Feeds:
Posts
Comments

Posts Tagged ‘Smooth muscle tissue’


Calcium-Channel Blocker, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Author, and Content Consultant to e-SERIES A: Cardiovascular Diseases: Justin Pearlman, MD, PhD, FACC

Author and Curator: Larry H Bernstein, MD, FCAP

and Article Curator: Aviva Lev-Ari, PhD, RN

Introduction

Author: Larry H Bernstein, MD, FACC  

This Chapter is one of a series of articles on calcium activation, in this case, in the signaling of smooth muscle cells by the interacting neural innervation.    The process occurs by calcium triggering neurotransmitter release by initiating synaptic vesicle fusion.   The mechanism by which this occurs is addressed in detail, and involves the interaction of soluble N-acetylmaleimide-sensitive factor (SNARE) and SM proteins, and in addition, the discovery of a calcium-dependsent Syt1 (C) domain of protein- kinase C isoenzyme, which binds to phospholipids.
The 2013 Lasker Prize was awarded to Richard Schell (Genentech) and Thomas Sudolf (Stanford University) for their discoveries concerning the molecular machinery and regulatory mechanism that underlie the rapid release of neurotransmitters, a process that underlies all of the brain’s activities. They identified and isolated many of this reaction’s key elements, unraveled central aspects of its fundamental mechanism, and deciphered how cells govern it with extreme precision. These advances have provided a molecular framework for understanding some of the most devastating disorders that afflict humans as well as normal functions such as learning and memory, explaining unresolved hypotheses derived from the earlier work in the 1950sof the late Bernard Katz.  We also see that the work clarifies the debates initiated by the Nobelist Santiago Ramon y Cajal (1891) concerning the development of neural networks.  A biological relay system achieves these feats. Neurotransmission kicks off with an electrical pulse that runs down a nerve cell, or neuron. When that signal reaches the tip, calcium enters the cell. In response, the neuron liberates chemical messengers—neurotransmitters.
In the 1950s, the late Bernard Katz figured out that cells eject neurotransmitters in fixed amounts.  Balloon-like containers—vesicles—each hold set quantities of the chemicals. Calcium incites these lipid-bound sacs to fuse with the membrane that encases the cell, and their contents spill out. The picture that emerges from the later work is that synaptic vesicle exocytosis operates by a general mechanism of membrane fusion that revealed itself to be a model for all membrane fusion, but that is uniquely regulated by a calcium-sensor protein called synaptotagmin. The general membrane-fusion mechanism thus identified is mediated by SNARE- (for soluble NSF-receptors) and SM-proteins (for Sec1/Munc18-like proteins), largely discovered at the synapse, with synaptotagmin acting together with a molecular assistant called complexin as a clamp and activator of the membrane fusion mediated by the SNARE- and SM-proteins. Strikingly, the biochemical properties of synaptotagmin were found to precisely correspond to the extraordinary calcium-triggering properties of release, and to account for a regulatory pathway that also applies to other types of calcium-triggered fusion, for example fusion observed in hormone secretion and fertilization. At the synapse, finally, these interdependent machines — the fusion apparatus and its synaptotagmin-dependent control mechanism — are embedded in a proteinaceous active zone that links them to calcium channels, and regulates the docking and priming of synaptic vesicles for subsequent calcium-triggered fusion. Thus, work on neurotransmitter release revealed a hierarchy of molecular machines that mediate the fusion of synaptic vesicles, the calcium-control of this fusion, and the embedding of calcium-controlled fusion in the context of the presynaptic terminal at the synapse.
This portion of the discussion deals with the interaction of the neuronal endings interwoven into smooth muscle.   The calcium triggering of smooth muscle contractions is similar with respect to airways and arteries, urinary bladder, uterine contraction, and gastrointestinl tract.
The basic mechanism that underlie this MOTIF taken as variations of that described above are well described  by Michael J. Berridge in ‘Smooth muscle cell calcium activation mechanisms’. (J Physiol. 2008 Nov 1;586(Pt 21):5047-61.
http://dx.doi.org/10.1113/jphysiol.2008.160440.  Epub 2008 Sep 11.)
This is illustrated in his graphical examples.
Figure 1. The three main mechanisms responsible for generating the Ca2+ transients that trigger smooth muscle cell (SMC) contraction. From: Smooth muscle cell calcium activation mechanisms.
 Fig 1 Ca2+
A, receptor-operated channels (ROCs) or a membrane oscillator induces the membrane depolarization (ΔV) that triggers Ca2+ entry and contraction.
B, a cytosolic Ca2+ oscillator induces the Ca2+ signal that drives contraction.
C, a cytosolic Ca2+ oscillator in interstitial cells of Cajal (ICCs) or atypical SMCs induces the membrane depolarization that spreads through the gap junctions to activate neighbouring SMCs. Reproduced from Berridge (2008), with permission.
Michael J Berridge. J Physiol. 2008 November 1;586(Pt 21):5047-5061.  http://www.ncbi.nlm.nih.gov/pmc/articles/instance/2652144/bin/tjp0586-5047-f1.jpg

Figure 5. Vascular or airway SMCs are driven by a cytosolic oscillator that generates a periodic release of Ca2+ from the endoplasmic reticulum that usually appears as a propagating Ca2+ wave. From: Smooth muscle cell calcium activation mechanisms.

tjp0586-5047-f5   Vascular or airway SMCs are driven by a cytosolic oscillator that generates a periodic release of Ca2+ from the endoplasmic reticulum

The oscillator is induced/modulated by neurotransmitters such as acetylcholine (ACh), 5-hydroxytryptamine (5-HT), noradrenaline (NA) and endothelin-1 (ET-1), which act through inositol 1,4,5-trisphosphate (InsP3) that initiates the oscillatory mechanism. The sequence of steps 1–9 is described in the text. Reproduced from Berridge (2008), with permission.
Michael J Berridge. J Physiol. 2008 November 1;586(Pt 21):5047-5061.    http://www.ncbi.nlm.nih.gov/pmc/articles/instance/2652144/bin/tjp0586-5047-f5.jpg

Figure 7. The cytosolic Ca2+ oscillator responsible for pacemaker activity in interstitial cells of Cajal releases periodic pulses of Ca2+ that form a Ca2+ wave. From: Smooth muscle cell calcium activation mechanisms.

tjp0586-5047-f7 The cytosolic Ca2+ oscillator responsible for pacemaker activity in interstitial cells of Cajal releases periodic pulses of Ca2+ that form a Ca2+ wave.

The increase in Ca2+ activates Cl− channels (CLCA) to give the spontaneous transient inward currents (STICs) that sum to form the spontaneous transient depolarizations (STD) resulting in the slow waves of membrane depolarization (see inset). Current flow through gap junctions allows these waves to spread into neighbouring smooth muscle cells to activate contraction. See text for a description of the oscillator that drives this activation process. Reproduced from Berridge (2008), with permission.
Michael J Berridge. J Physiol. 2008 November 1;586(Pt 21):5047-5061.  http://www.ncbi.nlm.nih.gov/pmc/articles/instance/2652144/bin/tjp0586-5047-f7.gif

This article is the Part IX in a series of articles on Activation and Dysfunction of the Calcium Release Mechanisms in Cardiomyocytes and Vascular Smooth Muscle Cells.

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmiasand Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IX: Calcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

This article has FIVE Sections:

Section One

Innovations in Combination Drug Therapy: Calcium-Channel Blocker –  Amlodipine (Norvasc) in single-pill combinations (SPCs) of drugs

Section Two

Calcium-Channel Blockers: Drug Class and Indications

Section Three

Brand and Generic Calcium Channel Blocking Agents

Section Four

Dysfunction of the Calcium Release Mechanism

Section Five

The Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

 Section One

Innovations in Combination Drug Therapy:

Calcium-Channel Blocker, Amlodipine (Norvasc) in Single-Pill Combinations (SPCs) of Drugs

Latest development on Cardiovascular Pharmacotherapy relates to the development of a Duo Combination Therapy to include a leading  Calcium-Channel Blocker, Amlodipine (Norvasc), as one of the two drug classes in one pill:The research investigated the therapeutic efficacy achieved via a comparison of a two single-pill combinations (SPCs) of drugs:

  • telmisartan/amlodipine (T/A) [ARB/CCB]

and

  • telmisartan/hydrochlorothiazide (T/H) [ARB/Diuterics]
Drug classes:
ARB – telmisartan
CCB – amlodipine
Diuretics – hydrochlorothiazide

A review of the benefits of early treatment initiation with single-pill combinations of telmisartan with amlodipine or hydrochlorothiazide

Authors: Segura J, Ruilope LM

Published Date September 2013 Volume 2013:9 Pages 521 – 528

http://www.dovepress.com/articles.php?article_id=14373

Published: 16 September 2013, Dovepress Journal: Vascular Health and Risk Management

Julian Segura, Luis Miguel Ruilope

Department of Nephrology, Hospital 12 de Octubre, Madrid, Spain

Abstract:

This review discusses the rationale for earlier use of single-pill combinations (SPCs) of antihypertensive drugs, with a focus on telmisartan/amlodipine (T/A) and telmisartan/hydrochlorothiazide (T/H) SPCs.
  • Compared with the respective monotherapies, the once-daily T/A and T/H SPCs have been shown to result in significantly higher blood pressure (BP) reductions, BP goal rates, and response rates in patients at all stages of hypertension.
  • As expected, BP reductions are highest with the highest dose (T80/A10 and T80/H25) SPCs. Subgroup analyses of the telmisartan trials have reported the efficacy of both SPCs to be consistent, regardless of the patients’ age, race, and coexisting diabetes, obesity, or renal impairment.
  • In patients with mild-to-moderate hypertension, the T/A combination provides superior 24-hour BP-lowering efficacy compared with either treatment administered as monotherapy.
  • Similarly, the T/H SPC treatment provides superior 24-hour BP-lowering efficacy, especially in the last 6 hours relative to other renin–angiotensin system inhibitor-based SPCs.
  • The T/A SPC is associated with a lower incidence of edema than amlodipine monotherapy, and
  • The T/H SPC with a lower incidence of hypokalemia than hydrochlorothiazide monotherapy
  • Existing evidence supports the use of the T/A SPC for the treatment of hypertensive patients with prediabetes, diabetes, or metabolic syndrome, due to the metabolic neutrality of both component drugs, and the use of the T/H SPC for those patients with edema or in need of volume reduction.
Keywords: angiotensin receptor blockers, or ARBs, calcium-channel blocker, or CCBs, essential hypertension, diuretic, , renin-angiotensin system inhibitor, or ACEI
http://www.dovepress.com/articles.php?article_id=14373
We reported on 5/29/2012

Triple Combination Therapy: ARB and Calcium Channel Blocker and Diuretics

In July 2010, a triple combination drug for hypertension was approved by the US Food and Drug Administration. Tribenzor contains olmesartan medoxomil, amlodipine and hydrochlorothiazide, according to Monthly Prescribing Reference.

TRIBENZOR is a Daiichi Sankyo’s product- ARB and Calcium Channel Blocker and Diuretic

How TRIBENZOR work

Tribenzor contains olmesartan medoxomil, amlodipine and hydrochlorothiazide. High blood pressure makes the heart work harder to pump blood through the body and causes damage to blood vessels. TRIBENZOR can help your blood vessels relax and reduce the amount of fluid in your blood. This can make your blood pressure lower. Medicines that lower blood pressure may lower your chance of having a stroke or a heart attack.

Some people may need more than 1—or even more than 2—medicines to help control their blood pressure. TRIBENZOR combines 3 effective medicines in 1 convenient pill. Read the following chart to learn how each medicine works in its own way to help lower blood pressure.

TRIBENZOR: 3 effective medicines in 1 pill

The medicine in TRIBENZOR How it works What it does
Angiotensin II receptor blocker Blocks a natural chemical in your body that causes blood vessels to narrow.

Lowers

Yours

blood

pressure

Calcium channel blocker Blocks the narrowing effect of calcium on your blood vessels. This helps your blood vessels relax.
Diuretic (water pill) Helps your kidneys flush extra fluid and salt from your body. This lowers the amount of fluid in your blood.

http://www.tribenzor.com/how_works.html

            Effectively lower blood pressure. People taking the 3 medicines in TRIBENZOR had greater reductions in blood pressure than did people taking any 2 of the medicines combined

            Start to work quickly. People taking TRIBENZOR saw results in as little as 2 weeks

AZOR is a Daiichi Sankyo’s product- ARB and Calcium Channel Blocker

How AZOR work

AZOR relaxes and widens blood vessels to help lower blood pressure.

You may have already tried another blood pressure medicine that works a certain way to lower blood pressure. But 1 blood pressure medicine may not be enough for you. You may find the help you need with the 2 effective medicines in AZOR.

AZOR combines 2 effective medicines in 1 convenient pill.

Learn how each medicine in AZOR works in its own way to help lower blood pressure.

The medicine in AZOR How it works What it does
Angiotensin II receptor blocker (ARB) Blocks a natural chemical in your body that causes blood vessels to narrow. This helps your blood vessels relax and widen.

Lowers

Your

Blood

pressure

Calcium channel blocker Blocks the narrowing effect of calcium on your blood vessels. This helps your blood vessels relax.

http://www.AZOR.com/how_works.html

Section Two

Calcium-Channel Blockers: Drug Class and Indications

In Sudhof’s Lasker Award presentation he refers to the biochemical properties of synaptotagmin were found to precisely correspond to the extraordinary calcium-triggering properties of release, and to account for a regulatory pathway that also applies to other types of calcium-triggered fusion, for example fusion observed in hormone secretion.  A CCB would have to block the calcium-triggering properties of release, and consequently, would block the release of neurohormones.  This is because the fusion apparatus and its synaptotagmin-dependent control mechanism linked to the calcium channels, docking and priming synaptic vesicles, being blocked, disables the calcium-control of the vesicle fusion that is necessary for neurotransmitter release. Consequently, the end result would be increased vascular flow from the inhibition.

What are calcium channel blockers and how do they work?

In order to pump blood, the heart needs oxygen. The harder the heart works, the more oxygen it requires. Angina (heart pain) occurs when the supply of oxygen to the heart is inadequate for the amount of work the heart must do. By dilating the arteries, CCBs reduce the pressure in the arteries. This makes it easier for the heart to pump blood, and, as a result, the heart needs less oxygen. By reducing the heart’s need for oxygen, CCBs relieve or prevent angina. CCBs also are used for treating high blood pressure because of their blood pressure-lowering effects. CCBs also slow the rate at which the heart beats and are therefore used for treating certain types of abnormally rapid heart rhythms.

For what conditions are calcium channel blockers used?

CCBs are used for treating high blood pressure, angina, and abnormal heart rhythms (for example, atrial fibrillationparoxysmal supraventricular tachycardia).

They also may be used after a heart attack, particularly among patients who cannot tolerate beta-blocking drugs, have atrial fibrillation, or require treatment for their angina.

Unlike beta blockers, CCBs have not been shown to reduce mortality or additional heart attacks after a heart attack.

CCBs are as effective as ACE inhibitors in reducing blood pressure, but they may not be as effective as ACE inhibitors in preventing the kidney failure caused by high blood pressure or diabetes.

They also are used for treating:

CCBs are also used in the prevention of migraine headaches.

Are there any differences among calcium channel blockers?

CCBs differ in their duration of action, the process by which they are eliminated from the body, and, most importantly, in their ability to affect heart rate and contraction. Some CCBs [for example, amlodipine (Norvasc)] have very little effect on heart rate and contraction so they are safer to use in individuals who have heart failure or bradycardia (a slow heart rate). Verapamil (Calan, Isoptin) and diltiazem (Cardizem) have the greatest effects on the heart and reduce the strength and rate of contraction. Therefore, they are used in reducing heart rate when the heart is beating too fast.

What are the side effects of calcium channel blockers?

  • The most common side effects of CCBs are constipationnausea,headacherashedema (swelling of the legs with fluid), low blood pressure, drowsiness, and dizziness.
  • Liver dysfunction and over growth of gums may also occur. When diltiazem (Cardizem) or verapamil (Calan, Isoptin) are given to individuals with heart failure, symptoms of heart failure may worsen because these drugs reduce the ability of the heart to pump blood.
  • Like other blood pressure medications, CCBs are associated with sexual dysfunction.

http://www.medicinenet.com/calcium_channel_blockers/article.htm

Section Three

Brand and Generic Calcium Channel Blocking Agents

A drug may be classified by the chemical type of the active ingredient or by the way it is used to treat a particular condition. Each drug can be classified into one or more drug classes.

Calcium channel blockers block voltage gated calcium channels and inhibits the influx of calcium ions into cardiac and smooth muscle cells. The decrease in intracellular calcium reduces the strength of heart muscle contraction, reduces conduction of impulses in the heart, and causes vasodilatation.

Decrease in intracellular calcium in the heart decreases cardiac contractility. Decreased calcium in the vascular smooth muscle reduces its contraction and therefore causes vasodilatation.

Decrease in cardiac contractility decreases cardiac output and vasodilatation decreases total peripheral resistance, both of which cause a drop in blood pressure.

Calcium channel blocking agents are used to treat hypertension.

Filter by: — all conditions –AnginaAngina Pectoris ProphylaxisArrhythmiaAtrial FibrillationAtrial FlutterBipolar DisorderCluster HeadachesCoronary Artery DiseaseHeart FailureHigh Blood PressureHypertensive EmergencyHypertrophic CardiomyopathyIdiopathic Hypertrophic Subaortic StenosisIschemic StrokeMigraine PreventionNocturnal Leg CrampsPremature LaborRaynaud’s SyndromeSubarachnoid HemorrhageSupraventricular Tachycardia

Drug Name ( View by: Brand | Generic )
Afeditab CR (Pro, More…)generic name: nifedipine
Diltia XT (Pro, More…)generic name: diltiazem
Diltiazem Hydrochloride SR (More…)generic name: diltiazem
Nimotop (Pro, More…)generic name: nimodipine
Verelan PM (Pro, More…)generic name: verapamil
Cartia XT (Pro, More…)generic name: diltiazem
Adalat (More…)generic name: nifedipine
Calan SR (Pro, More…)generic name: verapamil
Cardizem (Pro, More…)generic name: diltiazem
Diltiazem Hydrochloride CD (More…)generic name: diltiazem
Isoptin SR (Pro, More…)generic name: verapamil
Nifediac CC (Pro, More…)generic name: nifedipine
Tiazac (Pro, More…)generic name: diltiazem
Procardia (Pro, More…)generic name: nifedipine
Adalat CC (Pro, More…)generic name: nifedipine
Cardizem LA (Pro, More…)generic name: diltiazem
Calan (Pro, More…)generic name: verapamil
Procardia XL (Pro, More…)generic name: nifedipine
Isoptin (More…)generic name: verapamil
Nifedical XL (Pro, More…)generic name: nifedipine
Plendil (Pro, More…)generic name: felodipine
Taztia XT (Pro, More…)generic name: diltiazem
Cardizem CD (Pro, More…)generic name: diltiazem
Norvasc (Pro, More…)generic name: amlodipine
Verelan (Pro, More…)generic name: verapamil
Cardene SR (Pro, More…)generic name: nicardipine
DynaCirc CR (Pro, More…)generic name: isradipine
Sular (Pro, More…)generic name: nisoldipine
Cardene (Pro, More…)generic name: nicardipine
Cardene IV (Pro, More…)generic name: nicardipine
Cleviprex (Pro, More…)generic name: clevidipine
Covera-HS (Pro, More…)generic name: verapamil
Dilacor XR (Pro, More…)generic name: diltiazem
Dilt-XR (Pro, More…)generic name: diltiazem
Diltiazem Hydrochloride XR (More…)generic name: diltiazem
Diltiazem Hydrochloride XT (More…)generic name: diltiazem
Diltzac (Pro, More…)generic name: diltiazem
Dynacirc (Pro, More…)generic name: isradipine
Matzim LA (Pro, More…)generic name: diltiazem
Nymalize (Pro, More…)generic name: nimodipine
Vascor (More…)generic name: bepridil

Section Four

Dysfunction of the Calcium Release Mechanism

For Disruption of Calcium Homeostasis in Vascular Smooth Muscle Cells, see

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

For Disruption of Calcium Homeostasis in Cardiomyocyte Cells, see

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Section Five

The Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

This topic is covered in

Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

Summary

Work on neurotransmitter release revealed a hierarchy of molecular machines that mediate the fusion of synaptic vesicles, the calcium-control of this fusion, and the embedding of calcium-controlled fusion in the context of the presynaptic terminal at the synapse. The neural transmission is described as a biological relay system. Neurotransmission kicks off with an electrical pulse that runs down a nerve cell, or neuron. When that signal reaches the tip, calcium enters the cell. In response, the neuron liberates chemical messengers—neurotransmitters.  When the calcium-controlled fusion at the presynaptic junction is blocked, as with a CCB, neurotransmitters are not released.  The activity of the neurotransmitters would be to cause smaooth muscle contraction of the vessel.  The CCB would cause relaxation and flow.

http://www.nature.com/focus/Lasker/2013/pdf/ES-Lasker13-Sudhof.pdf

Part IX of this series of articles discussed the mechanism of the signaling of smooth muscle cells by the interacting parasympathetic neural innervation that occurs by calcium triggering neurotransmitter release by initiating synaptic vesicle fusion. It involves the interaction of soluble N-acetylmaleimide-sensitive factor (SNARE) and SM proteins, and in addition, the discovery of a calcium-dependent Syt1 (C) domain of protein- kinase C isoenzyme, which binds to phospholipids. It is reasonable to consider that it differs from motor neuron activation of skeletal muscles, mainly because the innervation is in the involuntary domain. The cranial nerve rooted innervation has evolved comes from the spinal ganglia at the corresponding level of the spinal cord. It is in this specific neural function that we find a mechanistic interaction with adrenergic hormonal function, a concept intimated by the late Richard Bing. Only recently has there been a plausible concept that brings this into serious consideration. Moreover, the review of therapeutic drugs that are used in blocking adrenergic receptors are closely related to the calcium-channels. Interesting too is the participation of a phospholipid bound protein-kinase isoenzyme C calcium-dependent domain Syt1. The neurohormonal connection lies in the observation by Katz in the 1950’s that the vesicles of the neurons hold and eject fixed amounts of neurotransmitters.  The mechanism of this action will be futher discussed in Part X.

Read Full Post »


Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

 

Author, Introduction: Larry H Bernstein, MD, FCAP

Author, Summary: Justin Pearlman, MD, PhD, FACC 

and

Article Curator: Aviva Lev-Ari, PhD, RN

This article is the Part VIII in a series of articles on Activation and Dysfunction of the Calcium Release Mechanisms in Cardiomyocytes and Vascular Smooth Muscle Cells. Calcium has a storage and release cycle that flags activation of important cellular activities that include in particular the cycle activation of muscle contraction both to circulate blood and control its pressure and distribution. Homeostasis – the maintenance of status – requires controlled release of calcium from storage and return of calcium to storage. Such controls are critical both within cells, and for the entire biologic system. Thus the role of kidneys in maintaining the correct total body load of available calcium is just as vital as the subcellular systems of calcium handling in heart muscle and in the muscles that line arteries to control blood flow. The practical side to this knowledge includes not only identifying abnormalities at the cellular as well as system levels, but also identifying better opportunities to characterize disease and to intervene.

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differences/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IXCalcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

 

This article has three Sections:

Section One:

Vascular Smooth Muscle Cells: The Cardiovascular Calcium Signaling Mechanism

Section Two:

Cardiomyocytes Cells: The Cardiac Calcium Signaling Mechanism

Section Three:

The Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Introduction

by Larry H Bernstein, MD, FACC   

Introduction

This discussion in two Sections brings to a conclusion the two main aspects of calcium signaling and transient current induction in the cardiovascular system – involving vascular smooth muscle and cardiomyocyte.  In this first Section, it extends the view of smooth muscle beyond the vascular smooth muscle to contraction events in gastrointestinal tract, urinary bladder, and uterus, but by inference, to ductal structures (gallbladder, parotid gland, etc.).  This discussion also reinforces the ECONOMY of the evolutionary development of these functional MOTIFS, as a common thread is used again, and again, in specific contexts.  The main elements of this mechanistic framework are:

  • the endoplasmic (sarcoplasmic) reticulum as a strorage depot for calcium needed in E-C coupling
  • the release of Ca(2+) into the cytoplasm
  • the generation of a voltage and current with contraction of the muscle cell unit
  • the coordination of smooth muscle cell contractions (in waves)
    • this appears to be related to the Rho/Rho kinase pathway
  • there is also a membrane depolarization inherent in the activation mechanism
  • whether there is an ordered relationship between the calcium release and the membrane polarization, and why this would be so, in not clear
  • three different models of calcium release are shown from the MJ Berridge classification article below in Figure 1.
  • Model C is of special interest because of the focus on cytosolic (Ca+) ion transfers involving the interstitial cells of Cajal (Ramin e’ Cajal) through gap junctions

Santiago Ramón y Cajal  (Spanish: [sanˈtjaɣo raˈmon i kaˈxal]; 1 May 1852 – 18 October 1934) was a Spanish pathologist, histologist and neuroscientist. He was awarded  the Nobel Prize in Physiology or Medicine in 1906 together with Italian Camillo Golgi “in recognition of their work on the structure of the nervous system”.  Relevant to this discussion, he discovered a new type of cell, to be named after him: the interstitial cell of Cajal (ICC). This cell is found interleaved among neurons embedded within the smooth muscles lining the gut, serving as the generator and pacemaker of the slow waves of contraction that move material along the gastrointestine, vitally mediating neurotransmission from motor nerves to smooth muscle cells . Cajal also described in 1891 slender horizontal bipolar cells in the developing marginal zone of lagomorphs.(See the Cajal’s original drawing of the cells) , considered by Retzius as homologues to the cells he found in humans and in other mammals (Retzius, 1893, 1894).  The term Cajal–Retzius cell is applied to reelin-producing neurons of the human embryonic marginal zone.  

240px-Cajal-Retzius_cell_drawing_by_Cajal_1891

Section One

Vascular Smooth Muscle Cells: The Cardiovascular Calcium Signaling Mechanism

Smooth Muscle Cell Calcium Activation Mechanisms

Michael J. Berridge

J Physiol 586.21 (2008) pp 5047–5061

http://jp.physoc.org/content/586/21/5047.full.pdf

Classification of Smooth Muscle Ca2+ Activation Mechanisms

Excitation–contraction coupling in SMCs occurs through two main mechanisms. Many SMCs are activated by Ca2+ signalling cascades (Haddock & Hill, 2005; Wray et al.  2005).  In addition, there is a Rho/Rho kinase signaling pathway that acts by altering the Ca2+ sensitivity of the contractile system (Somlyo & Somlyo, 2003). Since the latter appears to have more of a modulatory function,most attention will focus on how Ca2+ signalling is activated.  Since membrane depolarization is a key element for the activation of many SMCs,much attention will focus on the mechanisms responsible for depolarizing the membrane.  However, there are other SMCs where activation depends on the periodic release of Ca2+ from internal stores. These different Ca2+ activation mechanisms fall into the following three main groups (Fig. 1).

 

Fig 1 Ca2+

Figure 1. The three main mechanisms responsible for generating the Ca2+ transients that trigger smooth

muscle cell (SMC) contraction

A, receptor-operated channels (ROCs) or a membrane oscillator induces the membrane depolarization (_V) that

triggers Ca2+ entry and contraction.

B, a cytosolic Ca2+ oscillator induces the Ca2+ signal that drives contraction.

C, a cytosolic Ca2+ oscillator in interstitial cells of Cajal (ICCs) or atypical SMCs induces the membrane depolarization

that spreads through the gap junctions to activate neighbouring SMCs. Reproduced from Berridge (2008), with permission

SOURCE for Figure 1: J Physiol 586.21 M. J. Berridge Smooth muscle cell calcium activation mechanisms 5048

http://jp.physoc.org/content/586/21/5047.full.pdf

Mechanism A.

Many SMCs are activated by membrane depolarization (_V) that opens L-type voltage-operated channels (VOCs) allowing external Ca2+ to flood into the cell to trigger contraction. This depolarization is induced either by ionotropic receptors (vas deferens) or a membrane oscillator (bladder and uterus). Themembrane oscillator, which resides in the plasma membrane, generates the periodic pacemaker depolarizations responsible for the action potentials that drive contraction. The depolarizing signal that activates gastrointestinal, urethral and ureter SMCs is described in mechanism C.

Mechanism B.

The rhythmical contractions of vascular, lymphatic, airway and corpus cavernosum SMCs depend on an endogenous pacemaker driven by a cytosolic Ca2+ oscillator that is responsible for the periodic release of Ca2+  from the endoplasmic reticulum. The periodic pulses of Ca2+ often cause membrane depolarization, but this is not part of the primary activation mechanism but has a secondary role to synchronize and amplify the oscillatory mechanism. Neurotransmitters and hormones act by modulating the frequency of the cytosolic oscillator.

Mechanism C.

A number of SMCs are activated by pacemaker cells such as the interstitial cells of Cajal (ICCs)  (gastrointestinal and urethral SMCs) or atypical SMCs (ureter). These pacemaker cells have a cytosolic oscillator that generates the repetitive Ca2+  transients that activate inward currents that spread through the gap junctions to provide the depolarizing signal (_V) that triggers contraction through mechanism A.  In the following sections, some selected SMC types will illustrate how these signalling mechanisms have been adapted to control different contractile functions with particular emphasis on how Ca2+ signals are activated.

Vascular, Lymphatic and Airway Smooth Muscle Cells

Vascular, lymphatic and airway smooth muscle, which generate rhythmical contractions over an extended period of time, have an endogenous pacemaker mechanism driven by a cytosolic Ca2+ oscillator. In addition, these SMCs also respond to neurotransmitters released from the neural innervation. In the case of mesenteric arteries, the perivascular nerves release both ATP and noradrenaline  (NA). The ATP acts first to produce a small initial contraction that is then followed by a much larger contraction when NA initiates a series of Ca2+ transients (Lamont et al. 2003). Such agonist-induced Ca2+ oscillations are a characteristic feature of the activation mechanisms of vascular (Iino et al. 1994; Lee et al.  2001; Peng et al. 2001; Perez & Sanderson, 2005b; Shaw et al. 2004) and airway SMCs (Kuo et al. 2003; Perez & Sanderson, 2005a; Sanderson et al. 2008). In some blood vessels, a specific tone is maintained by the spatial averaging of asynchronous oscillations. However, there are some vessels where the oscillations in groups of cells are synchronized resulting in the pulsatile contractions known as vasomotion (Mauban et al. 2001; Peng et al.  2001; Lamboley et al. 2003; Haddock & Hill, 2005).  Such vasomotion is also a feature of lymphatic vessels (Imtiaz et al. 2007). Another feature of this oscillatory activity is that variations in transmitter concentration are translated into a change in contractile tone through a mechanism of frequency modulation (Iino et al.  1994; Kuo et al. 2003; Perez & Sanderson, 2005a,b).  Frequency modulation is one of the mechanisms used for encoding and decoding signalling information through Ca2+ oscillations (Berridge, 2007).

The periodic pulses of Ca2+ that drive these rhythmical SMCs are derived from the internal stores through the operation of a cytosolic Ca2+  oscillator (Haddock & Hill, 2005; Imtiaz et al. 2007;  Sanderson et al. 2008). The following general model, which applies to vascular, lymphatic, airway and perhaps also to corpus cavernosum SMCs, attempts to describe the nature of this oscillator and how it can be induced or modulated by neurotransmitters. A luminal loading Ca2+ oscillation mechanism (Berridge & Dupont, 1994; Berridge, 2007)  forms the basis of this cytosolic oscillator model that depends upon the following sequential series of events  (Fig. 5).

 Fig 2 Ca2+

Figure 5. Vascular or airway SMCs are driven by a cytosolic oscillator that generates a periodic release

of Ca2+ from the endoplasmic reticulum that usually appears as a propagating Ca2+ wave

The oscillator is induced/modulated by neurotransmitters such as acetylcholine (ACh), 5-hydroxytryptamine (5-HT),

noradrenaline (NA) and endothelin-1 (ET-1), which act through inositol 1,4,5-trisphosphate (InsP3) that initiates

the oscillatory mechanism. The sequence of steps 1–9 is described in the text. Reproduced from Berridge (2008),

with permission.

SOURCE for Figure 5: J Physiol 586.21 M. J. Berridge Smooth muscle cell calcium activation mechanisms 5053

http://jp.physoc.org/content/586/21/5047.full.pdf

For Disruption of Calcium Homeostasis in Vascular Smooth Muscle Cells, see

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

 

Section Two

Cardiomyocytes Cells: The Cardiac Calcium Signaling Mechanism

Cardiomyocytes and Ca2+ Channels

Published August 8, 2011 // JCB vol. 194 no. 3 355-365 
The Rockefeller University Press, doi: 10.1083/jcb.201101100

Cellular mechanisms of cardiomyopathy
  1. Pamela A. Harvey and
  2. Leslie A. Leinwand

+Author Affiliations


  1. Department of Molecular, Cellular, and Developmental Biology, University of Colorado at Boulder, Boulder, CO 80309
  1. Correspondence to Leslie Leinwand: leslie.leinwand@colorado.edu

Abbreviations

DCM dilated cardiomyopathy

HCM hypertrophic cardiomyopathy

MyH Cmyosin heavy chain

RCM restrictive cardiomyopathy

Introduction

The heart relies on a complex network of cells to maintain appropriate function. Cardiomyocytes, the contracting cells in the heart, exist in a three-dimensional network of endothelial cells, vascular smooth muscle, and an abundance of fibroblasts as well as transient populations of immune cells. Gap junctions electrochemically coordinate the contraction of individual cardiomyocytes, and their connection to the extracellular matrix (ECM) transduces force and coordinates the overall contraction of the heart. Intracellularly, repeating units of actin and myosin form the backbone of sarcomere structure, the basic functional unit of the cardiomyocyte (Fig. 1). The sarcomere itself consists of ∼20 proteins; however, more than 20 other proteins form connections between the myocytes and the ECM and regulate muscle contraction (Fig. 1 B). Given the complexity of the coordinated efforts of the many proteins that exist in multimeric complexes, dysfunction occurs when these interactions are disrupted.

Figure 1.

View larger version:

Figure 1. Anatomy of the cardiac sarcomere(A) Diagram of the basic organization of the sarcomere. The sarcomere forms the basic contractile unit in the cardiomyocytes of the heart. Thin filaments composed of actin are anchored at the Z line and form transient sliding interactions with thick filaments composed of myosin molecules. The M Line, I Band, and A Band are anatomical features defined by their components (actin, myosin, and cytoskeletal proteins) and appearance in polarized light. Titin connects the Z line with the M line and contributes to the elastic properties and force production of the sarcomere through its extensible region in the I Band. Coordinated shortening of the sarcomere creates contraction of the cardiomyocyte. (B) Representation of the major proteins of the cardiac sarcomere. Attachment to the ECM is mediated by costameres composed of the dystroglycan–glycoprotein complex and the integrin complex. Force transduction and intracellular signaling are coordinated through the costamere. The unique roles of each of these proteins are critical to appropriate function of the heart. T-cap, titin cap; MyBP-C, myosin-binding protein C; NOS, nitric oxide synthase.

