Advertisements
Feeds:
Posts
Comments

Posts Tagged ‘Thrombin’


Topical Bovine Thrombin Induces Vascular Cell Proliferation

Demet Sağ, Kamran Baig*, Steven Hanish*, Jeffrey Lawson

 

 

 

Running Foot:

Use of bovine thrombin induces the cell proliferation at anastomosis

Department of Surgery

Duke University Medical Center

Durham, NC 27710

United States of America

* Equally worked

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Box 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu

demet.sag@gmail.com

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Abstract:

Specific Aim:  The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.

Methods and Results:  Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery.    Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting.  Expression of PAR  (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR.  All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin.  These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK.  Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.

Conclusion:  Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.

Abbreviations: ERK, extracellular regulated kinase; ES, embryonic stem cells; JIP, JNK-interacting protein; JNK, c-Jun NH2-terminal kinase; JNKK, JNK kinase; JNKBP, JNK binding protein; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MEK, MAPK/ERK kinase; MEKK, MEK kinase; MKK, MAPK kinase.

Keywords: Hemostatics, Signal transduction; Thrombin, PTGF

————————————————————————————————————

Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4].  It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI  during various surgical procedures.  Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6].  Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].

Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin.  It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9].  Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10].  Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.

Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs.  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].

Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself.  There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs)   [24-27].

Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33].  To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure.  We had tested the impact of topical bovine thrombin affect at the anastomosis.

Materials and Methods:

Surgical Procedure:  We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency.  Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine.  Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days.  In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used.   Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.

Ki67 Immunostaining:  The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks.  The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0).  The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum.  The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast.  As a result, positive tissues became brown and negatives were red.

MAPKs Immunostaining:  The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody.  The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.

Immunoblotting:  Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h.  Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS.  The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).

RNA isolation and RT-PCR: The harvested vessels were kept in RNAlater (Ambion, Austin, TX).   The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.

The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler.  The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse); PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT  3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).

CTGF and Cyr61:  The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers.  For CTGF the primers were  forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.

RESULTS:

First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin.   Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs.   We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment.    These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr  treatment with BT.  This data  the hypothesis for the function of PAR receptors in vascular tissues that  they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.

 

TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:

Next question was to make linear correlation between the expressions of PARs  to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues.   Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes.  Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared.  If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min.  Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli.  The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls.    Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.

Proliferation of the tissue depends on pERK

PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen.   Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured.   As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.

First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues).  We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins.  The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls.  This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.

The next target was JNK that plays a role in the inflammation, stress, and differentiation.    In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application.  This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients.   The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots.  Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.

Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues.  The expression of p38 was higher than JNK but much lower than ERK.  Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.

In general, all MAPKs showed increased in their phosphorylation level.  The level of activated MAPK expression was increased 200% in the tested animal.  The order of expression from high to low would be  ERK, JNK, and p38.

The genetic expression change

The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement.   Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection.  The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment.  Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.

DISCUSSION:

The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access  that leads to the cell proliferation and inflammation  through MAPKs  as well as  downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.

From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues.  We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding.  This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.

It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions.  In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent.   Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.

The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used.  The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle.  In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase.  During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.

Next, level of evidence was the signaling pathway analysis from membrane to the nucleus.  As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK,  pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel.  Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK).  The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation.  In our data we had detected the elvation of ERK more than the other MAPKs.   In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.

Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis.  The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.  

Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered  thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.

 

 

 

 

 

 

 

REFERENCES:

1.         Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.

2.         Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.

3.         TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.

4.         Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.

5.         Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.

6.         Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.

7.         Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.

8.         Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.

9.         Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.

10.       Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.

11.       Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.

12.       Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.

13.       Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.

14.       Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.

15.       Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.

16.       Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.

17.       Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.

18.       Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.

19.       Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.

20.       Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.

21.       Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.

22.       Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.

23.       Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.

24.       Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.

25.       Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.

26.       Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.

27.       Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.

28.       Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.

29.       Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.

30.       Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.

31.       Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.

32.       Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.

33.       McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.

34.       Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.

35.       Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.

36.       Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.

37.       Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.

38.       Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.

39.       Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.

40.       Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.

41.       Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.

Figure Legends:

Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR.        PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr

Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation

Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues

Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues

Figure 5: The activity of p38. (A) Immunostaining of total and activated p38.  Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues

Figure 6: The Expression of CTGF and Cyr61 after Thrombin Treatment. (A)CTGF            (B) Cyr61 expressions of treated and un-treated with TBT veins at 24h and 7 days.Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment

Advertisements

Read Full Post »


The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and PathologyDuke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »


aprotinin-sequence.Par.0001.Image.260

aprotinin-sequence.Par.0001.Image.260 (Photo credit: redondoself)

English: Protein folding: amino-acid sequence ...

Protein folding: amino-acid sequence of bovine BPTI (basic pancreatic trypsin inhibitor) in one-letter code, with its folded 3D structure represented by a stick model of the mainchain and sidechains (in gray), and the backbone and secondary structure by a ribbon colored blue to red from N- to C-terminus. 3D structure from PDB file 1BPI, visualized in Mage and rendered in Raster3D. (Photo credit: Wikipedia)

 

 

 

 

 

 

 

 

 

 

 

 

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Demet Sag, PhD*†, Kamran Baig, MBBS, MRCS; James Jaggers, MD, Jeffrey H. Lawson, MD, PhD

Departments of Surgery and Pathology (J.H.L.) Duke University Medical Center Durham, NC  27710

Correspondence and Reprints:

                             Jeffrey H. Lawson, M.D., Ph.D.

                              Departments of Surgery & Pathology

                              DUMC Box 2622

                              Durham, NC  27710

                              (919) 681-6432 – voice

                              (919) 681-1094 – fax

                              lawso006@mc.duke.edu

*Current Address: Demet SAG, PhD

                          3830 Valley Centre Drive Suite 705-223, San Diego, CA 92130

Support:

Word Count: 4101 Journal Subject Heads:  CV surgery, endothelial cell activationAprotinin, Protease activated receptors,

Potential Conflict of Interest:         None

Abstract

Introduction:  Cardiopulmonary bypass is associated with a systemic inflammatory response syndrome, which is responsible for excessive bleeding and multisystem dysfunction. Endothelial cell activation is a key pathophysiological process that underlies this response. Aprotinin, a serine protease inhibitor has been shown to be anti-inflammatory and also have significant hemostatic effects in patients undergoing CPB. We sought to investigate the effects of aprotinin at the endothelial cell level in terms of cytokine release (IL-6), tPA release, tissue factor expression, PAR1 + PAR2 expression and calcium mobilization. Methods:  Cultured Human Umbilical Vein Endothelial Cells (HUVECS) were stimulated with TNFa for 24 hours and treated with and without aprotinin (200KIU/ml + 1600KIU/ml). IL-6 and tPA production was measured using ELISA. Cellular expression of Tissue Factor, PAR1 and PAR2 was measured using flow cytometry. Intracellular calcium mobilization following stimulation with PAR specific peptides and agonists (trypsin, thrombin, Human Factor VIIa, factor Xa) was measured using fluorometry with Fluo-3AM. Results: Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNFa stimulated HUVECS (p=0.043). Aprotinin treatment of TNFa activated endothelial cells significantly reduce the amount of tPA released in a dose dependent manner (A200 p=0.0018, A1600 p=0.033). Aprotinin resulted in a significant downregulation of TF expression to baseline levels. At 24 hours, we found that aprotinin treatment of TNFa stimulated cells resulted in a significant downregulation of PAR-1 expression. Aprotinin significantly inhibited the effects of the protease thrombin upon PAR1 mediated calcium release. The effects of PAR2 stimulatory proteases such as human factor Xa, human factor VIIa and trypsin on calcium release was also inhibited by aprotinin. Conclusion:  We have shown that aprotinin has direct anti-inflammatory effects on endothelial cell activation and these effects may be mediated through inhibition of proteolytic activation of PAR1 and PAR2. Abstract word count: 297

INTRODUCTION   Each year it is estimated that 350,000 patients in the United States, and 650,000 worldwide undergo cardiopulmonary bypass (CPB). Despite advances in surgical techniques and perioperative management the morbidity and mortality of cardiac surgery related to the systemic inflammatory response syndrome(SIRS), especially in neonates is devastatingly significant. Cardiopulmonary bypass exerts an extreme challenge upon the haemostatic system as part of the systemic inflammatory syndrome predisposing to excessive bleeding as well as other multisystem dysfunction (1). Over the past decade major strides have been made in the understanding of the pathophysiology of the inflammatory response following CPB and the role of the vascular endothelium has emerged as critical in maintaining cardiovascular homeostasis (2).

CPB results in endothelial cell activation and initiation of coagulation via the Tissue Factor dependent pathway and consumption of important clotting factors. The major stimulus for thrombin generation during CPB has been shown to be through the tissue factor dependent pathway. As well as its effects on the fibrin and platelets thrombin has been found to play a role in a host of inflammatory responses in the vascular endothelium. The recent discovery of the Protease-Activated Receptors (PAR), one of which through which thrombin acts (PAR-1) has stimulated interest that they may provide a vital link between inflammation and coagulation (3).

Aprotinin is a nonspecific serine protease inhibitor that has been used for its ability to reduce blood loss and preserve platelet function during cardiac surgery procedures requiring cardiopulmonary bypass and thus the need for subsequent blood and blood product transfusions. However there have been concerns that aprotinin may be pro-thrombotic, especially in the context of coronary artery bypass grafting, which has limited its clinical use. These reservations are underlined by the fact that the mechanism of action of aprotinin has not been fully understood. Recently aprotinin has been shown to exert anti-thrombotic effects mediated by blocking the PAR-1 (4). Much less is known about its effects on endothelial cell activation, especially in terms of Tissue Factor but it has been proposed that aprotinin may also exert protective effects at the endothelial level via protease-activated receptors (PAR1 and PAR2). In this study we simulated in vitro the effects of endothelial cell activation during CPB by stimulating Human Umbilical Vein Endothelial Cells (HUVECs) with a proinflammatory cytokine released during CPB, Tumor Necrosis Factor (TNF-a) and characterize the effects of aprotinin treatment on TF expression, PAR1 and PAR2 expression, cytokine release IL-6 and tPA secretion.  In order to investigate the mechanism of action of aprotinin we studied its effects on PAR activation by various agonists and ligands.

These experiments provide insight into the effects of aprotinin on endothelial related coagulation mechanisms in terms of Tissue Factor expression and indicate it effects are mediated through Protease-Activated Receptors (PAR), which are seven membrane spanning proteins called G-protein coupled receptors (GPCR), that link coagulant and inflammatory pathways. Therefore, in this study we examine the effects of aprotinin on the human endothelial cell coagulation biology by different-dose aprotinin, 200 and 1600units.  The data demonstrates that aprotinin appears to directly alter endothelial expression of inflammatory cytokines, tPA and PAR receptor expression following treatment with TNF.  The direct mechanism of action is unknown but may act via local protease inhibition directly on endothelial cells.  It is hoped that with improved understanding of the mechanisms of action of aprotinin, especially an antithrombotic effect at the endothelial level the fears of prothrombotic tendency may be lessened and its use will become more routine.  

METHODS Human Umbilical Vein Endothelial Cells (HUVECS) used as our model to study the effects of endothelial cell activation on coagulant biology. In order to simulate the effects of cardiopulmonary bypass at the endothelial cell interface we stimulated the cells with the proinflammatory cytokine TNFa. In the study group the HUVECs were pretreated with low (200kIU/mL) and high (1600kIU/mL) dosages of aprotinin prior to stimulation with TNFa and complement activation fragments. The effects of TNFa stimulation upon endothelial Tissue Factor expression, PAR1 and PAR2 expression, and tPA and IL6 secretion were determined and compared between control and aprotinin treated cells. In order to delineate whether aprotinin blocks PAR activation via its protease inhibition properties we directly activated PAR1 and PAR2 using specific agonist ligands such thrombin (PAR1), trypsin, Factor VIIa, Factor Xa (PAR2) in the absence and presence of aprotinin.

Endothelial Cell Culture HUVECs were supplied from Clonetics. The cells were grown in EBM-2 containing 2MV bullet kit, including 5% FBS, 100-IU/ml penicillin, 0.1mg/mL streptomycin, 2mmol/L L-glutamine, 10 U/ml heparin, 30µg/mL EC growth supplement (ECGS). Before the stimulation cells were starved in 0.1%BSA depleted with FBS and growth factors for 24 hours. Cells were sedimented at 210g for 10 minutes at 4C and then resuspended in culture media. The HUVECs to be used will be between 3 and 5 passages.

Assay of IL-6 and tPA production Levels of IL-6 were measured with an ELISA based kit (RDI, MN) according to the manufacturers instructions. tPA was measured using a similar kit (American Diagnostica).

  Flow Cytometry The expression of transmembrane proteins PAR1, PAR2 and tissue factor were measured by single color assay as FITC labeling agent. Prepared suspension of cells disassociated trypsin free cell disassociation solution (Gibco) to be labeled. First well washed, and resuspended into “labeling buffer”, phosphate buffered saline (PBS) containing 0.5% BSA plus 0.1% NaN3, and 5% fetal bovine serum to block Fc and non-specific Ig binding sites. Followed by addition of 5mcl of antibody to approx. 1 million cells in 100µl labeling buffer and incubate at 4C for 1 hour. After washing the cells with 200µl with wash buffer, PBS + 0.1% BSA + 0.1% NaN3, the cells were pelletted at 1000rpm for 2 mins. Since the PAR1 and PAR2 were directly labeled with FITC these cells were fixed for later analysis by flow cytometry in 500µl PBS containing 1%BSA + 0.1% NaN3, then add equal volume of 4% formalin in PBS. For tissue factor raised in mouse as monoclonal primary antibody, the pellet resuspended and washed twice more as before, and incubated at 4C for 1 hour addition of 5µl donkey anti-mouse conjugated with FITC secondary antibody directly to the cell pellets at appropriate dilution in labeling buffer. After the final wash three times, the cell pellets were resuspended thoroughly in fixing solution. These fixed and labeled cells were then stored in the dark at 4C until there were analyzed. On analysis, scatter gating was used to avoid collecting data from debris and any dead cells. Logarithmic amplifiers for the fluorescence signal were used as this minimizes the effects of different sensitivities between machines for this type of data collection.  

Intracellular Calcium Measurement

Measured the intracellular calcium mobilization by Fluo-3AM. HUVECs were grown in calcium and phenol free EBM basal media containing 2MV bullet kit. Then the cell cultures were starved with the same media by 0.1% BSA without FBS for 24 hour with or without TNFa stimulation presence or absence of aprotinin (200 and 1600KIU/ml). Next the cells were loaded with Fluo-3AM 5µg/ml containing agonists, PAR1 specific peptide SFLLRN-PAR1 inhibitor, PAR2 specific peptide SLIGKV-PAR2 inhibitor, human alpha thrombin, trypsin, factor VIIa, factor Xa for an hour at 37C in the incubation chamber. Finally the media was replaced by Flou-3AM free media and incubated for another 30 minutes in the incubation chamber. The readings were taken at fluoromatic bioplate reader. For comparison purposes readings were taken before and during Fluo-3AM loading as well.  

RESULTS Aprotinin reduces IL-6 production from activated/stimulated HUVECS The effects of aprotinin analyzed on HUVEC for the anti-inflammatory effects of aprotinin at cultured HUVECS with high and low doses.  Figure 1 shows that TNF-a stimulated a considerable increase in IL-6 production, 370.95 ± 109.9 mg/mL.   If the drug is used alone the decrease of IL-6 at the low dose is 50% that is 183.95 ng/ml and with the high dose of 20% that is 338.92 from 370.95ng/ml being compared value.  TNFa-aprotinin results in reduction of the IL-6 expression from 370.95ng/ml to 58.6 (6.4fold) fro A200 and 75.85 (4.9 fold) ng/ml, for A1600.  After the treatment the cells reach to the below baseline limit of IL-6 expression. Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNF-a stimulated HUVECS (p=0.043).  Therefore, the aprotinin prevents inflammation as well as loss of blood.  

