:964–972.
  6. Clayton GD. Air pollution. In: Clayton GD, Clayton FE, eds. Patty’s Industrial Hygiene and Toxicology. 4th ed. New York, NY: John Wiley & Sons; 1991:195–258.
  7. Lipsett MJ, Shusterman DJ, Beard RR. Inorganic compounds of carbon, nitrogen, and oxygen. In: Clayton GD, Clayton FE, eds. Patty’s Industrial Hygiene and Toxicology. New York, NY: John Wiley & Sons; 1994: 4523–4643.
  8. Modrak JE, Frampton MW, Utell MJ. Community air pollution: what a pulmonologist should know. Clin Pulm Med. 1997;4:266–272.
  9. Samet JM, Marbury MC, Spengler JD. Health effects and sources of indoor air pollution: part I. Am Rev Respir Dis. 1987;136:1486–1508.
  10. Occupational Safety and Health Administration, US Department of Labor. OSHA Regulated Hazardous Substances: Health, Toxicity, Economic and Technological Data. Vol. 2. Park Ridge, NJ: Noyes Data Corp; 1990:1419–1421, 1437–1440.
  11. Krafft P, Metnitz PGH, Fridrich P, Krenn CG, Hammerle AF, Steltzer H. Impact of inhaled nitric oxide on cardiopulmonary performance and outcome of ARDS patients: a literature review. Clin Intensive Care. 1997;8:27–32.
  12. Dellinger RP, Zimmerman JL, Taylor RW, et al. Effects of inhaled nitric oxide in patients with acute respiratory distress syndrome: results of a randomized phase II trial. Inhaled Nitric Oxide in ARDS Study Group. Crit Care Med. 1998;26:15–23.
  13. Michael JR, Barton RG, Saffle JR, et al. Inhaled nitric oxide versus conventional therapy: effect on oxygenation in ARDS. Am J Respir Crit Care Med.1998;157:1372–1380.
  14. The Neonatal Inhaled Nitric Oxide Study Group. Inhaled nitric oxide in full-term and nearly full-term infants with hypoxic respiratory failure. N Engl J Med.1997;336:597–604.
  15. Okamoto K, Hamaguchi M, Kukita I, Kikuta K, Sato T. Efficacy of inhaled nitric oxide in children with ARDS. Chest. 1998;114:827–833.
  16. Johannigman JA, Davis K Jr, Campbell RS, Luchette F, Hurst JM, Branson RD. Inhaled nitric oxide in acute respiratory distress syndrome. J Trauma. 1997;43:904–909.
  17. Johannigman JA, Davis K Jr, Miller SL, et al. Prone positioning and inhaled nitric oxide: synergistic therapies for acute respiratory distress syndrome. J Trauma. 2001;50:589–595.
  18. Gerlach H, Rossaint R, Pappert D, Falke KJ. Time-course and dose-response of nitric oxide inhalation for systemic oxygenation and pulmonary hypertension in patients with adult respiratory distress syndrome. Eur J Clin Invest. 1993;23:499–502.
  19. Young JD, Dyar OJ. Delivery and monitoring of inhaled nitric oxide. Intensive Care Med. 1996;22:77–86.
  20. Cuthbertson BH, Galley HF, Webster NR. Effect of inhaled nitric oxide on key mediators of the inflammatory response in patients with acute lung injury. Crit Care Med. 2000;28:1736–1741.
  21. Hoehn T, Krause MF. Response to inhaled nitric oxide in premature and term neonates. Drugs. 2001;61:27–39.
  22. Tworetzky W, Bristow J, Moore P, et al. Inhaled nitric oxide in neonates with persistent pulmonary hypertension [letter]. Lancet. 2001;357:118–120.
  23. Journois D, Pouard P, Mauriat P, Malhère T, Vouhé P, Safran D. Inhaled nitric oxide as a therapy for pulmonary hypertension after operation for congenital heart defects. J Thorac Cardiovasc Surg. 1994;107:1129–1135.