Although the heart may functionally tolerate a variety of pathological insults, adaptive responses that aim to maintain function eventually fail, resulting in a wide range of functional deficits or cardiomyopathy. Although a multitude of intrinsic and extrinsic stimuli promote cardiomyopathies, the best described causes are the >900 mutations in genes expressed in the cardiomyocyte (Fig. 1 BWang et al., 2010). Mutations in most of these genes cause a diverse range of cardiomyopathies, many with overlapping clinical phenotypes. Mutations in sarcomeric genes are usually inherited in an autosomal-dominant manner and are missense mutations that are incorporated into sarcomeres (Seidman and Seidman, 2001). Thus far >400 mutations in 13 sarcomeric proteins including β-myosin heavy chain (β-MyHC), α-cardiac actin, tropomyosin, and troponin have been associated with cardiomyopathy (www.cardiogenomics.med.harvard.edu). Table I summarizes these mutated proteins.

Ca2+ regulation and calcineurin signaling

Ca2+ concentrations inside the cardiomyocyte are critically important to actin–myosin interactions. Ca2+ is sequestered within the sarcoplasmic reticulum and the sarcomere itself, which serves as an intracellular reserve that is released in response to electrical stimulation of the cardiomyocyte. After contraction, sarco/endoplasmic reticulum Ca2+-ATPase sequesters the Ca2+ back into the sarcoplasmic reticulum to restore Ca2+balance. There is a clear correlation between force production and perturbation of Ca2+regulation, alterations of which might directly induce pathological, anatomical, and functional alterations that lead to heart failure via activation of GPCRs (Minamisawa et al., 1999).

Ca2+ in the cytosol can be increased to modulate sarcomere contractility by signaling through Gαq recruitment and activation of PLCβ. Ca2+ released from the sarcoplasmic reticulum activates calmodulin, which phosphorylates calcineurin, a serine/threonine phosphatase. Upon activation, calcineurin interacts with and dephosphorylates nuclear factor of activated T cells (NFAT), which then translocates into the nucleus. Calcineurin activation exacerbates hypertrophic signals and expedites the transition to a decompensatory state. Indeed, cardiac-specific overexpression of calcineurin or NFAT leads to significant cardiac hypertrophy that progresses rapidly to heart failure (Molkentin et al., 1998). Administration of antagonists of calcineurin attenuates the hypertrophic response of neonatal rat ventricular myocytes to stimuli such as phenylephrine (PE) and angiotensin II (Taigen et al., 2000).

Mechanotransduction and signaling in the cardiomyocyte

The responses of cardiomyocytes to systemic stress or genetic abnormalities are modulated by mechanosensitive mechanisms within the cardiomyocyte (Molkentin and Dorn, 2001Seidman and Seidman, 2001Frey and Olson, 2003). A complex network of proteins that connects the sarcomere to the ECM forms the basis of the mechanotransduction apparatus. For example, components of the costamere complex, which form the connection between the sarcomere and the ECM via integrins, initiate intracellular signaling and subsequently alter contractile properties and transcriptional regulation in response to membrane distortion. Mechanosensitive ion channels are also implicated in signal initiation in response to systemic stress (Le Guennec et al., 1990;Zhang et al., 2000de Jonge et al., 2002). These channels are likely responsible for acute changes that might initiate other longer-term responses in the heart but are nonetheless important to consider when examining possible transducers of systemic and tissue alterations to the cardiomyocyte.

Changes in wall stress induce signaling pathways that are associated with the development of cardiac pathology. The many intracellular signaling pathways that mediate responses to increased demand on the heart have been extensively reviewed elsewhere (Force et al., 1999Molkentin and Dorn, 2001Heineke and Molkentin, 2006). Here, we focus on pathways that are intimately involved in pathogenesis (Fig. 4). Although their effects in compensatory responses early in pathology initially increase function by promoting growth and contractility, persistent responses eventually compromise function.

Figure 4.

View larger version:

Figure 4. Signaling pathways associated with cardiac hypertrophy.

Although many pathways are associated with cardiomyopathy, up-regulation of transcription and induction of apoptosis are major mediators of pathogenic responses in the heart. The GPCR-associated pathway (dark red) can be activated by ET-1 and AngII, which are released in response to reduced contractility, and mediates contractile adaptation through increased calcium release from the sarcoplasmic reticulum. Increased intracellular calcium activates calmodulin and induces activation of the transcription factor MEF2. Incorporation into the sarcomere of mutant proteins that exhibit reduced ATP efficiency inhibits the sequestration of calcium from the cytosol and further enhances increases in intracellular calcium concentration. GPCR signaling is also associated with activation of the Akt signaling pathway (light green) that induces fetal gene expression and the cardiac hypertrophic response through inhibition of GSK3β. Apoptotic pathways (light blue) are induced by cytochrome c (CytC) release from mitochondria and activation of death receptors (like FasR) by cytokines such as TNF. Calcium overload and myocyte loss significantly contribute to reduced contractility in many forms of cardiomyopathy. ET-1, endothelin-1; HDAC, histone deacetylase; NFAT, nuclear factor of activated T cells; MEF-2, myocyte enhancer factor 2; SERCA, sarco/endoplasmic reticulum calcium-ATPase; cFLIP, cellular FLICE-inhibitory protein; AngII, angiotensin II; FasR, Fas receptor.

http://jcb.rupress.org/content/194/3/355.full

For Disruption of Calcium Homeostasis in Cardiomyocyte Cells, see

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Section Three

The Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

This topic is covered in

Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Summary

Justin D Pearlman, MD, PhD, FACC  PENDING

REFERENCES

Vascular Smooth Muscle Cells

References in http://jp.physoc.org/content/586/21/5047.full.pdf

Amberg GC, Navedo MF, Nieves-Cintr ´on M, Molkentin JD &

Santana LF (2007). Calcium sparklets regulate local and

global calcium in murine arterial smooth muscle. J Physiol

579, 187–201.

Aoyama M, Yamada A,Wang J, Ohya S, Furuzono S, Goto T,

Hotta S, Ito Y, Matsubara T, Shimokata K, Chen SRW,

Imaizumi Y & Nakayama S (2004). Requirement of

ryanodine receptors for pacemaker Ca2+ activity in ICC and

HEK293 cells. J Cell Sci 117, 2813–2825.

Berridge MJ (2007). Inositol trisphosphate and calcium

oscillations. Biochem Soc Symp 74, 1–7.

Berridge MJ (2008). Cell Signalling Biology. Portland Press

Limited (www.cellsignallingbiology.org).

Berridge MJ, Bootman MD & Roderick HL (2003). Calcium

signalling: Dynamics, homeostasis and remodelling. Nat Rev

Mol Cell Biol 4, 517–529.

Berridge MJ & Dupont G (1994). Spatial and temporal

signalling by calcium. Curr Opin Cell Biol 6, 267–274.

Blanks AM, Zhao Z-H, Shmygol A, Bru-Mercier G, Astle S &

Thornton S (2007). Characterization of the molecular and

electrophysiological properties of the T-type calcium

channel in human myometrium. J Physiol 581, 915–926.

Bradley KN, Currie S, MacMillan D, Muir TC & McCarron JG

(2003). Cyclic ADP-ribose inceases Ca2+ removal in smooth

muscle. J Cell Sci 116, 4291–4306.

Bradley E, HollywoodMA, Johnston L, Large RJ, Matsuda T,

Baba A, McHale NG, Thornbury KD & Sergeant GP (2006).

Contribution of reverse Na+–Ca2+ exchange to spontaneous

activity in interstitial cells of Cajal in the rabbit urethra.

J Physiol 574, 651–661.

Brain KL, Cuprian AM,Williams DJ & Cunnane TC (2003).

The sources and sequestration of Ca2+ transients in the

mouse vas deferens. J Physiol 553, 627–635.

Brain KL, Jackson MJ, Trout SJ & Cunnane TC (2002).

Intermittent ATP release from nerve terminals elicits focal

smooth muscle Ca2+ transients in mouse vas deferens.

J Physiol 541, 849–862.

Brown A, Cornwell T, Korniyenko I, Solodushko V, Bond CT,

Adelman JP & Taylor MS (2007). Myometrial expression of

small conductance Ca2+-activated K+ channels depresses

phasic uterine contractions. Am J Physiol Cell Physiol 292,

C832–C840.

Burdyga T &Wray S (2005). Action potential refractory period

in ureter smooth muscle is set by Ca sparks and BK channels.

Nature 436, 559–562.

Collier ML, Ji G,Wang Y-X & Kotlikoff MI (2000).

Calcium-induced calcium release in smooth muscle. Loose

coupling between the action potential and calcium release.

J Gen Physiol 115, 653–662.

Craven M, Sergeant GP, Hollywood MA, McHale NG &

Thornbury KD (2004). Modulation of spontaneous

Ca2+-activated Cl− currents in the rabbit corpus cavernosum

by the nitric oxide-cGMP pathway. J Physiol 556, 495–506.

Dai JM, Kuo K-H, Leo JM, van Breemen C & Lee C-H (2006).

Mechanism of ACh-induced asynchronous calcium waves

and tonic contraction in porcine tracheal muscle bundle.

Am J Physiol Lung Cell Mol Physiol 290, L459–L469.

Deshpande DA,White TA, Dogan S,Walseth TF, Panettieri RA

& Kanna MS (2005). CD38/cyclic ADP-ribose signalling: role

in the regulation of calcium homeostasis in airway smooth

muscle. Am J Physiol Lung Cell Mol Physiol 288, L733–L788.

Essin K,Welling A, Hofmann F, Luft FC, Gollasch M &

Moosmang S (2007). Indirect coupling between CaV1.2

channels and ryanodine receptors to generate Ca2+ sparks in

murine arterial smooth muscle cells. J Physiol 584, 205–219.

Haddock RE & Hill CE (2002). Differential activation of ion

channels by inositol 1,4,5-trisphosphate (IP3)- and

ryanodine-sensitive calcium stores in rat basilar artery

vasomotion. J Physiol 545, 615–627.

C2008 The Author. Journal compilation C 2008 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on September 12, 2013

5060 M. J. Berridge J Physiol 586.21

Haddock RE & Hill CE (2005). Rhythmicity in arterial smooth

muscle. J Physiol 566, 645–656.

Hashitani H, Fukuta H, Takano H, Klemm MF & Suzuki H

(2001). Origin and propagation of spontaneous excitation in

smooth muscle of the guinea-pig urinary bladder. J Physiol

530, 273–286.

Hashitani H (2006). Interaction between interstitial cells and

smooth muscles in the lower urinary tract and penis.

J Physiol 576, 707–714.

Hashitani H & Brading AF (2003a). Electrical properties of

detrusor smooth muscles from the pig and human urinary

bladder. Br J Pharmacol 140, 146–158.

Hashitani H & Brading AF (2003b). Ionic basis for the

regulation of spontaneous excitation in detrusor smooth

muscle cells of the guinea-pig urinary bladder.

Br J Pharmacol 140, 159–169.

Hashitani H, Brading AF & Suzuki H (2004). Correlation

between spontaneous electrical, calcium and mechanical

activity of detrusor smooth muscle of the guinea-pig

bladder. Br J Pharmacol 141, 183–193.

Hashitani H, Bramich NJ & Hirst GDS (2000). Mechanisms of

excitatory neuromuscular transmission in the guinea-pig

urinary bladder. J Physiol 524, 565–579.

Hashitani H & Suzuki H (2007). Properties of spontaneous

Ca2+ transients recorded from interstitial cells of Cajal-like

cells of the rabbit urethra in situ. J Physiol 583, 505–519.

Hashitani H, Yanai Y, Shirasawa N, Soji T, Tomita A, Kohri K &

Suzuki H (2005). Interaction between spontaneous and

neurally mediated regulation of smooth muscle cell tone in

the rabbit corpus cavernosum. J Physiol 569, 723–735.

Heppner TJ, Bonev AD & Nelson MT (2005). Elementary

purinergic Ca2+ transients evoked by nerve stimulation in

rat urinary bladder smooth muscle. J Physiol 564, 201–212.

Hirst GDS &Ward SM (2003). Interstitial cells: involvement in

rhythmicity and neural control of gut smooth muscle.

J Physiol 550, 337–346.

Hotta S, Morimura K, Ohya S, Muraki K, Takeshima H &

Imaizumi Y (2007). Ryanodine receptor type 2 deficiency

changes excitation–contraction coupling and membrane

potential in urinary bladder smooth muscle. J Physiol 582,

489–506.

Iino M, Kasai H & Yamazawa T (1994). Visualization of neural

control of intracellular Ca2+ concentration in single vascular

smooth muscle cells in situ. EMBO J 13, 5026–5031.

Imtiaz MS, Katnik CP, Smith DW& van Helden DF (2006).

Role of voltage-dependent modulation of store Ca2+ release

in synchronization of Ca2+ oscillations. Biophys J 90, 1–23.

Imtiaz MS, Zhao J, Hosaka K, von derWeid P-Y, Crowe M &

van Helden DF (2007). Pacemaking through Ca2+ stores

interacting as coupled oscillators via membrane

depolarization. Biophys J 92, 3843–3861.

Johnstone L, Sergeant GP, Hollywood MA, Thornbury KD &

McHale NG (2005). Calcium oscillations in interstitial cells

of the rabbit urethra. J Physiol 565, 449–461.

Kim YC, Koh SD & Sanders KM (2002). Voltage-dependent

inward currents of intestinal cells of Cajal from murine colon

and small intestine. J Physiol 541, 797–810.

Kito Y & Suzuki H (2003). Properties of pacemaker potentials

recorded from myenteric interstitial cells of Cajal distributed

in the mouse small intestine. J Physiol 553, 803–818.

Kito Y,Ward SM & Sanders KM (2005). Pacemaker potentials

generated by interstitial cells of Cajal in the murine intestine.

Am J Physiol Cell Physiol 288, C710–C720.

Komuro T (2006). Structure and organization of interstitial

cells of Cajal in the gastrointestinal tract. J Physiol 576,

653–658.

Kuo K-H, Dai J, Seow CY, Lee C-H & van Breemen C (2003).

Relationship between asynchronous Ca2+ waves and force

development in intact smooth muscle bundles of the porcine

trachea. Am J Physiol Lung Cell Mol Physiol 285,

L1345–L1353.

Kupittayanant S, Luckas MJM &Wray S (2002). Effect of

inhibiting the sarcoplasmic reticulum on spontaneous and

oxytocin-induced contractions of human myometrium.

Br J Obstet Gynaec 109, 289–296.

Lamboley M, Schuster A, B´eny J-L & Meister J-J (2003).

Recruitment of smooth muscle cells and arterial vasomotion.

Am J Physiol Heart Circ Physiol 285, H562–H569.

Lamont C, Vainorius E &WierWG (2003). Purinergic and

adrenergic Ca2+ transients during neurogenic contractions

of rat mesenteric small arteries. J Physiol 549, 801–808.

Lamont C &WierWG (2002). Evoked and spontaneous

purinergic junctional Ca2+ transients (jCaTs) in rat small

arteries. Circ Res 91, 454–456.

Lang RJ, Hashitani H, Tonta MA, Parkington HC & Suzuki H

(2007). Spontaneous electrical and Ca2+ signals in typical

and atypical smooth muscle cells and interstitial cell of

Cajal-like cells of mouse renal pelvis. J Physiol 583,

1049–1068.

Lee C-H, Poburko D, Sahota P, Sandhu J, Ruehlmann DO &

van Breemen C (2001). The mechanism of

phenylephrine-mediated [Ca2+]i oscillations underlying

tonic contraction in the rabbit inferior vena cava. J Physiol

534, 641–650.

Liu X & Farley JM (1996). Acetylcholine-induced chloride

current oscillations in swine tracheal smooth muscle cells.

J Pharmacol Exp Ther 276, 178–186.

McCarron JG, MacMillan D, Bradley KN, Chalmers S & Muir

TC (2004). Origin and mechanisms of Ca2+ waves in smooth

muscle as revealed by localized photolysis of caged inositol

1,4,5-trisphosphate. J Biol Chem 279, 8417–8427.

McHale NG, Hollywood MA, Sergeant GP, Shafei M,

Thornbury KT &Ward SM (2006). Organization and

function of ICC in the urinary tract. J Physiol 576, 689–694.

Mauban JRH, Lamont C, Balke CW&WierWG (2001).

Adrenergic stimulation of rat resistance arteries affects Ca2+

sparks, Ca2+ waves, and Ca2+ oscillations. Am J Physiol Heart

Circ Physiol 280, H2399–H2405.

Meredith AL, Thorneloe KS,WernerME, Nelson MT & Aldrich

RW(2004). Overactive bladder and incontinence in the

absence of the BK large conductance Ca2+-activated K+

channel. J Biol Chem 279, 36746–36752.

Morimura K, Ohi Y, Yamamura H, Ohya S, Muraki K &

Imaizumi Y (2005). Two-step Ca2+ intracellular release

underlies excitation-contraction coupling in mouse urinary

bladder myocytes. Am J Physiol Cell Physiol 290, C388–C403.

Mulryan K, Gitterman DP, Lewis CJ, Vial C, Leckie BJ, Cobb

AL, Brown JE, Conley EC, Buell G, Pritchard CA & Evans RJ

(2000). Reduced vas deferens contraction and male

infertility in mice lacking P2X1 receptors. Nature 403, 86–89.

C2008 The Author. Journal compilation C 2008 The Physiological Society

Downloaded from J Physiol (jp.physoc.org) by guest on September 12, 2013

J Physiol 586.21 Smooth muscle cell calcium activation mechanisms 5061

Nakao K, Inoue Y, Okabe K, Kawarabayashi T & Kitamura K

(1997). Oxytocin enhances action potentials in pregnant

human myometrium – a study with microelectrodes.

Am J Obstet Gynecol 177, 222–228.

Ohi Y, Yamamura H, Nagano N, Ohya S, Muraki K,Watanabe

M & Imaizumi Y (2001). Local Ca2+ transients and

distribution of BK channels and ryanodine receptors in

smooth muscle cells of guinea-pig vas deferens and urinary

bladder. J Physiol 534, 313–326.

Park KJ, Hennig GW, Lee H-T, Spencer NJ,Ward SM, Sith TK

& Sanders KM (2006). Spatial and temporal mapping of

pacemaker activity in interstitial cells of Cajal in mouse

ileum in situ. Am J Physiol Cell Physiol 290,

C1411–C1427.

Peng H, Matchkov V, Ivarsen A, Aalkjaer C & Nilsson H

(2001). Hypothesis for the initiation of vasomotion. Circ Res

88, 810–815.

Peppiatt-Wildman CM, Albert AP, Saleh SN & LargeWA

(2007). Endothelin-1 activates a Ca2+-permeable cation

channel with TRPC3 and TRPC7 properties in rabbit

coronary artery myocytes. J Physiol 580,

755–764.

Perez JF & Sanderson MJ (2005a). The frequency of calcium

oscillations induced by 5-HT, ACH, and KCl determine the

contraction of smooth muscle cells of intrapulmonary

bronchioles. J Gen Physiol 125, 535–553.

Perez JF & Sanderson MJ (2005b). The contraction of smooth

muscle cells of intrapulmonary arterioles is determined by

the frequency of Ca2+ oscillations induced by 5-HT and KCl.

J Gen Physiol 125, 555–567.

Rebolledo A, Speroni F, Raingo J, Salemme SV, Tanzi F, Munin

V, A˜n´on MC & Milesi V (2006). The Na+/Ca2+ exchanger is

active and working in the reverse mode in human umbilical

artery smooth muscle. Biochem Biophys Res Commun 339,

840–845.

Saleh SN, Albert AP, Peppiatt-Wildman CM & LargeWA

(2008). Diverse properties of store-operated TRPC channels

activated by protein kinase C in vascular myocytes. J Physiol

586, 2463–2476.

Sanders KM, Koy SD &Ward SM (2006). Interstitial cells of

Cajal as pacemakers in the gastrointestinal tract. Annu Rev

Physiol 68, 307–343.

Sanderson MJ, Delmotte P, Bai Y & Perez-Zogbhi JF (2008).

Regulation of airway SMC contractility by Ca2+ signaling

and sensitivity. Proc Am Thorac Soc 5, 23–31.

Sergeant GP, Hollywood MA, McCloskey KD, Thornbury KD

& McHale NG (2000). Specialised pacemaking cells in the

rabbit urethra. J Physiol 526, 359–366.

Sergeant GP, Hollywood MA, McHale NG & Thornbury KD

(2006a). Ca2+ signalling in urethral interstitial cells of Cajal.

J Physiol 576, 715–720.

Sergeant GP, Johnston L, McHale NG, Thornbury KD &

Hollywood MA (2006b). Activation of the cGMP/PKG

pathway inhibits electrical activity in rabbit urethral

interstitial cells of Cajal by reducing the spatial spread of

Ca2+ waves. J Physiol 574, 167–181.

Shaw L, O’Neill S, Jones CJP, Austin C & Taggart MJ (2004).

Comparison of U46619-, endothelin-1- or

phenylephrine-induced changes in cellular Ca2+ profiles and

Ca2+ sensitization of constriction of pressurised rat

resistance arteries. Br J Pharm 141, 678–688.

Shmygol A, Blanks AM, Bru-Mercier G, Gullam JE & Thornton

S (2007). Control of uterine Ca2+ by membrane voltage:

Toward understanding the excitation-contraction coupling

in human myometrium. Ann N Y Acad Sci 1101, 97–109.

Somlyo AP & Somlyo AV (2003). Ca2+ sensitivity of smooth

muscle and nonmuscle myosin II: modulated by G proteins,

kinases, and myosin phosphatase. Physiol Rev 83, 1325–1358.

van Helden DF & Imtiaz MS (2003). Ca2+ phase waves: a basis

for cellular pacemaking and long-range synchronicity in the

guinea-pig gastric pylorus. J Physiol 548, 271–296.

Wang H, Eto M, SteersWD, Somlyo AP & Somlyo AV (2002).

RhoA-mediated Ca2+ sensitization in erectile function. J Biol

Chem 277, 30614–30621.

Ward SM & Sanders KM (2006). Involvement of intramuscular

interstitial cells of Cajal in neuroeffector transmission in the

gastrointestinal tract. J Physiol 576, 675–682.

White C & McGeown JG (2003). Inositol 1,4,5-trisphosphate

receptors modulate Ca2+ sparks and Ca2+ store content in

vas deferens myocytes. Am J Physiol Cell Physiol 285,

C195–C204.

Wray S (2007). Insights into the uterus. Exp Physiol 92,

621–631.

Wray S, Burdyga T & Noble K (2005). Calcium signalling in

smooth muscle. Cell Calcium 38, 397–407.

Wray S & Noble K (2008). Sex hormones and excitationcontraction

coupling in the uterus: The effects of oestrus and

hormones. J Neuroendocrinol 20, 451–461.

Wray S & Shmygol A (2007). Role of the calcium store in

uterine contractility. Semin Cell Dev Biol 18, 315–320.

Yamazawa T & Iino M (2002). Simultaneous imaging of Ca2+

signals in interstitial cells of Cajal and longitudinal smooth

muscle cells during rhythmic activity in mouse ileum.

J Physiol 538, 823–835.

Young RC (2007). Myocytes, myometrium, and uterine

contraction. Ann N Y Acad Sci 1101, 72–84.

C2008 The Author. Journal compilation C 2008 The Physiological Society

Downloaded from JCB

Cardiomyocytes Cells

References in http://jcb.rupress.org/content/194/3/355.full

.         Adams, J.W., D.S. Migita, M.K. Yu, R. Young, M.S. Hellickson, F.E. Castro-Vargas, J.D. Domingo, P.H. Lee, J.S. Bui, S.A. Henderson. 1996. Prostaglandin F2 alpha stimulates hypertrophic growth of cultured neonatal rat ventricular myocytes. J. Biol. Chem. 271:1179–1186. doi:10.1074/jbc.271.2.1179 Abstract/FREE Full Text

.         Akyürek, O., N. Akyürek, T. Sayin, I. Dinçer, B. Berkalp, G. Akyol, M. Ozenci, D. Oral. 2001. Association between the severity of heart failure and the susceptibility of myocytes to apoptosis in patients with idiopathic dilated cardiomyopathy. Int. J. Cardiol. 80:29–36. doi:10.1016/S0167-5273(01)00451-X CrossRefMedline

.         Ashrafian, H., M.P. Frenneaux. 2007. Metabolic modulation in heart failure: the coming of age. Cardiovasc. Drugs Ther. 21:5–7. doi:10.1007/s10557-007-6000-z CrossRefMedline

.         Basso, C., D. Corrado, F.I. Marcus, A. Nava, G. Thiene. 2009. Arrhythmogenic right ventricular cardiomyopathy. Lancet. 373:1289–1300. doi:10.1016/S0140-6736(09)60256-7 CrossRefMedline

.         Berko, B.A., M. Swift. 1987. X-linked dilated cardiomyopathy. N. Engl. J. Med. 316:1186–1191. doi:10.1056/NEJM198705073161904 Medline

.         Buvoli, M., M. Hamady, L.A. Leinwand, R. Knight. 2008. Bioinformatics assessment of beta-myosin mutations reveals myosin’s high sensitivity to mutations. Trends Cardiovasc. Med. 18:141–149. doi:10.1016/j.tcm.2008.04.001 CrossRefMedline

.         Bybee, K.A., T. Kara, A. Prasad, A. Lerman, G.W. Barsness, R.S. Wright, C.S. Rihal. 2004. Systematic review: transient left ventricular apical ballooning: a syndrome that mimics ST-segment elevation myocardial infarction. Ann. Intern. Med. 141:858–865. Abstract/FREE Full Text

.         Chin, T.K., J.K. Perloff, R.G. Williams, K. Jue, R. Mohrmann. 1990. Isolated noncompaction of left ventricular myocardium. A study of eight cases. Circulation. 82:507–513. doi:10.1161/01.CIR.82.2.507 Abstract/FREE Full Text

.         Communal, C., K. Singh, D.R. Pimentel, W.S. Colucci. 1998. Norepinephrine stimulates apoptosis in adult rat ventricular myocytes by activation of the beta-adrenergic pathway. Circulation. 98:1329–1334. Abstract/FREE Full Text

.         Corrado, D., C. Basso, G. Thiene, W.J. McKenna, M.J. Davies, F. Fontaliran, A. Nava, F. Silvestri, C. Blomstrom-Lundqvist, E.K. Wlodarska, et al. 1997. Spectrum of clinicopathologic manifestations of arrhythmogenic right ventricular cardiomyopathy/dysplasia: a multicenter study. J. Am. Coll. Cardiol. 30:1512–1520. doi:10.1016/S0735-1097(97)00332-X Abstract

.         Cregler, L.L. 1989. Progression from hypertrophic cardiomyopathy to dilated cardiomyopathy. J. Natl. Med. Assoc. 81:820: 824–826. Search Google Scholar

.         D’Angelo, D.D., Y. Sakata, J.N. Lorenz, G.P. Boivin, R.A. Walsh, S.B. Liggett, G.W. Dorn II. 1997. Transgenic Galphaq overexpression induces cardiac contractile failure in mice. Proc. Natl. Acad. Sci. USA. 94:8121–8126. doi:10.1073/pnas.94.15.8121 Abstract/FREE Full Text

.         Dávila-Román, V.G., G. Vedala, P. Herrero, L. de las Fuentes, J.G. Rogers, D.P. Kelly, R.J. Gropler. 2002. Altered myocardial fatty acid and glucose metabolism in idiopathic dilated cardiomyopathy. J. Am. Coll. Cardiol. 40:271–277. doi:10.1016/S0735-1097(02)01967-8 Abstract/FREE Full Text

.         Davis, J., H. Wen, T. Edwards, J.M. Metzger. 2007. Thin filament disinhibition by restrictive cardiomyopathy mutant R193H troponin I induces Ca2+-independent mechanical tone and acute myocyte remodeling. Circ. Res. 100:1494–1502. doi:10.1161/01.RES.0000268412.34364.50 Abstract/FREE Full Text

.         de Jonge, H.W., D.H. Dekkers, B.C. Tilly, J.M. Lamers. 2002. Cyclic stretch and endothelin-1 mediated activation of chloride channels in cultured neonatal rat ventricular myocytes. Clin. Sci. 103(Suppl 48):148S–151S. Medline

.         Deinum, J., J.M. van Gool, M.J. Kofflard, F.J. ten Cate, A.H. Danser. 2001. Angiotensin II type 2 receptors and cardiac hypertrophy in women with hypertrophic cardiomyopathy. Hypertension. 38:1278–1281. doi:10.1161/hy1101.096114 Abstract/FREE Full Text

.         Dobrin, J.S., D. Lebeche. 2010. Diabetic cardiomyopathy: signaling defects and therapeutic approaches. Expert Rev. Cardiovasc. Ther. 8:373–391. doi:10.1586/erc.10.17 CrossRefMedline

.         Dolci, A., R. Dominici, D. Cardinale, M.T. Sandri, M. Panteghini. 2008. Biochemical markers for prediction of chemotherapy-induced cardiotoxicity: systematic review of the literature and recommendations for use. Am. J. Clin. Pathol. 130:688–695. doi:10.1309/AJCPB66LRIIVMQDR Abstract/FREE Full Text

.         Edwards, B.S., R.S. Zimmerman, T.R. Schwab, D.M. Heublein, J.C. Burnett Jr. 1988. Atrial stretch, not pressure, is the principal determinant controlling the acute release of atrial natriuretic factor. Circ. Res. 62:191–195. Abstract/FREE Full Text

.         Esposito, G., S.V. Prasad, A. Rapacciuolo, L. Mao, W.J. Koch, H.A. Rockman. 2001. Cardiac overexpression of a G(q) inhibitor blocks induction of extracellular signal-regulated kinase and c-Jun NH(2)-terminal kinase activity in in vivo pressure overload. Circulation. 103:1453–1458. Abstract/FREE Full Text

.         Flavigny, J., M. Souchet, P. Sébillon, I. Berrebi-Bertrand, B. Hainque, A. Mallet, A. Bril, K. Schwartz, L. Carrier. 1999. COOH-terminal truncated cardiac myosin-binding protein C mutants resulting from familial hypertrophic cardiomyopathy mutations exhibit altered expression and/or incorporation in fetal rat cardiomyocytes. J. Mol. Biol. 294:443–456. doi:10.1006/jmbi.1999.3276 CrossRefMedline

.         Force, T., R. Hajjar, F. Del Monte, A. Rosenzweig, G. Choukroun. 1999. Signaling pathways mediating the response to hypertrophic stress in the heart. Gene Expr. 7:337–348. Medline

.         Freedom, R.M., S.J. Yoo, D. Perrin, G. Taylor, S. Petersen, R.H. Anderson. 2005. The morphological spectrum of ventricular noncompaction. Cardiol. Young. 15:345–364. doi:10.1017/S1047951105000752 CrossRefMedline

.         Frey, N., E.N. Olson. 2003. Cardiac hypertrophy: the good, the bad, and the ugly. Annu. Rev. Physiol. 65:45–79. doi:10.1146/annurev.physiol.65.092101.142243 CrossRefMedline

.         Geng, Y.J., Y. Ishikawa, D.E. Vatner, T.E. Wagner, S.P. Bishop, S.F. Vatner, C.J. Homcy. 1999. Apoptosis of cardiac myocytes in Gsalpha transgenic mice. Circ. Res. 84:34–42. Abstract/FREE Full Text

.         Gill, C., R. Mestril, A. Samali. 2002. Losing heart: the role of apoptosis in heart disease—a novel therapeutic target? FASEB J. 16:135–146. doi:10.1096/fj.01-0629com Abstract/FREE Full Text

.         Grogan, M., M.M. Redfield, K.R. Bailey, G.S. Reeder, B.J. Gersh, W.D. Edwards, R.J. Rodeheffer. 1995. Long-term outcome of patients with biopsy-proved myocarditis: comparison with idiopathic dilated cardiomyopathy. J. Am. Coll. Cardiol. 26:80–84. doi:10.1016/0735-1097(95)00148-S Abstract

.         Gupta, A., N.S. Aberle II, J. Ren, A.C. Sharma. 2005. Endothelin-converting enzyme-1-mediated signaling in adult rat ventricular myocyte contractility and apoptosis during sepsis. J. Mol. Cell. Cardiol. 38:527–537. doi:10.1016/j.yjmcc.2005.01.002 CrossRefMedline

.         Haq, S., G. Choukroun, Z.B. Kang, H. Ranu, T. Matsui, A. Rosenzweig, J.D. Molkentin, A. Alessandrini, J. Woodgett, R. Hajjar, et al. 2000. Glycogen synthase kinase-3beta is a negative regulator of cardiomyocyte hypertrophy. J. Cell Biol. 151:117–130. doi:10.1083/jcb.151.1.117 Abstract/FREE Full Text

.         Heineke, J., J.D. Molkentin. 2006. Regulation of cardiac hypertrophy by intracellular signalling pathways. Nat. Rev. Mol. Cell Biol. 7:589–600. doi:10.1038/nrm1983 CrossRefMedline

.         Herron, T.J., K.S. McDonald. 2002. Small amounts of alpha-myosin heavy chain isoform expression significantly increase power output of rat cardiac myocyte fragments. Circ. Res. 90:1150–1152. doi:10.1161/01.RES.0000022879.57270.11 Abstract/FREE Full Text

.         Herron, T.J., R. Vandenboom, E. Fomicheva, L. Mundada, T. Edwards, J.M. Metzger. 2007. Calcium-independent negative inotropy by beta-myosin heavy chain gene transfer in cardiac myocytes. Circ. Res. 100:1182–1190. doi:10.1161/01.RES.0000264102.00706.4e Abstract/FREE Full Text

.         Hoogerwaard, E.M., P.A. van der Wouw, A.A. Wilde, E. Bakker, P.F. Ippel, J.C. Oosterwijk, D.F. Majoor-Krakauer, A.J. van Essen, N.J. Leschot, M. de Visser. 1999. Cardiac involvement in carriers of Duchenne and Becker muscular dystrophy. Neuromuscul. Disord. 9:347–351. doi:10.1016/S0960-8966(99)00018-8 CrossRefMedline

.         Huang, X.P., J.F. Du. 2004. Troponin I, cardiac diastolic dysfunction and restrictive cardiomyopathy. Acta Pharmacol. Sin. 25:1569–1575. Medline

.         Huang, Y., R.P. Hickey, J.L. Yeh, D. Liu, A. Dadak, L.H. Young, R.S. Johnson, F.J. Giordano. 2004. Cardiac myocyte-specific HIF-1alpha deletion alters vascularization, energy availability, calcium flux, and contractility in the normoxic heart. FASEB J. 18:1138–1140. doi:10.1096/fj.03-1377com Abstract/FREE Full Text

.         Iacovoni, A., R. De Maria, A. Gavazzi. 2010. Alcoholic cardiomyopathy. J. Cardiovasc. Med. (Hagerstown). 11:884–892. doi:10.2459/JCM.0b013e32833833a3 CrossRefMedline

.         Ingwall, J.S., R.G. Weiss. 2004. Is the failing heart energy starved? On using chemical energy to support cardiac function. Circ. Res. 95:135–145. doi:10.1161/01.RES.0000137170.41939.d9 Abstract/FREE Full Text

.         Iwai-Kanai, E., K. Hasegawa, M. Araki, T. Kakita, T. Morimoto, S. Sasayama. 1999. alpha- and beta-adrenergic pathways differentially regulate cell type-specific apoptosis in rat cardiac myocytes. Circulation. 100:305–311. Abstract/FREE Full Text