Aprotinin reduces tPA production from stimulated HUVECS Whether aprotinin exerted part of its fibrinolytic effects through inhibition of tPA mediated plasmin generation examined by the effects on TNFa stimulated HUVECS. Figure 2 also demonstrates that the amount of tPA released from HUVECS under resting, non-stimulated conditions incubated with aprotinin are significantly different. Figure 2 represents that the resting level of tPA released from non-stimulated cells significantly, by 100%, increase following TNF-a stimulation for 24 hours.  After application of aprotinin alone at two doses the tPA level goes down 25% of TNFa stimulated cells.  However, aprotinin treatment of TNF-a activated endothelial cells significantly lower the amount of tPA release in a dose dependent manner that is low dose decreased 25 but high dose causes 50% decrease of tPA expression (A200 p=0.0018, A1600 p=0.033) This finding suggests that aprotinin exerts a direct inhibitory effect on endothelial cell tPA production.

Aprotinin and receptor expression on activated HUVECS

TF is expressed when the cell in under stress such as TNFa treatments. The stimulated HUVECs with TNF-a tested for the expression of PAR1, PAR2, and tissue factor by single color flow cytometry through FITC labeled detection antibodies at 1, 3, and 24hs.

 

Tissue Factor expression is reduced:

Figure 3 demonstrates that there is a fluctuation of TF expression from 1 h to 24h that the TF decreases at first hour after aprotinin application 50% and 25%, A1600 and A200 respectively.  Then at 3 h the expression come back up 50% more than the baseline.  Finally, at 24h the expression of TF becomes almost as same as baseline.  Moreover, TNFa stimulated cells remains 45% higher than baseline after at 3h as well as at 24h.

PAR1 decreased:
Figure 4 demonstrates that aprotinin reduces the PAR1 expression 80% at 24h but there is no affect at 1 and 3 h intervals for both doses.

During the treatment with aprotinin only high dose at 1 hour time interval decreases the PAR1 expression on the cells. This data explains that ECCB is affected due to the expression of PAR1 is lowered by the high dose of aprotinin.

PAR2 is decreased by aprotinin:

  Figure 5 shows the high dose of aprotinin reduces the PAR2 expression close to 25% at 1h, 50% at 3h and none at 24h.  This pattern is exact opposite of PAR1 expression.  Figure 5 demonstrates the 50% decrease at 3h interval only.  Does that mean aprotinin affecting the inflammation first and then coagulation?

This suggests that aprotinin may affect the PAR2 expression at early and switched to PAR1 reduction later time intervals.  This fluctuation can be normal because aprotinin is not a specific inhibitor for proteases.  This approach make the aprotinin work better the control bleeding and preventing the inflammation causing cytokine such as IL-6.

Aprotinin inhibits Calcium fluxes induced by PAR1/2 specific agonists

  The specificity of aprotinin’s actions upon PAR studied the effects of the agent on calcium release following proteolytic and non-proteolytic stimulation of PAR1 and PAR2. Figure 6A (Figure 6) shows the stimulation of the cells with the PAR1 specific peptide (SFLLRN) results in release of calcium from the cells. Pretreatment of the cells with aprotinin has no significant effect on PAR1 peptide stimulated calcium release. This suggests that aprotinin has no effect upon the non-proteolytic direct activation of the PAR 1 receptor. Yet, Figure 6B (Figure 6) demonstrates human alpha thrombin does interact with the drug as a result the calcium release drops below base line after high dose (A1600) aprotinin used to zero but low dose does not show significant effect on calcium influx. Figure 7 demonstrates the direct PAR2 and indirect PAR2 stimulation by hFVIIa, hFXa, and trypsin of cells.  Similarly, at Figure 7A aprotinin has no effect upon PAR2 peptide stimulated calcium release, however, at figures 7B, C, and D shows that PAR2 stimulatory proteases Human Factor Xa, Human Factor VIIa and Trypsin decreases calcium release. These findings indicate that aprotinin’s mechanism of action is directed towards inhibiting proteolytic cleavage and hence subsequent activation of the PAR1 and PAR2 receptor complexes.  The binding site of the aprotinin on thrombin possibly is not the peptide sequence interacting with receptors.

Measurement of calcium concentration is essential to understand the mechanism of aprotinin on endothelial cell coagulation and inflammation because these mechanisms are tightly controlled by presence of calcium.  For example, activation of PAR receptors cause activation of G protein q subunit that leads to phosphoinositol to secrete calcium from endoplasmic reticulum into cytoplasm or activation of DAG to affect Phospho Lipase C (PLC). In turn, certain calcium concentration will start the serial formation of chain reaction for coagulation.  Therefore, treatment of the cells with specific factors, thrombin receptor activating peptides (TRAPs), human alpha thrombin, trypsin, human factor VIIa, and human factor Xa, would shed light into the effect of aprotinin on the formation of complexes for pro-coagulant activity.    DISCUSSION   There are two fold of outcomes to be overcome during cardiopulmonary bypass (CPB):  mechanical stress and the contact of blood with artificial surfaces results in the activation of pro- and anticoagulant systems as well as the immune response leading to inflammation and systemic organ failure.  This phenomenon causes the “postperfusion-syndrome”, with leukocytosis, increased capillary permeability, accumulation of interstitial fluid, and organ dysfunction.  CPB is also associated with a significant inflammatory reaction, which has been related to complement activation, and release of various inflammatory mediators and proteolytic enzymes. CPB induces an inflammatory state characterized by tumor necrosis factor-alpha release. Aprotinin, a low molecular-weight peptide inhibitor of trypsin, kallikrein and plasmin has been proposed to influence whole body inflammatory response inhibiting kallikrein formation, complement activation and neutrophil activation (5, 6). But shown that aprotinin has no significant influence on the inflammatory reaction to CPB in men.  Understanding the endothelial cell responses to injury is therefore central to appreciating the role that dysfunction plays in the preoperative, operative, and postoperative course of nearly all cardiovascular surgery patients.  Whether aprotinin increases the risk of thrombotic complications remains controversial.   The anti-inflammatory properties of aprotinin in attenuating the clinical manifestations of the systemic inflammatory response following cardiopulmonary bypass are well known(15) 16)  However its mechanisms and targets of action are not fully understood. In this study we have investigated the actions of aprotinin at the endothelial cell level. Our experiments showed that aprotinin reduced TNF-a induced IL-6 release from cultured HUVECS. Thrombin mediates its effects through PAR-1 receptor and we found that aprotinin reduced the expression of PAR-1 on the surface of HUVECS after 24 hours incubation. We then demonstrated that aprotinin inhibited endothelial cell PAR proteolytic activation by thrombin (PAR-1), trypsin, factor VII and factor X (PAR-2) in terms of less release of Ca preventing the activation of coagulation.  So aprotinin made cells produce less receptor, PAR1, PAR2, and TF as a result there would be less Ca++ release.    Our findings provide evidence for anti-inflammatory as well as anti-coagulant properties of aprotinin at the endothelial cell level, which may be mediated through its inhibitory effects on proteolytic activation of PARs.   IL6   Elevated levels of IL-6 have been shown to correlate with adverse outcomes following cardiac surgery in terms of cardiac dysfunction and impaired lung function(Hennein et al 1992). Cardiopulmonary bypass is associated with the release of the pro-inflammatory cytokines IL-6, IL-8 and TNF-a.  IL-6 is produced by T-cells, endothelial cells as a result monocytes and plasma levels of this cytokine tend to increase during CPB (21, 22). In some studies aprotinin has been shown to reduce levels of IL-6 post CPB(23) Hill(5). Others have failed to demonstrate an inhibitory effect of aprotinin upon pro-inflammatory cytokines following CPB(24) (25).  Our experiments showed that aprotinin significantly reduced the release of IL-6 from TNF-a stimulated endothelial cells, which may represent an important target of its anti-inflammatory properties. Its has been shown recently that activation of HUVEC by PAR-1 and PAR-2 agonists stimulates the production of IL-6(26). Hence it is possible that the effects of aprotinin in reducing IL-6 may be through targeting activation of such receptors.   TPA   Tissue Plasminogen activator is stored, ready made, in endothelial cells and it is released at its highest levels just after commencing CPB and again after protamine administration. The increased fibrinolytic activity associated with the release of tPA can be correlated to the excessive bleeding postoperatively. Thrombin is thought to be the major stimulus for release of t-PA from endothelial cells. Aprotinin’s haemostatic properties are due to direct inhibition of plasmin, thereby reducing fibrinolytic activity as well as inhibiting fibrin degradation.  Aprotinin has not been shown to have any significant effect upon t-PA levels in patients post CPB(27), which would suggest that aprotinin reduced fibrinolytic effects are not the result of inhibition of t-PA mediated plasmin generation. Our study, however demonstrates that aprotinin inhibits the release of t-PA from activated endothelial cells, which may represent a further haemostatic mechanism at the endothelial cell level.   TF   Resting endothelial cells do not normally express tissue factor on their cell surface. Inflammatory mediators released during CPB such as complement (C5a), lipopolysaccharide, IL-6, IL-1, TNF-a, mitogens, adhesion molecules and hypoxia may induce the expression of tissue factor on endothelial cells and monocytes. The expression of TF on activated endothelial cells activates the extrinsic pathway of coagulation, ultimately resulting in the generation of thrombin and fibrin. Aprotinin has been shown to reduce the expression of TF on monocytes in a simulated cardiopulmonary bypass circuit (28).

We found that treatment of activated endothelial cells with aprotinin significantly reduced the expression of TF after 24 hours. This would be expected to result in reduced thrombin generation and represent an additional possible anticoagulant effect of aprotinin. In a previous study from our laboratory we demonstrated that there were two peaks of inducible TF activity on endothelial cells, one immediately post CPB and the second at 24 hours (29). The latter peak is thought to be responsible for a shift from the initial fibrinolytic state into a procoagulant state.  In addition to its established early haemostatic and coagulant effect, aprotinin may also have a delayed anti-coagulant effect through its inhibition of TF mediated coagulation pathway. Hence its effects may counterbalance the haemostatic derangements, i.e. first bleeding then thrombosis caused by CPB. The anti-inflammatory effects of aprotinin may also be related to inhibition of TF and thrombin generation. PARs  

It has been suggested that aprotinin may target PAR on other cells types, especially endothelial cells. We investigated the role of PARs in endothelial cell activation and whether they can be the targets for aprotinin.  In recent study by Day group(30) demonstrated that endothelial cell activation by thrombin and downstream inflammatory responses can be inhibited by aprotinin in vitro through blockade of protease-activated receptor 1. Our results provide a new molecular basis to help explain the anti-inflammatory properties of aprotinin reported clinically.    The finding that PAR-2 can also be activated by the coagulation enzymes factor VII and factor X indicates that PAR may represent the link between inflammation and coagulation.  PAR-2 is believed to play an important role in inflammatory response. PAR-2 are widely expressed in the gastrointestinal tract, pancreas, kidney, liver, airway, prostrate, ovary, eye of endothelial, epithelial, smooth muscle cells, T-cells and neutrophils. Activation of PAR-2 in vivo has been shown to be involved in early inflammatory processes of leucocyte recruitment, rolling, and adherence, possibly through a mechanism involving platelet-activating factor (PAF)   We investigated the effects of TNFa stimulation on PAR-1 and PAR-2 expression on endothelial cells. Through functional analysis of PAR-1 and PAR-2 by measuring intracellular calcium influx we have demonstrated that aprotinin blocks proteolytic cleavage of PAR-1 by thrombin and activation of PAR-2 by the proteases trypsin, factor VII and factor X.  This confirms the previous findings on platelets of an endothelial anti-thrombotic effect through inhibition of proteolysis of PAR-1. In addition, part of aprotinin’s anti-inflammatory effects may be mediated by the inhibition of serine proteases that activate PAR-2. There have been conflicting reports regarding the regulation of PAR-1 expression by inflammatory mediators in cultured human endothelial cells. Poullis et al first showed that thrombin induced platelet aggregation was mediated by via the PAR-1(4) and demonstrated that aprotinin inhibited the serine protease thrombin and trypsin induced platelet aggregation. Aprotinin did not block PAR-1 activation by the non-proteolytic agonist peptide, SFLLRN indicating that the mechanism of action was directed towards inhibiting proteolytic cleavage of the receptor. Nysted et al showed that TNF did not affect mRNA and cell surface protein expression of PAR-1 (35), whereas Yan et al showed downregulation of PAR-1 mRNA levels (36). Once activated PAR1 and PAR2 are rapidly internalized and then transferred to lysosomes for degradation.

Endothelial cells contain large intracellular pools of preformed receptors that can replace the cleaved receptors over a period of approximately 2 hours, thus restoring the capacity of the cells to respond to thrombin. In this study we found that after 1-hour stimulation with TNF there was a significant upregulation in PAR-1 expression. However after 3 hours and 24 hours there was no significant change in PAR-1 expression suggesting that cleaved receptors had been internalized and replenished. Aprotinin was interestingly shown to downregulate PAR-1 expression on endothelial cells at 1 hour and increasingly more so after 24 hours TNF stimulation. These findings may suggest an effect of aprotinin on inhibiting intracellular cycling and synthesis of PAR-1.    

Conclusions   Our study has identified the anti-inflammatory and coagulant effects of aprotinin at the endothelial cell level. All together aprotinin affects the ECCB by reducing the t-PA, IL-6, PAR1, PAR 2, TF expressions. Our data correlates with the previous foundlings in production of tPA (7, (8) 9) 10), and  decreased IL-6 levels (11) during coronary artery bypass graft surgery (12-14). We have importantly demonstrated that aprotinin may target proteolytic activation of endothelial cell associated PAR-1 to exert a possible anti-inflammatory effect. This evidence should lessen the concerns of a possible prothrombotic effect and increased incidence of graft occlusion in coronary artery bypass patients treated with aprotinin. Aprotinin may also inhibit PAR-2 proteolytic activation, which may represent a key mechanism for attenuating the inflammatory response at the critical endothelial cell level. Although aprotinin has always been known as a non-specific protease inhibitor we would suggest that there is growing evidence for a PAR-ticular mechanism of action.  

REFERENCES

1.         Levy, J. H., and Tanaka, K. A. Inflammatory response to cardiopulmonary bypass. Ann Thorac Surg. 75: S715-720, 2003.

2.         Verrier, E. D., and Morgan, E. N. Endothelial response to cardiopulmonary bypass surgery. Ann Thorac Surg. 66: S17-19; discussion S25-18, 1998.

3.         Cirino, G., Napoli, C., Bucci, M., and Cicala, C. Inflammation-coagulation network: are serine protease receptors the knot? Trends Pharmacol Sci. 21: 170-172, 2000. 4.         Poullis, M., Manning, R., Laffan, M., Haskard, D. O., Taylor, K. M., and Landis, R. C. The antithrombotic effect of aprotinin: actions mediated via the proteaseactivated receptor 1. J Thorac Cardiovasc Surg. 120: 370-378, 2000.

5.         Hill, G. E., Alonso, A., Spurzem, J. R., Stammers, A. H., and Robbins, R. A. Aprotinin and methylprednisolone equally blunt cardiopulmonary bypass-induced inflammation in humans. J Thorac Cardiovasc Surg. 110: 1658-1662, 1995.