  24. Gothberg S, Edberg KE. Inhaled nitric oxide to newborns and infants after congenital heart surgery on cardiopulmonary bypass: a dose-response study.Scand Cardiovasc J. 2000;34:154–158.
  25. Solina AR, Ginsberg SH, Papp D, et al. Dose response to nitric oxide in adult cardiac surgery patients. J Clin Anesth. 2001;13:281–286.
  26. Ardehali A, Hughes K, Sadeghi A, et al. Inhaled nitric oxide for pulmonary hypertension after heart transplantation. Transplantation. 2001;72:638–641.
  27. Ardehali A, Laks H, Levine M, et al. A prospective trial of inhaled nitric oxide in clinical lung transplantation. Transplantation. 2001;72:112–115.
  28. Crerar-Gilbert A, Boots R. Use of inhaled nitric oxide in pulmonary embolism.Anaesth Intensive Care. 1999;27:412–414.
  29. Gladwin MT, Schechter AN, Shelhamer JH, et al. Inhaled nitric oxide augments nitric oxide transport on sickle cell hemoglobin without affecting oxygen affinity. J Clin Invest. 1999;104:937–945.
  30. Rabkin DG, Sladen RN, DeMango A, Steinglass KM, Goldstein DJ. Nitric oxide for the treatment of postpneumonectomy pulmonary edema. Ann Thorac Surg.2001;72:272–274.
  31. Nakagawa TA, Johnston SJ, Falkos SA, Gomez RJ, Morris A. Life-threatening status asthmaticus treated with inhaled nitric oxide. J Pediatr. 2000;137: 119–122.
  32. Perez-Penate G, Julia-Serda G, Pulido-Duque JM, Gorriz-Gomez E, Cabrera-Navarro P. One-year continuous inhaled nitric oxide for primary pulmonary hypertension. Chest. 2001;119:970–973.
  33. Jones C. Inhaled nitric oxide: are the safety issues being addressed? Intensive Crit Care Nurs. 1998;14:271–275.
  34. Goldman AP, Cook PD, Macrae DJ. Exposure of intensive-care staff to nitric oxide and nitrogen dioxide [letter]. Lancet. 1995;345:923–924.
  35. Kalweit S. Inhaled nitric oxide in the ICU. Crit Care Nurse. August 1997;17: 26–32.
  36. Bathe D, Berssenbrugge A, Kohlmann T, Montgomery F. Monitoring accuracy for the measurement of nitric oxide in the 0 to 80 ppm range [abstract]. Crit Care Med. 1996;24:A103.
  37. Guidelines for Protecting the Safety and Health of Health Care Workers.Washington, DC: US Dept of Health and Human Services, National Institute for Occupational Safety and Health, Division of Standards Development and Technology Transfer; 1988:2–9. DHHS (NIOSH) publication 88–119.
  38. Nitrogen dioxide and nitric oxide. In: Eller PM, Cassinelli ME, eds. NIOSH Manual of Analytical Methods. 4th ed. Washington, DC: US Dept of Health and Human Services, National Institute for Occupational Safety and Health, Division of Physical Sciences and Engineering; 1994:(6014)1–4. DHHS (NIOSH) publication 94–113.
  39. Stuehr DJ, Griffith OW. Mammalian nitric oxide synthases. Adv Enzymol Relat Areas Mol Biol. 1992;65:287–346.
  40. Kobzik L, Bredt DS, Lowenstein CJ, et al. Nitric oxide synthase in human and rat lung: immunocytochemical and histochemical localization. Am J Respir Cell Mol Biol. 1993;9:371–377.
  41. Gaston B, Drazen M, Loscalzo J, Stamler JS. The biology of nitrogen oxides in the airways. Am J Respir Crit Care Med. 1994;149:538–551.
  42. Greenbaum R, Bay J, Hargreaves MD, et al. Effects of higher oxides of nitrogen on the anaesthetized dog. Br J Anaesth. 1967;39:393–404.