.         Kalsi, K.K., R.T. Smolenski, R.D. Pritchard, A. Khaghani, A.M. Seymour, M.H. Yacoub. 1999. Energetics and function of the failing human heart with dilated or hypertrophic cardiomyopathy. Eur. J. Clin. Invest. 29:469–477. doi:10.1046/j.1365-2362.1999.00468.x CrossRefMedline

.         Kamisago, M., S.D. Sharma, S.R. DePalma, S. Solomon, P. Sharma, B. McDonough, L. Smoot, M.P. Mullen, P.K. Woolf, E.D. Wigle, et al. 2000. Mutations in sarcomere protein genes as a cause of dilated cardiomyopathy. N. Engl. J. Med. 343:1688–1696. doi:10.1056/NEJM200012073432304 CrossRefMedline

.         Kaneda, T., C. Naruse, A. Kawashima, N. Fujino, T. Oshima, M. Namura, S. Nunoda, S. Mori, T. Konno, H. Ino, et al. 2008. A novel beta-myosin heavy chain gene mutation, p.Met531Arg, identified in isolated left ventricular non-compaction in humans, results in left ventricular hypertrophy that progresses to dilation in a mouse model. Clin. Sci. 114:431–440. doi:10.1042/CS20070179 CrossRefMedline

.         Kantor, P.F., M.A. Robertson, J.Y. Coe, G.D. Lopaschuk. 1999. Volume overload hypertrophy of the newborn heart slows the maturation of enzymes involved in the regulation of fatty acid metabolism. J. Am. Coll. Cardiol. 33:1724–1734. doi:10.1016/S0735-1097(99)00063-7 Abstract/FREE Full Text

.         Karam, S., M.J. Raboisson, C. Ducreux, L. Chalabreysse, G. Millat, A. Bozio, P. Bouvagnet. 2008. A de novo mutation of the beta cardiac myosin heavy chain gene in an infantile restrictive cardiomyopathy. Congenit. Heart Dis. 3:138–143. doi:10.1111/j.1747-0803.2008.00165.x CrossRefMedline

.         Katritsis, D., P.T. Wilmshurst, J.A. Wendon, M.J. Davies, M.M. Webb-Peploe. 1991. Primary restrictive cardiomyopathy: clinical and pathologic characteristics. J. Am. Coll. Cardiol. 18:1230–1235. doi:10.1016/0735-1097(91)90540-P Abstract

.         Keeling, P.J., Y. Gang, G. Smith, H. Seo, S.E. Bent, V. Murday, A.L. Caforio, W.J. McKenna. 1995. Familial dilated cardiomyopathy in the United Kingdom. Br. Heart J. 73:417–421. doi:10.1136/hrt.73.5.417 Abstract/FREE Full Text

.         Kinnunen, P., O. Vuolteenaho, H. Ruskoaho. 1993. Mechanisms of atrial and brain natriuretic peptide release from rat ventricular myocardium: effect of stretching. Endocrinology. 132:1961–1970. doi:10.1210/en.132.5.1961 Abstract/FREE Full Text

.         Knowlton, K.U., M.C. Michel, M. Itani, H.E. Shubeita, K. Ishihara, J.H. Brown, K.R. Chien. 1993. The alpha 1A-adrenergic receptor subtype mediates biochemical, molecular, and morphologic features of cultured myocardial cell hypertrophy. J. Biol. Chem. 268:15374–15380. Abstract/FREE Full Text

.         Kojima, M., I. Shiojima, T. Yamazaki, I. Komuro, Z. Zou, Y. Wang, T. Mizuno, K. Ueki, K. Tobe, T. Kadowaki, et al. 1994. Angiotensin II receptor antagonist TCV-116 induces regression of hypertensive left ventricular hypertrophy in vivo and inhibits the intracellular signaling pathway of stretch-mediated cardiomyocyte hypertrophy in vitro. Circulation. 89:2204–2211. Abstract/FREE Full Text

.         Krown, K.A., M.T. Page, C. Nguyen, D. Zechner, V. Gutierrez, K.L. Comstock, C.C. Glembotski, P.J. Quintana, R.A. Sabbadini. 1996. Tumor necrosis factor alpha-induced apoptosis in cardiac myocytes. Involvement of the sphingolipid signaling cascade in cardiac cell death. J. Clin. Invest. 98:2854–2865. doi:10.1172/JCI119114 Medline

.         Kuwahara, K., Y. Saito, M. Takano, Y. Arai, S. Yasuno, Y. Nakagawa, N. Takahashi, Y. Adachi, G. Takemura, M. Horie, et al. 2003. NRSF regulates the fetal cardiac gene program and maintains normal cardiac structure and function. EMBO J. 22:6310–6321. doi:10.1093/emboj/cdg601 CrossRefMedline

.         Le Guennec, J.Y., N. Peineau, J.A. Argibay, K.G. Mongo, D. Garnier. 1990. A new method of attachment of isolated mammalian ventricular myocytes for tension recording: length dependence of passive and active tension. J. Mol. Cell. Cardiol. 22:1083–1093. doi:10.1016/0022-2828(90)90072-A CrossRefMedline

.         Lopaschuk, G.D., M.A. Spafford, D.R. Marsh. 1991. Glycolysis is predominant source of myocardial ATP production immediately after birth. Am. J. Physiol. 261:H1698–H1705. Medline

.         Lowes, B.D., W. Minobe, W.T. Abraham, M.N. Rizeq, T.J. Bohlmeyer, R.A. Quaife, R.L. Roden, D.L. Dutcher, A.D. Robertson, N.F. Voelkel, et al. 1997. Changes in gene expression in the intact human heart. Downregulation of alpha-myosin heavy chain in hypertrophied, failing ventricular myocardium. J. Clin. Invest. 100:2315–2324. doi:10.1172/JCI119770 Medline

.         Luckey, S.W., L.A. Walker, T. Smyth, J. Mansoori, A. Messmer-Kratzsch, A. Rosenzweig, E.N. Olson, L.A. Leinwand. 2009. The role of Akt/GSK-3beta signaling in familial hypertrophic cardiomyopathy. J. Mol. Cell. Cardiol. 46:739–747. doi:10.1016/j.yjmcc.2009.02.010 CrossRefMedline

.         Maass, A.H., M. Buvoli. 2007. Cardiomyocyte preparation, culture, and gene transfer. Methods Mol. Biol. 366:321–330. doi:10.1007/978-1-59745-030-0_18 CrossRefMedline

.         Marian, A.J. 2000. Pathogenesis of diverse clinical and pathological phenotypes in hypertrophic cardiomyopathy. Lancet. 355:58–60. doi:10.1016/S0140-6736(99)06187-5 CrossRefMedline

.         Maron, B.J., A. Pelliccia. 2006. The heart of trained athletes: cardiac remodeling and the risks of sports, including sudden death. Circulation. 114:1633–1644. doi:10.1161/CIRCULATIONAHA.106.613562 FREE Full Text

.         Maron, B.J., P.F. Nichols III, L.W. Pickle, Y.E. Wesley, J.J. Mulvihill. 1984. Patterns of inheritance in hypertrophic cardiomyopathy: assessment by M-mode and two-dimensional echocardiography. Am. J. Cardiol. 53:1087–1094. doi:10.1016/0002-9149(84)90643-X CrossRefMedline

.         Maron, B.J., J.M. Gardin, J.M. Flack, S.S. Gidding, T.T. Kurosaki, D.E. Bild. 1995. Prevalence of hypertrophic cardiomyopathy in a general population of young adults. Echocardiographic analysis of 4111 subjects in the CARDIA Study. Coronary Artery Risk Development in (Young) Adults. Circulation. 92:785–789. Abstract/FREE Full Text

.         Matsui, T., L. Li, J.C. Wu, S.A. Cook, T. Nagoshi, M.H. Picard, R. Liao, A. Rosenzweig. 2002. Phenotypic spectrum caused by transgenic overexpression of activated Akt in the heart. J. Biol. Chem. 277:22896–22901. doi:10.1074/jbc.M200347200 Abstract/FREE Full Text

.         Menon, S.C., B.W. Eidem, J.A. Dearani, S.R. Ommen, M.J. Ackerman, D. Miller. 2009. Diastolic dysfunction and its histopathological correlation in obstructive hypertrophic cardiomyopathy in children and adolescents. J. Am. Soc. Echocardiogr. 22:1327–1334. doi:10.1016/j.echo.2009.08.014 CrossRefMedline

.         Mestroni, L., C. Rocco, D. Gregori, G. Sinagra, A. Di Lenarda, S. Miocic, M. Vatta, B. Pinamonti, F. Muntoni, A.L. Caforio, et al.; Heart Muscle Disease Study Group. 1999. Familial dilated cardiomyopathy: evidence for genetic and phenotypic heterogeneity. J. Am. Coll. Cardiol. 34:181–190. doi:10.1016/S0735-1097(99)00172-2 Abstract/FREE Full Text

.         Michael, A., S. Haq, X. Chen, E. Hsich, L. Cui, B. Walters, Z. Shao, K. Bhattacharya, H. Kilter, G. Huggins, et al. 2004. Glycogen synthase kinase-3beta regulates growth, calcium homeostasis, and diastolic function in the heart. J. Biol. Chem. 279:21383–21393. doi:10.1074/jbc.M401413200 Abstract/FREE Full Text

.         Michels, V.V., P.P. Moll, F.A. Miller, A.J. Tajik, J.S. Chu, D.J. Driscoll, J.C. Burnett, R.J. Rodeheffer, J.H. Chesebro, H.D. Tazelaar. 1992. The frequency of familial dilated cardiomyopathy in a series of patients with idiopathic dilated cardiomyopathy. N. Engl. J. Med. 326:77–82. doi:10.1056/NEJM199201093260201 Medline

.         Minamisawa, S., M. Hoshijima, G. Chu, C.A. Ward, K. Frank, Y. Gu, M.E. Martone, Y. Wang, J. Ross Jr, E.G. Kranias, et al. 1999. Chronic phospholamban-sarcoplasmic reticulum calcium ATPase interaction is the critical calcium cycling defect in dilated cardiomyopathy. Cell. 99:313–322. doi:10.1016/S0092-8674(00)81662-1 CrossRefMedline

.         Miyata, S., W. Minobe, M.R. Bristow, L.A. Leinwand. 2000. Myosin heavy chain isoform expression in the failing and nonfailing human heart. Circ. Res. 86:386–390. Abstract/FREE Full Text

.         Mogensen, J., T. Kubo, M. Duque, W. Uribe, A. Shaw, R. Murphy, J.R. Gimeno, P. Elliott, W.J. McKenna. 2003. Idiopathic restrictive cardiomyopathy is part of the clinical expression of cardiac troponin I mutations. J. Clin. Invest. 111:209–216. CrossRefMedline

.         Molkentin, J.D., G.W. Dorn II. 2001. Cytoplasmic signaling pathways that regulate cardiac hypertrophy. Annu. Rev. Physiol. 63:391–426. doi:10.1146/annurev.physiol.63.1.391 CrossRefMedline

.         Molkentin, J.D., J.R. Lu, C.L. Antos, B. Markham, J. Richardson, J. Robbins, S.R. Grant, E.N. Olson. 1998. A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell. 93:215–228. doi:10.1016/S0092-8674(00)81573-1 CrossRefMedline

.         Nagata, K., R. Liao, F.R. Eberli, N. Satoh, B. Chevalier, C.S. Apstein, T.M. Suter. 1998. Early changes in excitation-contraction coupling: transition from compensated hypertrophy to failure in Dahl salt-sensitive rat myocytes. Cardiovasc. Res. 37:467–477. doi:10.1016/S0008-6363(97)00278-2 Abstract/FREE Full Text

.         Narula, J., N. Haider, R. Virmani, T.G. DiSalvo, F.D. Kolodgie, R.J. Hajjar, U. Schmidt, M.J. Semigran, G.W. Dec, B.A. Khaw. 1996. Apoptosis in myocytes in end-stage heart failure. N. Engl. J. Med. 335:1182–1189. doi:10.1056/NEJM199610173351603 CrossRefMedline

.         Narula, J., P. Pandey, E. Arbustini, N. Haider, N. Narula, F.D. Kolodgie, B. Dal Bello, M.J. Semigran, A. Bielsa-Masdeu, G.W. Dec, et al. 1999. Apoptosis in heart failure: release of cytochrome c from mitochondria and activation of caspase-3 in human cardiomyopathy. Proc. Natl. Acad. Sci. USA. 96:8144–8149. doi:10.1073/pnas.96.14.8144 Abstract/FREE Full Text

.         Neubauer, S. 2007. The failing heart—an engine out of fuel. N. Engl. J. Med. 356:1140–1151. doi:10.1056/NEJMra063052 CrossRefMedline

.         O’Neill, B.T., E.D. Abel. 2005. Akt1 in the cardiovascular system: friend or foe? J. Clin. Invest. 115:2059–2064. doi:10.1172/JCI25900 CrossRefMedline

.         Ohler, A., J. Weisser-Thomas, V. Piacentino, S.R. Houser, G.F. Tomaselli, B. O’Rourke. 2009. Two-photon laser scanning microscopy of the transverse-axial tubule system in ventricular cardiomyocytes from failing and non-failing human hearts. Cardiol. Res. Pract. 2009:802373. Medline

.         Olivetti, G., R. Abbi, F. Quaini, J. Kajstura, W. Cheng, J.A. Nitahara, E. Quaini, C. Di Loreto, C.A. Beltrami, S. Krajewski, et al. 1997. Apoptosis in the failing human heart. N. Engl. J. Med. 336:1131–1141. doi:10.1056/NEJM199704173361603 CrossRefMedline

.         Palmiter, K.A., M.J. Tyska, D.E. Dupuis, N.R. Alpert, D.M. Warshaw. 1999. Kinetic differences at the single molecule level account for the functional diversity of rabbit cardiac myosin isoforms. J. Physiol. 519:669–678. doi:10.1111/j.1469-7793.1999.0669n.x Abstract/FREE Full Text

.         Parvatiyar, M.S., J.R. Pinto, D. Dweck, J.D. Potter. 2010. Cardiac troponin mutations and restrictive cardiomyopathy. J. Biomed. Biotechnol. 2010:350706. doi:10.1155/2010/350706 Medline

.         Peddy, S.B., L.A. Vricella, J.E. Crosson, G.L. Oswald, R.D. Cohn, D.E. Cameron, D. Valle, B.L. Loeys. 2006. Infantile restrictive cardiomyopathy resulting from a mutation in the cardiac troponin T gene. Pediatrics. 117:1830–1833. doi:10.1542/peds.2005-2301 Abstract/FREE Full Text

.         Ritter, M., E. Oechslin, G. Sütsch, C. Attenhofer, J. Schneider, R. Jenni. 1997. Isolated noncompaction of the myocardium in adults. Mayo Clin. Proc. 72:26–31. doi:10.4065/72.1.26 Abstract/FREE Full Text

.         Ro, A., W.H. Frishman. 2006. Peripartum cardiomyopathy. Cardiol. Rev. 14:35–42. doi:10.1097/01.crd.0000174805.68081.f7 CrossRefMedline

.         Rodeheffer, R.J., I. Tanaka, T. Imada, A.S. Hollister, D. Robertson, T. Inagami. 1986. Atrial pressure and secretion of atrial natriuretic factor into the human central circulation. J. Am. Coll. Cardiol. 8:18–26. doi:10.1016/S0735-1097(86)80086-9 Abstract

.         Rose, E.A., A.C. Gelijns, A.J. Moskowitz, D.F. Heitjan, L.W. Stevenson, W. Dembitsky, J.W. Long, D.D. Ascheim, A.R. Tierney, R.G. Levitan, et al.; Randomized Evaluation of Mechanical Assistance for the Treatment of Congestive Heart Failure (REMATCH) Study Group. 2001. Long-term use of a left ventricular assist device for end-stage heart failure. N. Engl. J. Med. 345:1435–1443. doi:10.1056/NEJMoa012175 CrossRefMedline

.         Sack, M.N., T.A. Rader, S. Park, J. Bastin, S.A. McCune, D.P. Kelly. 1996. Fatty acid oxidation enzyme gene expression is downregulated in the failing heart. Circulation. 94:2837–2842. Abstract/FREE Full Text

.         Sadoshima, J., S. Izumo. 1993. Mechanical stretch rapidly activates multiple signal transduction pathways in cardiac myocytes: potential involvement of an autocrine/paracrine mechanism. EMBO J. 12:1681–1692. Medline

.         Sakata, Y., B.D. Hoit, S.B. Liggett, R.A. Walsh, G.W. Dorn II. 1998. Decompensation of pressure-overload hypertrophy in G alpha q-overexpressing mice. Circulation. 97:1488–1495. Abstract/FREE Full Text

.         Sasse-Klaassen, S., B. Gerull, E. Oechslin, R. Jenni, L. Thierfelder. 2003. Isolated noncompaction of the left ventricular myocardium in the adult is an autosomal dominant disorder in the majority of patients. Am. J. Med. Genet. A. 119A:162–167. doi:10.1002/ajmg.a.20075 Medline

.         Schram, K., S. De Girolamo, S. Madani, D. Munoz, F. Thong, G. Sweeney. 2010. Leptin regulates MMP-2, TIMP-1 and collagen synthesis via p38 MAPK in HL-1 murine cardiomyocytes. Cell. Mol. Biol. Lett. 15:551–563. doi:10.2478/s11658-010-0027-z CrossRefMedline

.         Schwartz, K., Y. Lecarpentier, J.L. Martin, A.M. Lompré, J.J. Mercadier, B. Swynghedauw. 1981. Myosin isoenzymic distribution correlates with speed of myocardial contraction. J. Mol. Cell. Cardiol. 13:1071–1075. doi:10.1016/0022-2828(81)90297-2 CrossRefMedline

.         Seidman, J.G., C. Seidman. 2001. The genetic basis for cardiomyopathy: from mutation identification to mechanistic paradigms. Cell. 104:557–567. doi:10.1016/S0092-8674(01)00242-2 CrossRefMedline

.         Semsarian, C., M.J. Healey, D. Fatkin, M. Giewat, C. Duffy, C.E. Seidman, J.G. Seidman. 2001. A polymorphic modifier gene alters the hypertrophic response in a murine model of familial hypertrophic cardiomyopathy. J. Mol. Cell. Cardiol. 33:2055–2060. doi:10.1006/jmcc.2001.1466 CrossRefMedline

.         Shen, W.K., W.D. Edwards, S.C. Hammill, K.R. Bailey, D.J. Ballard, B.J. Gersh. 1995. Sudden unexpected nontraumatic death in 54 young adults: a 30-year population-based study. Am. J. Cardiol. 76:148–152. doi:10.1016/S0002-9149(99)80047-2 CrossRefMedline

.         Shiojima, I., K. Sato, Y. Izumiya, S. Schiekofer, M. Ito, R. Liao, W.S. Colucci, K. Walsh. 2005. Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J. Clin. Invest. 115:2108–2118. doi:10.1172/JCI24682 CrossRefMedline

.         Silberbach, M., T. Gorenc, R.E. Hershberger, P.J. Stork, P.S. Steyger, C.T. Roberts Jr. 1999. Extracellular signal-regulated protein kinase activation is required for the anti-hypertrophic effect of atrial natriuretic factor in neonatal rat ventricular myocytes. J. Biol. Chem. 274:24858–24864. doi:10.1074/jbc.274.35.24858 Abstract/FREE Full Text

.         Simpson, P., A. McGrath, S. Savion. 1982. Myocyte hypertrophy in neonatal rat heart cultures and its regulation by serum and by catecholamines. Circ. Res. 51:787–801. Abstract/FREE Full Text

.         Smith, C.S., P.A. Bottomley, S.P. Schulman, G. Gerstenblith, R.G. Weiss. 2006. Altered creatine kinase adenosine triphosphate kinetics in failing hypertrophied human myocardium. Circulation. 114:1151–1158. doi:10.1161/CIRCULATIONAHA.106.613646 Abstract/FREE Full Text

.         Stanley, W.C., G.D. Lopaschuk, J.G. McCormack. 1997. Regulation of energy substrate metabolism in the diabetic heart. Cardiovasc. Res. 34:25–33. doi:10.1016/S0008-6363(97)00047-3 FREE Full Text

.         Stauffer, B.L., J.P. Konhilas, E.D. Luczak, L.A. Leinwand. 2006. Soy diet worsens heart disease in mice. J. Clin. Invest. 116:209–216. doi:10.1172/JCI24676 CrossRefMedline

.         Taigen, T., L.J. De Windt, H.W. Lim, J.D. Molkentin. 2000. Targeted inhibition of calcineurin prevents agonist-induced cardiomyocyte hypertrophy. Proc. Natl. Acad. Sci. USA. 97:1196–1201. doi:10.1073/pnas.97.3.1196 Abstract/FREE Full Text

.         Teekakirikul, P., S. Eminaga, O. Toka, R. Alcalai, L. Wang, H. Wakimoto, M. Nayor, T. Konno, J.M. Gorham, C.M. Wolf, et al. 2010. Cardiac fibrosis in mice with hypertrophic cardiomyopathy is mediated by non-myocyte proliferation and requires Tgf-β. J. Clin. Invest. 120:3520–3529. doi:10.1172/JCI42028 CrossRefMedline

.         Torre-Amione, G., S. Kapadia, J. Lee, J.B. Durand, R.D. Bies, J.B. Young, D.L. Mann. 1996. Tumor necrosis factor-alpha and tumor necrosis factor receptors in the failing human heart. Circulation. 93:704–711. Abstract/FREE Full Text

.         Vikstrom, K.L., S.M. Factor, L.A. Leinwand. 1996. Mice expressing mutant myosin heavy chains are a model for familial hypertrophic cardiomyopathy. Mol. Med. 2:556–567. Medline

.         Wang, L., J.G. Seidman, C.E. Seidman. 2010. Narrative review: harnessing molecular genetics for the diagnosis and management of hypertrophic cardiomyopathy. Ann. Intern. Med. 152:513–520: W181. Abstract/FREE Full Text

.         Weiford, B.C., V.D. Subbarao, K.M. Mulhern. 2004. Noncompaction of the ventricular myocardium. Circulation. 109:2965–2971. doi:10.1161/01.CIR.0000132478.60674.D0 FREE Full Text

.         Yamaji, K., S. Fujimoto, Y. Ikeda, K. Masuda, S. Nakamura, Y. Saito, C. Yutani. 2005. Apoptotic myocardial cell death in the setting of arrhythmogenic right ventricular cardiomyopathy. Acta Cardiol. 60:465–470. doi:10.2143/AC.60.5.2004965 CrossRefMedline

.         Yang, Z., N.E. Bowles, S.E. Scherer, M.D. Taylor, D.L. Kearney, S. Ge, V.V. Nadvoretskiy, G. DeFreitas, B. Carabello, L.I. Brandon, et al. 2006. Desmosomal dysfunction due to mutations in desmoplakin causes arrhythmogenic right ventricular dysplasia/cardiomyopathy. Circ. Res. 99:646–655. doi:10.1161/01.RES.0000241482.19382.c6 Abstract/FREE Full Text

.         Yousef, Z.R., P.W. Foley, K. Khadjooi, S. Chalil, H. Sandman, N.U. Mohammed, F. Leyva. 2009. Left ventricular non-compaction: clinical features and cardiovascular magnetic resonance imaging. BMC Cardiovasc. Disord. 9:37. doi:10.1186/1471-2261-9-37 CrossRefMedline

         .         Zhang, Y.H., J.B. Youm, H.K. Sung, S.H. Lee, S.Y. Ryu, W.K. Ho, Y.E. Earm. 2000. Stretch-activated and background non-selective cation channels in rat atrial myocytes. J. Physiol. 523:607–619. doi:10.1111/j.1469-7793.2000.00607.x Abstract/FREE Full Text

Read Full Post »

Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling


Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Author and Curator: Larry H Bernstein, MD, FCAP

Author and Cardiovascular Three-volume Series, Editor: Justin Pearlman, MD, PhD, FACC, and

Curator: Aviva Lev-Ari, PhD, RN

Abbreviations

AP, action potential; ARVD2, arrhythmogenic right ventricular cardiomyopathy type 2; CaMKII, Ca2+/calmodulim-dependent protein kinase II; CICR, Ca2+ induced Ca2+ release;CM, calmodulin; CPVT, catecholaminergic polymorphic ventricular tachycardia;  ECC, excitation–contraction coupling; FKBP12/12.6, FK506 binding protein; HF, heart failure; LCC, L-type Ca2+ channel;  P-1 or P-2, phosphatase inhibitor type-1 or type-2; PKA, protein kinase A; PLB, phosphoplamban; PP1, protein phosphatase 1; PP2A, protein phosphatase 2A; RyR1/2, ryanodine receptor type-1/type-2; SCD, sudden cardiac death; SERCA, sarcoplasmic reticulum Ca2+ ATPase; SL, sarcolemma; SR, sarcoplasmic reticulum.

This is Part V of a series on the cytoskeleton and structural shared thematics in cellular movement and cellular dynamics.

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

 

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

 

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

 

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

 

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

 

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

 

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

 

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

In the first part, we discussed common MOTIFs across cell-types that are essential for cell division, embryogenesis, cancer metastasis, osteogenesis, musculoskeletal function, vascular compliance, and cardiac contractility.   This second article concentrates on specific functionalities for cardiac contractility based on Ca++ signaling in excitation-contraction coupling.  The modifications discussed apply specifically to cardiac muscle and not to skeletal muscle.  Considering the observations described might raise additional questions specifically address to the unique requirements of smooth muscle, abundant in the GI tract and responsible for motility in organ function, and in blood vessel compliance or rigidity. Due to the distinctly different aspects of the cardiac contractility and contraction force, and the interactions with potential pharmaceutical targets, there are two separate articles on calcium signaling and cardiac arrhythmias or heart failure (Part 2 and Part 3).  Part 2 focuses on the RYANODINE role in cardiac Ca(2+) signaling and its effect in heart failure.  Part 3 takes up other aspects of heart failure and calcium signaling with respect to phosporylation/dephosphorylation. I add a single review and classification of genetic cardiac disorders of the same cardiac Ca(2+) signaling and the initiation and force of contraction. Keep in mind that the heart is a syncytium, and this makes a huge difference compared with skeletal muscle dynamics. In Part 1 there was some discussion of the importance of Ca2+ signaling on innate immune system, and the immunology will be further expanded in a fourth of the series.

SUMMARY:

This second article on the cardiomyocyte and the Ca(2+) cycling between the sarcomere and the cytoplasm, takes a little distance from the discussion of the ryanodine that precedes it.  In this discussion we found that there is a critical phosphorylation/dephosphorylation balance that exists between Ca(+) ion displacement and it occurs at a specific amino acid residue on the CaMKIId, specific for myocardium, and there is a 4-fold increase in contraction and calcium release associated with this CAM kinase (ser 2809) dependent exchange.  These events are discussed in depth, and the research holds promise for therapeutic application. We also learn that Ca(2+) ion channels are critically involved in the generation of arrhythmia as well as dilated and hypertrophic cardiomyopathy.  In the case of arrhythmiagenesis, there are two possible manners by which this occurs.  One trigger is Ca(2+) efflux instability.  The other is based on the finding that when the cellular instability is voltage driven, the steady-state wave­length (separation of nodes in space) depends on electrotonic coupling between cells and the steepness of APD and CV restitution. The last article is an in depth review of the genetic mutations that occur in cardiac diseases.  It is an attempt at classifying them into reasonable groupings. What are the therapeutic implications of this? We see that the molecular mechanism of cardiac function has been substantially elucidated, although there are contradictions in experimental findings that are unexplained.  However, for the first time, it appears that personalized medicine is on a course that will improve health in the population, and the findings will allow specific targets designed for the individual with a treatable impairment in cardiac function that is identifiable early in the course of illness. This article is a continuation to the following articles on tightly related topics: Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton     Larry H Bernstein, MD, FCAP https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/ Part II:  Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility    Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN  https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/ Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease    Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and  Aviva Lev-Ari, PhD, RN https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/ Part  IV:  The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN  http:/pharmaceuticalintelligence.com/2013.09.089/lhbern/The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Part V:  Heart Smooth Muscle and Cardiomyocyte Cells: Excitation-Contraction Coupling & Ryanodine Receptor (RyR) type-1/type-2 in Cytoskeleton Cellular Dynamics and Ca2+ Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN https://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/ Part VI:  Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD Curator: Aviva Lev-Ari, PhD, RN https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/ and Advanced Topics in Sepsis and the Cardiovascular System at its End Stage Larry H Bernstein, MD, FCAP  https://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-sepsis-and-the-cardiovascular-system-at-its-end-stage/

The Role of Protein Kinases and Protein Phosphatases in the Regulation of Cardiac Sarcoplasmic Reticulum Function

EG Kranias, RC Gupta, G Jakab, HW Kim, NAE Steenaart, ST Rapundalo Molecular and Cellular Biochemistry 06/1988; 82(1):37-44. · 2.06 Impact Factor http://www.researchgate.net/publication/6420466_Protein_phosphatases_decrease_sarcoplasmic_reticulum_calcium_content_by_stimulating_calcium_release_in_cardiac_myocytes Canine cardiac sarcoplasmic reticulum is phosphorylated by

  • adenosine 3,5-monophosphate (cAMP)-dependent and
  • calcium calmodulin-dependent protein kinases on
  • a proteolipid, called phospholamban.

Both types of phosphorylation are associated with

  •  an increase in the initial rates of Ca(2+) transport by SR vesicles
  • which reflects an increased turnover of elementary steps of the calcium ATPase reaction sequence.

The stimulatory effects of the protein kinases on the calcium pump may be reversed by an endogenous protein phosphatase, which

  • can dephosphorylate both the CAMP-dependent and the calcium calmodulin-dependent sites on phospholamban.

Thus, the calcium pump in cardiac sarcoplasmic reticulum appears to be under reversible regulation mediated by protein kinases and protein phosphatases. calcium release calmodulin + ER Ca(2+) and contraction

Regulation of the Cardiac Ryanodine Receptor Channel by Luminal Ca2+ involves Luminal Ca2+ Sensing Sites

I Györke, S Györke.   Biophysical Journal 01/1999; 75(6):2801-10. · 3.65 Impact factor  http:// www.researchgate.net/publication/13459335/Regulation_of_the_cardiac_ryanodine_receptor_channel_by_luminal_Ca2_involves_luminal_Ca2_sensing_sites The mechanism of activation of the cardiac calcium release channel/ryanodine receptor (RyR) by luminal Ca(2+) was investigated in native canine cardiac RyRs incorporated into lipid bilayers in the presence of 0.01 microM to 2 mM Ca(2+) (free) and 3 mM ATP (total) on the cytosolic (cis) side and 20 microM to 20 mM Ca(2+) on the luminal (trans) side of the channel and with Cs+ as the charge carrier. Under conditions of low [trans Ca(2+)] (20 microM), increasing [cis Ca(2+)] from 0.1 to 10 microM caused a gradual increase in channel open probability (Po). Elevating [cis Ca(2+)] [cytosolic] above 100 microM resulted in a gradual decrease in Po. Elevating trans [Ca(2+)] [luminal] enhanced channel activity (EC50 approximately 2.5 mM at 1 microM cis Ca2+) primarily by increasing the frequency of channel openings. The dependency of Po on trans [Ca2+] [luminal] was similar at negative and positive holding potentials and was not influenced by high cytosolic concentrations of the fast Ca(2+) chelator, 1,2-bis(2-aminophenoxy)ethane-N,N,N, N-tetraacetic acid. Elevated luminal Ca(2+)

  1. enhanced the sensitivity of the channel to activating cytosolic Ca(2+), and it
  2. essentially reversed the inhibition of the channel by high cytosolic Ca(2+).

Potentiation of Po by increased luminal Ca(2+) occurred irrespective of whether the electrochemical gradient for Ca(2+) supported a cytosolic-to-luminal or a luminal-to-cytosolic flow of Ca(2+) through the channel. These results rule out the possibility that under our experimental conditions, luminal Ca(2+) acts by interacting with the cytosolic activation site of the channel and suggest that the effects of luminal Ca2+ are mediated by distinct Ca(2+)-sensitive site(s) at the luminal face of the channel or associated protein. F1.large  calcium movement and RyR2 receptor

Protein phosphatases Decrease Sarcoplasmic Reticulum Calcium Content by Stimulating Calcium Release in Cardiac Myocytes

D Terentyev, S Viatchenko-Karpinski, I Gyorke, R Terentyeva and S Gyorke Texas Tech University Health Sciences Center, Lubbock, TX J Physiol 2003; 552(1), pp. 109–118.  http://dx.doi.org/10.1113/jphysiol.2003.046367 Phosphorylation/dephosphorylation of Ca2+ transport proteins by cellular kinases and phosphatases plays an important role in regulation of cardiac excitation–contraction coupling; furthermore,

  • abnormal protein kinase and phosphatase activities have been implicated in heart failure.

However, the precise mechanisms of action of these enzymes on intracellular Ca2+ handling in normal and diseased hearts remains poorly understood. We have investigated

  •   the effects of protein phosphatases PP1 and PP2A on spontaneous Ca(2+) sparks and SR Ca(2+) load in myocytes permeabilized with saponin.

Exposure of myocytes to PP1 or PP2A caused a dramatic increase in frequency of Ca(2+) sparks followed by a nearly complete disappearance of events, which were accompanied by depletion of the SR Ca(2+) stores, as determined by application of caffeine. These changes in

  •  Ca(2+) release and
  • SR Ca(2+) load

could be prevented by the inhibitors of PP1 and PP2A phosphatase activities okadaic acid and calyculin A. At the single channel level, PP1 increased the open probability of RyRs incorporated into lipid bilayers. PP1-medited RyR dephosphorylation in our permeabilized myocytes preparations was confirmed biochemically by quantitative immunoblotting using a phosphospecific anti-RyR antibody. Our results suggest that

  •  increased intracellular phosphatase activity stimulates
  • RyR mediated SR Ca(2+) release
    • leading to depleted SR Ca(2+) stores in cardiac myocytes.

In heart muscle cells, the process of excitation–contraction (EC) coupling is mediated by

  •  Ca(2+) influx through sarcolemmal L-type Ca(2+) channels
  • activating Ca(2+) release channels (ryanodine receptors, RyRs) in the sarcoplasmic reticulum (SR).

Once activated, the RyR channels allow Ca(2+) to be released from the SR into the cytosol to induce contraction. This mechanism is known as Ca(2+)-induced calcium release (CICR) (Fabiato, 1985; Bers, 2002).  During relaxation, most of the Ca(2+) is resequestered into the SR by the Ca(2+)-ATPase. The amount of Ca(2+) released and the force of contraction depend on

  •  the magnitude of the Ca(2+) trigger signal,
  • the functional state of the RyRs and
  • the amount of Ca(2+) stored in the SR.