6.         Hill, G. E., Pohorecki, R., Alonso, A., Rennard, S. I., and Robbins, R. A. Aprotinin reduces interleukin-8 production and lung neutrophil accumulation after cardiopulmonary bypass. Anesth Analg. 83: 696-700, 1996. 7.         Lu, H., Du Buit, C., Soria, J., Touchot, B., Chollet, B., Commin, P. L., Conseiller, C., Echter, E., and Soria, C. Postoperative hemostasis and fibrinolysis in patients undergoing cardiopulmonary bypass with or without aprotinin therapy. Thromb Haemost. 72: 438-443, 1994.

8.         de Haan, J., and van Oeveren, W. Platelets and soluble fibrin promote plasminogen activation causing downregulation of platelet glycoprotein Ib/IX complexes: protection by aprotinin. Thromb Res. 92: 171-179, 1998.

9.         Erhardtsen, E., Bregengaard, C., Hedner, U., Diness, V., Halkjaer, E., and Petersen, L. C. The effect of recombinant aprotinin on t-PA-induced bleeding in rats. Blood Coagul Fibrinolysis. 5: 707-712, 1994.

10.       Orchard, M. A., Goodchild, C. S., Prentice, C. R., Davies, J. A., Benoit, S. E., Creighton-Kemsford, L. J., Gaffney, P. J., and Michelson, A. D. Aprotinin reduces cardiopulmonary bypass-induced blood loss and inhibits fibrinolysis without influencing platelets. Br J Haematol. 85: 533-541, 1993.

11.       Tassani, P., Augustin, N., Barankay, A., Braun, S. L., Zaccaria, F., and Richter, J. A. High-dose aprotinin modulates the balance between proinflammatory and anti-inflammatory responses during coronary artery bypass graft surgery. J Cardiothorac Vasc Anesth.14: 682-686, 2000.

12.       Asehnoune, K., Dehoux, M., Lecon-Malas, V., Toueg, M. L., Gonieaux, M. H., Omnes, L., Desmonts, J. M., Durand, G., and Philip, I. Differential effects of aprotinin and tranexamic acid on endotoxin desensitization of blood cells induced by circulation through an isolated extracorporeal circuit. J Cardiothorac Vasc Anesth. 16: 447-451, 2002.

13.       Dehoux, M. S., Hernot, S., Asehnoune, K., Boutten, A., Paquin, S., Lecon-Malas, V., Toueg, M. L., Desmonts, J. M., Durand, G., and Philip, I. Cardiopulmonary bypass decreases cytokine production in lipopolysaccharide-stimulated whole blood cells: roles of interleukin-10 and the extracorporeal circuit. Crit Care Med. 28: 1721-1727, 2000.

14.       Greilich, P. E., Brouse, C. F., Rinder, C. S., Smith, B. R., Sandoval, B. A., Rinder, H. M., Eberhart, R. C., and Jessen, M. E. Effects of epsilon-aminocaproic acid and aprotinin on leukocyte-platelet adhesion in patients undergoing cardiac surgery. Anesthesiology. 100: 225-233, 2004.

15.       Mojcik, C. F., and Levy, J. H. Aprotinin and the systemic inflammatory response after cardiopulmonary bypass. Ann Thorac Surg. 71: 745-754, 2001.

16.       Landis, R. C., Asimakopoulos, G., Poullis, M., Haskard, D. O., and Taylor, K. M. The antithrombotic and antiinflammatory mechanisms of action of aprotinin. Ann Thorac Surg. 72: 2169-2175, 2001.

17.       Asimakopoulos, G., Kohn, A., Stefanou, D. C., Haskard, D. O., Landis, R. C., and Taylor, K. M. Leukocyte integrin expression in patients undergoing cardiopulmonary bypass. Ann Thorac Surg. 69: 1192-1197, 2000.

18.       Landis, R. C., Asimakopoulos, G., Poullis, M., Thompson, R., Nourshargh, S., Haskard, D. O., and Taylor, K. M. Effect of aprotinin (trasylol) on the inflammatory and thrombotic complications of conventional cardiopulmonary bypass surgery. Heart Surg Forum. 4 Suppl 1: S35-39, 2001.

19.       Asimakopoulos, G., Thompson, R., Nourshargh, S., Lidington, E. A., Mason, J. C., Ratnatunga, C. P., Haskard, D. O., Taylor, K. M., and Landis, R. C. An anti-inflammatory property of aprotinin detected at the level of leukocyte extravasation. J Thorac Cardiovasc Surg. 120: 361-369, 2000.

20.       Asimakopoulos, G., Lidington, E. A., Mason, J., Haskard, D. O., Taylor, K. M., and Landis, R. C. Effect of aprotinin on endothelial cell activation. J Thorac Cardiovasc Surg. 122: 123-128, 2001.

21.       Butler, J., Chong, G. L., Baigrie, R. J., Pillai, R., Westaby, S., and Rocker, G. M. Cytokine responses to cardiopulmonary bypass with membrane and bubble oxygenation. Ann Thorac Surg. 53: 833-838, 1992.

22.       Hennein, H. A., Ebba, H., Rodriguez, J. L., Merrick, S. H., Keith, F. M., Bronstein, M. H., Leung, J. M., Mangano, D. T., Greenfield, L. J., and Rankin, J. S. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg. 108: 626-635, 1994.

23.       Diego, R. P., Mihalakakos, P. J., Hexum, T. D., and Hill, G. E. Methylprednisolone and full-dose aprotinin reduce reperfusion injury after cardiopulmonary bypass. J Cardiothorac Vasc Anesth. 11: 29-31, 1997.

24.       Ashraf, S., Tian, Y., Cowan, D., Nair, U., Chatrath, R., Saunders, N. R., Watterson, K. G., and Martin, P. G. “Low-dose” aprotinin modifies hemostasis but not proinflammatory cytokine release. Ann Thorac Surg. 63: 68-73, 1997.

25.       Schmartz, D., Tabardel, Y., Preiser, J. C., Barvais, L., d’Hollander, A., Duchateau, J., and Vincent, J. L. Does aprotinin influence the inflammatory response to cardiopulmonary bypass in patients? J Thorac Cardiovasc Surg. 125: 184-190, 2003.

26.       Chi, L., Li, Y., Stehno-Bittel, L., Gao, J., Morrison, D. C., Stechschulte, D. J., and Dileepan, K. N. Interleukin-6 production by endothelial cells via stimulation of protease-activated receptors is amplified by endotoxin and tumor necrosis factor-alpha. J Interferon Cytokine Res. 21: 231-240, 2001.

27.       Ray, M. J., and Marsh, N. A. Aprotinin reduces blood loss after cardiopulmonary bypass by direct inhibition of plasmin. Thromb Haemost. 78: 1021-1026, 1997.

28.       Khan, M. M., Gikakis, N., Miyamoto, S., Rao, A. K., Cooper, S. L., Edmunds, L. H., Jr., and Colman, R. W. Aprotinin inhibits thrombin formation and monocyte tissue factor in simulated cardiopulmonary bypass. Ann Thorac Surg. 68: 473-478, 1999.

29.       Jaggers, J. J., Neal, M. C., Smith, P. K., Ungerleider, R. M., and Lawson, J. H. Infant cardiopulmonary bypass: a procoagulant state. Ann Thorac Surg. 68: 513-520, 1999.

30.       Day, J. R., Taylor, K. M., Lidington, E. A., Mason, J. C., Haskard, D. O., Randi, A. M., and Landis, R. C. Aprotinin inhibits proinflammatory activation of endothelial cells by thrombin through the protease-activated receptor 1. J Thorac Cardiovasc Surg. 131: 21-27, 2006.

31.       Vergnolle, N. Proteinase-activated receptor-2-activating peptides induce leukocyte rolling, adhesion, and extravasation in vivo. J Immunol. 163: 5064-5069, 1999.

32.       Vergnolle, N., Hollenberg, M. D., Sharkey, K. A., and Wallace, J. L. Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2)-activating peptides in the rat paw. Br J Pharmacol. 127: 1083-1090, 1999.

33.       McLean, P. G., Aston, D., Sarkar, D., and Ahluwalia, A. Protease-activated receptor-2 activation causes EDHF-like coronary vasodilation: selective preservation in ischemia/reperfusion injury: involvement of lipoxygenase products, VR1 receptors, and C-fibers. Circ Res. 90: 465-472, 2002.

34.       Maree, A., and Fitzgerald, D. PAR2 is partout and now in the heart. Circ Res. 90: 366-368, 2002.

35.       Nystedt, S., Ramakrishnan, V., and Sundelin, J. The proteinase-activated receptor 2 is induced by inflammatory mediators in human endothelial cells. Comparison with the thrombin receptor. J Biol Chem. 271: 14910-14915, 1996.

36.       Yan, W., Tiruppathi, C., Lum, H., Qiao, R., and Malik, A. B. Protein kinase C beta regulates heterologous desensitization of thrombin receptor (PAR-1) in endothelial cells. Am J Physiol. 274: C387-395, 1998.

37.       Shinohara, T., Suzuki, K., Takada, K., Okada, M., and Ohsuzu, F. Regulation of proteinase-activated receptor 1 by inflammatory mediators in human vascular endothelial cells. Cytokine. 19: 66-75, 2002.

FIGURES

Figure 1: IL-6 production following TNF-a stimulation Figure 1

Figure 2:  tPA production following TNF-a stimulation Figure 2

Figure 3:  Tissue Factor Expression on TNF-a stimulated HUVECS Figure 3

Figure 4:  PAR-1 Expression on TNF-a stimulated HUVECS Figure 4

Figure 5:  PAR-2 Expression on TNF-a stimulated HUVECS Figure 5

Figure 6:  Calcium Fluxes following PAR1 Activation Figure 6

Figure 7:  Calcium Fluxes following PAR2 Activation Figure 7

 

Read Full Post »


Biochemistry of the Coagulation Cascade and Platelet Aggregation: Nitric Oxide: Platelets, Circulatory Disorders, and Coagulation Effects

Curator/Editor/Author: Larry H. Bernstein, MD, FCAP 

 

 

Subtitle: Nitric Oxide: Platelets, Circulatory Disorders, and Coagulation Effects.  (Part I)

Summary: This portion of the Nitric Oxide series on PharmaceuticalIntelligence(wordpress.com) is the first of a two part treatment of platelets, the coagulation cascade, and protein-membrane interactions with low flow states, local and systemic inflammatory disease, and hematologic disorders.  It is highly complex as the lines separating intrinsic and extrinsic pathways become blurred as a result of endothelial shear stress, distinctly different than penetrating or traumatic injury.  In addition, other factors that come into play are also considered.  The 2nd piece will be concerned with oxidative stress and the diverse effects on NO on the vasoactive endothelium, on platelet endothelial interaction, and changes in blood viscosity.

Coagulation Pathway

The workhorse tests of the modern coagulation laboratory, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT), are the basis for the published extrinsic and intrinsic coagulation pathways.  This is, however, a much simpler model than one encounters delving into the mechanism and interactions involved in hemostasis and thrombosis, or in hemorrhagic disorders.

We first note that there are three components of the hemostatic system in all vertebrates:

  • Platelets,
  • vascular endothelium, and
  • plasma proteins.

The liver is the largest synthetic organ, which synthesizes

  • albumin,
  • acute phase proteins,
  • hormonal and metal binding proteins,
  • albumin,
  • IGF-1, and
  • prothrombin, mainly responsible for the distinction between plasma and serum (defibrinated plasma).

According to WH Seegers [Seegers WH,  Postclotting fates of thrombin.  Semin Thromb Hemost 1986;12(3):181-3], prothrombin is virtually all converted to thrombin in clotting, but Factor X is not. Large quantities of thrombin are inhibited by plasma and platelet AT III (heparin cofactor I), by heparin cofactor II, and by fibrin.  Antithrombin III, a serine protease, is a main inhibitor of thrombin and factor Xa in blood coagulation. The inhibitory function of antithrombin III is accelerated by heparin, but at the same time antithrombin III activity is also reduced. Heparin retards the thrombin-fibrinogen reaction, but otherwise the effectiveness of heparin as an anticoagulant depends on antithrombin III in laboratory experiments, as well as in therapeutics. The activation of prothrombin is inhibited, thereby inactivating  any thrombin or other vulnerable protease that might otherwise be generated. [Seegers WH, Antithrombin III. Theory and clinical applications. H. P. Smith Memorial Lecture. Am J Clin Pathol. 1978;69(4):299-359)].  With respect to platelet aggregation, platelets aggregate with thrombin-free autoprothrombin II-A. Aggregation is dependent on an intact release mechanism since inhibition of aggregation occurred with adenosine, colchicine, or EDTA. Autoprothrombin II-A reduces the sensitivity of platelets to aggregate with thrombin, but enhances epinephrine-mediated aggregation. [Herman GE, Seegers WH, Henry RL. Autoprothrombin ii-a, thrombin, and epinephrine: interrelated effects on platelet aggregation. Bibl Haematol 1977;44:21-7.]

A tetrapeptide, residues 6 to 9 in normal prothrombin, was isolated from the NH(2)-terminal, Ca(2+)-binding part of normal prothrombin. The peptide contained two residues of modified glutamic acid, gamma-carboxyglutamic acid. This amino acid gives normal prothrombin the Ca(2+)-binding ability that is necessary for its activation.

Abnormal prothrombin, induced by the vitamin K antagonist, dicoumarol, lacks these modified glutamic acid residues and that this is the reason why abnormal prothrombin does not bind Ca(2+) and is nonfunctioning in blood coagulation. [Stenflo J, Fernlund P, Egan W, Roepstorff P. Vitamin K dependent modifications of glutamic acid residues in prothrombinProc Natl Acad Sci U S A. 1974;71(7):2730-3.]

Interestingly, a murine monoclonal antibody (H-11) binds a conserved epitope found at the amino terminal of the vitamin K-dependent blood proteins prothrombin, factors VII and X, and protein C. The sequence of polypeptide recognized contains 2 residues of gamma-carboxyglutamic acid, and binding of the antibody is inhibited by divalent metal ions.  The antibody bound specifically to a synthetic peptide corresponding to residues 1-12 of human prothrombin that was synthesized as the gamma-carboxyglutamic acid-containing derivative, but binding to the peptide was not inhibited by calcium ion. This suggested that binding by divalent metal ions is not due simply to neutralization of negative charge by Ca2+. [Church WR, Boulanger LL, Messier TL, Mann KG. Evidence for a common metal ion-dependent transition in the 4-carboxyglutamic acid domains of several vitamin K-dependent proteins. J Biol Chem. 1989;264(30):17882-7.]

Role of vascular endothelium.

I have identified the importance of prothrombin, thrombin, and the divalent cation Ca 2+ (1% of the total body pool), mention of heparin action, and of vitamin K (inhibited by warfarin).  Endothelial functions are inherently related to procoagulation and anticoagulation. The subendothelial matrix is a complex of many materials, most important related to coagulation being collagen and von Willebrand factor.

What about extrinsic and intrinsic pathways?  Tissue factor, when bound to factor VIIa, is the major activator of the extrinsic pathway of coagulation. Classically, tissue factor is not present in the plasma but only presented on cell surfaces at a wound site, which is “extrinsic” to the circulation.  Or is it that simple?

Endothelium is the major synthetic and storage site for von Willebrand factor (vWF).  vWF is…

  • secreted from the endothelial cell both into the plasma and also
  • abluminally into the subendothelial matrix, and
  • acts as the intercellular glue binding platelets to one another and also to the subendothelial matrix at an injury site.
  • acts as a carrier protein for factor VIII (antihemophilic factor).
  • It  binds to the platelet glycoprotein Ib/IX/V receptor and
  • mediates platelet adhesion to the vascular wall under shear. [Lefkowitz JB. Coagulation Pathway and Physiology. Chapter I. in Hemostasis Physiology. In ( ???), pp1-12].