  43. Harris LR, Sarvadi DG. Synthetic polymers. In: Clayton GD, Clayton FE, eds.Patty’s Industrial Hygiene and Toxicology. 4th ed. Vol. 2, part E. New York, NY: John Wiley & Sons; 1991:3673–4005.
  44. Criteria for a Recommended Standard: Occupational Exposure to Oxides of Nitrogen (Nitrogen Dioxide and Nitric Oxide). Washington, DC: US Dept of Health and Human Services, National Institute for Occupational Safety and Health; 1976:2. DHHS (NIOSH) publication 76–149.
  45. Hyde D, Orthoefer J, Dungworth D, Tyler W, Carter R, Lum H. Morphometric and morphologic evaluation of pulmonary lesions in beagle dogs chronically exposed to high ambient levels of air pollutants. Lab Invest. 1978;38:455–469.
  46. Kagawa J. Respiratory effects of 2-hr exposure to 1.0 ppm nitric oxide in normal subjects. Environ Res. 1982;27:485–490.
  47. Rasmussen TR, Kjaergaard SK, Tarp U, Pedersen OF. Delayed effects of NO2 exposure on alveolar permeability and glutathione peroxidase in healthy humans.Am Rev Respir Dis. 1992;146:654–659.
  48. Tunnicliffe WS, Burge PS, Ayres JG. Effect of domestic concentrations of nitrogen dioxide on airway responses to inhaled allergen in asthmatic patients.Lancet. 1994;344:1733–1736.
  49. Morrow PE, Utell MJ, Bauer MA, et al. Pulmonary performance of elderly normal subjects and subjects with chronic obstructive pulmonary disease exposed to 0.3 ppm nitrogen dioxide. Am Rev Respir Dis. 1992;145:291–300.
  50. Mourgeon E, Levesque E, Duveau C, et al. Factors influencing indoor concentrations of nitric oxide in a Parisian intensive care unit. Am J Respir Crit Care Med. 1997;156:1692–1695.
  51. Markhorst DG, Leenhoven T, Uiterwijk JW, Meulenbelt J, van Vught AJ. Occupational exposure during nitric oxide inhalational therapy in a pediatric intensive care setting. Intensive Care Med. 1996;22:954–958.
  52. Phillips ML, Hall TA, Sekar K, Tomey JL. Assessment of medical personnel exposure to nitrogen oxides during inhaled nitric oxide treatment of neonatal and pediatric patients. Pediatrics. 1999;104:1095–1100.
  53. Sixth Annual Report of the Council on Environmental Quality. Washington, DC: Environmental Protection Agency; 1975. Publication 040-000-00337-1.
  54. Mourgeon E, Gallart L, Umamaheswara Rao GS, et al. Distribution of inhaled nitric oxide during sequential and continuous administration into the inspiratory limb of the ventilator. Intensive Care Med. 1997;23:849–858.
  55. Losa M, Tibballs J, Carter B, Holt MP. Generation of nitrogen dioxide during nitric oxide therapy and mechanical ventilation of children with a Servo 900C ventilator. Intensive Care Med. 1997;23:450–455.

Guidelines for preventing transmission of Mycobacterium tuberculosis in health-care facilities. Centers for Disease Control and Prevention. MMWR Recomm Rep.1994;43(RR-13):1–132.
SOURCE:

Exposure of Intensive Care Unit Nurses to Nitric Oxide and Nitrogen Dioxide During Therapeutic Use of Inhaled Nitric Oxide in Adults With Acute Respiratory Distress Syndrome

1.  Mohammed A. Qureshi, MD,

2. Nipurn J. Shah, MD,

3. Carol W. Hemmen, RN, BSN

4. Mary C. Thill, RN, MSN and

5. James A. Kruse, MD

Am J Crit Care March 2003 vol. 12 no. 2 147-153

 

Read Full Post »

Older Posts »