F1.large  calcium movement and RyR2 receptor Ca(2+) and contraction calcium release calmodulin + ER Reversible phosphorylation of proteins composing the EC coupling machinery plays an important role in regulation of cardiac contractility (Bers, 2002). Thus, during stimulation of the b-adrenergic pathway, phosphorylation of several target proteins, including

  • the L-type Ca(2+) channels,
  • RyRs and
  • phospholamban,

by protein kinase A (PKA) leads to an overall increase in SR Ca2+ release and contractile force in heart cells (Callewaert et al. 1988, Spurgeon et al. 1990; Hussain & Orchard, 1997; Zhou et al. 1999; Song et al. 2001; Viatchenko-Karpinski & Gyorke, 2001). PKA-dependent phosphorylation of the L-type Ca(2+) channels increases the Ca2+ current (ICa), increasing both

  • the Ca2+ trigger for SR Ca2+ release and
  • the SR Ca(2+) content

(Callewaert et al. 1988; Hussain & Orchard, 1997; Del Principe et al. 2001). Phosphorylation of phospholamban (PLB) relieves the tonic inhibition dephosphorylated PLB exerts on the SR Ca(2+)-ATPase (SERCA) resulting in enhanced SR Ca(2+) accumulation and enlarged Ca(2+) release (Kranias et al. 1985; Simmermann & Jones, 1998). With regard to the RyR, despite clear demonstration of phosphorylation of the channel in biochemical studies (Takasago et al. 1989; Yoshida et al. 1992), the consequences of this reaction to channel function have not been clearly defined. RyR phosphorylation by PKA and Ca(2+)–calmodulin dependent protein kinase (CaMKII) has been reported to increase RyR activity in lipid bilayers (Hain et al. 1995; Marx et al. 2000; Uehara et al. 2002). Moreover, it has been reported that in heart failure (HF), hyperphosphorylation of RyR causes

  •  the release of FK-506 binding protein (FKBP12.6) from the RyR,
    • rendering the channel excessively leaky for Ca(2+) (Marx et al. 2000).

However, other studies have reported no functional effects (Li et al. 2002) or even found phosphorylation to reduce RyR channel steady-state open probability (Valdivia et al. 1995; Lokuta et al. 1995).  The action of protein kinases is opposed by dephosphorylating phosphatases. Three types of protein phosphatases (PPs), referred to as PP1, PP2A and PP2B (calcineurin), have been shown to influence cardiac performance (Neumann et al. 1993; Rusnak & Mertz, 2000). Overall, according to most studies phosphatases appear to downregulate SR Ca(2+) release and contractile performance (Neumann et al. 1993; duBell et al. 1996, 2002; Carr et al. 2002; Santana et al. 2002). Furthermore, PP1 and PP2A activities appear to be increased in heart failure (Neumann, 2002; Carr et al. 2002). However, again the precise mode of action of these enzymes on intracellular Ca(2+) handling in normal and diseased hearts remains poorly understood.  In the present study, we have investigated the effects of protein phosphatases PP1 and PP2A on local Ca(2+) release events, Ca(2+) sparks, in cardiac cells. Our results show that

  •  phosphatases activate RyR mediated SR Ca(2+) release
    • leading to depletion of SR Ca(2+) stores.

These results provide novel insights into the mechanisms and potential role of protein phosphorylation/dephosphorylation in regulation of Ca(2+) signaling in normal and diseased hearts. F2.large   RyR and calcium

RESULTS

Effects of PP1 and PP2A on Ca2+ sparks and SR Ca(2+) content.

[1]  PP1 caused an early transient potentiation of Ca2+ spark frequency followed by a delayed inhibition of event occurrence. [2]  PP1 produced similar biphasic effects on the magnitude and spatio-temporal characteristics of Ca(2+) sparks Specifically, during the potentiatory phase (1 min after addition of the enzyme), PP1 significantly increased

  • the amplitude,
  • rise-time,
  • duration and
  • width of Ca(2+) sparks;

during the inhibitory phase (5 min after addition of the enzyme),

  •  all these parameters were significantly suppressed by PP1.

The SR Ca(2+) content decreased by 35 % or 69 % following the exposure of myocytes to either 0.5 or 2Uml_1 PP1, respectively (Fig. 1C). Qualitatively similar results were obtained with phosphatase PP2A. Similar to the effects of PP1, PP2A (5Uml_1) produced a transient increase in Ca(2+) spark frequency (~4-fold) followed by a depression of event occurrence and decreased SR Ca(2+) content (by 82 % and 65 %, respectively). Also similar to the action of PP1, PP2A increased

  •  the amplitude and
  • spatio-temporal spread (i.e. rise-time, duration and width) of Ca(2+) sparks at 1 min
  • and suppressed the same parameters at 5 min of exposure to the enzyme (Table 1).

Together, these results suggest that phosphatases enhance spark-mediated SR Ca2+ release, leading to decreased SR Ca(2+) content. Preventive effects of calyculin A and okadaic acid Preventive effects of ryanodine

PP1-mediated RyR dephosphorylation

F3.large  cardiomyocyte SR F3.large  cardiomyocyte SR F2.large   RyR and calcium coupled receptors coupled receptors The cardiac RyR is phosphorylated at Ser-2809 (in the rabbit sequence) by both PKA and CAMKII (Witcher et al. 1991; Marx et al. 2000). Although additional phosphorylation sites may exist on the RyR (Rodriguez et al. 2003), but Ser-2809 is believed to be the only site that is phosphorylated by PKA, and RyR hyperphosphorylation at this site has been reported in heart failure (Marx et al. 2000).  To test whether indeed phosphatases dephosphorylated the RyR in our permeabilized myocyte experiments we performed quantitative immunoblotting using an antibody that specifically recognizes the phosphorylated form of the RyR at Ser-2809 (Rodriguez et al. 2003). Myocytes exhibited a significant level of phosphorylation under baseline conditions. Maximal phosphorylation was 201 % of control. When exposed to 2Uml_1 PP1, RyR phosphorylation was 58 % of the control basal condition. Exposing to a higher PP1 concentration (10Uml_1) further reduced RyR phosphorylation to 22% of control. Thus, consistent with the results of our functional measurements,

  •  PP1 decreased RyR phosphorylation in cardiac myocytes.

Figure 1. Effects of PP1 on properties of Ca(2+) sparks and SR Ca(2+) content in rat permeabilized myocytes    see .  http://dx.doi.org/10.1113/jphysiol.2003.046367 A, spontaneous Ca(2+) spark images recorded under reference conditions, and 1 or 5 min after exposure of the cell to 2Uml_1 PP1. Traces below the images are Ca(2+) transients induced by application of 10 mM caffeine immediately following the acquisition of sparks before (3 min) and after (5 min) application of PP1 in the same cell. The Ca(2+) transients were elicited by a whole bath application of 10 mM caffeine. B, averaged spark frequency at early (1 min) and late (5 min) times following the addition of either 0.5 or 2Uml_1 of PP1 to the bathing solution. C, averaged SR Ca(2+) content for 0.5 or 2Uml_1 of PP1 measured before and 5 min after exposure to the enzyme. Data are presented as means ± S.E.M. of 6 experiments in different cells. Figure 2. Effects of PP2A on properties of Ca2+ sparks and SR Ca2+ content in rat permeabilized myocytes   see .  http://dx.doi.org/10.1113/jphysiol.2003.046367 A, spontaneous Ca(2+) spark images recorded under reference conditions, and 1 or 5 min after exposure of the cell to 5Uml_1 PP2A. Traces below the images are Ca(2+) transients induced by application of 10 mM caffeine immediately following the acquisition of sparks before (3 min) and after (5 min) application of PP2A in the same cell. B and C, averaged spark frequency (B) and SR Ca(2+) content (C) for the same conditions as in A. Data are presented as means ± S.E.M. of 6 experiments in different cells.

 DISCUSSION

In the present study, we have investigated the impact of physiologically relevant exogenous protein phosphatases PP1 and PP2A on RyR-mediated SR Ca(2+) release (measured as Ca(2+) sparks) in permeabilized heart cells. Our principal finding is that

  • phosphatases stimulated RyR channels lead to depleted SR Ca(2+) stores.

These results have important ramifications for understanding the mechanisms and role of protein phosphorylation/dephosphorylation in

  •  modulation of Ca(2+) handling in normal and diseased heart.

Modulation of SR Ca2+ release by protein phosphorylation/dephophorylation

Since protein dephosphorylation clearly resulted in increased functional activity of the Ca(+)release channel, our results imply that a reverse, phosphorylation reaction should reduce RyR activity. If indeed such effects take place, why do they not manifest in inhibition of Ca(+)sparks? One possibility is that enhanced Ca(+) uptake by SERCA

  •  masks or overcomes the effects phosphorylation may have on RyRs.

In addition, the potential inhibitory influence of protein phosphorylation on RyR activity in myocytes could be countered by feedback mechanisms  involving changes in luminal Ca(2+)(Trafford et al. 2002; Gyorke et al. 2002). In particular, reduced open probability of RyRs would be expected to lead to

  •  increased Ca2+ accumulation in the SR;
  • and increased intra-SR [Ca(2+)], in turn would
  • increase activity of RyRs at their luminal Ca(2+) regulatory sites

as demonstrated for the RyR channel inhibitor tetracaine (Gyorke et al. 1997; Overend et al. 1997). Thus

  • potentiation of SERCA
  • combined with the intrinsic capacity of the release mechanism to self-regulate

could explain at least in part why PKA-mediated protein phoshorylation results in maintained potentiation of Ca(2+) sparks despite a potential initial decrease in RyR activity.

Role of altered RyR Phosphorylation in Heart Failure

Marx et al. (2000) have proposed that  enhanced levels of circulating catecholamines lead to increased phosphorylation of RyR in heart failure.  Based on biochemical observations as well as on studying properties of single RyRs incorporated into artificial lipid bilayers, these investigators have hypothesized that

  •  hyperphosphorylation of RyRs contributes to pathogenesis of heart failure
    • by making the channel excessively leaky due to dissociation of FKBP12.6 from the channel.

We show that the mode of modulation of RyRs by phosphatases does not support this hypothesis as

  • dephosphorylation caused activation instead of

Interestingly, our results provide the basis for a different possibility in which

  •  dephophosphorylation of RyR rather than its phosphorylation causes depletion of SR Ca(2+) stores by stimulating RyRs in failing hearts.

It has been reported that PP1 and PP2 activities are increased in heart failure (Huang et al. 1999; Neumann et al. 1997; Neuman, 2002). Furthermore,  overexpression of PP1 or ablation of the endogenous PP1 inhibitor, l-1, results in

  • depressed contractile performance and heart failure (Carr et al. 2002).

Our finding that PP1 causes depletion of SR Ca(2+) stores by activating RyRs could account for, or contribute to, these results.

References

1 DelPrincipe F, Egger M, Pignier C & Niggli E (2001). Enhanced E-C coupling efficiency after beta-stimulation of cardiac myocytes. Biophys J 80, 64a. 2 Gyorke I & Gyorke S (1998). Regulation of the cardiac ryanodine receptor channel by luminal Ca2+ involves luminal Ca2+ sensing sites. Biophys J 75, 2801–2810. 3 Gyorke S, Gyorke I, Lukyanenko V, Terentyev D, Viatchenko-Karpinski S & Wiesner TF (2002). Regulation of sarcoplasmic reticulum calcium release by luminal calcium in cardiac muscle. Front Biosci 7, d1454–d1463. 4 Gyorke I, Lukyanenko V & Gyorke S (1997). Dual effects of tetracaine on spontaneous calcium release in rat ventricular myocytes. J Physiol 500, 297–309. 5 MacDougall LK, Jones LR & Cohen P (1991). Identification of the major protein phosphatases in mammalian cardiac muscle which dephosphorylate phospholamban. Eur J Biochem 196, 725–734. 6 Marx SO, Reiken S, Hisamatsu Y, Jayaraman T, Burkhoff D, Rosemblit N & Marks AR (2000). PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts. Cell 101, 365–376. 7 Rodriguez P, Bhogal MS & Colyer J (2003). Stoichiometric phosphorylation of cardiac ryanodine receptor on serine-2809 by calmodulin-dependent kinase II and protein kinase A. J Biol Chem (in press).

The δC Isoform of CaMKII Is Activated in Cardiac Hypertrophy and Induces Dilated Cardiomyopathy and Heart Failure

T Zhang, LS Maier, ND Dalton, S Miyamoto, J Ross, DM Bers, JH Brown.  University of California, San Diego, La Jolla, Calif; and Loyola University, Chicago, Ill. Circ Res. 2003;92:912-919.    http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5 Recent studies have demonstrated that transgenic (TG) expression of either Ca(2+)/calmodulin-dependent protein kinase IV (CaMKIV) or CaMKIIδB, both of which localize to the nucleus, induces cardiac hypertrophy. However,

  •  CaMKIV is not present in heart, and
  • cardiomyocytes express not only the nuclear CaMKIIδB
    • but also a cytoplasmic isoform, CaMKII δC.

In the present study, we demonstrate that

  1.  expression of the δC isoform of CaMKII is selectively increased and
  2. its phosphorylation elevated as early as 2 days and continuously for up to 7 days after pressure overload.

To determine whether enhanced activity of this cytoplasmic δC isoform of CaMKII can lead to phosphorylation of Ca(2+) regulatory proteins and induce hypertrophy, we generated TG mice that expressed the δC isoform of CaMKII.  Immunocytochemical staining demonstrated that the expressed transgene is confined to the cytoplasm of cardiomyocytes isolated from these mice. These mice develop a dilated cardiomyopathy with up to a 65% decrease in fractional shortening and die prematurely. Isolated myocytes are enlarged and exhibit reduced contractility and altered Ca2(2+) handling. Phosphorylation of the ryanodine receptor (RyR) at a CaMKII site is increased even before development of heart failure, and

  • CaMKII is found associated with the RyR  from the CaMKII TG mice.
  • Phosphorylation of phospholamban is increased specifically at the CaMKII but not at the PKA phosphorylation site.

These findings are the first to demonstrate that CaMKIIδC can mediate phosphorylation of Ca(2+) regulatory proteins in vivo and provide evidence for the involvement of CaMKIIδC activation in the pathogenesis of dilated cardiomyopathy and heart failure.  Multifunctional Ca(2+)/calmodulin-dependent protein kinases (CaM kinases or CaMKs) are transducers of Ca2+ signals that phosphorylate a wide range of substrates and thereby affect Ca(2+)-mediated cellular responses.1 The family includes CaMKI and CaMKIV, monomeric enzymes activated by CaM kinase kinase,2,3 and CaMKII, a multimer of 6 to 12 subunits activated by autophosphorylation.1 The CaMKII subunits α, β, γ, and δ show different tissue distributions,1 with

  • the δ isoform predominating in the heart.4–7
  • Splice variants of the δ isoform, characterized by the presence of a second variable domain,4,7 include δB, which contains a nuclear localization signal (NLS), and
  • δC, which does not. CaMKII composed of δB subunits localizes to the nucleus, whereas CaMKIIδC localizes to the cytoplasm.4,8,9

CaMKII has been implicated in several key aspects of acute cellular Ca(2+) regulation related to cardiac excitation-contraction (E-C) coupling. CaMKII

  • phosphorylates sarcoplasmic reticulum (SR) proteins including the ryanodine receptors (RyR2) and
  • phospholamban (PLB).10–14

Phosphorylation of RyR has been suggested to alter the channel open probability,14,15 whereas phosphorylation of PLB has been suggested to regulate SR Ca(2+) uptake.14 It is also likely that CaMKII phosphorylates the L-type Ca(2+) channel complex or an associated regulatory protein and thus

  1. mediates Ca(2+) current (ICa) facilitation.16-18 and
  2. the development of early after-depolarizations and arrhythmias.19

Thus, CaMKII has significant effects on E-C coupling and cellular Ca(2 +) regulation. Nothing is known about the CaMKII isoforms regulating these responses.  Contractile dysfunction develops with hypertrophy, characterizes heart failure, and is associated with changes in cardiomyocyte (Ca2+) homeostasis.20  CaMKII expression and activity are altered in the myocardium of rat models of hypertensive cardiac hypertrophy21,22 and heart failure,23 and

  • in cardiac tissue from patients with dilated cardiomyopathy.24,25

Several transgenic mouse models have confirmed a role for CaMK in the development of cardiac hypertrophy, as originally suggested by studies in isolated neonatal rat ventricular myocytes.9,26–28 Hypertrophy develops in transgenic mice that overexpress CaMKIV,27 but this isoform is not detectable in the heart,4,29 and CaMKIV knockout mice still develop hypertrophy after transverse aortic constriction (TAC).29  Transgenic mice overexpressing calmodulin developed severe cardiac hypertrophy,30 later shown to be associated with an increase in activated CaMKII31; the isoform of CaMKII involved in hypertrophy could not be determined from these studies. We recently reported that transgenic mice that overexpress CaMKIIδB, which is highly concentrated in cardiomyocyte nuclei, develop hypertrophy and dilated cardiomyopathy.32 To determine whether

  • in vivo expression of the cytoplasmic CaMKIIδC can phosphorylate cytoplasmic Ca(2+) regulatory proteins and
  • induce hypertrophy or heart failure,

we generated transgenic (TG) mice that expressed the δC isoform of CaMKII under the control of the cardiac specific α-myosin heavy chain (MHC) promoter. Our findings implicate CaMKIIδC in the pathogenesis of dilated cardiomyopathy and heart failure and suggest that

  • this occurs at least in part via alterations in Ca(2+) handling proteins.33

Ca(2+) and contraction RyR yuan_image3  Ca++ exchange yuan_image3  Ca++ exchange

Results

 Expression and Activation of CaMKIIδC Isoform After TAC

To determine whether CaMKII was regulated in pressure overload–induced hypertrophy, CaMKIIδ expression and phosphorylation were examined by Western blot analysis using left ventricular samples obtained at various times after TAC.  A selective increase (1.6-fold) in the lower band of CaMKIIδwas observed as early as 1 day and continuously for 4 days (2.3-fold) and 7 days (2-fold) after TAC (Figure 1A).  To confirm that CaMKIIδC was increased and determine whether this occurred at the transcriptional level, we performed semiquantitative RT-PCR using primers specific for the CaMKIIδC isoform. These experiments revealed that

  • mRNA levels for CaMKIIδC were increased 1 to 7 days after TAC (Figure 1B).

In addition to examining CaMKII expression, the activation state of CaMKII was monitored by its autophosphorylation, which confers Ca2-independent activity.

Figure 1. Expression and activation of CaMKII δC isoform after TAC.

see http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5 A, Western blot analysis of total CaMKII in left ventricular (LV) homogenates obtained at indicated times after TAC. Cardiomyocytes transfected with CaMKIIδB and δC (right) served as positive controls and molecular markers. Top band (58 kDa) represents CaMKIIδB plus δ9, and the bottom band (56 kDa) corresponds to CaMKIIδC. *P0.05 vs control. B, Semiquantitative RT-PCR using primers specific for CaMKIIδC isoform (24 cycles) and GAPDH (19 cycles) using total RNA isolated from the same LV samples. C, Western blot analysis of phospho-CaMKII in LV homogenates obtained at various times after TAC. Three bands seen for each sample represent CaMKIIγ subunit (uppermost), CaMKIIδB plus δ9 (58 kDa), and CaMKIIδC (56 kDa). Quantitation is based on the sum of all of the bands. *P0.05 vs control.

 Figure 2. Expression and activation of CaMKII in CaMKIIδC transgenic mice.

see  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5 A, Transgene copy number based on Southern blots using genomic DNA isolated from mouse tails (digested with EcoRI). Probe (a 32P-labeled 1.7-kb EcoRI-SalI -MHC fragment) was hybridized to a 2.3-kb endogenous fragment (En) and a 3.9-kb transgenic fragment (TG). Transgene copy number was determined from the ratio of the 3.9-kb/2.3-kb multiplied by 2. B, Immunocytochemical staining of ventricular myocytes isolated from WT and CaMKIIδTG mice. Myocytes were cultured on laminin-coated slides overnight. Transgene was detected by indirect immunofluorescence staining using rabbit anti-HA antibody (1:100 dilution) followed by FITC-conjugated goat antirabbit IgG antibody (1:100 dilution). CaMKIIδB localization to the nucleus in CaMKIIδB TG mice (see Reference 32) is shown here for comparative purpose. C, Quantitation of the fold increase in CaMKIIδprotein expression in TGL and TGM lines. Different amounts of ventricular protein (numbers) from WT control, TG () and their littermates () were immunoblotted with an anti-CaMKIIδ antibody. Standard curve from the WT control was used to calculate fold increases in protein expression in TGL and TGM lines. D, Phosphorylated CaMKII in ventricular homogenates was measured by Western blot analysis (n5 for each group). **P0.01 vs WT.

 Generation and Identification of CaMKIIδC Transgenic Mice

TG mice expressing HA-tagged rat wild-type CaMKIIδC under the control of the cardiac-specific α-MHC promoter were generated as described in Materials and Methods. By Southern blot analysis, 3 independent TG founder lines carrying 3, 5, and 15 copies of the transgene were identified. They were designated as TGL (low copy number), TGM (medium copy number), and TGH (high copy number), The founder mice from the TGH line died at 5 weeks of age with marked cardiac enlargement.  The other two lines showed germline transmission of the transgene. The transgene was expressed only in the heart. Although CaMKII protein levels in TGL and TGM hearts were increased 12- and 17-fold over wild-type (WT) controls (Figure 2C), the amount of activated CaMKII was only increased 1.7- and 3-fold in TGL and TGM hearts (Figure 2D). The relatively small increase in CaMKII activity in the TG lines probably reflects the fact that the enzyme is not constitutively activated and that the availability of Ca2/CaM, necessary for activation of the overexpressed CaMKII, is limited. Importantly,

  • the extent of increase in active CaMKII in the TG lines was similar to that elicited by TAC.

 Cardiac Overexpression of CaMKIIδC Induces Cardiac Hypertrophy and Dilated Cardiomyopathy

There was significant enlargement of hearts from CaMKIIδC TGM mice by 8 to 10 weeks [see  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5%5D  (Figure 3A) and from TGL mice by 12 to 16 weeks. Histological analysis showed ventricular dilation (Figure 3B), cardiomyocyte enlargement (Figure 3C), and mild fibrosis (Figure 3D) in CaMKIIδC TG mice. Quantitative analysis of cardiomyocyte cell volume from 12-week-old TGM mice gave values of 54.7 + 0.1 pL for TGM (n = 96) versus 28.6 + 0.1 pL for WT littermates (n=94; P0.001). Ventricular dilation and cardiac dysfunction developed over time in proportion to the extent of transgene expression. Left ventricular end diastolic diameter (LVEDD) was increased by 35% to 45%, left ventricular posterior wall thickness (LVPW) decreased by 26% to 29% and fractional shortening decreased by 50% to 60% at 8 weeks for TGM and at 16 weeks for TGL. None of these parameters were significantly altered at 4 weeks in TGM or up to 11 weeks in TGL mice, indicating that heart failure had not yet developed.  Contractile function was significantly decreased. Figure 6. Dilated cardiomyopathy and dysfunction in CaMKIIδC TG mice at both whole heart and single cell levels.  [see Fig 6:  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5] C, Decreased contractile function in ventricular myocytes isolated from 12-week old TGM and WT controls presented as percent change of resting cell length (RCL) stimulated at 0.5 Hz. Representative trace and mean values are shown. *P0.05 vs WT. Figure 7. Phosphorylation of PLB in CaMKIIδC TG mice.  [see Fig 7: http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5] Thr17 and Ser16 phosphorylated PLB was measured by Western blots using specific anti-phospho antibodies. Ventricular homogenates were from 12- to 14-week-old WT and TGM mice (A) or 4 to 5-week-old WT and TGM mice (B). Data were normalized to total PLB examined by Western blots (data not shown here). n = 6 to 8 mice per group; *P0.05 vs WT.

 Cardiac Overexpression of CaMKIIδC Results in Changes in the Phosphorylation of Ca2 Handling Proteins

To assess the possible involvement of phosphorylation of Ca2cycling proteins in the phenotypic changes observed in the CaMKIIC TG mice, we first compared PLB phosphorylation state in homogenates from 12- to 14-week-old TGM and WT littermates. Western blots using antibodies specific for phosphorylated PLB showed a 2.3-fold increase in phosphorylation of Thr17 (the CaMKII site) in hearts from TGM versus WT (Figure 7A). Phosphorylation of PLB at the CaMKII site was also increased 2-fold in 4- to 5-week-old TGM mice (Figure 7B). Significantly, phosphorylation of the PKA site (Ser16) was unchanged in either the older or the younger TGM mice (Figures 7A and 7B). (see  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5)  To demonstrate that the RyR2 phosphorylation changes observed in the CaMKII transgenic mice are not secondary to development of heart failure, we performed biochemical studies examining RyR2 phosphorylation in 4- to 5-week-old TGM mice. At this age, most mice showed no signs of hypertrophy or heart failure (see Figure 6B) and there was no significant increase in myocyte size (21.3 + 1.3 versus 27.7 + 4.6 pL; P0.14). Also, twitch Ca2 transient amplitude was not yet significantly depressed, and mean δ [Ca2+]i (1 Hz) was only 20% lower (192 + 36 versus 156 + 13 nmol/L; P0.47) versus 50% lower in TGM at 13 weeks.33  The in vivo phosphorylation of RyR2, determined by back phosphorylation, was significantly (2.10.3-fold; P0.05) increased in these 4- to 5-week-old TGM animals (Figure 8C), an increase equivalent to that seen in 12- to 14-week-old mice. We also performed the RyR2 back-phosphorylation assay using purified CaMKII rather than PKA. RyR2 phosphorylation at the CaMKII site was also significantly increased (2.2 + 0.3-fold; P0.05) in 4- to 5-week-old TGM mice (Figure 8C).  (http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5) The association of CaMKII with the RyR2 is consistent with a physical interaction between this protein kinase and its substrate. The catalytic subunit of PKA and the phosphatases PP1 and PP2A were also present in the RyR2 immunoprecipitates, but not different in WT versus TG mouse hearts (Figure 8D). These data provide further evidence that

  • the increase in RyR2 phosphorylation, which precedes development of failure in the 4- to 5-week-old CaMKIIδC TG hearts, can be attributed to the increased activity of CaMKII.

 Discussion

  1. CaMKII is involved in the dynamic modulation of cellular
  2. Ca2 regulation and has been implicated in the development of cardiac hypertrophy and heart failure.14
  3. Published data from CaMK-expressing TG mice demonstrate that forced expression of CaMK can induce cardiac hypertrophy and lead to heart failure.27,32

However, the CaMK genes expressed in these mice are neither the endogenous isoforms of the enzyme nor the isoforms likely to regulate cytoplasmic Ca(2+) handling, because they localize to the nucleus.

  1.  the cytoplasmic cardiac isoform of CaMKII is upregulated at the expression level and is in the active state (based on autophosphorylation) after pressure overload induced by TAC.
  2.  two cytoplasmic CaMKII substrates (PLB and RyR) are phosphorylated in vivo when CaMKII is overexpressed and its activity increased to an extent seen under pathophysiological conditions.
  3. CaMKIIδ is found to associate physically with the RyR in the heart.
  4.  heart failure can result from activation of the cytoplasmic form of CaMKII and this may be due to altered Ca(2+) handling.

 Differential Regulation of CaMKIIδ Isoforms in Cardiac Hypertrophy

  1.  The isoform of CaMKII that predominates in the heart is the δ isoform.4–7 Neither the α nor the β isoforms are expressed and there is only a low level of expression of the γ isoforms.39
  2. Both δB and δC splice variants of CaMKIIδ are present in the adult mammalian myocardium36,40 and expressed in distinct cellular compartments.4,8,9

We suggest that the CaMKIIδ isoforms are differentially regulated in pressure-overload–induced hypertrophy, because the expression of CaMKIIδC is selectively increased as early as 1 day after TAC. Studies using RT-PCR confirm that

  • CaMKIIδC is regulated at the transcriptional level in response to TAC. In addition,
  • activation of both CaMKIIδB and CaMKIIδC, as indexed by autophosphorylation, increases as early as 2 days after TAC.
  • Activation of CaMKIIδB by TAC is relevant to our previous work indicating its role in hypertrophy.9,32
  • The increased expression, as well as activation of the CaMKIIδC isoform, suggests that it could also play a critical role in both the acute and longer responses to pressure overload.

In conclusion, we demonstrate here that CaMKIIδC can phosphorylate RyR2 and PLB when expressed in vivo at levels leading to 2- to 3-fold increases in its activity. Similar increases in CaMKII activity occur with TAC or in heart failure. Data presented in this study and in the accompanying article33 suggest that altered phosphorylation of Ca(2+) cycling proteins is a major component of the observed decrease in contractile function in CaMKIIδC TG mice. The occurrence of increased CaMKII activity after TAC, and of RyR and PLB phosphorylation in the CaMKIIδC TG mice suggest that

  • CaMKIIδC plays an important role in the pathogenesis of dilated cardiomyopathy and heart failure.

These results have major implications for considering CaMKII and its isoforms in exploring new treatment strategies for heart failure.

Cardiac Electrophysiological Dynamics From the Cellular Level to the Organ Level

Daisuke Sato and Colleen E. Clancy Department of Pharmacology, University of California – Davis, Davis, CA. Biomedical Engineering and Computational Biology 2013:5: 69–75 http://www.la-press.com.   http://dx.doi.org/10.4137/BECB.S10960 Abstract: Cardiac alternans describes contraction of the ventricles in a strong-weak-strong-weak sequence at a constant pacing fre­quency. Clinically, alternans manifests as alternation of the T-wave on the ECG and predisposes individuals to arrhythmia and sudden cardiac death. In this review, we focus on the fundamental dynamical mechanisms of alternans and show how alternans at the cellular level underlies alternans in the tissue and on the ECG. A clear picture of dynamical mechanisms underlying alternans is important to allow development of effective anti-arrhythmic strategies. The cardiac action potential is the single cellular level electrical signal that triggers contraction of the heart.1 Under normal conditions, the originating activation signal comes from a small bundle of tissue in the right atrium called the sinoatrial node (SAN). The action potentials generated by the SAN initiate an excitatory wave that, in healthy tissue, propagates smoothly through a well-defined path and causes excitation and contraction in the ventricles. In disease states, the normal excitation pathway is disrupted and a variety of abnormal rhythms can occur, including cardiac alternans, a well-known precursor to sudden cardiac death. Cardiac alternans was initially documented in 1872 by a German physician, Ludwig Traube.2 He observed contraction of the ventricles in a strong-weak-strong-weak sequence even though the pacing frequency was constant. Clinically, alternans mani­fests as alternation of the T-wave on the ECG, typi­cally in the microvolt range. It is well established that individuals with microvolt T-wave alternans are at much higher risk for arrhythmia and sudden cardiac death. A clear picture of physio­logical mechanisms underlying alternans is important to allow development of effective anti-arrhythmic drugs. It is also important to understand dynamical mechanisms because while the cardiac action poten­tial is composed of multiple currents, each of which confers specific properties, revelation of dynamical mechanisms provides a unified fundamental view of the emergent phenomena that holds independently of specific current interactions. The ventricular myocyte is an excitable cell pro­viding the cellular level electrical activity that under­lies cardiac contraction. Under resting conditions, the membrane potential is about -80 mV. When the cell is stimulated, sodium (Na) channels open and the membrane potential goes above 0 mV. Then, a few ms later, the inward current L-type calcium (Ca) current activates and maintains depolarization of the mem­brane potential. During this action potential plateau, several types of outward current potassium (K) chan­nels also activate. Depending on the balance between inward and outward currents, the action potential duration (APD) is determined.The diastolic interval (DI) that follows cellular repolarization describes the duration the cell resides in the resting state until the next excitation. During the DI, channels recover with kinetics determined by intrinsic time constants. APD restitution defines the relationship between the APD and the previous DI (Fig. 1 top panel). In most cases1, the APD becomes longer as the previous DI becomes longer due to recovery of the L-type Ca channel (Fig. 1, bottom panel), and thus the APD restitution curve has a positive slope. Figure 1. (Top): APD and DI. (Bottom): The physiological mechanism of APD alternans involves recovery from inactivation of ICaL.  [see  http://dx.doi.org/10.4137/BECB.S10960]

 Action Potential Duration Restitution

In 1968 Nolasco and Dahlen showed graphically that APD alternans occurs when the slope of the APD res­titution curve exceeds unity. Why is the steepness of the slope important? As shown graphically in Figure 2, APD alternans amplitude is multiplied by the slope of the APD restitution curve in each cycle. When the slope is larger than one, then the alternans amplitude will be amplified until the average slope reaches 1 or the cell shows a 2:1 stimulus to response ratio.  The one-dimensional mapping between APD and DI fails to explain quasi-periodic oscillation of the APD. Figure 2. APD restitution and dynamical mechanism of APD alternans.   [see  http://dx.doi.org/10.4137/BECB.S10960]

Calcium Driven Alternans

A strong-weak-strong-weak oscillation in contrac­tion implies that the Ca transient (CaT) is alternating. Until 1999 it was assumed that if the APD is alternat­ing then the CaT alternates because the CaT follows APD changes. However, Chudin et al showed that CaT can alternate even when APD is kept constant during pacing with a periodic AP clamp waveform.14 This implies that the intracellular Ca cycling has intrinsic nonlinear dynamics. A critical component in this process is the sarcoplasmic reticulum (SR), a subcellular organelle that stores Ca inside the cell. When Ca enters a cell through the L-type Ca channel (or reverse mode Na-Ca exchanger (NCX) ryanodine receptors open and large Ca releases occur from the SR (Ca induced Ca release). The amount of Ca release steeply depends on SR Ca load. This steep relation between Ca release and SR Ca load is the key to induce CaT alternans.  A one-dimensional map between Ca release and SR calcium load can be constructed to describe the relationship21 similar to the map used in APD restitution.

 Subcellular Alternans

A number of experimental and computational stud­ies have been undertaken to identify molecular mechanisms of CaT alternans by identifying the specific components in the calcium cycling process critical to formation of CaT alternans. These compo­nents include SR Ca leak and load, Ca spark frequency and amplitude, and rate of SR refilling. For example, experiments have shown that alternation in diastolic SR Ca is not required for CaT alternans.24 In addition, stochastic openings of ryanodine receptors (RyR) lead to Ca sparks that occur randomly, not in an alternating sequence that would be expected to underlie Ca altern-ans. So, how do local random sparks and constant dia­stolic SR calcium load lead to global CaT alternans? Mathematical models with detailed representations of subcellular Ca cycling have been developed in order to elucidate the underlying mechanisms. Model­ing studies have shown that even when SR Ca load is not changing, RyRs, which are analogous to ICaL in APD alternans, recover gradually from refractoriness. As RyR availability increases (for example during a long diastolic interval) a single Ca spark from a RyR will be larger in amplitude and recruit neighboring Ca release units to generate more sparks. The large resultant CaT causes depletion of the SR and when complete recovery of RyRs does not occur prior to the arrival of the next stimulus, the subsequent CaT will be small. This process results in an alternans of CaT amplitude from beat-to-beat.

 Coupling Between the Membrane Potential and Subcellular Calcium Dynamics

Importantly, the membrane voltage and intracellu­lar Ca cycling are coupled via Ca sensitive channels such as the L-type Ca channel and the sodium-calcium exchanger (NCX). The membrane voltage dynamics and the intracellular Ca dynamics are bi-directionally coupled. One direction is from voltage to Ca. As the DI becomes longer, the CaT usually becomes larger since the recovery time for the L-type Ca channel in increased and the SR Ca release becomes larger. The other direction is from Ca to voltage. Here we consider two major currents, NCX and ICaL. As the CaT becomes larger, forward mode NCX becomes larger and pro­longs APD. On the other hand, as the CaT becomes larger, ICaL becomes smaller due to Ca-induced inacti­vation, and thus, larger CaT shortens the APD. There­fore, depending on which current dominates, larger CaT can prolong or shorten APD. If a larger CaT pro­longs (shortens) the APD, then the coupling is positive (negative). The coupled dynamics of the membrane voltage and the intracellular Ca cycling can be cate­gorized by the instability of membrane voltage (steep APD restitution), instability of the intracellular Ca cycling (steep relation between Ca release versus SR Ca load), and the coupling (positive or negative). If the coupling is positive, alternans is electromechani­cally concordant (long-short-long-short APD cor­responds to large-small-large-small CaT sequence) regardless of the underlying instability mechanism. On the other hand, if the coupling is negative, alternans is electromechanically concordant in a voltage-driven regime. However, if alternans is Ca driven, alternans becomes electromechanically discordant (long-short-long-short APD corresponds to small-large-small-large CaT sequence). It is also possible to induce quasi- periodic oscillation of APD and CaT when volt­age and Ca instabilities contribute equally.