Ca++ and phospholipids are necessary for all of the reactions that result in the activation of prothrombin to thrombin. Coagulation is initiated by an extrinsic mechanism that

  • generates small amounts of factor Xa, which in turn
  • activates small amounts of thrombin.

The tissue factor/factorVIIa proteolysis of factor X is quickly inhibited by tissue factor pathway inhibitor (TFPI).The small amounts of thrombin generated from the initial activation feedback

  • to create activated cofactors, factors Va and VIIIa, which in turn help to
  • generate more thrombin.
  • Tissue factor/factor VIIa is also capable of indirectly activating factor X through the activation of factor IX to factor IXa.
  • Finally, as more thrombin is created, it activates factor XI to factor XIa, thereby enhancing the ability to ultimately make more thrombin.

 

Coagulation Cascade

The procoagulant plasma coagulation cascade has traditionally been divided into the intrinsic and extrinsic pathways. The Waterfall/Cascade model consists of two separate initiations,

  • intrinsic (contact) and
    • The intrinsic pathway is initiated by a complex activation process of the so-called contact phase components,
      • prekallikrein,
      •  high-molecular weight kininogen (HMWK) and
      • factor XII

Activation of the intrinsic pathway is promoted by non-biological surfaces, such as glass in a test tube, and is probably not of physiological importance, at least not in coagulation induced by trauma.

Instead, the physiological activation of coagulation is mediated exclusively via the extrinsic pathway, also known as the tissue factor pathway.

  • extrinsic pathways,

Tissue factor (TF) is a membrane protein which is normally found in tissues. TF forms a procoagulant complex with factor VII, which activates factor IX and factor X.

  • which ultimately merge at the level of Factor Xa (common pathway).

Regulation of thrombin generation. Coagulation is triggered (initiation) by circulating trace amounts of fVIIa and locally exposed tissue factor (TF). Subsequent formations of fXa and thrombin are regulated by a tissue factor pathway inhibitor (TFPI) and antithrombin (AT). When the threshold level of thrombin is exceeded, thrombin activates platelets, fV, fVIII, and fXI to augment its own generation (propagation).

Activated factors IX and X (IXa and Xa) will activate prothrombin to thrombin and finally the formation of fibrin. Several of these reactions are much more efficient in the presence of phospholipids and protein cofactors factors V and VIII, which thrombin activates to Va and VIIIa by positive feedback reactions.

We depict the plasma coagulation emphasizing the importance of membrane surfaces for the coagulation processes. Coagulation is initiated when tissue factor (TF), an integral membrane protein, is exposed to plasma. TF is expressed on subendothelial cells (e.g. smooth muscle cells and fibroblasts), which are exposed after endothelium damage. Activated monocytes are also capable of exposing TF.

A small amount, approximately 1%, of activated factor VII (VIIa) is present in circulating blood and binds to TF. Free factor VIIa has poor enzymatic activity and the initiation is limited by the availability of its cofactor TF. The first steps in the formation of a blood clot is the specific activation of factor IX and X by the TF-VIIa complex. (Initiation of coagulation: Factor VIIa binds to tissue factor and activates factors IX and X). Coagulation is propagated by procoagulant enzymatic complexes that assemble on the negatively charged membrane surfaces of activated platelets. (Propagation of coagulation: Activation of factor X and prothrombin).  Once thrombin has been formed it will activate the procofactors, factor V and factor VIII, and these will then assemble in enzyme complexes. Factor IXa forms the tenase complex together with its cofactor factor VIIIa, and factor Xa is the enzymatic component of the prothrombinase complex with factor Va as cofactor.

Activation of protein C takes place on the surface of intact endothelial cells. When thrombin (IIa) reaches intact endothelium it binds with high affinity to a specific receptor called thrombomodulin. This shifts the specific activity of thrombin from being a procoagulant enzyme to an anticoagulant enzyme that activates protein C to activated protein C (APC).  The localization of protein C to the thrombin-thrombomodulin complex can be enhanced by the endothelial protein C receptor (EPCR), which is a transmembrane protein with high affinity for protein C.  Activated protein C (APC) binds to procoagulant surfaces such as the membrane of activated platelets where it finds and degrades the procoagulant cofactors Va and VIIIa, thereby shutting down the plasma coagulation.  Protein S (PS) is an important nonenzymatic  cofactor to APC in these reactions. (Degradation of factors Va and VIIIa).

The common theme in activation and regulation of plasma coagulation is the reduction in dimensionality. Most reactions take place in a 2D world that will increase the efficiency of the reactions dramatically. The localization and timing of the coagulation processes are also dependent on the formation of protein complexes on the surface of membranes. The coagulation processes can also be controlled by certain drugs that destroy the membrane binding ability of some coagulation proteins – these proteins will be lost in the 3D world and not able to form procoagulant complexes on surfaces.

Assembly of proteins on membranes – making a 3D world flat

• The timing and efficiency of coagulation processes are handled by reduction in dimensionality

– Make 3 dimensions to 2 dimensions

• Coagulation proteins have membrane binding capacity

• Membranes provide non-coagulant and procoagulant surfaces

– Intact cells/activated cells

• Membrane binding is a target for anticoagulant drugs

– Anti-vitamin K (e.g. warfarin)

Modern View

It can be divided into the phases of initiation, amplification and propagation.

  • In the initiation phase, small amounts of thrombin can be formed after exposure of tissue factor to blood.
  • In the amplification phase, the traces of thrombin will be inactivated or used for amplification of the coagulation process.

At this stage there is not enough thrombin to form insoluble fibrin. In order to proceed further thrombin  activates platelets, which provide a procoagulant surface for the coagulation factors. Thrombin will also activate the vital cofactors V and VIII that will assemble on the surface of activated platelets. Thrombin can also activate factor XI, which is important in a feedback mechanism.

In the final step, the propagation phase, the highly efficient tenase and prothrombinase complexes have been assembled on the membrane surface. This yields large amounts of thrombin at the site of injury that can cleave fibrinogen to insoluble fibrin. Factor XI activation by thrombin then activates factor IX, which leads to the formation of more tenase complexes. This ensures enough thrombin is formed, despite regulation of the initiating TF-FVIIa complex, thus ensuring formation of a stable fibrin clot. Factor XIII stabilizes the fibrin clot through crosslinking when activated by thrombin.

English: Gene expression pattern of the VWF gene.

English: Gene expression pattern of the VWF gene. (Photo credit: Wikipedia)

Coagulation cascade

Coagulation cascade (Photo credit: Wikipedia)

Blood Coagulation (Thrombin) and Protein C Pat...

Fibrinolytic pathway

Fibrinolysis is the physiological breakdown of fibrin to limit and resolve blood clots. Fibrin is degraded primarily by the serine protease, plasmin, which circulates as plasminogen. In an auto-regulatory manner, fibrin serves as both the co-factor for the activation of plasminogen and the substrate for plasmin.

In the presence of fibrin, tissue plasminogen activator (tPA) cleaves plasminogen producing plasmin, which proteolyzes the fibrin. This reaction produces the protein fragment D-dimer, which is a useful marker of fibrinolysis, and a marker of thrombin activity because fibrin is cleaved from fibrinogen to fibrin.

Bleeding after Coronary Artery bypass Graft

Cardiac surgery with concomitant CPB can profoundly alter haemostasis, predisposing patients to major haemorrhagic complications and possibly early bypass conduit-related thrombotic events as well. Five to seven percent of patients lose more than 2 litres of blood within the first 24 hours after surgery, between 1% and 5% require re-operation for bleeding. Re-operation for bleeding increases hospital mortality 3 to 4 fold, substantially increases post-operative hospital stay and has a sizeable effect on health care costs. Nevertheless, re-exploration is a strong risk factor associated with increased operative mortality and morbidity, including sepsis, renal failure, respiratory failure and arrhythmias.

(Gábor Veres. New Drug Therapies Reduce Bleeding in Cardiac Surgery. Ph.D. Doctoral Dissertation. 2010. Semmelweis University)

Read Full Post »

Coagulation: Transition from a familiar model tied to Laboratory Testing, and the New Cellular-driven Model


Coagulation: Transition from a familiar model tied to Laboratory Testing, and the New Cellular-driven Model

 

Curator: Larry H. Bernstein, MD, FCAP 

Short Title: Coagulation viewed from Y to cellular biology.

PART I.

Summary: This portion of the series on PharmaceuticalIntelligence(wordpress.com) isthe first of a three part treatment of the diverse effects on platelets, the coagulation cascade, and protein-membrane interactions.  It is highly complex as the distinction between intrinsic and extrinsic pathways become blurred as a result of  endothelial shear stress, distinctly different than penetrating or traumatic injury.  In addition, other factors that come into play are also considered.  The second part will be directed toward low flow states, local and systemic inflammatory disease, oxidative stress, and hematologic disorders, bringing NO and the role of NO synthase in the process.   A third part will be focused on management of these states.

Coagulation Pathway

The workhorse tests of the modern coagulation laboratory, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT), are the basis for the published extrinsic and intrinsic coagulation pathways.  This is, however, a much simpler model than one encounters delving into the mechanism and interactions involved in hemostasis and thrombosis, or in hemorrhagic disorders.

We first note that there are three components of the hemostatic system in all vertebrates:

  • Platelets,
  • vascular endothelium, and
  • plasma proteins.

The liver is the largest synthetic organ, which synthesizes

  • albumin,
  • acute phase proteins,
  • hormonal and metal binding proteins,
  • albumin,
  • IGF-1, and
  • prothrombin, mainly responsible for the distinction between plasma and serum (defibrinated plasma).

According to WH Seegers [Seegers WH,  Postclotting fates of thrombin.  Semin Thromb Hemost 1986;12(3):181-3], prothrombin is virtually all converted to thrombin in clotting, but Factor X is not. Large quantities of thrombin are inhibited by plasma and platelet AT III (heparin cofactor I), by heparin cofactor II, and by fibrin.  Antithrombin III, a serine protease, is a main inhibitor of thrombin and factor Xa in blood coagulation. The inhibitory function of antithrombin III is accelerated by heparin, but at the same time antithrombin III activity is also reduced. Heparin retards the thrombin-fibrinogen reaction, but otherwise the effectiveness of heparin as an anticoagulant depends on antithrombin III in laboratory experiments, as well as in therapeutics. The activation of prothrombin is inhibited, thereby inactivating  any thrombin or other vulnerable protease that might otherwise be generated. [Seegers WH, Antithrombin III. Theory and clinical applications. H. P. Smith Memorial Lecture. Am J Clin Pathol. 1978;69(4):299-359)].  With respect to platelet aggregation, platelets aggregate with thrombin-free autoprothrombin II-A. Aggregation is dependent on an intact release mechanism since inhibition of aggregation occurred with adenosine, colchicine, or EDTA. Autoprothrombin II-A reduces the sensitivity of platelets to aggregate with thrombin, but enhances epinephrine-mediated aggregation. [Herman GE, Seegers WH, Henry RL. Autoprothrombin ii-a, thrombin, and epinephrine: interrelated effects on platelet aggregation. Bibl Haematol 1977;44:21-7.]

A tetrapeptide, residues 6 to 9 in normal prothrombin, was isolated from the NH(2)-terminal, Ca(2+)-binding part of normal prothrombin. The peptide contained two residues of modified glutamic acid, gamma-carboxyglutamic acid. This amino acid gives normal prothrombin the Ca(2+)-binding ability that is necessary for its activation.

Abnormal prothrombin, induced by the vitamin K antagonist, dicoumarol, lacks these modified glutamic acid residues and that this is the reason why abnormal prothrombin does not bind Ca(2+) and is nonfunctioning in blood coagulation. [Stenflo J, Fernlund P, Egan W, Roepstorff P. Vitamin K dependent modifications of glutamic acid residues in prothrombin.  Proc Natl Acad Sci U S A. 1974;71(7):2730-3.]

Interestingly, a murine monoclonal antibody (H-11) binds a conserved epitope found at the amino terminal of the vitamin K-dependent blood proteins prothrombin, factors VII and X, and protein C. The sequence of polypeptide recognized contains 2 residues of gamma-carboxyglutamic acid, and binding of the antibody is inhibited by divalent metal ions.  The antibody bound specifically to a synthetic peptide corresponding to residues 1-12 of human prothrombin that was synthesized as the gamma-carboxyglutamic acid-containing derivative, but binding to the peptide was not inhibited by calcium ion. This suggested that binding by divalent metal ions is not due simply to neutralization of negative charge by Ca2+. [Church WR, Boulanger LL, Messier TL, Mann KG. Evidence for a common metal ion-dependent transition in the 4-carboxyglutamic acid domains of several vitamin K-dependent proteins. J Biol Chem. 1989;264(30):17882-7.]

Role of vascular endothelium.

I have identified the importance of prothrombin, thrombin, and the divalent cation Ca 2+ (1% of the total body pool), mention of heparin action, and of vitamin K (inhibited by warfarin).  Endothelial functions are inherently related to procoagulation and anticoagulation. The subendothelial matrix is a complex of many materials, most important related to coagulation being collagen and von Willebrand factor.

What about extrinsic and intrinsic pathways?  Tissue factor, when bound to factor VIIa, is the major activator of the extrinsic pathway of coagulation. Classically, tissue factor is not present in the plasma but only presented on cell surfaces at a wound site, which is “extrinsic” to the circulation.  Or is it that simple?

Endothelium is the major synthetic and storage site for von Willebrand factor (vWF).  vWF is…

  • secreted from the endothelial cell both into the plasma and also
  • abluminally into the subendothelial matrix, and
  • acts as the intercellular glue binding platelets to one another and also to the subendothelial matrix at an injury site.
  • acts as a carrier protein for factor VIII (antihemophilic factor).
  • It  binds to the platelet glycoprotein Ib/IX/V receptor and
  • mediates platelet adhesion to the vascular wall under shear. [Lefkowitz JB. Coagulation Pathway and Physiology. Chapter I. in Hemostasis Physiology. In ( ???), pp1-12].

Ca++ and phospholipids are necessary for all of the reactions that result in the activation of prothrombin to thrombin. Coagulation is initiated by an extrinsic mechanism that

  • generates small amounts of factor Xa, which in turn
  • activates small amounts of thrombin.

The tissue factor/factorVIIa proteolysis of factor X is quickly inhibited by tissue factor pathway inhibitor (TFPI).The small amounts of thrombin generated from the initial activation feedback

  • to create activated cofactors, factors Va and VIIIa, which in turn help to
  • generate more thrombin.
  • Tissue factor/factor VIIa is also capable of indirectly activating factor X through the activation of factor IX to factor IXa.
  • Finally, as more thrombin is created, it activates factor XI to factor XIa, thereby enhancing the ability to ultimately make more thrombin.

 

Coagulation cascade

Coagulation cascade (Photo credit: Wikipedia)

Coagulation Cascade

The procoagulant plasma coagulation cascade has traditionally been divided into the intrinsic and extrinsic pathways. The Waterfall/Cascade model consists of two separate initiations,

  • intrinsic (contact)and
    • The intrinsic pathway is initiated by a complex activation process of the so-called contact phase components,
      • prekallikrein,
      • high-molecular weight kininogen (HMWK) and
      • factor XII

Activation of the intrinsic pathway is promoted by non-biological surfaces, such as glass in a test tube, and is probably not of physiological importance, at least not in coagulation induced by trauma.

Instead, the physiological activation of coagulation is mediated exclusively via the extrinsic pathway, also known as the tissue factor pathway.

  • extrinsic pathways

Tissue factor (TF) is a membrane protein which is normally found in tissues. TF forms a procoagulant complex with factor VII, which activates factor IX and factor X.