 Alternans in Higher Dimensions

Tissue level alternans in APD and CaT also occur and here we describe how the dynamical mechanism of alternans at the single cell level determines the phenomena in tissue. Spatially discordant alternans (SDA) where APDs in different regions of tissue alternate out-of-phase, is more arrhythmogenic since it causes large gradients of refractoriness and wave-break, which can initiate ventricular tachycardia and ventricular fibrillation. How is SDA induced? As the APD is a function of the previous DI, con­duction velocity (CV) is also function of the previ­ous DI (CV restitution) since the action potential propagation speed depends on the availability of the sodium channel. As the DI becomes shorter, sodium channels have less time to recover. Therefore, in general, as the DI becomes shorter, the CV becomes slower. When tissue is paced rapidly, action poten­tials propagate slowly near the stimulus, and thenac-celerate downstream as the DI becomes longer. This causes heterogeneity in APD (APD is shorter near the stimulus). During the following tissue excitation, APD becomes longer and the CV becomes faster at the pacing site then gradually APD becomes shorter and the CV becomes slower. The interaction between steep APD restitution and steep CV restitution creates SDA. This mechanism applies only when the cel­lular instability is voltage driven. When the cellular instability is Ca driven, the mechanism of SDA formation is different. If the volt­age-Ca coupling is negative, SDA can form without steep APD and CV restitution. The mechanism can be understood as follows. First, when cells are uncou­pled, alternans of APD and Ca are electromechanically discordant. If two cells are alternating in opposite phases, once these cells are coupled by voltage, due to electrotonic coupling, the membrane voltage of both cells is synchronized and thus APD becomes the same. This synchronization of APD amplifies the difference of CaT between two cells (Fig. 5 in). In other words it desynchronizes CaT. This instability mechanism is also found in subcellular SDA. In the case where the instability is Ca driven and the coupling is positive, there are several interest­ing distinctive phenomena that can occur. First, the profile of SDA of Ca contains a much steeper gra­dient at the node (point in space where no alternans occurs–cells downstream of the node are alternating out of phase with those upstream of the node) com­pared to the case of voltage driven SDA. Thus, the cellular mechanism of instability can be identified by evaluating the steepness of the alternans amplitude gradient in space around the node. When the cellular instability is voltage driven, the steady-state wave­length (separation of nodes in space) depends on electrotonic coupling between cells and the steepness of APD and CV restitution, regardless of the initial conditions. However, if the cellular instability is Ca driven, the location of nodes depends on the pacing history, which includes pacing cycle length and other parameters affected by pacing frequency. In this case, once the node is formed, the location of the node may be fixed, especially when Ca instability is strong. Such an explanation may apply to recent experimen­tal results. Summary In this review, we described how the origin of alternans at the cellular level (voltage driven, Ca drive, coupling between voltage and Ca) affects the formation of spatially discordant alternans at the tissue level. Cardiac alternans is a multi-scale emergent phenomenon. Channel properties determine the instability mechanism at the cellular level. Alternans mechanisms at cellular level determine SDA patterns at the tissue level. In order to understand alternans and develop anti-arrhythmic drug and therapy, multi-scale modeling of the heart is useful, which is increasingly enabled by emerging technologies such as general-purpose computing on graphics processing units (GPGPU) and cloud computing.

English: Diagram of contraction of smooth musc...

English: Diagram of contraction of smooth muscle fiber (Photo credit: Wikipedia)

Schematic representation of Calcium Cycling in Contractile and Proliferating VSMCs receptors voltage gated Ca(2) channel Marks-Wehrens Model and multiphosphorylation  site model ncpcardio0419-f4   calcium leak

Read Full Post »


Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Author: Larry H. Bernstein, MD

Author: Stephen Williams, PhD

and

Curator: Aviva Lev-Ari, PhD, RN

This article is Part II in a series of articles on Calcium and its role in Cell motility

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IX: Calcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

 

This article, constitute, Part II, it is a broad, but not complete review of the emerging discoveries of the critical role of calcium signaling on cell motility and by extension, embryonic development, cancer metastasis, changes in vascular compliance at the junction between the endothelium and the underlying interstitial layer.  The effect of calcium signaling on the heart in arrhtmogenesis and heart failure will be a third in this series, while the binding of calcium to troponin C in the synchronous contraction of the myocardium had been discussed by Dr. Lev-Ari in Part I.

Universal MOTIFs essential to skeletal muscle, smooth muscle, cardiac syncytial muscle, endothelium, neovascularization, atherosclerosis and hypertension, cell division, embryogenesis, and cancer metastasis. The discussion will be presented in several parts:
1.  Biochemical and signaling cascades in cell motility
2.  Extracellular matrix and cell-ECM adhesions
3.  Actin dynamics in cell-cell adhesion
4.  Effect of intracellular Ca++ action on cell motility
5.  Regulation of the cytoskeleton
6.  Role of thymosin in actin-sequestration
7.  T-lymphocyte signaling and the actin cytoskeleton

Part 1.  Biochemical and Signaling Cascades in Cell Motility

BIOCHEMISTRY AND BIOMECHANICS OF CELL MOTILITY

Song Li, Jun-Lin Guan, and Shu Chien
Annu. Rev. Biomed. Eng. 2005. 7:105–50   [doi:10.1146/annurev.bioeng.7.060804.100340]
Cell motility or migration is an essential cellular process for a variety of biological events. In embryonic development, cells migrate to appropriate locations for the morphogenesis of tissues and organs. Cells need to migrate to heal the wound in repairing damaged tissue. Vascular endothelial cells (ECs) migrate to form new capillaries during angiogenesis. White blood cells migrate to the sites of inflammation to kill bacteria. Cancer cell metastasis involves their migration through the blood vessel wall to invade surrounding tissues.

Variety of important roles for cell migration:

1. Embryogenesis
2. Wound healing (secondary extension)
3. Inflammatory infiltrate (chemotaxis)
4. Angiogenesis
5. Cancer metastasis
6. Arterial compliance
7. Myocardial and skeletal muscle contraction
8. Cell division

Portrait of Cell in Migration:

1. protrusion of leading edge
2. Formation of new adhesions at front
3. Cell contraction
4. Release of adhesions at rear
Microenvironmental factor:
1. Concentration gradient of chemoattractants
2. Gradient of immobilized ECM proteins
3. Gradient of matrix rigidity
4. Mechanotaxis
Extracellular signals are sensed by receptors or mechanosensors on cell surface or in cell interior to initiate migration. Actin polymerization is the key event leading to protrusion at the leading edge and new focal adhesions anchor the actin filaments and the cell to the underlying surface.  This is followed by contraction of the actin filaments.  The contraction of actomyosin filaments pulls the elongate body forward and at the same time the tail retracts.

Part 2.  Cell-ECM Adhesions

Cytoskeleton and cell-ECM adhesions are two major molecular machineries involved in mechano-chemical signal transduction during cell migration. Although all three types of cytoskeleton (actin microfilaments, microtubules, and intermediate filaments) contribute to cell motility, actin cytoskeleton plays the central role. The polymerization of actin filaments provides the driving force for the protrusion of the leading edge as lamellipodia (sheet-like protrusions) or filopodia (spike-like protrusions), and actomyosin contraction generates the traction force at (focal adhesions) FAs and induces the retraction at the rear. It is generally accepted that actin filaments interact with the double-headed myosin to generate the force for cell motility and that actomyosin contraction/relaxation involves the modulation of myosin light chain (MLC) phosphorylation.  Rho family GTPases, including Cdc42, Rac, and Rho, are the key regulators of actin polymerization, actomyosin contraction, and cell motility.  Cdc42 activation induces the formation of filopodia; Rac activation induces lamellipodia; and Rho activation increases actin polymerization, stress fiber formation, and actomyosin contractility. All three types of Rho GTPases stimulate new FA formation.
Integrins are the major receptors for ECM proteins. The integrin family includes more than 20  transmembrane heterodimers composed of α and β subunits with noncovalent association. The extracellular domain of integrin binds to specific ligands, e.g., ECM proteins such as fibronectin (FN), vitronectin, collagen, and laminin. The cytoplasmic domain interacts with cytoskeletal proteins (e.g., paxillin, talin, vinculin, and actin) and signaling molecules in the focal adhesion (FA) sites. The unique structural features of integrins enable them to mediate outside-in signaling, in which extracellular stimuli induce the intracellular signaling cascade via integrin activation, and inside-out signaling, in which intracellular signals modulate integrin activation and force generation through FAs.

Part 3. Actin Dynamics in Cell-cell Adhesion

Actin filaments are linked to the focal adhesions (Fas) between cell and ECM through a protein complex that includes talin, vinculin, α-actinin, and filamin. Such a complex couples the actomyosin contractile apparatus to FAs, and plays an important role in the force transmission between ECM and the cell.

3a. Actin dynamics and cell–cell adhesion in epithelia

Valeri Vasioukhin and Elaine Fuchs
Howard Hughes Medical Institute, Department of Molecular Genetics and Cell Biology, The University of Chicago, Chicago, IL
Current Opinion in Cell Biology 2001, 13:76–84
Recent advances in the field of intercellular adhesion highlight the importance of adherens junction association with the underlying actin cytoskeleton. In skin epithelial cells a dynamic feature of adherens junction formation involves filopodia, which physically project into the membrane of adjacent cells, catalyzing the clustering of adherens junction protein complexes at their tips. In turn, actin polymerization is stimulated at the cytoplasmic interface of these complexes. Although the mechanism remains unclear, the VASP/Mena family of proteins seems to be involved in organizing actin polymerization at these sites. In vivo, adherens junction formation appears to rely upon filopodia in processes where epithelial sheets must be physically moved closer to form stable intercellular connections, for example, in ventral closure in embryonic development or wound healing in the postnatal animal.
Located at cell–cell borders, adherens junctions are electron dense transmembrane structures that associate with the actin cytoskeleton. In their absence, the formation of other cell–cell adhesion structures is dramatically reduced. The transmembrane core of adherens junctions consists of cadherins, of which E-cadherin is the epithelial prototype. Its extracellular domain is responsible for homotypic, calcium-dependent, adhesive interactions with E-cadherins on the surface of opposing cells. Its cytoplasmic domain is important for associations with other intracellular proteins involved in the clustering of surface cadherins to form a junctional structure.
The extracellular domain of the transmembrane E-cadherin dimerizes and interacts in a calcium-dependent manner with similar molecules on neighboring cells. The intracellular juxtamembrane part of E-cadherin binds to p120ctn, an armadillo repeat protein capable of modulating E-cadherin clustering. The distal segment of E-cadherin’s cytoplasmic domain can interact with β-catenin or plakoglobin, armadillo repeat proteins which in turn bind to α-catenin. The carboxyl end of α-catenin binds directly to f-actin, and, through a direct mechanism, α-catenin can link the membrane-bound cadherin–catenin complex to the actin cytoskeleton. Additionally, α-catenin can bind to either vinculin or ZO1, and it is required for junctional localization of zyxin. Vinculin and zyxin can recruit VASP (and related family members), which in turn can associate with the actin cytoskeleton, providing the indirect mechanism to link the actin cytoskeleton to adherens junctions. ZO1 is also a member of tight junctions family, providing a means to link these junctions with adherens junctions.
Through a site near its transmembrane domain, cadherins bind directly to the catenin p120ctn, and through a more central site within the cytoplasmic domain, cadherins bind preferentially to β-catenin. Cell migration appears to be promoted by p120ctn through recruiting and activating small GTPases. β-catenin is normally involved in adherens junction formation through its ability to bind to β-catenin and link cadherins to the actin cytoskeleton. However, β-catenin leads a dual life in that it can also act as a transcriptional cofactor when stimulated by the Wnt signal transduction pathway

α-Catenin: More than just a Bridge between Adherens Junctions and the Actin Cytoskeleton

α-catenin was initially discovered as a member of the E-cadherin–catenin complex.  It is related to vinculin, an actin-binding protein that is found at integrin-based focal contacts. The amino-terminal domain of α-catenin is involved in α-catenin/plakoglobin binding and is also important for dimerization. Its central segment can bind to α-actinin and to vinculin, and it partially encompasses the region of the protein necessary for cell adhesion (which is the adhesion-modulation domain; amino acids 509–643). The carboxy-terminal domain of both vinculin and α-catenin is involved in filamentous actin (f-actin) binding, and for α-catenin, this domain is also involved in binding to ZO1.  VH1, VH2 and VH3 are three regions sharing homology to vinculin. The percentage amino acid identity and the numbers correspond to the amino acid residues of the α-catenin polypeptide.
α-catenin is the only catenin that can directly bind to actin filaments , and E-cadherin–catenin complexes do not associate with the actin cytoskeleton after α-catenin is removed by extraction with detergent. Cancer cell lines lacking α-catenin still express E-cadherin and β-catenin, but do not show proper cell–cell adhesion unless the wild-type gene is reintroduced into the cancer cell. This provides strong evidence that clustering of the E-cadherin–catenin complex and cell–cell adhesion requires the presence of α-catenin.
Although intercellular adhesion is dependent upon association of the E-cadherin–β-catenin protein complex with α-catenin and the actin cytoskeleton, it is unclear whether α-catenin’s role goes beyond linking the two structures. Fusion of a nonfunctional tailless E-cadherin (E C71) with α-catenin resulted in a chimeric protein able to confer cell–cell adhesion on mouse fibroblasts in vitro, and generation of additional chimeric proteins enabled delineation of the region of α-catenin that is important for cell aggregation. Not surprisingly, the essential domain of α-catenin was its carboxy-terminal domain (~amino acids 510–906), containing the actin-binding site, which encompasses residues 630–906 of this domain.
The binding of α-catenin to the actin cytoskeleton is required for cell–cell adhesion,  but α-catenin appears to have additional function(s) beyond its ability to link E-cadherin–β-catenin complexes to actin filaments.  The domain encompassing residues 509–643 of α-catenin has been referred to as an adhesion-modulation domain to reflect this added, and as yet unidentified, function.  Besides its association with β-catenin and f-actin, α-catenin binds to a number of additional proteins, some of which are actin binding proteins themselves.  Additionally, the localization of vinculin to cell–cell borders is dependent upon the presence of α-catenin. α-catenin can also bind to the MAGUK (membrane-associated guanylate kinase) family members ZO1 and ZO2.  Thus, the role for α-catenin might not simply be to link E-cadherin–catenin complexes to the actin cytoskeleton but rather to organize a multiprotein complex with multiple actin-binding, bundling and polymerization activities.
The decisive requirement for α-catenin’s actin-binding domain in adherens junction formation underscores the importance of the actin cytoskeleton in intercellular adhesion. Thus, it is perhaps not surprising that the majority of f-actin in epithelial cells localizes to cell–cell junctions.  When epidermal cells are incubated in vitro in culture media with calcium concentrations below 0.08 mM they are unable to form adherens junctions. However, when the calcium concentrations are raised to the levels naturally occurring in skin (1.5–1.8 mM), intercellular adhesion is initiated.
This switch in part promotes a calcium-dependent conformational change in the extracellular domain of E-cadherin that is necessary for homotypic interactions to take place.  It appears that the actin cytoskeleton has a role in facilitating the process that brings opposing membranes together and stabilizing them once junction formation has been initiated. In this regard, the formation of cell–cell adhesion can be divided into two categories:
  • active adhesion, a process that utilizes the actin cytoskeleton to generate the force necessary to bring opposing membranes together, and
  • passive adhesion, a process which may not require actin if the membranes are already closely juxtaposed and stabilized by the deposition of cadherin–catenin complexes.
Upon a switch from low to high calcium, cadherin-mediated intercellular adhesion is activated. Passive adhesion: in cells whose actin cytoskeleton has been largely disrupted by cytochalasin D, cadherin–catenin complexes occur at sites where membranes of neighboring cells directly contact each other. Active adhesion: neighboring cells with functional actin cytoskeletons can draw their membranes together, forming a continuous epithelial sheet.  Upon initial membrane contact, E-cadherin forms punctate aggregates or puncta along regions where opposing membranes are in contact with one another. Each of these puncta is contacted by a bundle of actin filaments that branch off from the cortical belt of actin filaments underlying the cell membrane. At later stages in the process, those segments of the circumferential actin cables that reside along the zone of cell–cell contacts disappear, and the resulting semi-circles of cortical actin align to form a seemingly single circumferential cable around the perimeter of the two cells. At the edges of the zone of cell–cell contact, plaques of E-cadherin–catenin complexes connect the cortical belt of actin to the line of adhesion. At the center of the developing zone of adhesion, E-cadherin puncta associate with small bundles of actin filaments oriented perpendicular to the zone.
Multiple E-cadherin-containing puncta that form along the developing contact rapidly associate with small bundles of actin filaments. As the contact between cells lengthens, puncta continue to develop at a constant average density, with new puncta at the edges of the contact. The segment of the circumferential actin cable that underlies the developing contact gradually ‘dissolves’, and merges into a large cable, encompassing both cells. This is made possible through cable-mediated connections to the E-cadherin plaques at the edges of the contact. As contact propagates, E-cadherin is deposited along the junction as a continuous line. The actin cytoskeleton reorganizes and is now oriented along the cell–cell contact. In primary keratinocytes, two neighboring cells send out filopodia, which, upon contact, slide along each other and project into the opposing cell’s membrane. Filopodia are rich in f-actin. Embedded tips of filopodia are stabilized by puncta, which are transmembrane clusters of adherens junction proteins.
This process draws regions of the two cell surfaces together, which are then clamped by desmosomes. Radial actin fibers reorganize at filopodia tips in a zyxin-, vinculin-, VASP-, and Mena-dependent fashion.  Actin polymerization is initiated at stabilized puncta, creating the directed reverse force needed to push and merge puncta into a single line as new puncta form at the edges. The actin-based movement physically brings remaining regions of opposing membranes together and seals them into epithelial sheets. As filopodia contain actin rather than keratin intermediate filaments, they become natural zones of adherens junctions, whereas the cell surface flanking filopodia becomes fertile ground for desmosome formation, alternating adherens junctions and desmosomes.

Possible Roles of Myosin in Cell–cell Adhesion.

[a] A hypothetical ‘purse string’ model for myosin-driven epithelial sheet closure at a large circular wound site in the cornea of an adult mouse. At the edge of wound site epithelial cables of actin appear to extend from cell to cell, forming a ring around the wound circumference. Contraction of actin cables  driven by myosin can lead to wound closure.
[b] Inside out ‘purse string’ model for contact propagation (compaction) in MDCK cells. During contact formation in MDCK cells, circumferential actin cables contact cadherin–catenin plaques at the edges of the contact. Contraction of actin cables driven by myosin can lead to the contact expansion.

What Regulates the Actin Dynamics that are Important for Cell–cell Adhesion?

The answer to this remains uncertain, but the small GTPases of the Rho family seem to be likely candidates, given that Rho, Rac1 and Cdc42 promote stress fiber, lamellipodia and filopodia formation, respectively.
In vivo mutagenesis studies in Drosophila reveal a role for Rac1 and Rho in dorsal closure and/or in head involution, processes that involve complex and well orchestrated rearrangements of cells. In contrast, Cdc42 appears to be involved in regulating polarized cell shape changes. In vitro, keratinocytes microinjected with dominant negative Rac1 or with C3 toxin, a specific inhibitor of Rho, are unable to form cadherin-based cell–cell contacts.  Similarly, overexpression of a constitutively active form of Rac1 or Cdc42 in MDCK cells increases junctional localization of E-cadherin–catenin complexes, whereas the dominant negative forms of Rac1 and Cdc42, or C3 microinjection, have the opposite effect. The finding that Tiam1, a guanine nucleotide exchange factor for Rac1, increases E-cadherin mediated cell–cell adhesion, inhibits hepatocyte growth-factor-induced cell scattering and reverses the loss of adhesion in Ras-transformed cells is consistent with the above.  Together, these findings provide compelling evidence that activation of the Rho family of small GTPases plays a key role in the actin dynamics that are necessary for adherens junction formation.
We found that E-cadherin–catenin-enriched puncta, which assemble during the first stages of epithelial sheet formation, are sites of de novo actin polymerization. This led us to postulate that actin polymerization might provide the force that is subsequently necessary to merge the double role of puncta into a single row and ultimately into an epithelial sheet. Knowledge of how actin polymerization might generate movement comes largely from studies of the mechanism by which the pathogen Listeria monocytogenes pirates actin polymerization and utilizes it for intracellular propulsion. For this endeavor, these bacteria recruit two types of cellular components, the VASP family of proteins and the Arp2/3 complex. The Arp2/3 protein complex is required for de novo nucleation of actin filament polymerization, whereas VASP appears to accelerate bacterial movement by about 10 fold.
Although most studies have revealed positive roles for VASP and its cousins in actin reorganization/ polymerization, recent experiments have shown that in certain instances these proteins act negatively in directing cell movement. A further complication is the finding that VASP family proteins can be phosphorylated, thereby inhibiting their actin nucleation and f-actin binding ability. A  role for VASP may be in the actin polymerization necessary for filopodia  extensions. In this regard, VASP family proteins localize to the tips of filopodia during neural growth and in calcium-stimulated keratinocytes. VASP family proteins in this process might provide directionality to the process of actin polymerization, reshaping f-actin into parallel bundles to produce and extend filopodia-like structures from branched lamellipodial networks.

The Might of Myosins

Although actin polymerization seems to be important in generating the cellular movement necessary for intercellular adhesion, this does not rule out the possibility that the myosin family of actin motor proteins may also play a role.  It is known, for instance, that cells can use myosin–actin contractile forces to alter cell shape, and myosin II is a ubiquitously expressed protein involved in such diverse processes as cell spreading, cytokinesis, cell migration, generation of tension within actin stress fiber networks and retrograde flow of actin filaments at the leading edge of moving cells. Interestingly, mouse corneal cells at a wound edge assemble cables of actin filaments anchored to E-cadherin–catenin complexes. The cells surrounding the wound site display myosin-II-associated actin filaments that are aligned in a structure resembling a purse string. It has been postulated that closure of the wound may be achieved through myosin-directed contraction of the actin filaments, in a mechanism similar to that of pulling on a purse string.
Overall, through guilt by association, myosins have been implicated in cell–cell adhesion and in adherens junction formation and although the models proposed are attractive, direct experimental evidence is still lacking. BDM (2,3-butanedione monoxime), a general inhibitor of myosin function, had no obvious effect on intercellular junction formation in our keratinocyte adhesion assays (V Vasioukhin, E Fuchs, unpublished data). However, the role of myosins clearly deserves a more detailed investigation, and this awaits the development of new and improved inhibitors and activators of myosin action.

 Key references:

1. Imamura Y, Itoh M, Maeno Y, Tsukita S, Nagafuchi A: Functional  domains of α-catenin required for the strong state of cadherin based cell adhesion. J Cell Biol 1999, 144:1311-1322.
Three distinct functional domains for α-catenin were identified: a vinculin binding domain, a ZO-1-binding domain and an adhesion modulation domain. Both ZO1-binding (also actin binding) and adhesion modulation domains are necessary for strong adhesion.
2. Vasioukhin V, Bauer C, Yin M, Fuchs E: Directed actin polymerization is the driving force for epithelial cell–cell adhesion. Cell 2000, 100:209-219.
A dynamic filopodia-driven process of cell–cell adhesion is described in primary mouse keratinocyte cultures. Newly forming adherens junctions were identified as sites of actin polymerization and/or reorganization, involving VASP/Mena family members.
3. Raich WB, Agbunag C, Hardin J: Rapid epithelial-sheet sealing in the Caenorhabditis elegans embryo requires cadherin-dependent filopodial priming. Curr Biol 1999, 9:1139-1146.
An elegant in vivo analysis of filopodia-based cell–cell junction formation during epithelial-sheet closure in embryonic development of C. elegans.
4. Loisel TP, Boujemaa R, Pantaloni D, Carlier MF: Reconstitution of actin-based motility of Listeria and Shigella using pure proteins.  Nature 1999, 401:613-616.
Using an in vitro reconstitution approach, the authors show that Arp2/3, actin, cofilin and capping proteins are required for motility of Listeria, in contrast VASP seems to act by increasing the speed of movement by about 10 fold.

3b.  Role for Gelsolin in Actuating Epidermal Growth Factor Receptor-mediated Cell Motility

Philip Chen,  Joanne E. Murphy-Ullrich, and Alan Wells
Department of Pathology, University of Alabama at Birmingham, AL
J Cell Biology Aug 1996; 134(3): 689-698
Phospholipase C-~/(PLC~/) is required for EGF-induced motility (Chen, P., H. Xie, M.C. Sekar, K.B. Gupta, and A. Wells. J. Cell Biol. 1994. 127:847-857); however, the molecular basis of how PLC~/modulates the actin filament network underlying cell motility remains undetermined. One connection to the actin cytoskeleton may be direct hydrolysis of PIP 2 with subsequent mobilization of membrane-associated actin modifying proteins. We used signaling restricted EGFR mutants expressed in receptor-devoid NR6 fibroblast cells to investigate whether EGFR activation of PLC causes gelsolin mobilization from the cell membrane in vivo and whether this translocation facilitates cell movement. Gelsolin anti-sense  oligonucleotide (20 p,M) treatment of NR6 ceils expressing the motogenic full-length (WT) and  truncated c’ 1000 EGFR decreased endogenous gelsolin by 30–60%; this resulted in preferential reduction of EGF (25 nM)-induced cell movement by >50% with little effect on the basal motility. As 14 h of EGF stimulation of cells did not increase total cell gelsolin content, we determined whether EGF induced redistribution of gelsolin from the membrane fraction. EGF treatment decreased the gelsolin mass associated with the membrane fraction in motogenic WT and c’1000 EGFR NR6 cells but not in cells expressing the fully mitogenic, but nonmotogenic c’973 EGFR. Blocking PLC activity with the pharmacologic agent U73122 (1 ~M) diminished both this mobilization of gelsolin and EGF-induced motility, suggesting that gelsolin mobilization is downstream of PLC. Concomitantly observed was reorganization of submembranous actin filaments correlating directly with PLC activation and gelsolin mobilization. In vivo expression of a peptide that is reported to compete in vitro with gelsolin in binding to PIP2 dramatically increased basal cell motility in NR6 cells expressing either motogenic (WT and c’1000) or nonmotogenic (c’973) EGFR; EGF did not further augment cell motility and gelsolin mobilization. Cells expressing this peptide demonstrated actin reorganization similar to that observed in EGF-treated control cells; the peptide-induced changes were unaffected by U73122. These data suggest that much of the EGF induced motility and cytoskeletal alterations can be reproduced by displacement of select actin-modifying proteins from a PIP2-bound state. This provides a signaling mechanism for translating cell surface receptor mediated biochemical reactions to the cell movement machinery.

3c.  Actomyosin Contraction at the Cell Rear Drives Nuclear Translocation in Migrating Cortical Interneurons

Francisco J. Martini and Miguel Valdeolmillos
Instituto de Neurociencias de Alicante, Universidad Miguel Hernandez, Alacant, Spain
Journal of Neuroscience 2010 • 30(25):8660–8670
Neuronal migration is a complex process requiring the coordinated interaction of cytoskeletal components and regulated by calcium signaling among other factors. Migratory neurons are polarized cells in which the largest intracellular organelle, the nucleus, has to move repeatedly. Current views support a central role for pulling forces that drive nuclear movement. By analyzing interneurons migrating in cortical slices of mouse brains, we have found that nucleokinesis is associated with a precise pattern of actin dynamics characterized by the initial formation of a cup-like actin structure at the rear nuclear pole. Time-lapse experiments show that progressive actomyosin contraction drives the nucleus forward. Nucleokinesis concludes with the complete contraction of the cup-like structure, resulting in an actin spot at the base of the retracting trailing process. Our results demonstrate that this actin remodeling requires a threshold calcium level provided by low-frequency spontaneous fast intracellular calcium transients. Microtubule stabilization with taxol treatment prevents actin remodeling and nucleokinesis, whereas cells with a collapsed microtubule cytoskeleton induced by nocodazole treatment, display nearly normal actin dynamics and nucleokinesis. In summary, the results presented here demonstrate that actomyosin forces acting at the rear side of the nucleus drives nucleokinesis in tangentially migrating interneurons in a process that requires calcium and a dynamic cytoskeleton of microtubules.

3d. Migration of Zebrafish Primordial Germ Cells: A Role for Myosin Contraction and Cytoplasmic Flow

H Blaser, M Reichman-Fried, I Castanon, K Dumstrei, F L Marlow, et al.
Max Planck Institute, Gottingen & Dresden, Germany;  Vanderbilt University, Nashville, Tenn; National Institute of Genetics, Shizuoka, Japan
Developmental Cell 2006; 11: 613–627 [DOI 10.1016/j.devcel.2006.09.023]
The molecular and cellular mechanisms governing cell motility and directed migration in response to the chemokine SDF-1 are largely unknown. Here, we demonstrate that zebrafish primordial germ cells whose migration is guided by SDF-1 generate bleb-like protrusions that are powered by cytoplasmic flow. Protrusions are formed at sites of higher levels of free calcium where activation of myosin contraction occurs. Separation of the acto-myosin cortex from the plasma membrane at these sites is followed by a flow of cytoplasm into the forming bleb. We propose that polarized activation of the receptor CXCR4 leads to a rise in free calcium that in turn activates myosin contraction in the part of the cell responding to higher levels of the ligand SDF-1. The biased formation of new protrusions in a particular region of the cell in response to SDF-1 defines the leading edge and the direction of cell migration.

Part 4.  Calcium Signaling

4a. Indirect Association of Ezrin with F-Actin: Isoform Specificity and Calcium Sensitivity

Charles B. Shuster and Ira M. Herman
Tufts University Health Science Schools, Boston, MA
J Cell Biology Mar 1995; 128(5): 837-848
Muscle and nonmuscle isoactins are segregated into distinct cytoplasmic domains,  but the mechanism regulating subcellular sorting is unknown (Herman, 1993a). To reveal whether isoform-specific actin-binding proteins function to coordinate these events, cell extracts derived from motile (Era) versus stationary (Es) cytoplasm were selectively and sequentially fractionated over filamentous isoactin affinity columns prior to elution with a KC1 step gradient.  A polypeptide of interest, which binds specifically to/3-actin filament columns, but not to muscle actin columns has been conclusively identified as the ERM family member, ezrin. We studied ezrin-/3 interactions in vitro by passing extracts (Era) over isoactin affinity matrices in the presence of Ca2+-containing versus Ca2+-free buffers, with or without cytochalasin D. Ezrin binds and can be released from/3-actin Sepharose-4B in the presence of Mg2+/EGTA and 100 mM NaC1 (at 4°C and room temperature), but not when affinity fractionation of Em is carried out in the presence of 0.2 mM CaC12 or 2/~M cytochalasin D. N-acetyl-(leucyl)2-norleucinal and E64, two specific inhibitors of the calcium-activated protease, calpain I, protect ezrin binding to β-actin in the presence of calcium. Biochemical analysis of endothelial lysates reveals that a calpain I cleavage product of ezrin emerges when cell locomotion is stimulated in response to monolayer injury. Immunofluorescence analysis shows that anti-ezrin and anti-β-actin IgGs can be simultaneously co-localized, extending the results of isoactin affinity fractionation of Em-derived extracts and suggesting that ezrin and β-actin interact in vivo. To test the hypothesis that ezrin binds directly to β-actin, we performed three sets of studies under a wide range of physiological conditions (pH 7.0-8.5) using purified pericyte ezrin and either α- or β-actin. Results of these experiments reveal that purified ezrin does not directly bind to β-actin filaments. We mapped cellular free calcium in endothelial monolayers crawling in response to injury. Confocal imaging of fluo-3 fluorescence followed by simultaneous double antibody staining reveals a transient rise of free calcium within ezrin-/3-actin-enriched domains in the majority of motile cells bordering the wound edge. These results support the notion that calcium and calpain I modulate ezrin and β-actin interactions during forward protrusion formation.

4b.  Calcium channel and glutamate receptor activities regulate actin organization in salamander retinal neurons

Massimiliano Cristofanilli and Abram Akopian
New York University School of Medicine, New York, NY
J Physiol 575.2 (2006) pp 543–554
Intracellular Ca2+ regulates a variety of neuronal functions, including neurotransmitter release, protein phosphorylation, gene expression and synaptic plasticity. In a variety of cell types, including neurons, Ca2+ is involved in actin reorganization, resulting in either actin polymerization or depolymerization. Very little, however, is known about the relationship between Ca2+ and the actin cytoskeleton organization in retinal neurons. We studied the effect of high-K+-induced depolarization on F-actin organization in salamander retina and found that Ca2+ influx through voltage-gated L-type channels causes F-actin disruption, as assessed by 53±5% (n=23, P <0.001) reduction in the intensity of staining with Alexa-Fluor488-phalloidin, a compound that permits visualization and quantification of polymerized actin. Calcium-induced F-actin depolymerization was attenuated in the presence of protein kinase C antagonists, chelerythrine or bis-indolylmaleimide hydrochloride (GF 109203X). In addition, phorbol 12-myristate 13-acetate (PMA), but not 4α-PMA, mimicked the effect of Ca2+ influx on F-actin. Activation of ionotropic AMPA and NMDA glutamate receptors also caused a reduction in F-actin. No effect on F-actin was exerted by caffeine or thapsigargin, agents that stimulate Ca2+ release from internal stores. In whole-cell recording from a slice preparation, light-evoked ‘off’ but not ‘on’ EPSCs in ‘on–off’ ganglion cells were reduced by 60±8% (n=8, P <0.01) by cytochalasin D. These data suggest that elevation of intracellular Ca2+ during excitatory synaptic activity initiates a cascade for activity-dependent  actin remodelling, which in turn may serve as a feedback mechanism to attenuate excite-toxic Ca2+ accumulation induced by synaptic depolarization.

4c.  Electric Field-directed Cell Shape Changes, Displacement, and Cytoskeletal Reorganization Are Calcium Dependent

Edward K. Onuma and Sek-Wen Hui
Roswell Park Memorial Institute, Buffalo, New York
J Cell Biology 1988; 106: 2067-2075

C3H/10T1/2 mouse embryo fibroblasts were stimulated by a steady electric field ranging up to 10 V/cm. Some cells elongated and aligned perpendicular to the field direction. A preferential positional shift toward the cathode was observed which was inhibited by the calcium channel blocker D-600 and the calmodulin antagonist trifluoperazine. Rhodaminephalloidin labeling of actin filaments revealed a field induced disorganization of the stress fiber pattern, which was reduced when stimulation was conducted in calcium-depleted buffer or in buffer containing calcium antagonist CoC12, calcium channel blocker D-600, or calmodulin antagonist trifluoperazine. Treatment with calcium ionophore A23187 had similar effects, except that the presence of D-600 did not reduce the stress fiber disruption. The calcium-sensitive photoprotein aequorin was used to monitor changes in intracellular-free calcium. Electric stimulation caused an increase of calcium to the micromolar range. This increase was inhibited by calcium-depleted buffer or by CoC12, and was reduced by D-600. A calcium-dependent mechanism is proposed to explain the observed field-directed cell shape changes, preferential orientation, and displacement.