  • common pathway which ultimately merge at the level of Factor Xa

Regulation of thrombin generation. Coagulation is triggered (initiation) by circulating trace amounts of fVIIa and locally exposed tissue factor (TF). Subsequent formations of fXa and thrombin are regulated by a tissue factor pathway inhibitor (TFPI) and antithrombin (AT). When the threshold level of thrombin is exceeded, thrombin activates platelets, fV, fVIII, and fXI to augment its own generation (propagation).

Activated factors IX and X (IXa and Xa) will activate prothrombin to thrombin and finally the formation of fibrin. Several of these reactions are much more efficient in the presence of phospholipids and protein cofactors factors V and VIII, which thrombin activates to Va and VIIIa by positive feedback reactions.

We depict the plasma coagulation emphasizing the importance of membrane surfaces for the coagulation processes. Coagulation is initiated when tissue factor (TF), an integral membrane protein, is exposed to plasma. TF is expressed on subendothelial cells (e.g. smooth muscle cells and fibroblasts), which are exposed after endothelium damage. Activated monocytes are also capable of exposing TF.

A small amount, approximately 1%, of activated factor VII (VIIa) is present in circulating blood and binds to TF. Free factor VIIa has poor enzymatic activity and the initiation is limited by the availability of its cofactor TF. The first steps in the formation of a blood clot is the specific activation of factor IX and X by the TF-VIIa complex. (Initiation of coagulation: Factor VIIa binds to tissue factor and activates factors IX and X). Coagulation is propagated by procoagulant enzymatic complexes that assemble on the negatively charged membrane surfaces of activated platelets. (Propagation of coagulation: Activation of factor X and prothrombin).  Once thrombin has been formed it will activate the procofactors, factor V and factor VIII, and these will then assemble in enzyme complexes. Factor IXa forms the tenase complex together with its cofactor factor VIIIa, and factor Xa is the enzymatic component of the prothrombinase complex with factor Va as cofactor.

Activation of protein C takes place on the surface of intact endothelial cells. When thrombin (IIa) reaches intact endothelium it binds with high affinity to a specific receptor called thrombomodulin. This shifts the specific activity of thrombin from being a procoagulant enzyme to an anticoagulant enzyme that activates protein C to activated protein C (APC).  The localization of protein C to the thrombin-thrombomodulin complex can be enhanced by the endothelial protein C receptor (EPCR), which is a transmembrane protein with high affinity for protein C.  Activated protein C (APC) binds to procoagulant surfaces such as the membrane of activated platelets where it finds and degrades the procoagulant cofactors Va and VIIIa, thereby shutting down the plasma coagulation.  Protein S (PS) is an important nonenzymatic  cofactor to APC in these reactions. (Degradation of factors Va and VIIIa).

Blood Coagulation (Thrombin) and Protein C Pat...

Blood Coagulation (Thrombin) and Protein C Pathways (Blood_Coagulation_and_Protein_C_Pathways.jpg) (Photo credit: Wikipedia)

The common theme in activation and regulation of plasma coagulation is the reduction in dimensionality. Most reactions take place in a 2D world that will increase the efficiency of the reactions dramatically. The localization and timing of the coagulation processes are also dependent on the formation of protein complexes on the surface of membranes. The coagulation processes can also be controlled by certain drugs that destroy the membrane binding ability of some coagulation proteins – these proteins will be lost in the 3D world and not able to form procoagulant complexes on surfaces.

Activated protein C resistance

Activated protein C resistance (Photo credit: Wikipedia)

Assembly of proteins on membranes – making a 3D world flat

  • The timing and efficiency of coagulation processes are handled by reduction in dimensionality
  • – Make 3 dimensions to 2 dimensions
  • Coagulation proteins have membrane binding capacity
  • Membranes provide non-coagulant and procoagulant surfaces
  • – Intact cells/activated cells
  • Membrane binding is a target for anticoagulant drugs
  • – Anti-vitamin K (e.g. warfarin)

Modern View

It can be divided into the phases of initiation, amplification and propagation.

  • In the initiation phase, small amounts of thrombin can be formed after exposure of tissue factor to blood.
  • In the amplification phase, the traces of thrombin will be inactivated or used for amplification of the coagulation process.

At this stage there is not enough thrombin to form insoluble fibrin. In order to proceed further thrombin  activates platelets, which provide a procoagulant surface for the coagulation factors. Thrombin will also activate the vital cofactors V and VIII that will assemble on the surface of activated platelets. Thrombin can also activate factor XI, which is important in a feedback mechanism.

In the final step, the propagation phase, the highly efficient tenase and prothrombinase complexes have been assembled on the membrane surface. This yields large amounts of thrombin at the site of injury that can cleave fibrinogen to insoluble fibrin. Factor XI activation by thrombin then activates factor IX, which leads to the formation of more tenase complexes. This ensures enough thrombin is formed, despite regulation of the initiating TF-FVIIa complex, thus ensuring formation of a stable fibrin clot. Factor XIII stabilizes the fibrin clot through crosslinking when activated by thrombin.

Platelet Aggregation

The activities of adenylate and guanylate cyclase and cyclic nucleotide 3′:5′-phosphodiesterase were determined during the aggregation of human blood platelets with

  • thrombin, ADP
  • arachidonic acid and
  • epinephrine

[Aggregation is dependent on an intact release mechanism since inhibition of aggregation occurred with adenosine, colchicine, or EDTA.  (Herman GE, Seegers WH, Henry RL. Autoprothrombin ii-a, thrombin, and epinephrine: interrelated effects on platelet aggregation. Bibl Haematol 1977;44:21-7)].

The activity of guanylate cyclase is altered to a much larger degree than adenylate cyclase, while cyclic nucleotide phosphodiesterase activity remains unchanged. During the early phases of thrombin- and ADP-induced platelet aggregation a marked activation of the guanylate cyclase occurs whereas aggregation induced by arachidonic acid or epinephrine results in a rapid diminution of this activity. In all four cases, the adenylate cyclase activity is only slightly decreased when examined under identical conditions.

Platelet aggregation induced by a wide variety of aggregating agents including collagen and platelet isoantibodies results in the “release” of only small amounts (1–3%) of guanylate cyclase and cyclic nucleotide phosphodiesterase and no adenylate cyclase. The guanylate cyclase and cyclic nucleotide phosphodiesterase activities are associated almost entirely with the soluble cytoplasmic fraction of the platelet, while the adenylate cyclase is found exclusively in a membrane bound form. ADP and epinephrine moderately inhibit guanylate and adenylate cyclase in subcellular preparations, while arachidonic and other unsaturated fatty acids moderately stimulate (2–4-fold) the former.

  1. The platelet guanylate cyclase activity during aggregation depends on the nature and mode of action of the inducing agent.
  2. The membrane adenylate cyclase activity during aggregation is independent of the aggregating agent and is associated with a reduction of activity and
  3. Cyclic nucleotide phosphodiesterase remains unchanged during the process of platelet aggregation and release.

Furthermore, these observations suggest a role for unsaturated fatty acids in the control of intracellular cyclic GMP levels. Arachidonic acid, once deemed essential, is a derivative of linoleic acid. (Barbera AJ. Cyclic nucleotides and platelet aggregation effect of aggregating agents on the activity of cyclic nucleotide-metabolizing enzymes. Biochimica et Biophysica Acta (BBA) 1976; 444 (2): 579–595. http://dx.doi.org/10.1016/0304-4165(76)90402-5).

Leukocyte and platelet adhesion under flow

The basic principles concerning mechanical stress demonstrated by Robert Hooke (1635-1703) proved to be essential for the understanding of pathophysiological mechanisms in the vascular bed.

In physics, stress is the internal distribution of forces within a body that balance and react to the external loads applied to it. Stress is a 2nd order tensor. The hemodynamic conditions inside blood vessels lead to the development of superficial stresses near the vessel walls, which can be divided into two categories:

a) circumferential stress due to pulse pressure variation inside the vessel;

b) shear stress due to blood flow.

The direction of the shear stress vector is determined by the direction of the blood flow velocity vector very close to the vessel wall. Shear stress is applied by the blood against the vessel wall. Friction is the force applied by the wall to the blood and has a direction opposite to the blood flow. The tensions acting against the vessel wall are likely to be determined by blood flow conditions. Shear stresses are most complicated during turbulent flow, regions of flow recirculation or flow separation.

The notions of shear rate and fluid viscosity should be first clearly apprehended, since they are crucial for the assessment and development of shear stress. Shear rate is defined as the rate at which adjacent layers of fluid move with respect to each other, usually expressed as reciprocal seconds. The size of the shear rate gives an indication of the shape of the velocity profile for a given situation.  The determination of shear stresses on a surface is based on the fundamental assumption of fluid mechanics, according to which the velocity of fluid upon the surface is zero (no-slip condition). Assuming that the blood is an ideal Newtonian fluid with constant viscosity, the flow is steady and laminar and the vessel is straight, cylindrical and inelastic, which is not the case. Under ideal conditions a parabolic velocity profile could be assumed.

The following assumptions have been made:

  1. The blood is considered as a Newtonian fluid.
  2. The vessel cross sectional area is cylindrical.
  3. The vessel is straight with inelastic walls.
  4. The blood flow is steady and laminar.

The Haagen-Poisseuille equation indicates that shear stress is directly proportional to blood flow rate and inversely proportional to vessel diameter.

Viscosity is a property of a fluid that offers resistance to flow, and it is a measure of the combined effects of adhesion and cohesion. It increases as temperature decreases. Blood viscosity (non-Newtonian fluid) depends on shear rate, which is determined by blood platelets, red cells, etc. Moreover, it is slightly affected by shear rate changes at low levels of hematocrit. In contrast, as hematocrit increases, the effect of shear rate changes on blood viscosity becomes greater. Blood viscosity measurement is required for the accurate calculation of shear stress in veins or microcirculation.

It has to be emphasised that the dependence of blood viscosity on hematocrit is more pronounced in the microcirculation than in larger vessels, due to hematocrit variations observed in small vessels (lumen diameter <100 Ìm). The significant change of hematocrit in relation to vessel diameter is associated with the tendencyof red blood cells to travel closer to the centre of the vessels. Thus, the greater the decrease in vessel lumen, the smaller the number of red blood cells that pass through, resulting in a decrease in blood viscosity.

Shear stress and vascular endothelium

Endothelium responds to shear stress through various pathophysiological mechanisms depending on the kind and the magnitude of shear stresses. More specifically, the exposure of vascular endothelium to shear forces in the normal value range stimulates endothelial cells to release agents with direct or indirect antithrombotic properties, such as prostacyclin, nitric oxide (NO), calcium, thrombomodulin, etc.  The possible existence of so-called “mechanoreceptors” has provoked a number of research groups to propose receptors which “translate” mechanical forces into biological signals.

Under normal shear conditions, endothelial as well as smooth muscle cells have a rather low rate of proliferation. Changes in shear stress magnitude activate cellular proliferation mechanisms as well as vascular remodeling processes. More specifically, a high grade of shear stress increases wall thickness and expands the vessel’s diameter, so that shear stress values return to their normal values. In contrast, low shear stress induces a reduction in vessel diameter. Shear stresses stimulate vasoregulatory mechanisms which, together with alterations of arterial diameter, serves to maintain a mean shear stress level of about 15 dynes/cm2. The presence of low shear stresses is frequently accompanied by unstable flow conditions (e.g. turbulence flow, regions of blood recirculation, “stagnant” blood areas).

(Papaioannou TG, Stefanadis C. Vascular Wall Shear Stress: Basic Principles and Methods. Hellenic J Cardiol 2005; 46: 9-15.)

Leukocyte adhesion under flow in the microvasculature is mediated by binding between cell surface receptors and complementary ligands expressed on the surface of the endothelium. Leukocytes adhere to endothelium in a two-step mechanism: rolling (primarily mediated by selectins) followed by firm adhesion (primarily mediated by integrins). These investigators simulated the adhesion of a cell to a surface in flow, and elucidated the relationship between receptor–ligand functional properties and the dynamics of adhesion using a computational method called ‘‘Adhesive Dynamics.’’ This relationship was expressed in a one-to-one map between the biophysical properties of adhesion molecules and various adhesive behaviors.

Behaviors that are observed in simulations include firm adhesion, transient adhesion (rolling), and no adhesion. They varied the dissociative properties, association rate, bond elasticity, and shear rate and found that the unstressed dissociation rate, kro, and the bond interaction length, γ, are the most important molecular properties controlling the dynamics of adhesion.

(Chang KC, Tees DFJ and Hammer DA. The state diagram for cell adhesion under flow: Leukocyte rolling and firm adhesion. PNAS 2000; 97(21):11262-11267.)

The study of the effect of leukocyte adhesion on blood flow in small vessels is of primary interest to understand the resistance changes in venular microcirculation when blood is considered as a homogeneous Newtonian fluid. When studying the effect of leukocyte adhesion on the non-Newtonian Casson fluid flow of blood in small venules; the Casson model represents the effect of red blood cell aggregation. In this model the blood vessel is considered as a circular cylinder and the leukocyte is considered as a truncated spherical protrusion in the inner side of the blood vessel. Numerical simulations demonstrated that for a Casson fluid with hematocrit of 0.4 and flow rate Q = 0:072 nl/s, a single leukocyte increases flow resistance by 5% in a 32 m diameter and 100 m long vessel. For a smaller vessel of 18 m, the flow resistance increases by 15%.

(Das B, Johnson PC, and Popel AS. Computational fluid dynamic studies of leukocyte adhesion effects on non-Newtonian blood flow through microvessels. Biorheology  2000; 37:239–258.)

Biologists have identified many of the molecular constituents that mediate adhesive interactions between white blood cells, the cell layer that lines blood vessels, blood components, and foreign bodies. However, the mechanics of how blood cells interact with one another and with biological or synthetic surfaces is quite complex: owing to the deformability of cells, the variation in vessel geometry, and the large number of competing chemistries present (Lipowski et al., 1991, 1996).

Adhesive interactions between white blood cells and the interior surface of the blood vessels they contact is important in inflammation and in the progression of heart disease. Parallel-plate microchannels have been useful in characterizing the strength of these interactions, in conditions that are much simplified over the complex environment these cells experience in the body. Recent computational and experimental work by several laboratories have attempted to bridge this gap between behavior observed in flow chamber experiments, and cell surface interactions observed in the microvessels of anesthetized animals.

We have developed a computational simulation of specific adhesive interactions between cells and surfaces under flow. In the adhesive dynamics formulation, adhesion molecules are modeled as compliant springs. One well-known model used to describe the kinetics of single biomolecular bond failure is due to Bell, which relates the rate of dissociation kr to the magnitude of the force on the bond F. The rate of formation directly follows from the Boltzmann distribution for affinity. The expression for the binding rate must also incorporate the effect of the relative motion of the two surfaces. Unless firmly adhered to a surface, white blood cells can be effectively modeled as rigid spherical particles, as evidenced by the good agreement between bead versus cell in vitro experiments (Chang and Hammer, 2000).

Various in vitro, in vivo, and computational methods have been developed to understand the complex range of transient interactions between cells, neighboring cells, and bounding surfaces under flow. Knowledge gained from studying physiologically realistic flow systems may prove useful in microfluidic applications where the transport of blood cells and solubilized, bioactive molecules is needed, or in miniaturized diagnostic devices where cell mechanics or binding affinities can be correlated with clinical pathologies.

(King MR. Cell-Surface Adhesive Interactions in Microchannels and Microvessels.   First International Conference on Microchannels and Minichannels. 2003, Rochester, NY. Pp 1-6. ICMM2003-1012.

P-selectin role in adhesion of leukocytes and sickle cells blocked by heparin

Vascular occlusion is responsible for much of the morbidity associated with sickle cell disease. Although the underlying cause of sickle cell disease is a single nucleotide mutation that directs the production of an easily polymerized hemoglobin protein, both the erythrocyte sickling caused by hemoglobin polymerization and the interactions between a proadhesive population of sickle cells and the vascular endothelium are essential to vascular occlusion.