4d. Local Calcium Elevation and Cell Elongation Initiate Guided Motility in Electrically Stimulated osteoblast-Like Cells

N Ozkucur, TK Monsees, S Perike, H Quynh Do, RHW Funk.
Carl Gustav Carus, TU-Dresden, Dresden, Germany; University of the Western Cape, SAfrica.
Plos ONE 2009; 4 (7): e6131

Investigation of the mechanisms of guided cell migration can contribute to our understanding of many crucial biological processes, such as development and regeneration. Endogenous and exogenous direct current electric fields (dcEF) are known to induce directional cell migration, however the initial cellular responses to electrical stimulation are poorly understood. Ion fluxes, besides regulating intracellular homeostasis, have been implicated in many biological events, including regeneration. Therefore understanding intracellular ion kinetics during EF-directed cell migration can provide useful information for development and regeneration.
We analyzed the initial events during migration of two osteogenic cell types, rat calvarial and human SaOS-2 cells, exposed to strong (10–15 V/cm) and weak (#5 V/cm) dcEFs. Cell elongation and perpendicular orientation to the EF vector occurred in a time- and voltage-dependent manner. Calvarial osteoblasts migrated to the cathode as they formed new filopodia or lamellipodia and reorganized their cytoskeleton on the cathodal side. SaOS-2 cells showed similar responses except towards the anode. Strong dcEFs triggered a rapid increase in intracellular calcium levels, whereas a steady state level of intracellular calcium was observed in weaker fields. Interestingly, we found that dcEF induced intracellular calcium elevation was initiated with a local rise on opposite sides in calvarial and SaOS-2 cells, which may explain their preferred directionality. In calcium-free conditions, dcEFs induced neither intracellular calcium elevation nor directed migration, indicating an important role for calcium ions. Blocking studies using cadmium chloride revealed that voltage-gated calcium channels (VGCCs) are involved in dcEF-induced intracellular calcium elevation. Taken together, these data form a time scale of the morphological and physiological rearrangements underlying EF-guided migration of osteoblast-like cell types and reveal a requirement for calcium in these reactions. We show for the first time here that dcEFs trigger different patterns of intracellular calcium elevation and positional shifting in osteogenic cell types that migrate in opposite directions.

4e. TRPM4 Regulates Migration of Mast Cells in Mice

T Shimizua, G Owsianik, M Freichelb, V Flockerzi, et al.
Laboratory of Ion Channel Research, KU Leuven, Leuven, Belgium; Universität des Saarlandes, Homburg, Germany; National Institute for Physiological Sciences,Okazaki, Japan
Cell Calcium 2008; xxx–xxx

We demonstrate here that the transient receptor potential melastatin subfamily channel, TRPM4, controls migration of bone marrow-derived mast cells (BMMCs), triggered by dinitrophenylated human serum albumin (DNP-HSA) or stem cell factor (SCF). Wild-type BMMCs migrate after stimulation with DNPHSA or SCF whereas both stimuli do not induce migration in BMMCs derived from TRPM4 knockout mice (trpm4−/−). Mast cell migration is a Ca2+-dependent process, and TRPM4 likely controls this process by setting the intracellular Ca2+ level upon cell stimulation. Cell migration depends on filamentous actin (F-actin) rearrangement, since pretreatment with cytochalasin B, an inhibitor of F-actin formation, prevented both DNP-HSA- and SCF-induced migration in wild-type BMMC. Immunocytochemical experiments using fluorescence-conjugated phalloidin demonstrate a reduced level of F-actin formation in DNP-HSA-stimulated BMMCs from trpm4−/− mice. Thus, our results suggest that TRPM4 is critically involved in migration of BMMCs by regulation of Ca2+-dependent actin cytoskeleton rearrangements.
4f. Nuclear and cytoplasmic free calcium level changes induced by elastin peptides in human endothelial cells
G FAURY, Y USSON, M ROBERT-NICOUD, L ROBERT, AND J VERDETTI.
Institut Albert Bonniot, Universite´ J. Fourier, Grenoble, Fr; and Universite´ Paris, Paris, Fr
PNAS: Cell Biology 1998; 95: pp. 2967–2972.

The extracellular matrix protein ‘‘elastin’’ is the major component of elastic fibers present in the arterial wall. Physiological degradation of elastic fibers, enhanced in vascular pathologies, leads to the presence of circulating elastin peptides (EP). EP have been demonstrated to influence cell migration and proliferation. EP also induce, at circulating pathophysiological concentrations (and not below), an endothelium-and NO- dependent vasorelaxation mediated by the 67-kDa subunit of the elastin-laminin receptor. Here, by using the techniques of patch-clamp, spectrofluorimetry and confocal microscopy, we demonstrate that circulating concentrations of EP activate low specificity calcium channels on human umbilical venous endothelial cells, resulting in increase in cytoplasmic and nuclear free calcium concentrations. This action is independent of phosphoinositide metabolism. Furthermore, these effects are inhibited by lactose, an antagonist of the elastin-laminin receptor, and by cytochalasin D, an actin microfilament depolymerizer. These observations suggest that EP-induced signal transduction is mediated by the elastin-laminin receptor via coupling of cytoskeletal actin microfilaments to membrane channels and to the nucleus. Because vascular remodeling and carcinogenesis are accompanied by extracellular matrix modifications involving elastin, the processes here described could play a role in the elastin-laminin receptor-mediated cellular migration, differentiation, proliferation, as in atherogenesis, and metastasis formation.

Part 5. Regulation of the Cytoskeleton

5a Regulation of the Actin Cytoskeleton by PIP2 in Cytokinesis

MR Logan and CA Mandato
McGill University, Montreal, Ca
Biol. Cell (2006) 98, 377–388 [doi:10.1042/BC20050081]

Cytokinesis is a sequential process that occurs in three phases:

  • assembly of the cytokinetic apparatus, 
  • furrow progression and 
  • fission (abscission) of the newly formed daughter cells.

The ingression of the cleavage furrow is dependent on the constriction of an equatorial actomyosin ring in many cell types. Recent studies have demonstrated that this structure is highly dynamic and undergoes active polymerization and depolymerization throughout the furrowing process. Despite much progress in the identification of contractile ring components, little is known regarding the mechanism of its assembly and structural rearrangements. PIP2 (phosphatidylinositol 4,5-bisphosphate) is a critical regulator of actin dynamics and plays an essential role in cell motility and adhesion. Recent studies have indicated that an elevation of PIP2 at the cleavage furrow is a critical event for furrow stability. We discuss the role of PIP2-mediated signaling in the structural maintenance of the contractile ring and furrow progression. In addition, we address the role of other phosphoinositides, PI(4)P (phosphatidylinositol-4-phosphate) and PIP3 (phosphatidylinositol 3,4,5-triphosphate) in these processes.

Regulation of the actin cytoskeleton by PIPKs (phosphatidylinositol phosphate kinases) and PIP2 (phosphatidylinositol 4,5-bisphosphate)

PIP2 is generated by the activity of type I (PIPKIs) or type II (PIPKII) kinase isoforms (α, β, γ) which utilize PI(4)P (phosphatidylinositol 4-phosphate) and PI(5)P (phosphatidylinositol 5-phosphate) as substrates respectively. PIPKIs are localized to the plasma membrane and are thought to account for the majority of PIP2 synthesis, whereas PIPKIIs are predominantly localized to intracellular sites. PIP2 plays a key role in re-structuring the actin cytoskeleton in several ways. In general, high levels of PIP2 are associated with actin polymerization, whereas low levels block assembly or promote actin severing activity. PIP2 facilitates actin polymerization in multiple ways such as:

(i) activating N-WASp (neuronal Wiskott–Aldrich syndrome protein)- and Arp2/3 (actin-related protein 2/3)-mediated actin branching, 
(ii) binding and impairing the activity of actin-severing proteins, such as gelsolin and cofilin/ADF (actin depolymerizing factor); and
(iii) uncapping actin filaments for the addition on new actin monomers

This polymerization signal is counteracted by the generation of IP3 (inositol 1,4,5-triphosphate) and DAG (diacylglycerol), following PLC (phospholipase C)-mediated hydrolysis of PIP2. IP3-mediated activation of Ca2+/CaM (calmodulin) promotes the activation of severing proteins such as gelsolins and cofilin, which lead to solubilization of the actin network (Figure 1). In addition to influencing actin polymerization, PIP2 modulates the function of several actin cross-linking and regulatory proteins which are critical for the assembly of stress fibres, gel meshworks and membrane attachment. For example, PIP2 negatively regulates cross-linking mediated by filamin and the actin-bundling activity of α-actinin. In contrast, PIP2 induces conformational changes in vinculin, talin and ERM (ezrin/radixin/moesin) family proteins to promote anchoring of the actin cytoskeleton to the plasma membrane. PLC-mediated hydrolysis of PIP2 and the downstream activation of Ca2+/CaM and PKC (protein kinase C) also influences actin-myosin based contractility. Ca2+/CaM activates MLCK (myosin regulatory light chain kinase), leading to phosphorylation of the MLC (myosin regulatory light chain). Similarly, PKC has been shown to phosphorylate and activate MLC (Figure 1).

Figure 1 Summary of PIP2-mediated regulation of the actin cytoskeleton

Role of PIP2-mediated signaling in cell division

Prior to cell division cells undergo a global cell rounding which is a prerequisite step for the initiation of the cleavage furrow. In frog, sea urchin and newt eggs these shape changes correlate with an increase in cortical tension that precedes or occurs near the onset of the cleavage furrow.  Precise mapping of the changes in cortical tension have shown that peaks of tension are propagated in waves that occur in front of and at the same time as furrow initiation. These tension waves are generated by actomyosin-based contractility and subside after the furrow has passed. Experiments in Xenopus eggs, zebrafish and  Xenopus embryos indicated that site-specific Ca2+ waves were generated within the cleavage furrow that would be predicted to coincide with peaks of cortical tension. The injection of heparin, a competitive inhibitor of IP3 receptors, or Ca2+ chelators were both demonstrated to significantly delay or arrest furrowing , and a similar inhibitory effect was observed of microinjected PIP2 antibodies that caused a depletion of the intracellular pool of DAG and Ca2+ in Xenopus blastomeres. In addition, the increase in cortical contractility of Xenopus oocytes has been shown to occur via a PKC-dependent pathway. Together, these studies demonstrate a role for PIP2-mediated signaling at the early stages of cytokinesis.
Recent studies have supported that PIP2-mediated signaling also plays a critical role in ingression of the cleavage furrow, although significant differences have been shown in the localization of PIP2 and the role of PLC. Lithium and the PLC inhibitor, U73122, caused a rapid (within minutes) regression of cleavage furrows in crane fly spermatocytes, but did not block their initial formation. PIP2 may become concentrated within the cleavage furrow and could facilitate anchoring of the plasma membrane to structural components of the actomyosin ring. A PIPKI homologue, its3, and PIP2 were reported at the septum of dividing fission yeast, Schizosaccharomyces pombe. A temperature sensitive mutant of its3 exhibited disrupted actin patches, following a shift to the restrictive temperature, and also impaired cytokinesis. Although a contractile ring was still evident in these cells, abnormalities, such as an extra ring, were found. Two recent studies demonstrated an increase in PIP2-specific GFP-labeled PH domains within the cleavage furrow of mammalian cells. Both of these reports suggested de novo synthesis of PIP2 occurs within the furrow. Another study found that endogenous and over-expressed PIPKIβ, but not PIPKIγ, concentrated in the cleavage furrow of CHO (Chinese hamster ovary) cells. The expression of a kinase-dead mutant of this isoform and microinjection of PIP2-specific antibodies both caused a significant increase in the number of multinucleated cells. A multinucleated phenotype was, similarly, observed in multiple cell lines (CHO, HeLa, NIH 3T3 and 293T) transfected with high levels of PIP2-specific PH domains, synaptojanin [which dephosphorylates PIP2 to PI(4)P], or a kinase-dead mutant of PIPKIα. In addition, a small percentage of CHO and HeLa cells expressing high levels of PIP2-specific PH domains or synaptojanin showed signs of F-actin dissociation from the plasma membrane.  CHO cells transfected with PIP2 PH domains, but not PH domains specific for PI(3,4)P2 (phosphatidylinositol 3,4-bisphosphate) and PIP3, also exhibited impaired furrow expansion induced by the application of hypotonic buffer. This suggests one of the primary roles of PIP2 is to promote cytoskeleton–membrane anchoring at the furrow.
Role of PI3Ks (phosphoinositide 3-kinases) and PI4Ks (phosphoinositide 4-kinases) in cytokinesis PI4Ks generate the PIPKI substrate, PI(4)P, and play a critical role in PIP2 generation.  Studies in lower organisms support  the requirement of PI4Ks for cytokinesis. In Saccharomyces cerevisiae two PI4Ks, STT4 and PIK1, have non-overlapping functions in Golgi-tomembrane trafficking and cell-wall integrity respectively.  Both genes are also required for cell division. Conditional mutants of Pik1p exhibited a cytokinesis defect: cells arrest with large buds and fully divided nuclei. In addition, STT4 was identified as a gene implicated in reorientation of the mitotic spindle prior to cytokinesis.  Spermatocytes derived from fwd mutant males had unstable furrows that failed to ingress and abnormal contractile rings with dissociated myosin II and F-actin, fwd has homology with yeast PIK1 and human PI4KIIIβ. Although PIK1 is an essential gene in yeast, the deletion of fwd was not lethal and female flies were fertile.  A study in fission yeast suggests that PI4Ks may be recruited to the furrow, as reported for PIPKs. Desautels et al. (2001) identified a PI4K as a binding partner of Cdc4p, a contractile ring protein with homology to the myosin essential light chain. A Cdc4p mutant, G107S, abolished the interaction with PI4K and induced the formation of multinucleated cells with defects in septum formation. This finding suggests that, at least for fission yeast, anchoring of PI4K to the contractile ring may concentrate PI(4)P substrate within the furrow for subsequent PIP2 generation.
An increased synthesis of PIP2 by PIPKIs at the cleavage furrow is anticipated to promote both actin polymerization and structural support to the contractile ring. Structural proteins of the contractile ring regulated by PIP2 include anillin, septin and ERM proteins. The concentration of PIP2 at the cleavage furrow is postulated to be a critical molecule in the recruitment of these proteins and their integration with the actomyosin ring. Anillin exhibits actin-bundling activity and is required at the terminal stages of cytokinesis in Drosophila and human cells.  The depletion of anillin in Drosophila and human cells causes cytokinesis failure, which is correlated with uncoordinated actomyosin contraction of the medial ring. Anillin also functions as a cofactor to promote the recruitment of septins to actin bundles. Mutations within the PH domain of anillin were recently demonstrated to impair septin localization to both the furrow canal and the contractile ring in Drosophila cells, blocking cellularization and furrow progression. Septins have also been shown to bind to phosphoinositides and this interaction regulates their subcellular localization. The mammalian septin, H5, bound PIP2 and PIP3 liposomes at its N-terminal basic region, which is conserved in most septin proteins. The over-expression of synaptojanin and treatment with neomycin (which depletes cellular PIP2) both caused disruption of actin stress fibres and dissociation of H5 from filamentous structures in Swiss 3T3 cells. Septins are co-localized with actin at the cleavage furrow and form ring structures that are postulated to structurally support  the contractile ring.
Studies suggest that PLC-mediated hydrolysis of PIP2 and the subsequent release of intracellular Ca2+ stores is a necessary event for furrow stability and ingression.  A role for Ca2+ is similarly supported by previous findings that Ca2+ waves were localized to the cleavage furrow in frog embryos, eggs and fish. PLC second messengers have also been implicated in cytokinesis. For example, CaM was localized to mitotic spindles of HeLa cells and the inhibition of its activity was reported to cause cytokinesis defects. A recent RNAi (RNA interference) screen also identified PI4Ks and PIPKs, but not PLC genes, as critical proteins for cytokinesis in Drosophila.  This may indicate PLC is required for completion of furrowing, rather than its initiation.
It is hypothesized that PLC activity may promote actin filament severing through the activation of Ca2+-dependent actin-severing proteins, such as gelsolin and cofilin. Depending on the localization of PLC, this could either drive disassembly of actin filaments of the medial ring or the cortical actin network. Furthermore, the activation of PKC and CaM would activate actomyosin contraction via the phosphorylation of MLCK. At the furrow, PKC and CaM could act in concert with the Rho effectors ROCK and Citron kinase, which also phosphorylate and activate MLC.
The activation of CaM and/or PKC may also provide positive feedback for the recruitment of PIP2 effectors and regulate GTPase-mediated actin polymerization. Both PKC and CaM have been shown to promote the dissociation of MARCKS (myristoylated alanine-rich C kinase substrates) family proteins from PIP2. MARCKS are postulated to play a major regulatory role in phosphoinositide signalling by sequestering PIP2 at the membrane. Thus the activation of PKC and CaM promotes PIP2 availability for the recruitment of PH-domain-containing effector proteins. Studies in yeast and mammalian cells have supported that CaM and PKC can mediate positive feedback for PIP2 synthesis by activating PIPKs.

Signaling Crosstalk: Role of GTPases and Phosphoinositides

On the basis of the present available data, PIP2 has been shown to be a critical molecule for structural integrity of the contractile ring and furrow stability. However, the observation that furrows are initiated in cells treated with agents that either sequester PIP2 or prevent its hydrolysis suggests PIP2 does not provide the originating signal for furrow formation. Recent studies suggest that the recruitment and activation of RhoA may provide this early signal.

Figure 2 Proposed model of PIP2 and GTPase signaling at the cleavage furrow

Ect2, is recruited to the cleavage furrow via its interaction withMgcRacGAP at the central spindle. Ect2 and MgcRacGAP regulate the activities of Rho GTPases (RhoA, Cdc42 and Rac) and are functionally implicated in the assembly of the contractile ring. Active RhoA and Cdc42 are increased at the furrow, whereas Rac is suppressed (grey). Furrow-recruited GTPases (RhoA, ARF6 and Cdc42) are predicted to activate PIPKI, leading to the generation of PIP2. PI3K activity is suppressed at the furrow (grey), which may be due to MgcRacGAP-mediated inhibition of Rac and/or the activity of the PIP3 phosphatase, PTEN. Cycles of PIP2 synthesis and hydrolysis by PLC are thought to play a critical role in re-structuring the contractile ring throughout the duration of furrowing. PIP2-mediated activation of anillin, septins and ERM proteins promotes cross-linking and membrane anchoring of the contractile ring. PLC-mediated activation of PKC and CaM can facilitate the contraction of the actomyosin ring, similar to RhoA effectors, ROCK and Citron kinase. CaM may also regulate IQGAP–Cdc42 interactions, and thereby modulate actin organization. It is hypothesized that Cdc42-mediated actin polymerization via effectors, such as N-WASp (neuronalWiskott–Aldrich syndrome protein) and Arp2/3 (actin-related protein 2/3), may reduce membrane tension outside the inner region of RhoA-mediated contractility.
Actin core bundle fimbrin

Actin core bundle fimbrin (Photo credit: Wikipedia)

English: Diagram showing Actin-Myosin filament...

English: Diagram showing Actin-Myosin filaments in Smooth muscle. The actin fibers attach to the cell wall and to dense bodies in the cytoplasm. When activated the slide over the myosin bundles causing shortening of the cell walls (Photo credit: Wikipedia)

English: Figure 2: The matrix can play into ot...

English: Figure 2: The matrix can play into other pathways inside the cell even through just its physical state. Matrix immobilization inhibits the formation of fibrillar adhesions and matrix reorganization. Likewise, players of other signaling pathways inside the cell can affect the structure of the cytoskeleton and thereby the cell’s interaction with the ECM. (Photo credit: Wikipedia)

Read Full Post »


The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and PathologyDuke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »

Drug Eluting Stents: On MIT’s Edelman Lab’s Contributions to Vascular Biology and its Pioneering Research on DES


Drug Eluting Stents: On MIT‘s Edelman Lab’s Contributions to Vascular Biology and its Pioneering Research on DES

Author: Larry H Bernstein, MD, FACP

and 

Curator: Aviva Lev-Ari, PhD, RN
http://PharmaceuticalIntelligence.com/2013/04/25/Contributions
-to-vascular-biology/

This is the first of a three part series on the evolution of vascular biology and the studies of the effects of biomaterials in vascular reconstruction and on drug delivery, which has embraced a collaboration of cardiologists at Harvard Medical School , Affiliated Hospitals, and MIT,
requiring cardiovascular scientists at the PhD and MD level, physicists, and computational biologists working in concert, and
an exploration of the depth of the contributions by a distinguished physician, scientist, and thinker.

The first part – Vascular Biology and Disease – will cover the advances in the research on

  • vascular biology,
  • signaling pathways,
  • drug diffusion across the endothelium and
  • the interactions with the underlying muscularis (media),
  • with additional considerations for type 2 diabetes mellitus.

The second part – Stents and Drug Delivery – will cover the

  • purposes,
  • properties and
  • evolution of stent technology with
  • the acquired knowledge of the pharmacodynamics of drug interactions and drug distribution.

The third part – Problems and Promise of Biomaterials Technology – will cover the shortcomings of the cardiovascular devices, and opportunities for improvement

Vascular Biology and Cardiovascular Disease

Early work on endothelial injury and drug release principles

The insertion of a catheter for the administration of heparin is not an innocuous procedure. Heparin is infused to block coagulation, lowering the risk of a dangerous

  • clot formation and
  • dissemination.

It was shown experimentally that the continuous infusion of heparin

  • suppresses smooth muscle proliferation after endothelial injury. It may lead to
  • hemorrhage as a primary effect.

The anticoagulant property of heparin was removed by chemical modification without loss of the anti-proliferative effect.

In this study, MIT researches placed ethylene-vinyl acetate copolymer matrices containing standard and modified heparin adjacent to rat carotid arteries at the time of balloon deendothelialization.

Matrix delivery of both heparin compounds effectively diminished this proliferation in comparison to controls without producing systemic anticoagulation or side effects.

This mode of therapy appeared more effective than administering the agents by either

  • intravenous pumps or
  • heparin/polymer matrices placed in a subcutaneous site distant from the injured carotid artery

This indicated that the site of placement at the site of injury is a factor in the microenvironment, and is a preference for avoiding restenosis after angioplasty and other interventions.

This raised the question of why the proliferation of vascular muscle occurs in the first place.
 Edelman, Nugent and Karnovsky  (1) showed that the proliferation required first the denudation of vascular surface endothelium. This exposed the underlayer to the effect of basic fibroblast growth factor, which stimulates mitogenesis of the exposed cell, explained by the endothelium as a barrier from circulating bFGF.

To answer this question, they compared the effect of

  • 125I-labelled bFGF intravenously given with perivascular controlled bFGF release.
  • Polymeric controlled release devices delivered bFGF to the extravascular space without transendothelial transport. 
Deposition within the blood vessel wall was rapidly distributed circumferentially and was substantially greater than that observed following intravenous injection.

The amount of bFGF deposited in arteries adjacent to the release devices was 40 times that deposited in similar arteries in animals who received a single intravenous bolus of bFGF.

The presence of intimal hyperplasia increased deposition of perivascularly released bFGF 2.4-fold but decreased the deposition of intravenously injected bFGF by 67%.

  • bFGF was 5- to 30-fold more abundant in solid organs after intravenous injection than it was following perivascular release, and
  • bFGF deposition was greatest in the kidney, liver, and spleen and was substantially lower in the heart and lung.

This result indicated that vascular deposition of bFGF is independent of endothelium, and

  • bFGF delivery is effectively perivascular. (2)

Drug activity studies have to be done in well controlled and representative conditions.
 Edelsman’s Lab researchers studied the

  • dose response of injured arteries to exogenous heparin in vivo by providing steady and predictable arterial levels of drug.
  • Controlled-release devices were fabricated to direct heparin uniformly and at a steady rate to the adventitial surface of balloon-injured rat carotid arteries.

Researchers predicted the distribution of heparin throughout the arterial wall using computational simulations and correlated these concentrations with the biologic response of the tissues.

Researchers determined from this process that an in vivo arterial concentration of 0.3 mg/ml of heparin is required to maximallyinhibit intimal hyperplasia after injury.

This estimation of the required tissue concentration of a drug is

  • independent of the route of administration and
  • applies to all forms of drug release.

In this way the Team was able to

  • evaluate the potential of  widely disparate forms of drug release and, to finally
  • create some rigorous criteria by which to guide the development of particular delivery strategies for local diseases. (3)

Chiefly, the following three effects:

(1) Effect of controlled adventitial heparin delivery on smooth muscle cell proliferation following endothelial injury. ER Edelman, DH Adams, and MJ Karnovsky. PNAS May 1990; 87: 3773-3777.


(2) Perivascular and intravenous administration of basic fibroblast growth factor: Vascular and solid organ deposition. ER Edelman, MA Nugent, and MJ Karnovsky. PNAS Feb 1993; 90: 1513-1517.


(3) Tissue concentration of heparin, not administered dose, correlates with the biological response of injured arteries in vivo. MA Lovich and ER Edelman. PNAS Sep 1999; 96: 11111–11116.

Vascular Injury and Repair

Perlecan is a heparin-sulfate proteoglycan that might be critical for regulation of vascular repair by inhibiting the binding and mitogenic activity of basic fibroblast growth factor-2 (bFGF-2) in vascular smooth muscle cells .

The Team generated

  • Clones of endothelial cells expressing an antisense vector targeting domain III of perlecan. The transfected cells produced significantly less perlecan than parent cells, and they had reduced bFGF in vascular smooth muscle cells.
  • Endothelial cells were seeded onto three-dimensional polymeric matrices and implanted adjacent to porcine carotid arteries subjected to deep injury.
  • The parent endothelial cells prevented thrombosis, but perlecan deficient cells were ineffective.

The ability of endothelial cells to inhibit intimal hyperplasia, however, was only in part suppressed by perlecan. The differential regulation by perlecan of these aspects of vascular repair may clarify why control of clinical clot formation does not lead to full control of intimal hyperplasia.

The use of genetically modified tissue engineered cells provides a new approach for dissecting the role of specific factors within the blood vessel wall.(1) Successful implementation of local arterial drug delivery requires transmural distribution of drug. The physicochemical properties of the applied compound govern its transport and tissue binding.

  • Hydrophilic compounds are cleared rapidly.
  • Hydrophobic drugs bind to fixed tissue elements, potentially prolonging tissue residence and biological effect.

Local vascular drug delivery provides

  • elevated concentrations of drug in the target tissue while
  • minimizing systemic side effects.

To better characterize local pharmacokinetics the Team examined the arterial transport of locally applied dextran and dextran derivatives in vivo.

Using a two-compartment pharmacokinetic model to correct

  • The measured transmural flux of these compounds for systemic
  • Redistribution and elimination as delivered from a photo-polymerizable hydrogel.
  • The diffusivities and the transendothelial permeabilities were strongly dependent on molecular weight and charge
  • For neutral dextrans, the diffusive resistance increased with molecular weightapproximately 4.1-fold between the molecular weights of 10 and 282 kDa.
  • Endothelial resistance increased 28-fold over the same molecular weight range.
  • The effective medial diffusive resistance was unaffected by cationic charge as such molecules moved identically to neutral compounds, but increased approximately 40% when dextrans were negatively charged.

Transendothelial resistance was 20-fold lower for the cationic dextrans, and 11-fold higher for the anionic dextrans, when both were compared to neutral counterparts.

These results suggest that, while

  • low molecular weight drugs will rapidly traverse the arterial wall with the endothelium posing a minimal barrier,
  • the reverse is true for high molecular weight agents.

The deposition and distribution of locally released vascular therapeutic compounds might be predicted based upon chemical properties, such as molecular weight and charge. (2)

Paclitaxel is hydrophobic and has therapeutic potential against proliferative vascular disease.
 The favorable preclinical data with this compound may, in part, result from preferential tissue binding.
 The complexity of Paclitaxel pharmacokinetics required in-depth investigation if this drug is to reach its full clinical potential in proliferative vascular diseases.

Equilibrium distribution of Paclitaxel reveals partitioning above and beyond perfusate concentration and a spatial gradient of drug across the arterial wall.

The effective diffusivity (Deff) was estimated from the Paclitaxel distribution data to

  • facilitate comparison of transport of Paclitaxel through arterial parenchyma with that of other vasoactive agents and to
  • characterize the disparity between endovascular and perivascular application of drug.

This transport parameter described the motion of drug in tissues given an applied concentration gradient and includes, in addition to diffusion,

  • the impact of steric hindrance within the arterial interstitium;
  • nonspecific binding to arterial elements; and, in the preparation used here,
  • convective effects from the applied transmural pressure gradient.

At all times, the effective diffusivity for endovascular delivery exceeded that of perivascular delivery. The arterial transport of Paclitaxel was quantified through application ex vivo and measurement of the subsequent transmural distribution.

  • Arterial Paclitaxel deposition at equilibrium varied across the arterial wall.
  • Permeation into the wall increased with time, from 15 minutes to 4 hours, and
  • varied with the origin of delivery.

In contrast to hydrophilic compounds, the concentration in tissue exceeded the applied concentration and the rate of transport was markedly slower. Furthermore, endovascular and perivascular Paclitaxel application led to differences in deposition across the blood vessel wall.

This leads to a conclusion that Paclitaxel interacts with arterial tissue elements  as it moves under the forces of

  • diffusion and
  • convection and
  • can establish substantial partitioning and spatial gradients across the tissue. (3)

Endovascular drug-eluting stents have changed the practice of  cardiovascular vascularization, and yet it is unclear how they so dramatically reduce restenosis

We don’t know how to distinguish between the different formulations available.
 Researchers are now questioning whether individual properties of different drugs beyond lipid avidity effect arterial transport and distribution.

In bovine internal carotid segments, tissue-loading profiles for

  • Hydrophobic Paclitaxel and Rapamycin are indistinguishable, reaching load steady state after 2 days.
  • Hydrophilic dextran reaches equilibrium in hours.

Paclitaxel and Rapamycin bind to the artery at 30–40 times bulk concentration, and bind to specific tissue elements.

Transmural drug distribution profiles are markedly different for the two compounds.

  • Rapamycin binds specifically to FKBP12 binding protein and it distributes evenly through the artery,
  • Paclitaxel binds specifically to microtubules, and remains primarily in the subintimal space.

The binding of Rapamycin and Paclitaxel to specific intracellular proteins plays an essential role in

  • determining arterial transport and distribution and in
  • distinguishing one compound from another.

These results offer further insight into the

  • mechanism of local drug delivery and the
  • specific use of existing drug-eluting stent formulations. (4)

The Role of Amyloid beta (A) in Creation of Vascular Toxic Plaque

Amyloid beta (A) is a peptide family produced and deposited in neurons and endothelial cells (EC).
It is found at subnanomolar concentrations in the plasma of healthy individuals.
 Simple conformational changes produce a form of A-beta , A-beta 42, which creates toxic plaque in the brains of Alzheimer’s patients.

Oxidative stress induced blood brain barrier degeneration has been proposed as a key factor for A-beta 42 toxicity.

This cannot account for lack of injury from the same peptide in healthy tissues.
Researchers hypothesized that cell state mediates A-beta’s effect.
 They examined the viability in the presence of A-beta secreted from transfected
Chinese hamster ovary cells (CHO) of

  • aortic Endothelial Cells (EC),
  • vascular smooth muscle cells (SMC) and
  • epithelial cells (EPI) in different states

A-beta was more toxic to all cell types when they were subconfluent.
 Subconfluent EC sprouted and SMC and EPI were inhibited by A-beta.
Confluent EC were virtually resistant to A-beta and suppressed A-beta production by A-beta +CHO.

Products of subconfluent EC overcame this resistant state, stimulating the production and toxicity of A-beta 42. Confluent EC overgrew >35% beyond their quiescent state in the presence of A-beta conditioned in media from subconfluent EC.

These findings imply that A-beta 42 may well be even more cytotoxic to cells in injured or growth states and potentially explain the variable and potent effects of this protein.

One may now need to consider tissue and cell state in addition to local concentration of and exposure duration to A-beta.

The specific interactions of A-beta and EC in a state-dependent fashion may help understand further the common and divergent forms of vascular and cerebral toxicity of A-beta and the spectrum of AD. (5)

(1) Perlecan is required to inhibit thrombosis after deep vascular injury and contributes
to endothelial cell-mediated inhibition of intimal hyperplasia. MA Nugent, HM Nugent,
RV Iozzoi, K Sanchack, and ER Edelman. PNAS Jun 2000; 97(12): 6722-6727


(2) Correlation of transarterial transport of various dextrans with their physicochemical properties.
O Elmalak, MA Lovich, E Edelman. Biomaterials 2000; 21: 2263-2272


(3) Arterial Paclitaxel Distribution and Deposition. CJ Creel, MA Lovich, ER Edelman. Circ Res. 2000;86:879-884


(4) Specific binding to intracellular proteins determines arterial transport properties for rapamycin and Paclitaxel.
AD Levin, N Vukmirovic, Chao-Wei Hwang, and ER Edelman. PNAS Jun 2004; 101(25): 9463–9467.
www.pnas.org/cgi/doi/10.1073/pnas.0400918101

(5) Amyloid beta toxicity dependent upon endothelial cell state. M Balcells, JS Wallins, ER Edelman.
Neuroscience Letters 441 (2008) 319–322

Endothelial Damage as an Inflammatory State

Autoimmunity may drive vascular disease through anti-endothelial cell (EC) antibodies. This raises a question about whether an increased morbidity of cardiovascular diseases in concert with systemic illnesses may involve these antibodies.

Matrix-embedded ECs act as powerful regulators of vascular repair accompanied by significant reduction in expected systemic and local inflammation.

The Lab researchers compared the immune response against free and matrix-embedded ECs in naive mice and mice with heightened EC immune reactivity. Mice were presensitized to EC with repeated subcutaneous injections of saline-suspended porcine EC (PAE) (5*10^5 cells).

On day 42, both naive mice (controls) and mice with heightened EC immune reactivity received 5*10^5 matrix-embedded or free PAEs. Circulating PAE-specific antibodies and effector T-cells were analyzed 90 days after implantation for –

  • PAE-specific antibody-titers,
  • frequency of CD4+-effector cells, and
  • xenoreactive splenocytes

These were 2- to 4-fold lower (P<0.0001) when naıve mice were injected with matrix-embedded instead of saline-suspended PAEs.

Though basal levels of circulating antibodies were significantly elevated after serial PAE injections (2210+341 mean fluorescence intensity, day 42) and almost doubled again 90 days after injection of a fourth set of free PAEs, antibody levels declined by half in recipients of matrix-embedded PAEs at day 42 (P<0.0001), as did levels of CD4+-effector cells and xenoreactive splenocytes.

A significant immune response to implantation of free PAE is elicited in naıve mice, that is even more pronounced in mice with pre-developed anti-endothelial immunity.

Matrix-embedding protects xenogeneic ECs against immune reaction in naive mice and in mice with heightened immune reactivity.

Matrix-embedded EC might offer a promising approach for treatment of advanced cardiovascular disease. (1)

Researchers examined the molecular mechanisms through which

mechanical force and hypertension modulate

endothelial cell regulation of vascular homeostasis.