Interactions between sickle cells and the endothelium use several cell adhesion molecules. Sickle red cells express adhesion molecules including integrin, CD36, band 3 protein, sulfated glycolipid, Lutheran protein, phosphatidylserine, and integrin-associated protein. The proadhesive sickle cells may bind to endothelial cell P-selectin, E-selectin, vascular cell adhesion molecule-1 (VCAM-1), CD36, and integrins. Activation of endothelial cells by specific agonists enhances adhesion by inducing the expression of cellular adhesion molecules and by causing cell contraction, which exposes extracellular matrix proteins, such as thrombospondin (TSP), laminin, and fibronectin. Initial events likely involve the adhesion of sickle erythrocytes to activated endothelial cells under laminar flow. The resultant adhesion of cells to the vascular wall creates nonlaminar and arrested flow, which propagates vascular occlusion by both static and flow adhesion mechanisms. It is likely too that the distinct mechanisms of adhesion and of regulation of endothelial cell adhesivity pertain under dissimilar types of flow.

The expression of adhesion molecules by endothelial cells is affected by cell agonists such as thrombin, histamine, tumor necrosis factor  (TNF-), interleukin 1 (IL-1), platelet activating factor (PAF), erythropoietin, and vascular endothelial growth factor (VEGF), and by local environmental factors such as hypoxia, reperfusion, flow, as well as by sickle erythrocytes themselves. An important effector in sickle cell vascular occlusion is thrombin. Increased thrombin activity correlates with sickle cell disease pain episodes. In addition to generating fibrin clot, thrombin also acts on specific thrombin receptors on endothelial cells and platelets. Work from our laboratory has demonstrated that thrombin treatment causes a rapid increase of endothelial cell adhesivity for sickle erythrocytes under static conditions

We have also reported that sickle cell adhesion to endothelial cells under static conditions involves P-selectin. Although P-selectin plays a major role in the tethering, rolling, and firm adhesion of leukocytes to activated endothelial cells, its contribution to the initial steps is singular and essential to the overall adhesion process. Upon stimulation of endothelial cells by thrombin, P-selectin rapidly translocates from Weibel-Palade bodies to the luminal surface of the cells. Others have shown that sickle cell adhesion is decreased by unfractionated heparin, but the molecular target of this inhibition has not been defined. We postulated that the adhesion of sickle cells to P-selectin might be the pathway blocked by unfractionated heparin. Heparin is known to block certain types of tumor cell adherence, TSP-independent sickle cell adherence, and coagulation processes that are active in sickle cell disease. In one uncontrolled study, prophylactic administration of heparin reduced the frequency of sickle cell pain crises. The role of P-selectin in the endothelial adhesion of sickle red blood cells, the capacity of heparin to block selected P-selectin–mediated adhesive events, and the effect of heparin on sickle cell adhesion suggest an association among these findings.

We postulate that, in a manner similar to that seen for neutrophil adhesion, P-selectin may play a role in the tethering and rolling adhesion of sickle cells. As with neutrophils, integrins may then mediate the firm adhesion of rolling sickle erythrocytes. The integrin  is expressed on sickle reticulocytes and can mediate adhesion to endothelial cells, possibly via endothelial VCAM-4. The endothelial integrin, V3, also mediates sickle cell adhesion to endothelial cells. Other 1 and 3 integrins may also fulfill this role.

In this report we demonstrate that the flow adherence of sickle cells to thrombin-treated human vascular endothelial cells also uses P-selectin and that this component of adhesion is inhibited by unfractionated heparin. We also demonstrate that sickle cells adhere to immobilized recombinant P-selectin under flow conditions. This adhesion too was inhibited by unfractionated heparin, in a concentration range that is clinically attainable. These findings and the general role of P-selectin in initiating adhesion of blood cells to the endothelium suggest that unfractionated heparin may be useful in preventing painful vascular occlusion. A clinical trial to test this hypothesis is indicated.

(Matsui NM, Varki A, and Embury SH.  Heparin inhibits the flow adhesion of sickle red blood cells to P-selectin  Blood. 2002; 100:3790-3796)

Related articles

Read Full Post »


Nitric Oxide, Platelets, Endothelium and Hemostasis (Coagulation Part II)

Curator: Larry H. Bernstein, MD, FCAP 

Subtitle: Nitric oxide and hemostatic mechanisms.  Part II.

Summary: This is the second of a coagulation series on

http://pharmaceuticalIntelligence.com

Treating the diverse effects of NO on platelets, the coagulation cascade, and protein-membrane interactions with low flow states, local and systemic inflammatory disease, oxidative stress, and hematologic disorders.  It is highly complex as the distinction between intrinsic and extrinsic pathways become blurred as a result of  endothelial shear stress, distinctly different than penetrating or traumatic injury.  In addition, other factors that come into play are also considered.

Please refer to Part I. Coagulation Pathway

https://pharmaceuticalintelligence.com/2012/11/26/biochemistry-of-the-coagulation-cascade-and-platelet-aggregation/

The workhorse tests of the modern coagulation laboratory, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT), are the basis for the published extrinsic and intrinsic coagulation pathways.  This is, however, a much simpler model than one encounters delving into the mechanism and interactions involved in hemostasis and thrombosis, or in hemorrhagic disorders.

We first note that there are three components of the hemostatic system in all vertebrates:

  • Platelets,
  • vascular endothelium, and
  • plasma proteins.

The liver is the largest synthetic organ, which synthesizes

  • albumin,
  • acute phase proteins,
  • hormonal and metal binding proteins,
  • albumin,
  • IGF-1, and
  • prothrombin, mainly responsible for the distinction between plasma and serum (defibrinated plasma).

Role of vascular endothelium.

I have identified the importance of prothrombin, thrombin, and the divalent cation Ca 2+ (1% of the total body pool), mention of heparin action, and of vitamin K (inhibited by warfarin).  Endothelial functions are inherently related to procoagulation and anticoagulation. The subendothelial matrix is a complex of many materials, most important related to coagulation being collagen and von Willebrand factor.

What about extrinsic and intrinsic pathways?  Tissue factor, when bound to factor VIIa, is the major activator of the extrinsic pathway of coagulation. Classically, tissue factor is not present in the plasma but only presented on cell surfaces at a wound site, which is “extrinsic” to the circulation.  Or is it that simple?

Endothelium is the major synthetic and storage site for von Willebrand factor (vWF).  vWF is…

  • secreted from the endothelial cell both into the plasma and also
  • abluminally into the subendothelial matrix, and
  • acts as the intercellular glue binding platelets to one another and also to the subendothelial matrix at an injury site.
  • acts as a carrier protein for factor VIII (antihemophilic factor).
  • It  binds to the platelet glycoprotein Ib/IX/V receptor and
  • mediates platelet adhesion to the vascular wall under shear. [Lefkowitz JB. Coagulation Pathway and Physiology. Chapter I. in Hemostasis Physiology. In ( ???), pp1-12].

Ca++ and phospholipids are necessary for all of the reactions that result in the activation of prothrombin to thrombin. Coagulation is initiated by an extrinsic mechanism that

  • generates small amounts of factor Xa, which in turn
  • activates small amounts of thrombin.

The tissue factor/factorVIIa proteolysis of factor X is quickly inhibited by tissue factor pathway inhibitor (TFPI).The small amounts of thrombin generated from the initial activation feedback

  • to create activated cofactors, factors Va and VIIIa, which in turn help to
  • generate more thrombin.
  • Tissue factor/factor VIIa is also capable of indirectly activating factor X through the activation of factor IX to factor IXa.
  • Finally, as more thrombin is created, it activates factor XI to factor XIa, thereby enhancing the ability to ultimately make more thrombin.

The reconceptualization of hemostasis 

The common theme in activation and regulation of plasma coagulation is the reduction in dimensionality. Most reactions take place in a 2D world that will increase the efficiency of the reactions dramatically. The localization and timing of the coagulation processes are also dependent on the formation of protein complexes on the surface of membranes. The coagulation processes can also be controlled by certain drugs that destroy the membrane binding ability of some coagulation proteins – these proteins will be lost in the 3D world and not able to form procoagulant complexes on surfaces.

Assembly of proteins on membranes – making a 3D world flat

• The timing and efficiency of coagulation processes are handled by reduction in dimensionality

– Make 3 dimensions to 2 dimensions

• Coagulation proteins have membrane binding capacity

• Membranes provide non-coagulant and procoagulant surfaces

– Intact cells/activated cells

• Membrane binding is a target for anticoagulant drugs

– Anti-vitamin K (e.g. warfarin)

Modern View

It can be divided into the phases of initiation, amplification and propagation.

  • In the initiation phase, small amounts of thrombin can be formed after exposure of tissue factor to blood.
  • In the amplification phase, the traces of thrombin will be inactivated or used for amplification of the coagulation process.

At this stage there is not enough thrombin to form insoluble fibrin. In order to proceed further thrombin  activates platelets, which provide a procoagulant surface for the coagulation factors. Thrombin will also activate the vital cofactors V and VIII that will assemble on the surface of activated platelets. Thrombin can also activate factor XI, which is important in a feedback mechanism.

In the final step, the propagation phase, the highly efficient tenase and prothrombinase complexes have been assembled on the membrane surface. This yields large amounts of thrombin at the site of injury that can cleave fibrinogen to insoluble fibrin. Factor XI activation by thrombin then activates factor IX, which leads to the formation of more tenase complexes. This ensures enough thrombin is formed, despite regulation of the initiating TF-FVIIa complex, thus ensuring formation of a stable fibrin clot. Factor XIII stabilizes the fibrin clot through crosslinking when activated by thrombin.

Platelet Aggregation

The activities of adenylate and guanylate cyclase and cyclic nucleotide 3′:5′-phosphodiesterase were determined during the aggregation of human blood platelets with

  • thrombin, ADP,
  • arachidonic acid and
  • epinephrine.

[Aggregation is dependent on an intact release mechanism since inhibition of aggregation occurred with adenosine, colchicine, or EDTA.  (Herman GE, Seegers WH, Henry RL. Autoprothrombin ii-a, thrombin, and epinephrine: interrelated effects on platelet aggregation. Bibl Haematol 1977;44:21-7)].

  1. The platelet guanylate cyclase activity during aggregation depends on the nature and mode of action of the inducing agent.
  2. The membrane adenylate cyclase activity during aggregation is independent of the aggregating agent and is associated with a reduction of activity and
  3. Cyclic nucleotide phosphodiesterase remains unchanged during the process of platelet aggregation and release.

The role of platelets in arterial thrombosis

Formation of a thrombus on a ruptured plaque is the product of a complex interaction between coagulation factors in the plasma and platelets.

  • Tissue factor (TF) released from the subendothelial tissue after endothelial damage induces a cascade of activation of coagulation factors ultimately leading to the formation of thrombin.
  • Thrombin cleaves fibrinogen to fibrin, which assembles into a mesh that supports the platelet aggregates.

The Platelet

The platelets are …

  • anucleated,
  • discoid shaped cell fragments
  • originating from megakaryocytes
  •  fragmented as they are released from the bone marrow

Whether they can in circumstances be developed at extramedullary sites (liver sinusoid) is another matter. They have a lifespan of 7-10 days.  Of special interest is:

  • They have a network of internal membranes forming a dense tubular system and the open canalicular system (OCS).
  • The plasma membrane is an extension of the OCS, thereby greatly increasing the surface area of the platelet.
  • The dense tubular system is comparable to the endoplasmatic reticulum in other cell types and is the main storage place of the majority of the platelet’s Ca2+.

Three types of secretory granules exist in platelets:

  • the dense granules
    •  In the dense granules serotonin
    • adenosine diphosphate (ADP) and
    • Ca2+ are stored.
    • a-granules contain
      • P-selectin,
      • fibrinogen,
      •  thrombospondin,
      • Von Willebrand Factor,
      • platelet factor 4 and
      • platelet derived growth factor
      • lysosomes.

Circulating platelets are kept in a resting state by endothelial cell derived

  • prostacyclin (PGI2) and
  • nitric oxide (NO).

PGI2 increases cyclic adenosine monophosphate (cAMP), the most potent platelet inhibitor.

Contact activation

The major regulator of the activation of the contact system is the plasma protease inhibitor, C1-INH, which inhibits activated fXII, kallikrein and fXIa. In addition, α2-macroglobulin is an important inhibitor of kallikrein and α1-antitrypsin for fXIa. Factor XII also converts the fXI to an active enzyme, fXIa, which, in turn, converts fIX to fIXa, thereby activating the intrinsic pathway of coagulation.

Activation

Several agonists can activate platelets;

  • ADP,
  • collagen,
  • thromboxane A2 (TxA2),
  • epinephrin,
  • serotonine and
  • thrombin,

which lead to activation previously referred to:

  • platelet shape change is
  • followed by aggregation and
  • granule secretion.

Upon activation the discoid shape changes into a spherical form.

Activation of platelets is increased by two positive feedback loops

  1. arachidonic acid is cleaved from phospholipids and transformed by cyclooxygenase

(COX) to prostaglandin G2 and H2,

  • followed by the formation of TxA2, a potent platelet agonist.

2.   the secretion of ADP by the dense granules,

  • resulting in activation of the ADP receptor P2Y12.

This causes inhibition of cyclic AMP and sustained aggregation.

Aggregation

The integrin receptor αIIbβ3 plays a vital role in platelet aggregation. The platelet agonists

  • induce a conformational change of the αIIbβ3 receptor and
  • exposition of binding domains for fibrinogen and von Willebrand Factor.

This allows cross-linking of platelets and the formation of aggregates.

In addition to shape change and aggregation, the membranes of the α- and dense granules fuse with the membranes of the OCS. This causes the release of their contents and the transportation of proteins embedded in their membrane to the plasma membrane.

This complex interaction between

  • endothelial cells
  • clotting factors
  • platelets and
  • other factors and cells

can be studied in both in vitro and in vivo model systems. The disadvantage of in vitro assays is that it studies the role of a certain protein or cell in isolation. Given the large number of participants and the complex interactions of thrombus formation there is need to study thrombosis and hemostasis in intact living animals, with all the components important for thrombus formation – a vessel wall and flowing blood – present.

Endothelial Damage and Role as “Primer”

  • Endothelial injury changes the permeability of the arterial wall.
  • This is followed by an influx of low-density lipoprotein (LDL).
  • This elicits an inflammatory response in the vascular wall.
  • Monocytes and T-cells bind to the endothelial cells promoting increased migration of the cells into the intima layer
  • The monocytes differentiate into macrophages, which take up modified lipoproteins and transform them into foam cells.
  • Concurrent with this process macrophages produce cytokines and proteases.

This is a vicious circle of lipid driven inflammation that leads to narrowing of the vessel’s lumen without early clinical consequences. Clinical manifestations of more advanced atherosclerotic disease are caused by destabilization of an atherosclerotic plaque formed as described.

  • The first recognizable lesion of the stable atherosclerotic plaque is the fatty streak, which consists of the above described foam cells and T-lymphocytes in the intima.
  • Further development of the lesion leads to the intermediate lesion, composed
  • of layers of macrophages and smooth muscle cells.
  • A more advanced stage is called the vulnerable plaque.
    • It has a large lipid core that is covered by a thin fibrous cap.
    • This cap separates the lipid contents of the plaque from the circulating blood.
    • The vulnerable plaque is prone to rupture, resulting in the formation of a thrombus on the site of disruption or the thrombus can be superimposed on plaque erosion without signs of plaque rupture.

The formation of a superimposed thrombus on a disrupted atherosclerotic plaque in the lumen of the artery leads to

  • an acute occlusion of the vessel
  • hypoxia of the downstream tissue.