Exposure to mechanical strain increased the paracrine inhibition of vascular smooth muscle cells (VSMCs) by endothelial cells.

Mechanical strain stimulated the production by endothelial cells of perlecan and heparan-sulfate glycosaminoglycans. By inhibiting the expression of perlecan with an antisense vector researchers demonstrated that perlecan was essential to the strain-mediated effects on endothelial cell growth control.

Mechanical regulation of perlecan expression in endothelial cells was

  • governed by a mechano-transduction pathway
  • requiring transforming growth factor (TGF-β) signaling and
  • intracellular signaling through the ERK pathway.

Immunohistochemical staining of the aortae of spontaneously hypertensive rats
demonstrated strong correlations between

  • endothelial TGF-β,
  • phosphorylated signaling intermediates, and
  • arterial thickening.

Studies on ex vivo arteries exposed to varying levels of pressure demonstrated that

ERK and TGF-beta signaling were required for pressure-induced upregulation of endothelial HSPG.

The Team’s findings suggest a novel feedback control mechanism in which

  • net arterial remodeling to hemodynamic forces is controlled by a dynamic interplay between growth stimulatory signals from vSMCs and
  • growth inhibitory signals from endothelial cells. (2)

Heparan-sulfate proteoglycans (HSPGs) are potent regulators of vascular remodeling and repair.
 The major enzyme capable of degrading HSPGs is heparanase, which led us to examine
the role of heparanase in controlling

  • arterial structure,
  • mechanics, and
  • remodeling.

In vitro studies suggested heparanase expression in endothelial cells serves as a negative regulator of endothelial inhibition of vascular smooth muscle cell (vSMC) proliferation.

ECs inhibit vSMC proliferation through the interplay between

  • growth stimulatory signals from vSMCs and
  • growth inhibitory signals from ECs.

This would be expected if ECs had HSPGs that are degraded by heparanase.
Arterial structure and remodeling to injury is modified by heparanase expression.
Transgenic mice overexpressing heparanase had

  • increased arterial thickness,
  • cellular density, and
  • mechanical compliance.

Endovascular stenting studies in Zucker rats demonstrated increased heparanase expression in the neointima of obese, hyperlipidemic rats in comparison to lean rats.

The extent of heparanase expression within the neointima strongly correlated with the neointimal thickness following injury. To test the effects of heparanase overexpression on arterial repair, researchers developed a novel murine model of stent injury using small diameter self-expanding stents.

Using this model, researchers found that increased

  • neointimal formation and
  • macrophage recruitment occurs in transgenic mice overexpressing heparanase.
  • Taken together, these results support a role for heparanase in the regulation of arterial structure, mechanics, and repair. (3)

The first host–donor reaction in transplantation occurs at the blood–tissue interface.
When the primary component of the implant (donor) is the endothelial cells, it incites an immunologic reaction. Injections of free endothelial cell implants elicit a profound major histocompatibility complex (MHC) II dominated immune response.

Endothelial cells embedded within three-dimensional matrices behave like quiescent endothelial cells.

Perivascular implants of such embedded ECs cells are the most potent inhibitor of intimal hyperplasia and thrombosis following controlled vascular injury, but without any immune reactivity.

Allo- and even exenogenic endothelial cells evoke no significant humoral or
cellular immune response in immune-competent hosts when embedded within matrices.
 Moreover,  endothelial implants are immune-modulatory, reducing the extent of the memory response to previous free cell implants.

Attenuated immunogenicity results in muted activation of adaptive and innate immune cells. These findings point toward a pivotal role of matrix–cell-interconnectivity for

  • the cellular immune phenotype and might therefore assist in the design  of
  • extracellular matrix components for successful tissue engineering. (4)

Because changes in subendothelial matrix composition are associated with alterations of the endothelial immune phenotype, researchers sought to understand if

  • cytokine-induced NF-κB activity and
  • downstream effects depend on substrate adherence of endothelial cells (EC).

The team compared the upstream

  • phosphorylation cascade,
  • activation of NF-ĸβ, and
  • expression/secretion

of downstream effects of EC grown on tissue culture polystyrene plates (TCPS) with EC embedded within collagen-based matrices (MEEC).

Adhesion of natural killer (NK) cells was quantified in vitro and in vivo.

  • NF-κβ subunit p65 nuclear levels were significantly lower and
  • p50 significantly higher in cytokine-stimulated MEEC than in EC-TCPS.

Despite similar surface expression of TNF-α receptors, MEEC had significantly decreased secretion and expression of IL-6, IL-8, MCP-1, VCAM-1, and ICAM-1.

Attenuated fractalkine expression and secretion in MEEC (two to threefold lower than in EC-TCPS; p < 0.0002) correlated with 3.7-fold lower NK cell adhesion to EC (6,335 ± 420 vs. 1,735 ± 135 cpm; p < 0.0002).

Furthermore, NK cell infiltration into sites of EC implantation in vivo was significantly reduced when EC were embedded within matrix.

Matrix embedding enables control of EC substratum interaction.

This in turn regulates chemokine and surface molecule expression and secretion, in particular – of those compounds within NF-κβ pathways,

  • chemoattraction of NK cells,
  • local inflammation, and
  • tissue repair. (5)

Monocyte recruitment and interaction with the endothelium is imperative to vascular recovery.

Tie2 plays a key role in endothelial health and vascular remodeling.
Researchers studied monocyte-mediated Tie2/angiopoietin signaling following interaction of primary monocytes with endothelial cells and its role in endothelial cell survival.

The direct interaction of primary monocytes with subconfluent endothelial cells

resulted in transient secretion of angiopoietin-1 from monocytes and

the activation of endothelial Tie2. This effect was abolished by preactivation of monocytes with tumor necrosis factor-α (TNFα).

Although primary monocytes contained high levels of

  • both angiopoietin 1 and 2,
  • endothelial cells contained primarily angiopoietin 2.

Seeding of monocytes on serum-starved endothelial cells reduced caspase-3 activity by 46+5.1%, and 52+5.8% after TNFα treatment, and it decreased single-stranded DNA levels by 41+4.2% and 40+ 3.5%, respectively.

This protective effect of monocytes on endothelial cells was reversed by Tie2 silencing with specific short interfering RNA.

The antiapoptotic effect of monocytes was further supported by the

  • activation of cell survival signaling pathways involving phosphatidylinositol 3-kinase,
  • STAT3, and
  • AKT.

Monocytes and endothelial cells form a unique Tie2/angiopoietin-1 signaling system that affects endothelial cell survival and may play critical a role in vascular remodeling and homeostasis. (6)

(1) Cell–Matrix Contact Prevents Recognition and Damage of Endothelial Cells in States of Heightened Immunity.
H Methe, ER Edelman. Circulation. 2006;114[suppl I]:I-233–I-238.
http://www.circulationaha.org/DOI/10.1161/CIRCULATIONAHA.105.000687

(2) Endothelial Cells Provide Feedback Control for Vascular Remodeling Through a Mechanosensitive Autocrine
TGFβ Signaling Pathway. AB Baker, DS Ettenson, M Jonas, MA Nugent, RV Iozzo, ER Edelman.
Circ. Res. 2008;103;289-297   http://dx.doi.org/10.1161/CIRCRESAHA.108.179465http://circres.ahajournals.org/cgi/content/full/103/3/289

(3) Heparanase Alters Arterial Structure, Mechanics, and Repair Following Endovascular Stenting in Mice.
AB Baker, A Groothuis, M Jonas, DS Ettenson…ER Edelman.   Circ. Res. 2009;104;380-387;
http://dx.doi.org/10.1161/CIRCRESAHA.108.180695  http://circres.ahajournals.org/cgi/content/full/104/3/380

(4) The effect of three-dimensional matrix-embedding of endothelial cells on the humoral and cellular immune response.
H Methe, S Hess, ER Edelman. Seminars in Immunology 20 (2008) 117–122. http://dx.doi.org/10.1016/j.smim.2007.12.005

(5) NF-kB Activity in Endothelial Cells Is Modulated by Cell Substratum Inter-actions and Influences Chemokine-Mediated
Adhesion of Natural Killer Cells.  S Hess, H Methe, Jong-Oh Kim, ER Edelman.
Cell Transplantation 2009; 18: 261–273


(6) Primary Monocytes Regulate Endothelial Cell Survival Through Secretion of Angiopoietin-1 and Activation of Endothelial Tie2.
SY Schubert, A Benarroch, J Monter-Solans and ER Edelman. Arterioscler Thromb Vasc Biol 2011;31;870-875
http://dx.doi.org/10.1161/ATVBAHA.110.218255

Neointimal Formation, Shear Stress, and Remodelling with Reference to Diabetes

Innate immunity is of major importance in vascular repair. The present study evaluated whether

  • systemic and transient depletion of monocytes and macrophages with
  • liposome-encapsulated bisphosphonates inhibits experimental in-stent neointimal formation.

The Experiment

Rabbits fed on a hypercholesterolemic diet underwent bilateral iliac artery balloon denudation and stent deployment.

Liposomal alendronate (3 or 6 mg/kg) was given concurrently with stenting.

  • Monocyte counts were reduced by 90% 24 to 48 hours aftera single injection of liposomal alendronate, returning to basal levels at 6 days.

This treatment significantly reduced

  • intimal area at 28 days, from 3.88+0.93 to 2.08+0.58 and 2.16 +0.62 mm2.
  • Lumen area was increased from 2.87+0.44 to 3.57­+0.65 and 3.45+0.58 mm2, and
  • arterial stenosis was reduced from 58 11% to 37 8% and 38 7% in controls, in rabbits treated with 3 mg/kg, and with 6 mg/kg, respectively (mean+SD, n=8 rabbits/group, P< 0.01 for all 3 parameters).

No drug-related adverse effects were observed.
Reduction in neointimal formation was associated with

  • reduced arterial macrophage infiltration and proliferation at 6 days and with an
  • equal reduction in intimal macrophage and smooth muscle cell content at 28 days after injury.

Conversely, drug regimens ineffective in reducing monocyte levels did not inhibit neointimal formation.
Researchers have shown that a

  • single liposomal bisphosphonates injection concurrent with injury reduces in-stent neointimal formation and
  • arterial stenosis in hypercholesterolemic rabbits, accompanied by systemic transient depletion of monocytes and macrophages. (1)

Diabetes and insulin resistance are associated with increased disease risk and poor outcomes from cardiovascular interventions.

Even drug-eluting stents exhibit reduced efficacy in patients with diabetes.
Researchers reported the first study of vascular response to stent injury in insulin-resistant and diabetic animal models.

Endovascular stents were expanded in the aortae of

  • obese insulin-resistant and
  • type 2 diabetic Zucker rats,
  • in streptozotocin-induced type 1 diabetic Sprague-Dawley rats, and
  • in matched controls.

Insulin-resistant rats developed thicker neointima (0.46+0.08 versus 0.37+0.06 mm2, P 0.05), with  decreased lumen area (2.95+0.26 versus 3.29+0.15 mm2, P 0.03) 14 days after stenting compared with controls, but without increased vascular inflammation (tissue macrophages).

Insulin-resistant and diabetic rat vessels did exhibit markedly altered signaling pathway activation 1 and 2 weeks after stenting, with up to a 98% increase in p-ERK (anti-phospho ERK) and a 54% reduction in p-Akt (anti-phospho Akt) stained cells. Western blotting confirmed a profound effect of insulin resistance and diabetes on Akt and ERK signaling in stented segments. p-ERK/p-Akt ratio in stented segments uniquely correlated with neointimal response (R2 = 0.888, P< 0.04) , but not in lean controls.

Transfemoral aortic stenting in rats provides insight into vascular responses in insulin resistance and diabetes.

Shifts in ERK and Akt signaling related to insulin resistance may reflect altered tissue repair in diabetes accompanied by a

  • shift in metabolic : proliferative balance.

These findings may help explain the increased vascular morbidity in diabetes and suggest specific therapies for patients with insulin resistance and diabetes. (2)

Researchers investigated the role of Valsartan (V) alone or in combination with Simvastatin (S) on coronary atherosclerosis and vascular remodeling, and tested the hypothesis that V or V/S attenuate the pro-inflammatory effect of low endothelial shear stress (ESS).

Twenty-four diabetic, hyperlipidemic swine were allocated into Early (n = 12) and Late (n=12) groups.
Diabetic swine in each group were treated with Placebo (n=4), V (n = 4) and V/S (n = 4) and  followed for 8 weeks in the Early group and 30 weeks in the Late group.

Blood pressure, serum cholesterol and glucose were similar across the treatment subgroups.
ESS was calculated in plaque-free subsegments of interest (n = 109) in the Late group at week 23.
Coronary arteries of this group were harvested at week 30, and the subsegments of interest were identified, and analyzed histopathologically.

Intravascular geometrically correct 3-dimensional reconstruction of the coronary arteries of 12 swine was performed 23 weeks after initiation of diabetes mellitus and a hyperlipidemic diet. Local endothelial shear stress was calculated

  • in plaque-free subsegments of interest (n=142) with computational fluid dynamics, and
  • the coronary arteries (n=31) were harvested and the same subsegments were identified at 30 weeks.

V alone or with S

  • reduced the severity of inflammation in high-risk plaques.
Both regimens attenuated the severity of enzymatic degradation of the arterial wall, reducing the severity of expansive remodeling.
  • attenuated the pro-inflammatory effect of low ESS.
V alone or with S
  • exerts a beneficial effect of reducing and stabilizing high-risk plaque characteristics independent of a blood pressure- and lipid-lowering effect. (3)

This study tested the hypothesis that low endothelial shear stress  augments the

  • expression of matrix-degrading proteases, promoting the
  • formation of thin-capped atheromata.

Researchers assessed the messenger RNA and protein expression, and elastolytic activity of selected elastases and their endogenous inhibitors.

Subsegments with low endothelial shear stress at week 23 showed

  • reduced endothelial coverage,
  • enhanced lipid accumulation, and
  • intense infiltration of activated inflammatory cells at week 30.

These lesions showed increased expression of messenger RNAs encoding

  • matrix metalloproteinase-2, -9, and -12, and cathepsins K and S
  • relative to their endogenous inhibitors and
  • increased elastolytic activity.

Expression of these enzymes correlated positively with the severity of internal elastic lamina fragmentation.

Thin-capped atheromata in regions with

  • lower preceding endothelial shear stress had
  • reduced endothelial coverage,
  • intense lipid and inflammatory cell accumulation,
  • enhanced messenger RNA expression and
  • elastolytic activity of MMPs and cathepsins with
  • severe internal elastic lamina fragmentation.

Low endothelial shear stress induces endothelial discontinuity and

  • accumulation of activated inflammatory cells, thereby
  • augmenting the expression and activity of elastases in the intima and
  • shifting the balance with their inhibitors toward matrix breakdown.

Team’s results provide new insight into the mechanisms of regional formation of plaques with thin fibrous caps. (4)

Elevated CRP levels predict increased incidence of cardiovascular events and poor outcomes following interventions. There is the suggestion that CRP is also a mediator of vascular injury.

Transgenic mice carrying the human CRP gene (CRPtg) are predisposed to arterial thrombosis post-injury.

Researchers examined whether CRP similarly modulates the proliferative and hyperplastic phases of vascular repair in CRPtg when thrombosis is controlled with daily aspirin and heparin at the time of trans-femoral arterial wire-injury.

Complete thrombotic arterial occlusion at 28 days was comparable for wild-type and CRPtg mice (14 and 19%, respectively). Neointimal area at 28d was 2.5 fold lower in CRPtg (4190±3134 m2, n = 12) compared to wild-types (10,157±8890 m2, n = 11, p < 0.05).

Likewise, neointimal/media area ratio was 1.10±0.87 in wild-types and 0.45±0.24 in CRPtg (p < 0.05).

  • Seven days post-injury, cellular proliferation and apoptotic cell number in the intima were both less pronounced in CRPtg than wild-type.
  • No differences were seen in leukocyte infiltration or endothelial coverage.
CRPtg mice had significantly reduced p38 MAPK signaling pathway activation following injury.

The pro-thrombotic phenotype of CRPtg mice was suppressed by aspirin/heparin, revealing CRP’s influence on neointimal growth after trans-femoral arterial wire-injury.

  • Signaling pathway activation,
  • cellular proliferation, and
  • neointimal formation

were all reduced in CRPtg following vascular injury.
 Increasingly the Team was aware of CRP multipotent effects.
 Once considered only a risk factor, and recently a harmful agent, CRP is a far more complex regulator of vascular biology. (5)

(1) Liposomal Alendronate Inhibits Systemic Innate Immunity and Reduces In-Stent Neointimal
Hyperplasia in Rabbits. HD Danenberg, G Golomb, A Groothuis, J Gao…, ER Edelman.
Circulation. 2003;108:2798-2804


(2) Vascular Neointimal Formation and Signaling Pathway Activation in Response to Stent Injury
in Insulin-Resistant and Diabetic Animals. M Jonas, ER Edelman, A Groothuis, AB Baker, P Seifert, C Rogers.
Circ. Res. 2005;97;725-733.        http://dx.doi.org/10.1161/01.RES.0000183730.52908.C6
http://circres.ahajournals.org/cgi/content/full/97/7/725

(3) Attenuation of inflammation and expansive remodeling by Valsartan alone or in combination with
Simvastatin in high-risk coronary atherosclerotic plaques. YS Chatzizisis, M Jonas, R Beigel, AU Coskun…
ER Edelman, CL Feldman, PH Stone.  Atherosclerosis 203 (2009) 387–394


(4) Augmented Expression and Activity of Extracellular Matrix-Degrading Enzymes in Regions of Low
Endothelial Shear Stress Colocalize With Coronary Atheromata With Thin Fibrous Caps in Pigs.
YS Chatzizisis, AB Baker, GK Sukhova,…P Libby, CL Feldman, ER Edelman, PH Stone
Circulation 2011;123;621-630     http://dx.doi.org/10.1161/CIRCULATIONAHA.110.970038
http://circ.ahajournals.org/cgi/content/full/123/6/621


(5) Neointimal formation is reduced after arterial injury in human crp transgenic mice
HD Danenberg, E Grad, RV Swaminathan, Z Chenc,…ER Edelman
Atherosclerosis 201 (2008) 85–91

A Rattle Bag of Science and the Art of Translation

Science Translational Medicine – A rattle bag of science and the art of translation
E. R. Edelman, G. A. FitzGerald.
Sci.Transl. Med. 3, 104ed3 (2011). http://dx.doi.org/10.1126/scitranslmed.3002131

Elazer R. Edelman is the Thomas D. and Virginia W. Cabot Professor of Health Sciences and Technology at MIT,
Professor of Medicine at Harvard Medical School, a coronary care unit cardiologist at the Brigham and Women’s
Hospital, and Director of the Harvard-MIT Biomedical Engineering Center. E-mail: ere@mit.edu

Garret A. FitzGerald is the McNeil Professor in Translational Medicine and Therapeutics, Chair of the Department of
Pharmacology, and Director of the Institute for Translational Medicine & Therapeutics, University of Pennsylvania.
E-mail: garret@upenn.edu

In 2011, the American Association for the Advancement of Science (AAAS)  founded Science Translational Medicine (STM)
to disseminate interdisciplinary science integrating basic and clinical research that defines and fosters new therapeutics, devices, and diagnostics.

Conceived and nourished under the creative vision of Elias Zerhouni and Katrina Kelner, the journal has attracted widespread attention.
Now, as we assume the mantle of co-chief scientific advisors, we look back on the journal’s early accomplishments, restate our mission, and make clear the kinds of manuscripts we seek and accept for publication.

STM’s mission, as articulated by Elias and Katrina, was to

“promote human health by providing a forum for communication and cross-fertilization among basic, translational, and clinical research practitioners and trainees from all relevant established and emerging disciplines.”

This statement remains relevant and accurate today.
 With this mission on our masthead, STM now receives ~25 manuscripts (full-length research articles) per week and publishes ~10% of them. Roughly half of the submissions are deemed inappropriate for the journal and are returned without review within 8 to 10 days of receipt.

Of those papers that undergo full peer review,

decisions to reject are made within 48 days and

the mean time to acceptance (including the revision period) is 125 days.

There is now an average wait of only 24 days between acceptance and publication.

Defining TRANSLATIONAL Medicine

In accord with the journal’s broad readership, the ideal manuscript meets five criteria: It
(i) reports a discovery of translational relevance with high-impact potential;
(ii) has a conceptual focus with interdisciplinary appeal;
(iii) elucidates a biological mechanism;
(iv) is innovative and novel; and
(v) is presented in clear, broadly accessible language.
 STM seeks to publish research that describes

  • how innovative concepts drive the creative biomedical science
  • that ultimately improves the quality of people’s lives—

This is the broadest of our journal’s criteria but is the one that sets us apart as well.
Translational relevance does not require demonstration of benefit in humans but does require the evident potential to advance clinical medicine, thus impacting the direction of our culture and the welfare of our communities. Conceptual focus and mechanistic emphasis discriminate our papers from those that contain observational descriptions of technical findings for which value is restricted to a specific discipline.

However, innovation and novelty may apply to a fundamental scientific discovery or to the nature of its application and relevance to the translational process. Criteria enable the journal to consider versatile technological advances that apply new and creative thinking but may not necessarily offer fresh insights into biological mechanisms. Finally, while the subsequent additional efforts of the STM editorial staff are not to be discounted, the clarity of writing and coherence of argument presented within a submitted manuscript are likely to facilitate its progress through the challenge of peer review.

On Causes – Hippocrates, Aristotle, Robert Koch, and the Dread Pirate Roberts

Elazer R. Edelman
Circulation 2001;104:2509-2512

The idea of risk factors for vascular disease has evolved

  • from a dichotomous to continuous hazard analysis and
  • from the consideration of a few factors to
  • mechanistic investigation of many interrelated risks.

However, confusion still abounds regarding issues of association and causation. Originally, the simple presence of

  • tobacco abuse, hypertension, and/or hypercholesterolemia were tallied, and
  • the cumulative score was predictive of subsequent coronary artery disease.

Since then, dose responses have been defined for these and other factors and it has been suggested that almost 300 factors place patients at risk; these factors include elevations in plasma homocysteine.
 Recent studies shed interesting light on the mechanism of this potentially causal relationship, which was first noted in 1969.

Aside from putative effects on vessel wall dynamics, there is now direct evidence that homocysteine is atherogenic. Twenty-fold increases in plasma homocysteine achieved by dietary manipulation of apoE–/– mice increased aortic root lesion size 2-fold and produced a prolonged chronic inflammatory mural response accompanied by elevations in vascular cell adhesion molecule-1 (VCAM) and tumor necrosis factor-a (TNF-a).

In long term followup, homocysteine levels elevated by

  • dietary supplementation with methionine or homocysteine
  • promoted lesion size and plaque fibrosis in these
  • atherosclerosis-prone mice early in life, but without influencing ultimate plaque burden as the animals aged.

A number of mechanisms were proposed by which homocysteine achieved this effect, including

  • promotion of inflammation,
  • regulation of lipoprotein metabolism, and
  • modification of critical biochemical pathways and
  • metabolites including nitric oxide (NO).

See p 2569
In the present issue of Circulation,

Stühlinger et al 7 advance these mechanistic insights one critical step further by defining homocysteine’s effects at an enzymatic level.

The group led by Lentz published an association between levels of the

  • endogenous inhibitor of Nirtic Oxide synthase,
  • asymmetric dimethyl arginine (ADMA), and
  • homocysteine in cultured endothelial cells and in the serum of cynomolgus monkeys.

Such an association is interesting because the L-arginine–NO synthase pathway seems to be a critical component in the full range of endothelial cell biology and vascular dysfunction.

Stühlinger et al 7  now show that increased cultured endothelial cell elaboration of ADMA by homocysteine and its precursor L-methionine is associated with a dose-dependent impairment of the activity of endothelial dimethylarginine dimethylaminohydrolase (DDAH), the enzyme that degrades ADMA. Homocysteine directly inhibited DDAH activity in a cell-free system by targeting a critical sulfhydryl group on this enzyme.

Thus, one could envision that the balance of cardiovascular health and disease could well be determined by the ability of an intact Nirtic Oxide synthase system to overcome environmental, dietary, and even genetic factors.

In patients with altered enzymatic defense systems,

  • elevated homocysteine,
  • oxidized lipoproteins,
  • inflammation, and other
  • vasotoxins

may dominate even the most potent defense mechanisms.
These studies raise a number of issues.
Do we need to add to our list of established cardiovascular risk factors to accommodate new findings and associations?
Is there a final common pathway for all risk factors or perhaps even a unified factor theory into which all potential risks can be grouped?
And, as always, should we consider Nirtic Oxide at the core of this universality?
Finally, should we change our focus altogether and speak not of risk factors but of

  • genetic predisposition,
  • extent of biochemical aberration, and
  • degree of physical damage?

Some would view these remarkable success stories and the repeated association of hyperhomocyst(e)inemia with coronary, cerebral, and peripheral vascular disease and simply advocate for increased folic acid intake for all.

Indeed, this intervention of negligible cost and

  • insignificant side effect is already partially in place;
  • many foods are fortified with folate to prevent congenital neural tube defects.

This reader considers the seminal work by Vernon Young and Yves Ingenbleek on the relationship between

  • S8 and regions distant from lava flows in Asia and Indian subcontinents,
  • where they have determined hyperhomocysteinemia and the consequence associated with:
  • veganism (not voluntary)
  • impaired methyl donor reactions and transsulfuration pathways (not corrected by B12, folate)
  • loss of lean body mass due to the constant relationship of S:N (insufficient from plant sources)

What happens, when we fail to continue to pursue causality,

  • the linkage of biological significance or scientific plausibility with
  • epidemiologically or statistically significant association?

In medicine, risk becomes the likelihood that people without a disease will acquire the disease through contact with factors thought to increase disease risk.

All of these risk factors are then, by nature, imprecise and nonspecific.
 They are stochastic measures of what will happen to normal people who fall into particular measures of these parameters.

The daring may be willing to accept these risks, citing friend and foe who live well beyond or for far lesser times than anticipated by risk alone. Such concerns may well become moot if we can simultaneously identify patients at risk

  • by linking phenotype with genotype,
  • gene expression with protein elaboration, and
  • environmental exposures with the biochemical consequences and
  • direct anatomic aberrations they induce.

This kind of characterization may well replace a family history of arterial disease as a rough estimate of

  • genotype,
  • serum cholesterol as an indirect measure of the health of lipoprotein metabolism,
  • serum glucose as a crude determinant of the ravages of diabetes mellitus,
  • blood pressure measurement as a marker of long-standing endogenous exposure to altered flow, and
  • tobacco abuse as a maker of long-standing exposure to exogenous toxins.

Rather than identifying patients on the basis of their serum cholesterol, we will have a direct measure of their

  • LDL receptor number,
  • internalization rate,
  • macrophage content in the blood vessel wall,
  • metalloproteinase activity, etc.
  • insulin receptor metabolism,
  • oxidative state, and
  • glycated burden.
  • Serum glucose will similarly give way to these tests

Evaluating a new way to open clogged arteries: Computational model offers insight into mechanisms of drug-coated balloons.

A new study from MIT analyzes the potential usefulness of a new treatment that combines the benefits of angioplasty balloons and drug-releasing stents, but may pose fewer risks. With this new approach, a balloon is inflated in the artery for only a brief period, during which it releases a drug that prevents cells from accumulating and clogging the arteries over time.
While approved for limited use in Europe, these drug-coated balloons are still in development in the United States and have not received FDA approval. The MIT study, which models the behavior of the balloons, should help scientists optimize their performance and aid regulators in evaluating their effectiveness and safety.
“Until now, people who evaluate such technology could not distinguish hype from promise,” says Elazer Edelman, the Thomas D. and Virginia W. Cabot Professor of Health Sciences and Technology and senior author of the paper describing the study, which appeared online recently in the journal Circulation.
Lead author of the paper is Vijaya Kolachalama, a former MIT postdoc who is now a principal member of the technical staff at the Charles Stark Draper Laboratory.
Edelman’s lab is investigating a possible alternative to the current treatments: drug-coated balloons. “We’re trying to understand how and when this therapy could work and identify the conditions in which it may not,” Kolachalama says. “It has its merits; it has some disadvantages.”

Modeling drug release

The drug-coated balloons are delivered by a catheter and inflated at the narrowed artery for about 30 seconds, sometimes longer. During that time, the balloon coating, containing a drug such as Zotarolimus, is released from the balloon. The properties of the coating allow the drug to be absorbed in the body’s tissues. Once the drug is released, the balloon is removed.
In their new study, Kolachalama, Edelman and colleagues set out to rigorously characterize the properties of the drug-coated balloons. After performing experiments in tissue grown in the lab and in pigs, they developed a computer model that explains the dynamics of drug release and distribution. They found that factors such as the size of the balloon, the duration of delivery time, and the composition of the drug coating all influence how long the drug stays at the injury site and how effectively it clears the arteries.
One significant finding is that when the drug is released, some of it sticks to the lining of the blood vessels. Over time, that drug is slowly released back into the tissue, which explains why the drug’s effects last much longer than the initial 30-second release period.
“This is the first time we can explain the reasons why drug-coated balloons can work,” Kolachalama says. “The study also offers areas where people can consider thinking about optimizing drug transfer and delivery.”

http://circ.ahajournals.org/content/127/20/2047.short  
http://www.mit.edu/people/vbk/Circulation_2013.pdf 
http://www.sciencedaily.com/…13/05/130521121513.ht…    
Circulation, 2013; 127 (20): 2047 – 2055
http://dx.doi.org/10.1161/CIRCULATIONAHA.113.002051;

 

Conclusion

MIT’s Edelman’s Lab conducted the pioneering work in Vascular biology, animal models of drug eluting stents and was at the forefront of Empirical Molecular Cardiology in its studies in vascular physiology, biology and biomaterials for medical devices.

Related articles

MUC1* Ligand, NM23-H1, Is a Novel Growth Factor That Maintains Human Stem Cells in a More Naïve State (plosone.org)

Mass. General team develops implantable, bioengineered rat kidney (eurekalert.org)

Suppression of JAK2/STAT3 Signaling Reduces End-to-End Arterial Anastomosis Induced Cell Proliferation in Common Carotid Arteries of Rats (plosone.org)

Blood Vessel Function and Breathing Control Adversely Affected by Cutting Back on Sleep (medindia.net)

miRNA Biogenesis Enzyme Drosha Is Required for Vascular Smooth Muscle Cell Survival (plosone.org)

Cell-Permeable Peptide Shows Promise For Controlling Cardiovascular Disease (medicalnewstoday.com)

The Heart Revolution By Kilmer McCully, Martha McCully

HarperCollinsPublishers, 1969

http://books.google.com/books?id=iYLbuZFxEt8C&pg=PR20&dq=New+York+Times+homocysteine+and+Cholesterol&hl=en&sa=X&ei=_0F7UfDRA8zB4APozIHQAQ&ved=0CEMQ6AEwAg

 

Other Related Articles that were published on this Open Access Online Scientific Journal include the following:

Modeling Targeted Therapy

Larry H Bernstein, MD, FACP 3/2/2013

Quantum Biology And Computational Medicine

Larry H Bernstein, MD, FACP 4/3/2013

Virtual Biopsy – is it possible?

Larry H Bernstein, MD, FACP 3/3/2013

Reprogramming cell fate  3/2/2013

Larry H Bernstein, MD, FACP

How Methionine Imbalance with Sulfur-Insufficiency Leads to Hyperhomocysteinemia

Larry H Bernstein, MD, FACP 4/4/2013

https://pharmaceuticalintelligence.com/2013/04/04/sulfur-deficiency-and-hyperhomocusteinemia/

Amyloidosis with Cardiomyopathy

Larry H Bernstein, MD, FACP 3/31/2013

https://pharmaceuticalintelligence.com/2013/03/31/amyloidosis-with-cardiomyopathy/

Nitric Oxide, Platelets, Endothelium and Hemostasis

Larry H Bernstein, MD, FACP 11/8/2012

https://pharmaceuticalintelligence.com/2012/11/08/nitric-oxide-platelets-endothelium-and-hemostasis/

Mitochondrial Damage and Repair under Oxidative Stress

Larry H Bernstein, MD, FACP 10/28/2012

https://pharmaceuticalintelligence.com/2012/10/28/mitochondrial-damage-and-repair-under-oxidative-stress/

Endothelial Function and Cardiovascular Disease

Larry H Bernstein, MD, FACP 10/25/2012

https://pharmaceuticalintelligence.com/2012/10/25/endothelial-function-and-cardiovascular-disease/

Endothelial Dysfunction, Diminished Availability of cEPCs, Increasing CVD Risk for Macrovascular Disease –Therapeutic Potential of cEPCs

Aviva Lev-Ari, PhD, RN 8/27/2012

Revascularization: PCI, Prior History of PCI vs CABG

Aviva Lev-Ari, PhD, RN 4/25/2013

https://pharmaceuticalintelligence.com/2013/04/25/revascularization-pci-prior-history-of-pci-vs-cabg/

Cholesteryl Ester Transfer Protein (CETP) Inhibitor: Potential of Anacetrapib to treat Atherosclerosis and CAD

Aviva Lev-Ari, PhD, RN 4/7/2013

https://pharmaceuticalintelligence.com/2013/04/07/cholesteryl-ester-transfer-protein-cetp-inhibitor-potential-of-anacetrapib-to-treat-atherosclerosis-and-cad/

Hypertriglyceridemia concurrent Hyperlipidemia: Vertical Density Gradient Ultracentrifugation a Better Test to Prevent Undertreatment of High-Risk Cardiac Patients

Aviva Lev-Ari, PhD, RN 4/4/2013

https://pharmaceuticalintelligence.com/2013/04/04/hypertriglyceridemia-concurrent-hyperlipidemia-vertical-density-gradient-ultracentrifugation-a-better-test-to-prevent-undertreatment-of-high-risk-cardiac-patients/

Fight against Atherosclerotic Cardiovascular Disease: A Biologics not a Small Molecule – Recombinant Human lecithin-cholesterol acyltransferase (rhLCAT) attracted AstraZeneca to acquire AlphaCore

Aviva Lev-Ari, PhD, RN 4/3/2013

https://pharmaceuticalintelligence.com/2013/04/03/fight-against-atherosclerotic-cardiovascular-disease-a-biologics-not-a-small-molecule-recombinant-human-lecithin-cholesterol-acyltransferase-rhlcat-attracted-astrazeneca-to-acquire-alphacore/

High-Density Lipoprotein (HDL): An Independent Predictor of Endothelial Function & Atherosclerosis, A Modulator, An Agonist, A Biomarker for Cardiovascular Risk

Aviva Lev-Ari, PhD, RN 3/31/2013

https://pharmaceuticalintelligence.com/2013/03/31/high-density-lipoprotein-hdl-an-independent-predictor-of-endothelial-function-artherosclerosis-a-modulator-an-agonist-a-biomarker-for-cardiovascular-risk/

Acute Chest Pain/ER Admission: Three Emerging Alternatives to Angiography and PCI

Aviva Lev-Ari, PhD, RN 3/10/2013

https://pharmaceuticalintelligence.com/2013/03/10/acute-chest-painer-admission-three-emerging-alternatives-to-angiography-and-pci/

Genomics & Genetics of Cardiovascular Disease Diagnoses: A Literature Survey of AHA’s Circulation Cardiovascular Genetics, 3/2010 – 3/2013

Lev-Ari, A. and L H Bernstein 3/7/2013

https://pharmaceuticalintelligence.com/2013/03/07/genomics-genetics-of-cardiovascular-disease-diagnoses-a-literature-survey-of-ahas-circulation-cardiovascular-genetics-32010-32013/

The Heart: Vasculature Protection – A Concept-based Pharmacological Therapy including THYMOSIN

Aviva Lev-Ari, PhD, RN 2/28/2013

https://pharmaceuticalintelligence.com/2013/02/28/the-heart-vasculature-protection-a-concept-based-pharmacological-therapy-including-thymosin/

Arteriogenesis and Cardiac Repair: Two Biomaterials – Injectable Thymosin beta4 and Myocardial Matrix Hydrogel

Aviva Lev-Ari, PhD, RN 2/27/2013

https://pharmaceuticalintelligence.com/2013/02/27/arteriogenesis-and-cardiac-repair-two-biomaterials-injectable-thymosin-beta4-and-myocardial-matrix-hydrogel/

Coronary artery disease in symptomatic patients referred for coronary angiography: Predicted by Serum Protein Profiles

Aviva Lev-Ari, PhD, RN 12/29/2012

https://pharmaceuticalintelligence.com/2012/12/29/coronary-artery-disease-in-symptomatic-patients-referred-for-coronary-angiography-predicted-by-serum-protein-profiles/

Special Considerations in Blood Lipoproteins, Viscosity, Assessment and Treatment

Bernstein, HL and Lev-Ari, A. 11/28/2012

https://pharmaceuticalintelligence.com/2012/11/28/special-considerations-in-blood-lipoproteins-viscosity-assessment-and-treatment/

Peroxisome proliferator-activated receptor (PPAR-gamma) Receptors Activation: PPARγ transrepression for Angiogenesis in Cardiovascular Disease and PPARγ transactivation for Treatment of Diabetes

Aviva Lev-Ari, PhD, RN 11/13/2012

https://pharmaceuticalintelligence.com/2012/11/13/peroxisome-proliferator-activated-receptor-ppar-gamma-receptors-activation-pparγ-transrepression-for-angiogenesis-in-cardiovascular-disease-and-pparγ-transactivation-for-treatment-of-dia/

Clinical Trials Results for Endothelin System: Pathophysiological role in Chronic Heart Failure, Acute Coronary Syndromes and MI – Marker of Disease Severity or Genetic Determination?