Depending on the location of the atherosclerotic plaque this will cause a myocardial infarction, stroke or peripheral vascular disease.

Endothelial regulation of coagulation

The endothelium attenuates platelet activity by releasing

  • nitric oxide and
  • prostacyclin.

Several coagulation inhibitors are produced by endothelial cells.

Endothelium-derived TFPI (on its surface) is rapidly released into circulation after heparin administration, reducing the pro-coagulant activities of TF-fVIIa. Endothelial cells also secrete heparin-sulphate, a glycosaminoglycan which catalyzes anti-coagulant activity of AT. Plasma AT binds to heparin-sulphate located on the luminal surface and in the basement membrane of the endothelium. Thrombomodulin is another endothelium-bound protein with anti-coagulant and anti-inflammatory functions. In response to systemic pro-coagulant stimuli, tissue-type plasminogen activator (tPA) is transiently released from the Weibel-Palade bodies of endothelial cells to promote fibrinolysis. Downstream of the vascular injury, the complex of TF-fVIIa/fXa is inhibited by TFPI. Plasma (free) fXa and thrombin are rapidly neutralized by heparan-bound AT. Thrombin is also taken up by endothelial surface-bound thrombomodulin.

The protein C pathway works in hemostasis to control thrombin formation in the area surrounding the clot. Thrombin, generated via the coagulation pathway, is localized to the endothelium by binding to the integral membrane protein, thrombomodulin (TM). TM by occupying exosite I on thrombin, which is required for fibrinogen binding and cleavage, reduces thrombin’s pro-coagulant activities. TM bound thrombin  on the endothelial cell surface is able to cleave PC producing activated protein C (APC), a serine protease.  In the presence of protein S, APC inactivates FVa and FVIIIa. The proteolytic activity of APC is regulated predominantly by a protein C inhibitor.

Fibrinolytic pathway

Fibrinolysis is the physiological breakdown of fibrin to limit and resolve blood clots. Fibrin is degraded primarily by the serine protease, plasmin, which circulates as plasminogen. In an auto-regulatory manner, fibrin serves as both the co-factor for the activation of plasminogen and the substrate for plasmin. In the presence of fibrin, tissue plasminogen activator (tPA) cleaves plasminogen producing plasmin, which proteolyzes the fibrin. This reaction produces the protein fragment D-dimer, which is a useful marker of fibrinolysis, and a marker of thrombin activity because fibrin is cleaved from fibrinogen to fibrin.

Nitric Oxide and Platelet Energy Production

Nitric oxide (NO) has been increasingly recognized as an important intra- and intercellular messenger molecule with a physiological role in

  • vascular relaxation
  • platelet physiology
  • neurotransmission and
  • immune responses.

In vitro NO is a strong inhibitor of platelet adhesion and aggregation. In the blood stream, platelets remain in contact with NO that is permanently released from the endothelial cells and from activated macrophages. It  has been suggested that the activated platelet itself is able to produce NO. It has been proposed that the main intracellular target for NO in platelets is soluble cytosolic guanylate cyclase. NO activates the enzyme. When activated, intracellular cGMP elevation inhibits platelet activation. Further, elevated cGMP may not be the sole factor directly involved in the inhibition of platelet activation.

The reaction mechanism of Nitric oxide synthase

The reaction mechanism of Nitric oxide synthase (Photo credit: Wikipedia)

Platelets are fairly active metabolically and have a total ATP turnover rate of about 3–8 times that of resting mammalian muscle. Platelets contain mitochondria which enable these cells to produce energy both in the oxidative and anaerobic pathways.

  • Under aerobic conditions, ATP is produced by aerobic glycolysis which can account for 30–50% of total ATP production,
  • by oxidative metabolism using glucose and glycogen (6–11%), amino-acids (7%) or free fatty acids (20–40%).

The inhibition of mitochondrial respiration by removing oxygen or by respiratory chain blockers (antimycin A, cyanide, rotenone) results in the stimulation of glycolytic flux. This phenomenon indicates that in platelets glycolysis and mitochondrial respiration are tightly functionally connected. It has been reported that the activation of human platelets by high concentration of thrombin is accompanied by an acceleration of lactate production and an increase in oxygen consumption.

The results (in porcine platelets) indicate that:

  • NO is able to diminish mitochondrial energy production through the inhibition of cytochrome oxidase
  • The inhibitory effect of NO on platelet secretion (but not aggregation) can be attributed to the reduction of mitochondrial energy production.

Porcine blood platelets stimulated by collagen produce more lactate. This indicates that both glycolytic and oxidative ATP production supports platelet responses, and blocking of energy production in platelets may decrease their responses. It is well established that platelet responses have different metabolic energy (ATP) requirements increasing in the order:

  • Aggregation
  • < dense and alfa granule secretion
  • < acid hydrolase secretion.

In addition, exogenously added NO (in the form of NO donors) stimulates glycolysis in intact porcine platelets. Since in platelets glycolysis and mitochondrial respiration are tightly functionally connected, this indicates the stimulatory effect of NO on glycolysis in intact platelets may be produced by non-functional mitochondria.

Can this be the case?

  • NO donors are able to inhibit both mitochondrial respiration and platelet cytochrome oxidase.
  • Interestingly, the concentrations of NO donors inhibiting mitochondrial respiration and cytochrome oxidase were similar to those stimulating glycolysis in intact platelets.

Studies have shown that mitochondrial complex I is inhibited only after a prolonged (6–18 h) exposure to NO and

  • This inhibition appears to result from S-nitrosylation of critical thiols in the enzyme complex.
  • Further studies are needed to establish whether long term exposure of platelets to NO affects Mitochondrial complexes I and II.

Comparison of the concentrations of SNAP and SNP affecting cytochrome oxidase activity and mitochondrial respiration with those reducing the platelet responses indicates that NO does not reduce platelet aggregation through the inhibition of oxidative energy production. The concentrations of the NO donors inhibiting platelet secretion, mitochondrial respiration and cytochrome oxidase were similar. Thus, the platelet release reaction strongly depends on the oxidative energy production, and  in porcine platelets NO inhibits mitochondrial energy production at the step of cytochrome oxidase.

Taking into account that platelets may contain NO synthase and are able to produce significant amounts of NO it seems possible that nitric oxide can function in these cells as a physiological regulator of mitochondrial energy production.

Key words: glycolysis, mitochondrial energy production, nitric oxide, porcine platelets.
Abbreviations: NO, nitric oxide; SNAP, S-nitroso-N-acetylpenicyllamine; SNP, sodium nitroprusside.

[M Tomasiak, H Stelmach, T Rusak and J Wysocka.  Nitric oxide and platelet energy metabolism.  Acta Biochimica Polonica 2004; 51(3):789–803.]

Nitric Oxide and Platelet Adhesion

The adhesion of human platelets to monolayers of bovine endothelial cells in culture was studied to determine the role of endothelium-derived nitric oxide in the regulation of platelet adhesion. The adhesion of unstimulated and thrombin-stimulated platelets, washed and labelled with indium-111, was lower in the presence than in the absence of bradykinin or exogenous nitric oxide. The inhibitory action of both bradykinin and nitric oxide was abolished by hemoglobin, but not by aspirin, and was potentiated by superoxide dismutase to a similar degree. It appears that the effect of bradykinin is mediated by the release of nitric oxide from the endothelial cells, and that nitric oxide release contributes to the non-adhesive properties of vascular endothelium.

(Radomski MW, Palmer RMJ, Moncada S.   Endogenous Nitric Oxide Inhibits Human Platelet Adhesion to Vascular Endothelium. The Lancet  1987 330; 8567(2): 1057–1058.
http://dx.doi.org/10.1016/S0140-6736(87)91481-4)

1 The interactions between endothelium-derived nitric oxide (NO) and prostacyclin as inhibitors of platelet aggregation were examined to determine whether release of NO accounts for the inhibition of platelet aggregation attributed to EDRF.

2 Porcine aortic endothelial cells treated with indomethacin and stimulated with bradykinin (10-100 nM) released NO in quantities sufficient to account for the inhibition of platelet aggregation attributed to endothelium-derived relaxing factor (EDRF).

3 In the absence of indomethacin, stimulation of the cells with bradykinin (1-3 nM) released small amounts of prostacyclin and EDRF which synergistically inhibited platelet aggregation.

4 EDRF and authentic NO also caused disaggregation of platelets aggregated either with collagen or with U46619.

5 A reciprocal potentiation of both the anti- and the disaggregating activity was also observed between low concentrations of prostacyclin and authentic NO or EDRF released from endothelial cells.

6 It is likely that interactions between prostacyclin and NO released by the endothelium play a role in the homeostatic regulation of platelet-vessel wall interactions.

(Radomski MW, Palmer RMJ & Moncada S. The anti-aggregating properties of vascular endothelium: interactions between prostacyclin and nitric oxide. Br J Pharmac 1987; 92: 639-646.

 

Factor Xa–Nitric Oxide Signaling

Although primarily recognized for maintaining the hemostatic balance, blood proteases of the coagulation and fibrinolytic cascades elicit rapid cellular responses in

  • vascular
  • mesenchymal
  • inflammatory cell types.

Considerable effort has been devoted to elucidate the molecular interface between protease-dependent signaling and pleiotropic cellular responses. This led to the identification of several membrane protease receptors, initiating intracellular signal transduction and effector functions in vascular cells. In this context, thrombin receptor activation

  • generated second messengers in endothelium and smooth muscle cells,
  • released inflammatory cytokines from monocytes, fibroblasts, and endothelium, and
  • increased the expression of leukocyte-endothelial cell adhesion molecules.

Similarly, binding of factor Xa to effector cell protease receptor-1 (EPR-1) participated in

  • in vivo acute inflammatory responses,
  • platelet and brain pericyte prothrombinase activity, and
  • endothelial cell and smooth muscle cell signaling and proliferation.

Factor Xa stimulated a 5- to 10-fold increased release of nitric oxide (NO) in a dose-dependent reaction (0.1–2.5 mgyml) unaffected by the thrombin inhibitor hirudin but abolished by active site inhibitors, tick anticoagulant peptide, or Glu-Gly-Arg-chloromethyl ketone. In contrast, the homologous clotting protease factor IXa or another endothelial cell ligand, fibrinogen, was ineffective.

A factor Xa inter-epidermal growth factor synthetic peptide L83FTRKL88(G) blocking ligand binding to effector cell protease receptor-1 inhibited NO release by factor Xa in a dose-dependent manner, whereas a control scrambled peptide KFTGRLL was ineffective.

Catalytically active factor Xa induced hypotension in rats and vasorelaxation in the isolated rat mesentery, which was blocked by the NO synthase inhibitor L-NG-nitroarginine methyl ester (LNAME) but not by D-NAME. Factor Xa/NO signaling also produced a dose-dependent endothelial cell release of interleukin 6 (range 0.55–3.1 ngyml) in a reaction

  • inhibited by L-NAME and by the
  • inter-epidermal growth factor peptide Leu83–Leu88 but
  • unaffected by hirudin.
We observe that incubation of HUVEC monolayers with factor Xa which resulted in a concentration-dependent release of NO, as determined by cGMP accumulation in these cells, was inhibited by the nitric oxide synthase antagonist L-NAME.

Catalytically inactive DEGR-factor Xa or TAP-treated factor Xa failed to stimulate NO release by HUVEC.

To determine whether factor Xa-induced NO release could also modulate acute phase/inflammatory cytokine gene expression we examined potential changes in IL-6 release following HUVEC stimulation with factor Xa. HUVEC stimulation with factor Xa resulted in a concentration-dependent release of IL-6.

The specificity of factor Xa-induced cytokine release was investigated. Factor Xa-induced IL-6 release from HUVEC was quantitatively indistinguishable from that obtained with tumor necrosis factor-a or thrombin stimulation. This response was abolished by heat denaturation of factor Xa.

Maximal induction of interleukin 6 mRNA required a brief, 30-min stimulation with factor Xa, and was unaffected by subsequent addition of tissue factor pathway inhibitor (TFPI). These data suggest that factor Xa-induced NO release modulates endothelial cell-dependent vasorelaxation and IL-6 cytokine gene expression.

Here, we find that factor Xa induces the release of endothelial cell NO

  • regulating vasorelaxation in vivo and acute response cytokine gene expression in vitro.

This pathway requires a dual step cascade, involving

  • binding of factor Xa to EPR-1 and
  • a secondary as yet unidentified protease activated mechanism.

This pathway requiring factor Xa binding to effector cell protease receptor-1 and a secondary step of ligand-dependent proteolysis may preserve an anti-thrombotic phenotype of endothelium but also trigger acute phase responses during activation of coagulation in vivo.

In summary, these investigators have identified a signaling pathway centered on the ability of factor Xa to rapidly stimulate endothelial cell NO release. This involves a two-step cascade initiated by catalytic active site-independent binding of factor Xa to its receptor, EPR-1, followed by a second step of ligand dependent proteolysis.

(Papapetropoulos A, Piccardoni P, Cirino G, Bucci M, et al. Hypotension and inflammatory cytokine gene expression triggered by factor Xa–nitric oxide signaling. Proc. Natl. Acad. Sci. USA. Pharmacology. 1998; 95:4738–4742.)

Platelets and liver disease

Thrombocytopenia is a marked feature of chronic liver disease and cirrhosis. Traditionally, this thrombocytopenia was attributed to passive platelet sequestration in the spleen. More recent insights suggest an increased platelet breakdown and to a lesser extent decreased platelet production plays a more important role. Besides the reduction in number, other studies suggest functional platelet defects. This platelet dysfunction is probably both intrinsic to the platelets and secondary to soluble plasma factors. It reflects not only a decrease in aggregability, but also an activation of the intrinsic inhibitory pathways. (Witters P, Freson K, Verslype C, Peerlinck K, et al. Review article: blood platelet number and function in chronic liver disease and cirrhosis. Aliment Pharmacol Ther 2008; 27: 1017–1029).

The shortcomings of the old Y-shaped model of normal coagulation are nowhere more apparent than in its clinical application to the complex coagulation disorders of acute and chronic liver disease. In this condition, the clotting cascade is heavily influenced by numerous currents and counter-currents resulting in a mixture of pro- and anticoagulant forces that are themselves further subject to change with altered physiological stress such as super-imposed infection or renal failure.

Multiple mechanisms exist for thrombocytopenia common in patients with cirrhosis besides hypersplenism and expected altered thrombopoietin metabolism. Increased production of two important endothelial derived platelet inhibitors

  • nitric oxide and
  • prostacyclin

may contribute to defective platelet activation in vivo. On the other hand, high plasma levels of vWF in cirrhosis appear to support platelet adhesion.

Reduced levels of coagulation factors V, VII, IX, X, XI, and prothrombin are also commonly observed in liver failure. Vitamin K–dependent clotting factors (II, VII, IX, X) may be defective in function as a result of decreased  y-carboxylation (from vitamin K deficiency or intrinsically impaired carboxylase activity). Fibrinogen levels are decreased with advanced cirrhosis and in patients with acute liver failure.

A hyperfibrinolytic state may develop when plasminogen activation by tPA is accelerated on the fibrin surface. Physiologic stress including infection may be key in tipping this process off through increased release of tPA.  Not uncommonly, laboratory abnormalities in decompensated cirrhosis come to resemble disseminated intravascular coagulation (DIC). Relatively stable platelet levels and characteristically high factor VIII levels distinguish this process from DIC as does the absence of uncompensated thrombin generation. The features of both hyperfibrinolysis and DIC are often evident in the decompensated liver disease patient, and the term “accelerated intravascular coagulation and fibrinolysis” (AICF) has been proposed as a way to encapsulate the process under a single heading. The essence of AICF can be postulated to be the result of formation of a fibrin clot that is more susceptible to plasmin degradation due to elevated levels of tPA coupled with inadequate release of PAI to control tPA and lack of a-2 plasmin inhibitor to quench plasmin activity and the maintenance of high local concentrations of plasminogen on clot surfaces despite lower total plasminogen production. These normally balanced processes become pronounced when disturbed by additional stress such as infection.