Aviva Lev-Ari, PhD, RN 10/19/2012

https://pharmaceuticalintelligence.com/2012/10/19/clinical-trials-results-for-endothelin-system-pathophysiological-role-in-chronic-heart-failure-acute-coronary-syndromes-and-mi-marker-of-disease-severity-or-genetic-determination/

Endothelin Receptors in Cardiovascular Diseases: The Role of eNOS Stimulation

Aviva Lev-Ari, PhD, RN 10/4/2012

https://pharmaceuticalintelligence.com/2012/10/04/endothelin-receptors-in-cardiovascular-diseases-the-role-of-enos-stimulation/

Inhibition of ET-1, ETA and ETA-ETB, Induction of NO production, stimulation of eNOS and Treatment Regime with PPAR-gamma agonists (TZD): cEPCs Endogenous Augmentation for Cardiovascular Risk Reduction – A Bibliography

Aviva Lev-Ari, PhD, RN 10/4/2012

https://pharmaceuticalintelligence.com/2012/10/04/inhibition-of-et-1-eta-and-eta-etb-induction-of-no-production-and-stimulation-of-enos-and-treatment-regime-with-ppar-gamma-agonists-tzd-cepcs-endogenous-augmentation-for-cardiovascular-risk-reduc/

Positioning a Therapeutic Concept for Endogenous Augmentation of cEPCs — Therapeutic Indications for Macrovascular Disease: Coronary, Cerebrovascular and Peripheral

Aviva Lev-Ari, PhD, RN 8/29/2012

https://pharmaceuticalintelligence.com/2012/08/29/positioning-a-therapeutic-concept-for-endogenous-augmentation-of-cepcs-therapeutic-indications-for-macrovascular-disease-coronary-cerebrovascular-and-peripheral/

Cardiovascular Outcomes: Function of circulating Endothelial Progenitor Cells (cEPCs): Exploring Pharmaco-therapy targeted at Endogenous Augmentation of cEPCs

Aviva Lev-Ari, PhD, RN 8/28/2012

https://pharmaceuticalintelligence.com/2012/08/28/cardiovascular-outcomes-function-of-circulating-endothelial-progenitor-cells-cepcs-exploring-pharmaco-therapy-targeted-at-endogenous-augmentation-of-cepcs/

Endothelial Dysfunction, Diminished Availability of cEPCs, Increasing CVD Risk for Macrovascular Disease – Therapeutic Potential of cEPCs

Aviva Lev-Ari, PhD, R N 8/27/2012

https://pharmaceuticalintelligence.com/2012/08/27/endothelial-dysfunction-diminished-availability-of-cepcs-increasing-cvd-risk-for-macrovascular-disease-therapeutic-potential-of-cepcs/

Vascular Medicine and Biology: CLASSIFICATION OF FAST ACTING THERAPY FOR PATIENTS AT HIGH RISK FOR MACROVASCULAR EVENTS Macrovascular Disease – Therapeutic Potential of cEPCs

Aviva Lev-Ari, PhD, RN 8/24/2012

https://pharmaceuticalintelligence.com/2012/08/24/vascular-medicine-and-biology-classification-of-fast-acting-therapy-for-patients-at-high-risk-for-macrovascular-events-macrovascular-disease-therapeutic-potential-of-cepcs/

Cardiovascular Disease (CVD) and the Role of agent alternatives in endothelial Nitric Oxide Synthase (eNOS) Activation and Nitric Oxide Production

Aviva Lev-Ari, PhD, RN 7/19/2012

https://pharmaceuticalintelligence.com/2012/07/19/cardiovascular-disease-cvd-and-the-role-of-agent-alternatives-in-endothelial-nitric-oxide-synthase-enos-activation-and-nitric-oxide-production/

Resident-cell-based Therapy in Human Ischaemic Heart Disease: Evolution in the PROMISE of Thymosin beta4 for Cardiac Repair

Aviva Lev-Ari, PhD, RN 4/30/2012

https://pharmaceuticalintelligence.com/2012/04/30/93/

Triple Antihypertensive Combination Therapy Significantly Lowers Blood Pressure in Hard-to-Treat Patients with Hypertension and Diabetes

Aviva Lev-Ari, PhD, RN 5/29/2012

https://pharmaceuticalintelligence.com/2012/05/29/445/

Macrovascular Disease – Therapeutic Potential of cEPCs: Reduction Methods for CV Risk

Aviva Lev-Ari, PhD, RN 7/2/2012

https://pharmaceuticalintelligence.com/2012/07/02/macrovascular-disease-therapeutic-potential-of-cepcs-reduction-methods-for-cv-risk/

Mitochondria Dysfunction and Cardiovascular Disease – Mitochondria: More than just the “powerhouse of the cell”

Aviva Lev-Ari, PhD, RN 7/9/2012

https://pharmaceuticalintelligence.com/2012/07/09/mitochondria-more-than-just-the-powerhouse-of-the-cell/

Bystolic’s generic Nebivolol – positive effect on circulating Endothelial Proginetor Cells endogenous augmentation

Aviva Lev-Ari, PhD, RN 7/16/2012

https://pharmaceuticalintelligence.com/2012/07/16/bystolics-generic-nebivolol-positive-effect-on-circulating-endothilial-progrnetor-cells-endogenous-augmentation/

Arteriogenesis and Cardiac Repair: Two Biomaterials – Injectable Thymosin beta4 and Myocardial Matrix Hydrogel

Aviva Lev-Ari, PhD, RN 2/27/2013

https://pharmaceuticalintelligence.com/2013/02/27/arteriogenesis-and-cardiac-repair-two-biomaterials-injectable-thymosin-beta4-and-myocardial-matrix-hydrogel/

Cardiac Surgery Theatre in China vs. in the US: Cardiac Repair Procedures, Medical Devices in Use, Technology in Hospitals, Surgeons’ Training and Cardiac Disease Severity”

Aviva Lev-Ari, PhD, RN 1/8/2013

https://pharmaceuticalintelligence.com/2013/01/08/cardiac-surgery-theatre-in-china-vs-in-the-us-cardiac-repair-procedures-medical-devices-in-use-technology-in-hospitals-surgeons-training-and-cardiac-disease-severity/

Heart Remodeling by Design – Implantable Synchronized Cardiac Assist Device: Abiomed’s Symphony

Aviva Lev-Ari, PhD, RN 7/23/2012

https://pharmaceuticalintelligence.com/2012/07/23/heart-remodeling-by-design-implantable-synchronized-cardiac-assist-device-abiomeds-symphony/

Acute Chest Pain/ER Admission: Three Emerging Alternatives to Angiography and PCI

Aviva Lev-Ari, PhD, RN 3/10/2013

https://pharmaceuticalintelligence.com/2013/03/10/acute-chest-painer-admission-three-emerging-alternatives-to-angiography-and-pci/

Dilated Cardiomyopathy: Decisions on implantable cardioverter-defibrillators (ICDs) using left ventricular ejection fraction (LVEF) and Midwall Fibrosis: Decisions on Replacement using late gadolinium enhancement cardiovascular MR (LGE-CMR)

Aviva Lev-Ari, PhD, RN 3/10/2013
https://pharmaceuticalintelligence.com/2013/03/10/dilated-cardiomyopathy-decisions-on-implantable-cardioverter-defibrillators-icds-using-left-ventricular-ejection-fraction-lvef-and-midwall-fibrosis-decisions-on-replacement-using-late-gadolinium/

The Heart: Vasculature Protection – A Concept-based Pharmacological Therapy including THYMOSIN

Aviva Lev-Ari, PhD, RN 2/28/2013
https://pharmaceuticalintelligence.com/2013/02/28/the-heart-vasculature-protection-a-concept-based-pharmacological-therapy-including-thymosin/

FDA Pending 510(k) for The Latest Cardiovascular Imaging Technology

Aviva Lev-Ari, PhD, RN 1/28/2013
https://pharmaceuticalintelligence.com/2013/01/28/fda-pending-510k-for-the-latest-cardiovascular-imaging-technology/

PCI Outcomes, Increased Ischemic Risk associated with Elevated Plasma Fibrinogen not Platelet Reactivity

Aviva Lev-Ari, PhD, RN 1/10/2013
https://pharmaceuticalintelligence.com/2013/01/10/pci-outcomes-increased-ischemic-risk-associated-with-elevated-plasma-fibrinogen-not-platelet-reactivity/

The ACUITY-PCI score: Will it Replace Four Established Risk Scores — TIMI, GRACE, SYNTAX, and Clinical SYNTAX

Aviva Lev-Ari, PhD, RN
https://pharmaceuticalintelligence.com/2013/01/03/the-acuity-pci-score-will-it-replace-four-established-risk-scores-timi-grace-syntax-and-clinical-syntax/

Coronary artery disease in symptomatic patients referred for coronary angiography: Predicted by Serum Protein Profiles

Aviva Lev-Ari, PhD, RN
https://pharmaceuticalintelligence.com/2012/12/29/coronary-artery-disease-in-symptomatic-patients-referred-for-coronary-angiography-predicted-by-serum-protein-profiles/

Heart Renewal by pre-existing Cardiomyocytes: Source of New Heart Cell Growth Discovered

Aviva Lev-Ari, PhD, RN 12/23/2012
https://pharmaceuticalintelligence.com/2012/12/23/heart-renewal-by-pre-existing-cardiomyocytes-source-of-new-heart-cell-growth-discovered/

Cardiovascular Risk Inflammatory Marker: Risk Assessment for Coronary Heart Disease and Ischemic Stroke – Atherosclerosis.

Aviva Lev-Ari, PhD, RN 10/30/2012
https://pharmaceuticalintelligence.com/2012/10/30/cardiovascular-risk-inflammatory-marker-risk-assessment-for-coronary-heart-disease-and-ischemic-stroke-atherosclerosis/

To Stent or Not? A Critical Decision

Aviva Lev-Ari, PhD, RN 10/23/2012
https://pharmaceuticalintelligence.com/2012/10/23/to-stent-or-not-a-critical-decision/

New Definition of MI Unveiled, Fractional Flow Reserve (FFR)CT for Tagging Ischemia

Aviva Lev-Ari, PhD, RN 8/27/2012
https://pharmaceuticalintelligence.com/2012/08/27/new-definition-of-mi-unveiled-fractional-flow-reserve-ffrct-for-tagging-ischemia/

Ethical Considerations in Studying Drug Safety — The Institute of Medicine Report

Aviva Lev-Ari, PhD, RN 8/23/2012
https://pharmaceuticalintelligence.com/2012/08/23/ethical-considerations-in-studying-drug-safety-the-institute-of-medicine-report/

New Drug-Eluting Stent Works Well in STEMI

Aviva Lev-Ari, PhD, RN 8/22/2012
https://pharmaceuticalintelligence.com/2012/08/22/new-drug-eluting-stent-works-well-in-stemi/

Expected New Trends in Cardiology and Cardiovascular Medical Devices

Aviva Lev-Ari, PhD, RN 8/17/2012
https://pharmaceuticalintelligence.com/2012/08/17/expected-new-trends-in-cardiology-and-cardiovascular-medical-devices/

Coronary Artery Disease – Medical Devices Solutions: From First-In-Man Stent Implantation, via Medical Ethical Dilemmas to Drug Eluting Stents

Aviva Lev-Ari, PhD, RN 8/13/2012

https://pharmaceuticalintelligence.com/2012/08/13/coronary-artery-disease-medical-devices-solutions-from-first-in-man-stent-implantation-via-medical-ethical-dilemmas-to-drug-eluting-stents/

Percutaneous Endocardial Ablation of Scar-Related Ventricular Tachycardia

Aviva Lev-Ari, PhD, RN 7/18/2012

https://pharmaceuticalintelligence.com/2012/07/18/percutaneous-endocardial-ablation-of-scar-related-ventricular-tachycardia/

Competition in the Ecosystem of Medical Devices in Cardiac and Vascular Repair: Heart Valves, Stents, Catheterization Tools and Kits for Open Heart and Minimally Invasive Surgery (MIS)

Aviva Lev-Ari, PhD, RN 6/22/2012

https://pharmaceuticalintelligence.com/2012/06/22/competition-in-the-ecosystem-of-medical-devices-in-cardiac-and-vascular-repair-heart-valves-stents-catheterization-tools-and-kits-for-open-heart-and-minimally-invasive-surgery-mis/

Global Supplier Strategy for Market Penetration & Partnership Options (Niche Suppliers vs. National Leaders) in the Massachusetts Cardiology & Vascular Surgery Tools and Devices Market for Cardiac Operating Rooms and Angioplasty Suites

Aviva Lev-Ari, PhD, RN 6/22/2012

https://pharmaceuticalintelligence.com/2012/06/22/global-supplier-strategy-for-market-penetration-partnership-options-niche-suppliers-vs-national-leaders-in-the-massachusetts-cardiology-vascular-surgery-tools-and-devices-market-for-car/

Blood_Vessels

Blood_Vessels (Photo credit: shoebappa)

Visceral Myopathy in Statins

Visceral Myopathy in Statins (Photo credit: Snipergirl)

Medical science has advanced significantly sin...

Medical science has advanced significantly since 1507, when Leonardo da Vinci drew this diagram of the internal organs and vascular systems of a woman. (Photo credit: Wikipedia)

English: Lee Hood, MD, PhD, President and Co-f...

English: Lee Hood, MD, PhD, President and Co-found of the Institute for Systems Biology (Photo credit: Wikipedia)

Read Full Post »


Identification of Biomarkers that are Related to the Actin Cytoskeleton

Curator and Writer: Larry H Bernstein, MD, FCAP

This is Part I in a series of articles on Calcium and Cell motility.

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IXCalcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

 

In this article the Author will cover two types of biomarker on the function of actin in cytoskeleton mobility in situ.

  • First, is an application in developing the actin or other component, for a biotarget and then, to be able to follow it as

(a) a biomarker either for diagnosis, or

(b) for the potential treatment prediction of disease free survival.

  • Second, is mostly in the context of MI, for which there is an abundance of work to reference, and a substantial body of knowledge about

(a) treatment and long term effects of diet, exercise, and

(b) underlying effects of therapeutic drugs.

1.  Cell Membrane (cytoskeletal) Plasticity

Refer to … Squeezing Ovarian Cancer Cells to Predict Metastatic Potential: Cell Stiffness as Possible Biomarker

Reporter/curator: Prabodh Kandala, PhD

New Georgia Tech research shows that cell stiffness could be a valuable clue for doctors as they search for and treat cancerous cells before they’re able to spread. The findings, which are published in the journal PLoS One, found that highly metastatic ovarian cancer cells are several times softer than less metastatic ovarian cancer cells. This study used atomic force microscopy (AFM) to study the mechanical properties of various ovarian cell lines. A soft mechanical probe “tapped” healthy, malignant and metastatic ovarian cells to measure their stiffness. In order to spread, metastatic cells must push themselves into the bloodstream. As a result, they must be highly deformable and softer. This study results indicate that cell stiffness may be a useful biomarker to evaluate the relative metastatic potential of ovarian and perhaps other types of cancer cells.

Comparative gene expression analyses indicate that the reduced stiffness of highly metastatic HEY A8 cells is associated with actin cytoskeleton remodeling and microscopic examination of actin fiber structure in these cell lines is consistent with this prediction.   The results suggest either of two approaches. Atomic Force Microscopy is not normally used by pathologists in diagnostics. Electron microscopy requires space for making and cutting the embedded specimen, and a separate room for the instrument. The instrument is large and the technique was not suitable for anything other than research initially until EM gained importance in Renal Pathology. It has not otherwise been used.  This new method looks like it might be more justified over a spectrum of cases.

A.  Atomic Force Microscopy

So the first point related to microscopy is whether AFM has feasibility for routine clinical use in the pathologists’ hands. This requires:

  1. suitable size of equipment
  2.  suitable manipulation of the specimen
  3. The question of whether you are using overnight fixed specimen, or whether the material is used unfixed
  4. Nothing is said about staining of cells for identification.
  5. Then there is the question about whether this will increase the number of Pathologist Assistants used across the country, which I am not against.   This would be the end of “house” trained PAs, and gives more credence to the too few PA programs across the country. The PA programs have to be reviewed and accredited by NAACLS (I served 8 years on the Board). A PA is represented on the Board, and programs are inspected by qualified peers.   There is no academic recognition given to this for tenure and promotion in Pathology Departments, and a pathologist is selected for a medical advisory role by the ASCP, and must be a Medical Advisor to a MLS accredited Program.   The fact is that PAs do gross anatomic dictation of selected specimens, and they do autopsies under the guidance of a pathologist. This is the reality of the profession today. The pathologist has to be in attendance at a variety of quality review conferences, for surgical morbidity and mortality to obstetrics review, and the Cancer Review. Cytopathology and cytogenetics are in the pathology domain.   In the case of tumors of the throat, cervix, and accessible orifices, it seems plausible to receive a swab for preparation. However, sampling error is greater than for a biopsy. A directed needle biopsy or a MIS specimen is needed for the ovary.

B.  identification of biomarkers that are related to the actin cytoskeleton

The alternative to the first approach is the identification of biomarkers that are related to the actin cytoskeleton, perhaps in the nature of the lipid or apoprotein isoform that gives the cell membrane deformability. The method measuring by Atomic Force Microscopy is shown with the current method of cytological screening, and I call attention to cells clustered together that have a scant cytoplasm surrounding nuclei occupying 1/2 to 3/4 of the cell radius.  The cells are not anaplastic, but the clumps are suggestive of glnad forming epithelium.

English: Animation showing 3-D nature of clust...

English: Animation showing 3-D nature of cluster. Image:Serous carcinoma 2a – cytology.jpg (Photo credit: Wikipedia)

The cell membrane, also called the plasma memb...

The cell membrane, also called the plasma membrane or plasmalemma, is a semipermeable lipid bilayer common to all living cells. It contains a variety of biological molecules, primarily proteins and lipids, which are involved in a vast array of cellular processes. It also serves as the attachment point for both the intracellular cytoskeleton and, if present, the cell wall. (Photo credit: Wikipedia)

English: AFM bema detection

AFM non contact mode

AFM non contact mode (Photo credit: Wikipedia)

C.  The diagnosis of ovarian cancer can be problematic because it can have a long period of growth undetected.

On the other hand, it is easily accessible once there is reason to suspect it. They are terrible to deal with because they metastasize along the abdominal peritoneum and form a solid cake. It is a problem of location and silence until it is late. Once they do announce a presence on the abdominal wall, there is probably a serous effusion. It was not possible to rely on a single marker, but when CA125 was introduced, Dr. Marguerite Pinto, Chief of Cytology at Bridgeport Hospital-Yale New Haven Health came to the immnunochemistry lab and we worked out a method for analyzing effusions, as we had already done with carcinoembryonic antigen.       The use of CEA and CA125 was published by Pinto and Bernstein as a first that had an impact.  This was followed by a study with the Chief of Oncology, Dr. Martin Rosman, that showed that the 30 month survival of patients post treatment is predicted by the half-life of disappearance of CA125 in serum.  At the time of this writing, I am not sure of the extent of its use 20 years later. History has taught us that adoption can be slow, depending very much on dissemination from major academic medical centers.  On the other hand, concepts can also be stuck at academic medical centers because of a rigid and unprepared mindset in the professional community.  The best example of this is the story of Ignaz Semmelweis, the best student of Rokitansky in Vienna for discovering the cause and prevention of childbirth fever at a time that nursemaids had far better results at obstetrical delivery than physicians.  Contrary to this, Edward Jenner, the best student of John Hunter (anatomist, surgeon, and physician to James Hume), discovered vaccination from the observation that milkmaids did not get smallpox (cowpox was a better alternative).
Only this year a Nobel Prize in Physics was awarded to an Israeli scientist who, working in the US, was unable to convince his associates of his discovery of PSEUDOCRYSTALS. – Diagnostic efficiency of carcinoembryonic antigen and CA125 in the cytological evaluation of effusions. M M Pinto, L H Bernstein, R A Rudolph, D A Brogan, M Rosman Arch Pathol Lab Med 1992; 116(6):626-631 ICID: 825503 Article type: Review article – Immunoradiometric assay of CA 125 in effusions. Comparison with carcinoembryonic antigen. M M Pinto, L H Bernstein, D A Brogan, E Criscuolo Cancer 1987; 59(2):218-222 ICID: 825555 Article type: Review article – Carcinoembryonic antigen in effusions. A diagnostic adjunct to cytology. M M Pinto, L H Bernstein, D A Brogan, E M Criscuolo Acta Cytologica 1987; 31(2):113-118 ICID: 825557

Predictive Modeling

Ovarian Cancer a plot of the CA125 elimination half-life vs the Kullback-Liebler distance

Ca125 half-life vs Kullback Entropy                                                          HL vs Survival KM plot 

Troponin(s) T, I, C  and the contractile apparatus  (contributed by Aviva Lev-Ari, PhD, RN)

 

For 2012 – 2013 Frontier Contribution in Cardiology on Gene Therapy Solutions for Improving Myocardial Contractility, see

Lev-Ari, A. 8/1/2013 Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

For explanation of Conduction prior to Myocardial Contractility, see

Lev-Ari, A. 4/28/2013 Genetics of Conduction Disease: Atrioventricular (AV) Conduction Disease (block): Gene Mutations – Transcription, Excitability, and Energy Homeostasis

https://pharmaceuticalintelligence.com/2013/04/28/genetics-of-conduction-disease-atrioventricular-av-conduction-disease-block-gene-mutations-transcription-excitability-and-energy-homeostasis/

The contraction of skeletal muscle is triggered by nerve impulses, which stimulate the release of Ca2+ from the sarcoplasmic reticulum—a specialized network of internal membranes, similar to the endoplasmic reticulum, that stores high concentrations of Ca2+ ions. The release of Ca2+ from the sarcoplasmic reticulum increases the concentration of Ca2+ in the cytosol from approximately 10-7 to 10-5 M. The increased Ca2+ concentration signals muscle contraction via the action of two accessory proteins bound to the actin filaments: tropomyosin and troponin (Figure 11.25). Tropomyosin is a fibrous protein that binds lengthwise along the groove of actin filaments. In striated muscle, each tropomyosin molecule is bound to troponin, which is a complex of three polypeptides: troponin C (Ca2+-binding), troponin I (inhibitory), and troponin T (tropomyosin-binding).

  • When the concentration of Ca2+ is low, the complex of the troponins with tropomyosin blocks the interaction of actin and myosin, so the muscle does not contract.
  • At high concentrations, Ca2+ binding to troponin C shifts the position of the complex, relieving this inhibition and allowing contraction to proceed.

Figure 11.25

Association of tropomyosin and troponins with actin filaments. (A) Tropomyosin binds lengthwise along actin filaments and, in striated muscle, is associated with a complex of three troponins: troponin I (TnI), troponin C (TnC), and troponin T (TnT). In (more…)
Contractile Assemblies of Actin and Myosin in Nonmuscle Cells

Contractile assemblies of actin and myosin, resembling small-scale versions of muscle fibers, are present also in nonmuscle cells. As in muscle, the actin filaments in these contractile assemblies are interdigitated with bipolar filaments of myosin II, consisting of 15 to 20 myosin II molecules, which produce contraction by sliding the actin filaments relative to one another (Figure 11.26). The actin filaments in contractile bundles in nonmuscle cells are also associated with tropomyosin, which facilitates their interaction with myosin II, probably by competing with filamin for binding sites on actin.

Figure 11.26

Contractile assemblies in nonmuscle cells. Bipolar filaments of myosin II produce contraction by sliding actin filaments in opposite directions.

Two examples of contractile assemblies in nonmuscle cells, stress fibers and adhesion belts, were discussed earlier with respect to attachment of the actin cytoskeleton to regions of cell-substrate and cell-cell contacts (see Figures 11.13 and 11.14). The contraction of stress fibers produces tension across the cell, allowing the cell to pull on a substrate (e.g., the extracellular matrix) to which it is anchored. The contraction of adhesion belts alters the shape of epithelial cell sheets: a process that is particularly important during embryonic development, when sheets of epithelial cells fold into structures such as tubes.

The most dramatic example of actin-myosin contraction in nonmuscle cells, however, is provided by cytokinesis—the division of a cell into two following mitosis (Figure 11.27). Toward the end of mitosis in animal cells, a contractile ring consisting of actin filaments and myosin II assembles just underneath the plasma membrane. Its contraction pulls the plasma membrane progressively inward, constricting the center of the cell and pinching it in two. Interestingly, the thickness of the contractile ring remains constant as it contracts, implying that actin filaments disassemble as contraction proceeds. The ring then disperses completely following cell division.

Figure 11.27

Cytokinesis. Following completion of mitosis (nuclear division), a contractile ring consisting of actin filaments and myosin II divides the cell in two.

http://www.ncbi.nlm.nih.gov/books/NBK9961/

2.  Use of Troponin(s) in Diagnosis

Troponins T and I are released into the circulation at the time of an acute coronary syndrome (ACS).  Troponin T was first introduced by Roche (developed in Germany) for the Roche platform as a superior biomarker for identifying acute myocardial infarction (AMI), because of a monoclonal specificity to the cardiac troponin T.  It could not be measured on any other platform (limited license patent), so the Washington University Clinical Chemistry group developed a myocardiocyte specific troponin I that quickly became widely available to Beckman, and was adapted to other instruments.  This was intended to replace the CK isoenzyme MB, that is highly elevated in rhabdomyolysis associated with sepsis or with anesthesia in special cases.

The troponins I and T had a tenfold scale difference, and the Receiver Operator Curve Generated cutoff was accurate for AMI, but had significant elevation with end-stage renal disease.  The industry worked in concert to develop a high sensitivity assay for each because there were some missed AMIs just below the ROC cutoff, which could be interpreted as Plaque Rupture.  However, the concept of plaque rupture had to be reconsidered, and we are left with type1 and type 2 AMI (disregarding the case of post PCI or CABG related).   This led to the current establishment of 3 standard deviations above the lowest measureable level at 10% coefficient of variation.  This has been discussed sufficiently elsewhere.  It did introduce a problem in the use of the test as a “silver bullet” once the finer distinctions aqnd the interest in using the test for prognosis as well as diagnosis.   This is where the use of another protein associated with heart failure came into play – either the B type natriuretic peptide, or its propeptide, N-terminal pro BNP.  The prognostic value of using these markers, secreted by the HEART and acting on the kidneys (sodium reabsorption) has proved useful.  But there has not been a multivariate refinement of the use of a two biomarker approach.  In the following part D, I illustrate what can be done with an algorithmic approach to multiple markers.

Software Agent for Diagnosis of AMI

Isaac E. Mayzlin, Ph.D., David Mayzlin, Larry H. Bernstein, M.D. The so called gold standard of proof of a method is considered the Receiver-Operating Characteristic Curve, developed for detecting “enemy planes or missiles”, and adopted first by radiologists in medicine.  This matches the correct “hits” to the actual calssification and it is generally taught as a plot of sensitivity vs (1 – specifity).  But what if you had no “training” variable?  Work inspired by Eugene Rypka’s bacterial classification led to Rosser Rudolph’s application of the Entropy of Shannon and Weaver to identify meaningful information, referring to what was Kullback-Liebler distance as “effective information”.  This allowed Rudolph and Bernstein to classify using disease biomarkers obtaing the same results as the ROC curve using an apl program.  The same data set was used by Bernstein, Adan et al. previously, and was again used by Izaak Mayzlin from University of Moscow with a new wrinkle.  Dr. Mayzlin created a neural network (Maynet), and then did a traditional NN with training on the data, and also clustered the data using geometric distance clustering and trained on the clusters.  It was interesting to see that the optimum cluster separation was closely related to the number of classes and the accuracy of classification.  An earlier simpler model using the slope of the MB isoenzyme increase and percent of total CK activity was perhaps related to Burton Sobel’s work on CK-MB disappearance rate for infarct size. The main process consists of three successive steps: (1)       clustering performed on training data set, (2)       neural network’s training on clusters from previous step, and (3)       classifier’s accuracy evaluation on testing data. The classifier in this research will be the ANN, created on step 2, with output in the range [0,1], that provides binary result (1 – AMI, 0 – not AMI), using decision point 0.5. Table  1.  Effect  of  selection  of  maximum  distance  on  the  number  of  classes  formed  and  on  the accuracy of recognition by ANN

Clustering Distance Factor F(D = F * R) Number ofClasses Number of Nodes in The Hidden Layers Number of Misrecognized Patterns inThe TestingSet of 43 Percent ofMisrecognized
10.90.80.7 2414135 1,  02,  03,  01,  02,  03,  0 3,  2 3,  2 121121 1 1 2.34.62.32.34.62.3 2.3 2.3

Creatine kinase B-subunit activity in serum in cases of suspected myocardial infarction: a prediction model based on the slope of MB increase and percentage CK-MB activity. L H Bernstein, G Reynoso Clin Chem 1983; 29(3):590-592 ICID: 825549 Diagnosis of acute myocardial infarction from two measurements of creatine kinase isoenzyme MB with use of nonparametric probability estimation. L H Bernstein, I J Good, G I Holtzman, M L Deaton, J Babb.  Clin Chem 1989; 35(3):444-447 ICID: 825570 – Information induction for predicting acute myocardial infarction. R A Rudolph, L H Bernstein, J Babb. Clin Chem 1988; 34(10):2031-2038 ICID: 825568

Related articles

Related articles published on this Open Access Online Scientific Journal, include the following:

Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN 8/1/2013

https://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

High-Sensitivity Cardiac Troponin Assays- Preparing the United States for High-Sensitivity Cardiac Troponin Assays

Larry Bernstein, MD, FCAP 6/13/2013

https://pharmaceuticalintelligence.com/2013/06/13/high-sensitivity-cardiac-troponin-assays/

Dealing with the Use of the High Sensitivity Troponin (hs cTn) Assays

Larry Bernstein and Aviva Lev-Ari  5/18/2013

https://pharmaceuticalintelligence.com/2013/05/18/dealing-with-the-use-of-the-hs-ctn-assays/

Acute Chest Pain/ER Admission: Three Emerging Alternatives to Angiography and PCI – Corus CAD, hs cTn, CCTA

Aviva Lev-Ari  3/10/2013

https://pharmaceuticalintelligence.com/2013/03/10/acute-chest-painer-admission-three-emerging-alternatives-to-angiography-and-pci/

  • Redberg’s conclusions are correct for the initial screening. The issue has been whether to do further testing for low or intermediate risk patients.
  • The most intriguing finding that is not at all surprising is that the CCTA added very little in the suspect group with small or moderate risk.
  • The ultra sensitive troponin threw the ROC out the window
  • The improved assay does pick up minor elevations of troponin in the absence of MI.

Critical Care | Abstract | Cardiac ischemia in patients with septic …
Aviva Lev-Ari  6/26/2013
https://pharmaceuticalintelligence.com/2013/06/26/critical-care-abstract-cardiac-ischemia-in-patients-with-septic/

  • refer to:  Cardiac ischemia in patients with septic shock randomized to vasopressin or norepinephrine

Mehta S, Granton J,  Gordon AC, Cook DJ, et al.
Critical Care 2013, 17:R117   http://dx.doi.org/10.1186/cc12789
Troponin and CK levels, and rates of ischemic ECG changes were similar in the VP and NE groups. In multivariable analysis

  • only APACHE II was associated with 28-day mortality (OR 1.07, 95% CI 1.01-1.14, p=0.033).

Assessing Cardiovascular Disease with Biomarkers

Larry H Bernstein, MD, FCAP 12/25/2012

https://pharmaceuticalintelligence.com/2012/12/25/assessing-cardiovascular-disease-with-biomarkers/

Vascular Medicine and Biology: CLASSIFICATION OF FAST ACTING THERAPY FOR PATIENTS AT HIGH RISK FOR MACROVASCULAR EVENTS Macrovascular Disease – Therapeutic Potential of cEPCs

Aviva Lev-Ari, PhD, RN 8/24/2012

https://pharmaceuticalintelligence.com/2012/08/24/vascular-medicine-and-biology-classification-of-fast-acting-therapy-for-patients-at-high-risk-for-macrovascular-events-macrovascular-disease-therapeutic-potential-of-cepcs/

 PENDING Integration

  • ‘Ryanopathy’: causes and manifestations of RyR2 dysfunction in heart failureCardiovasc Res. 2013;98:240-247,
  • Up-regulation of sarcoplasmic reticulum Ca2+ uptake leads to cardiac hypertrophy, contractile dysfunction and early mortality in mice deficient in CASQ2Cardiovasc Res. 2013;98:297-306,
  • Myocardial Delivery of Stromal Cell-Derived Factor 1 in Patients With Ischemic Heart Disease: Safe and PromisingCirc. Res.. 2013;112:746-747,
  • Circulation Research Thematic Synopsis: Cardiovascular GeneticsCirc. Res.. 2013;112:e34-e50,
  • Gene and cytokine therapy for heart failure: molecular mechanisms in the improvement of cardiac functionAm. J. Physiol. Heart Circ. Physiol.. 2012;303:H501-H512,
  • Ryanodine Receptor Phosphorylation and Heart Failure: Phasing Out S2808 and “Criminalizing” S2814Circ. Res.. 2012;110:1398-1402,

http://circres.ahajournals.org/content/110/5/777.figures-only

Read Full Post »