Normal hemostasis and coagulation is now viewed as primarily a cell-based process wherein key steps in the classical clotting cascade

  • occur on the phospholipid membrane surface of cells (especially platelets)
  • beginning with activation of tissue factor and factor VII at the site of vascular breach
    •  which produces an initial “priming” amount of thrombin and a
    • subsequent thrombin burst.

Coagulation and hemostasis in the liver failure patient is influenced by multiple, often opposing, and sometimes changing variables. A bleeding diathesis is usually predominant, but the assessment of bleeding risk based on conventional laboratory tests is inherently deficient.

(Caldwell SH, Hoffman M, Lisman T, Gail Macik B, et al. Coagulation Disorders and Hemostasis in Liver Disease: Pathophysiology and Critical Assessment of Current Management. Hepatology 2006;44:1039-1046.)

Bleeding after Coronary Artery bypass Graft

Cardiac surgery with concomitant CPB can profoundly alter haemostasis, predisposing patients to major haemorrhagic complications and possibly early bypass conduit-related thrombotic events as well. Five to seven percent of patients lose more than 2 litres of blood within the first 24 hours after surgery, between 1% and 5% require re-operation for bleeding. Re-operation for bleeding increases hospital mortality 3 to 4 fold, substantially increases post-operative hospital stay and has a sizeable effect on health care costs. Nevertheless, re-exploration is a strong risk factor associated with increased operative mortality and morbidity, including sepsis, renal failure, respiratory failure and arrhythmias.

(Gábor Veres. New Drug Therapies Reduce Bleeding in Cardiac Surgery. Ph.D. Doctoral Dissertation. 2010. Semmelweis University)

Hypercoagulable State in Thalassemia

As the life expectancy of β-thalassemia patients has increased in the last decade, several new complications are being recognized. The presence of a high incidence of thromboembolic events, mainly in thalassemia intermedia patients, has led to the identification of a hypercoagulable state in thalassemia. Patients with thalassemia intermedia (TI) have, in general, a milder clinical phenotype than those with TM and remain largely transfusion independent. The pathophysiology of TI is characterized by extravascular hemolysis, with the release into the peripheral circulation of damaged red blood cells (RBCs) and erythroid precursors because of a high degree of ineffective erythropoiesis. This has also been recently attributed to severe complications such as pulmonary hypertension (PHT) and thromboembolic phenomena.

Many investigators have reported changes in the levels of coagulation factors and inhibitors in thalassemic patients. Prothrombin fragment 1.2 (F1.2), a marker of thrombin generation, is elevated in TI patients. The status of protein C and protein S was investigated in thalassemia in many studies and generally they were found to be decreased; this might be responsible for the occurrence of thromboembolic events in thalassemic patients.

The pathophysiological roles of hemolysis and the dysregulation of nitric oxide homeostasis are correlated with pulmonary hypertension in sickle cell disease and in thalassemia. Nitric oxide binds soluble guanylate cyclase, which converts GTP to cGMP, relaxing vascular smooth muscle and causing vasodilatation. When plasma hemoglobin liberated from intravascularly hemolyzed sickle erythrocytes consumes nitric oxide, the balance is shifted toward vasoconstriction. Pulmonary hypertension is aggravated and in sickle cell disease, it is linked to the intensity of hemolysis. Whether the same mechanism contributes to hypercoagulability in thalassemia is not yet known.

While there are diverse factors contributing to the hypercoagulable state observed in patients with thalassemia. In most cases, a combination of these abnormalities leads to clinical thrombosis. An argument has been made for the a higher incidence of thrombotic events in TI compared to TM patients  attributed to transfusion for TM. The higher rate of thrombosis in transfusion-independent TI compared to polytransused TM patients suggests a potential role for transfusions in decreasing the rate of thromboembolic events (TEE). The reduction of TEE in adequately transfused patients may be the result of decreased numbers of pathological RBCs.

(Cappellini MD, Musallam KM,  Marcon A, and Taher AT. Coagulopathy in Beta-Thalassemia: Current Understanding and Future Prospects. Medit J Hemat Infect Dis 2009; 1(1):22009029.
DOI 10.4084/MJHID.2009.0292.0), www.mjhid.org/article/view/5250.  ISSN 2035-3006.)

Microvascular Endothelial Dysfunction

Severe sepsis, defined as sepsis associated with acute organ dysfunction, results from a generalized inflammatory and procoagulant host response to infection. Coagulopathy in severe sepsis is commonly associated with multiple organ dysfunction, and often results in death. The molecule that is central to these effects is thrombin, although it may also have anticoagulant and antithrombotic effects through the activation of Protein C and induction of prostacyclin. In recent years, it has been recognized that chemicals produced by endothelial cells play a key role in the pathogenesis of sepsis. Thrombomodulin on endothelial cells coverts Protein C to Activated Protein C, which has important antithrombotic, profibrinolytic and anti-inflammatory properties. A number of studies have shown that Protein C levels are reduced in patients with severe infection, or even in inflammatory states without infection. Because coagulopathy is associated with high mortality rates, and animal studies have indicated that therapeutic intervention may result in improved outcomes, it was rational to initiate clinical studies.

Considering the coagulation cascade as a whole, it is the extrinsic pathway (via TF and thrombin activation) rather than the intrinsic pathway that is of primary importance in sepsis. Once coagulation has been triggered by TF activation, leading to thrombin formation, this can have further procoagulant effects, because thrombin itself can activate factors VIII, IX and X. This is normally balanced by the production of anticoagulant factors, such as TF pathway inhibitor, antithrombin and Activated Protein C.

It has been recognized that endothelial cells play a key role in the pathogenesis of sepsis, and that they produce important regulators of both coagulation and inflammation. They can express or release a number of substances, such as TF, endothelin-1 and PAI-1, which promote the coagulation process, as well as other substances, such as antithrombin, thrombomodulin, nitric oxide and prostacyclin, which inhibit it.

Protein C is the source of Activated Protein C. Although Protein C is a biomarker or indicator of sepsis, it has no known specific biological activity. Protein C is converted to Activated Protein C in the presence of normal endothelium. In patients with severe sepsis, the vascular endothelium becomes damaged. The level of thrombomodulin is significantly decreased, and the body’s ability to convert Protein C to Activated Protein C diminishes. Only when activated does Protein C have antithrombotic, profibrinolytic and anti-inflammatory properties.

Blood Coagulation (Thrombin) and Protein C Pat...

Blood Coagulation (Thrombin) and Protein C Pathways (Blood_Coagulation_and_Protein_C_Pathways.jpg) (Photo credit: Wikipedia)

Coagulation abnormalities can occur in all types of infection, including both Gram-positive and Gram-negative bacterial infections, or even in the absence of infection, such as in inflammatory states secondary to trauma or neurosurgery. Interestingly, they can also occur in patients with localized disease, such as those with respiratory infection. In a study by Günther et al., procoagulant activity in bronchial lavage fluid from patients with pneumonia or acute respiratory distress syndrome was found to be increased compared with that from control individuals, with a correlation between the severity of respiratory failure and level of coagulant activity.

Severe sepsis, defined as sepsis associated with acute organ dysfunction, results from a generalized inflammatory and procoagulant host response to infection.  Once the endothelium becomes damaged, levels of endothelial thrombomodulin significantly decrease, and the body’s ability to convert Protein C to Activated Protein C diminishes. The ultimate cause of acute organ dysfunction in sepsis is injury to the vascular endothelium, which can result in microvascular coagulopathy.

(Vincent JL. Microvascular endothelial dysfunction: a renewed appreciation of sepsis pathophysiology.
Critical Care 2001; 5:S1–S5. http://ccforum.com/content/5/S2/S1)

Endothelial Cell Dysfunction in Severe Sepsis

During the past decade a unifying hypothesis has been developed to explain the vascular changes that occur in septic shock on the basis of the effect of inflammatory mediators on the vascular endothelium. The vascular endothelium plays a central role in the control of microvascular flow, and it has been proposed that widespread vascular endothelial activation, dysfunction and eventually injury occurs in septic shock, ultimately resulting in multiorgan failure. This has been characterized in various models of experimental septic shock. Now, direct and indirect evidence for endothelial cell alteration in humans during septic shock is emerging.

The vascular endothelium regulates the flow of nutrient substances, diverse biologically active molecules and the blood cells themselves. This role of endothelium is achieved through the presence of membrane-bound receptors for numerous molecules, including proteins, lipid transporting particles, metabolites and hormones, as well as through specific junction proteins and receptors that govern cell–cell and cell–matrix interactions. Endothelial dysfunction and/or injury with subendothelium exposure facilitates leucocyte and platelet aggregation, and aggravation of coagulopathy. Therefore, endothelial dysfunction and/or injury should favour impaired perfusion, tissue hypoxia and subsequent organ dysfunction.

Anatomical damage to the endothelium during septic shock has been assessed in several studies. A single injection of bacterial lipopolysaccharide (LPS) has long been demonstrated to be a nonmechanical technique for removing endothelium. In endotoxic rabbits, observations tend to demonstrate that EC surface modification occurs easily and rapidly, with ECs being detached from the internal elastic lamina with an indication of subendothelial oedema.  Proinflammatory cytokines increase permeability of the ECs, and this is manifested approximately 6 hours after inflammation is triggered and becomes maximal over 12–24 hours as the combination of cytokines exert potentiating effects. Endothelial physical disruption allows inflammatory fluid and cells to shift from the blood into the interstitial space.

In sepsis

  • ECs become injured, prothrombotic and antifibrinolytic
  • They promote platelet adhesion
  • They promote leucocyte adhesion and inhibit vasodilation

An important point is that EC injury is sustained over time. In an endotoxic rabbit model, we demonstrated that endothelium denudation is present at the level of the abdominal aorta as early as after several hours following injury and persisted for at least 5 days afterward. After 21 days we observed that the endothelial surface had recovered. The de-endothelialized surface accounted for approximately 25% of the total surface.

Thrombomodulin and protein C activation at the microcirculatory level.

The endothelial cell surface thrombin (Th)-binding protein thrombomodulin (TM) is responsible for inhibition of thrombin activity. TM, when bound to Th, forms a potent protein C activator complex. Loss of TM and/or internalization results in Th–thrombin receptor (TR) interaction. Loss of TM and associated protein C activation represents the key event of decreased endothelial coagulation modulation ability and increased inflammation pathways.
( Iba T, Kidokoro A, Yagi Y: The role of the endothelium in changes in procoagulant activity in sepsis. J Am Coll Surg 1998; 187:321-329. Keywords: ATIII, antithrombin III; NF-κ, nuclear factor-κB; PAI,plasminogen activator inhibitor).

In order to test the role of the endothelial-derived relaxing factors NO and PGI2, we investigated, in dogs, the influence of a combination of NG-nitro-L-arginine methyl ester (an inhibitor of NO synthesis) and indomethacin (an inhibitor of PGI2 synthesis). In these dogs treated with indomethacin plus NG-nitro-L-arginine methyl ester, the severity of the oxygen extraction defect was lower than that observed in the deoxycholate-treated dogs, suggesting that other mediators and/or mechanisms may be involved in microcirculatory control during hypoxia. One of these mediators or mechanisms could be related to hyperpolarization. Membrane potential is an important determinant of vascular smooth muscle tone through its influence on calcium influx via voltage-gated calcium channels. Hyperpolarization (as well as depolarization) has been shown to be a means of cell–cell communication in upstream vasodilatation and microcirculatory coordination. It is important to emphasize that intercell coupling exclusively involves ECs.

Interestingly, it was recently shown that sepsis, a situation that is characterized by impaired tissue perfusion and abnormal oxygen extraction, is associated with abnormal inter-EC coupling and reduction in the arteriolar conducted response.  An intra-organ defect in blood flow related to abnormal vascular reactivity, cell adhesion and coagulopathy may account for impaired organ oxygen regulation and function. If specific classes of microvessels must or must not be perfused to achieve efficient oxygen extraction during limitation in oxygen delivery, then impaired vascular reactivity and vessel injury might produce a pathological limitation in supply. In sepsis, the inflammatory response profoundly alters circulatory homeostasis, and this has been referred to as a ‘malignant intravascular inflammation’ that alters vasomotor tone and the distribution of blood flow among and within organs. These mechanisms might coexist with other types of sepsis associated cell dysfunction. For example, data suggest that endotoxin directly impairs oxygen uptake in ECs and indicate the importance of endothelium respiration in maintaining vascular homeostasis under conditions of sepsis.

Consistent with the hypothesis that alteration in endothelium plays a major in the pathophysiology of sepsis, it was observed that chronic ecNOS overexpression in the endothelium of mice resulted in resistance to LPS-induced hypotension, lung injury and death . This observation was confirmed by another group of investigators, who used transgenic mice overexpressing adrenomedullin  – a vasodilating peptide that acts at least in part via an NO-dependent pathway. They demonstrated resistance of these animals to LPS-induced shock, and lesser declines in blood pressure and less severe organ damage than occurred in the control animals. It might therefore be of importance to favour ecNOS expression and function during sepsis. The recent negative results obtained with therapeutic strategies aimed at blocking inducible NOS with the nonselective NOS inhibitor NG-monomethyl-L-arginine in human septic shock further confirm the overall importance of favoring vessel dilatation.

(Vallet B. Bench-to-bedside review: Endothelial cell dysfunction in severe sepsis: a role in organ dysfunction?  Critical Care 2003; 7(2):130-138 (DOI 10.1186/cc1864). (Print ISSN 1364-8535; Online ISSN 1466-609X). http://ccforum.com/content/7/2/130

Thrombosis in Inflammatory Bowel Disease

An association between IBD and thrombosis has been recognized for more than 60 years. Not only are patients with IBD more likely to have thromboembolic complications, but it has also been suggested that thrombosis might be pathogenic in IBD.

Coagulation Described.  See Part I. (Cascade)

Endothelial injury exposes TF, which forms a complex with factor VII.  This complex activates factors X and, to a lesser extent, IX. TFPI prevents this activation progressing  further; for coagulation to progress, factor Xa must be produced via factors IX and VIII. Thrombin, generated by the initial production of factor Xa, activates factor VIII and, through factor XI, factor IX, resulting in further activation of factor X. This positive feedback loop allows coagulation to proceed. Fibrin polymers are stabilized by factor XIIIa. Activated proteins CS (APCS) together inhibit factors VIIIa and Va, whereas antithrombin (AT) inhibits factors VIIa, IXa, Xa, and XIa. Fibrinolysis balances this system through the action of plasmin on fibrin. Plasminogen activator inhibitor controls the plasminogen activator-induced conversion of plasminogen to plasmin.

Inflammation and Thrombotic Processes Linked

Although interest has recently moved away from the proposal that ischemia is a primary cause of IBD, it has become increasingly clear that inflammatory and thrombotic processes are linked.  A vascular component to the pathogenesis of CD was first proposed only a year after Crohn et al. described the condition.  Subsequently, in 1989, a series of changes comprising vascular injury, focal arteritis, fibrin deposition, arterial occlusion, and then microinfarction or neovascularization was proposed as a possible pathogenetic sequence in CD.  In this study, resin casts of the intestinal vasculature showed changes ranging from intravascular fibrin deposition to complete thrombotic occlusion. Furthermore, the early vascular changes appeared to precede mucosal changes, suggesting that they were more likely to cause rather than result from the pathologic features of CD. Subsequent studies showed that intravascular fibrin deposition occurred at the site of granulomatous destruction of mesenteric blood vessels, and positive immunostaining for platelet glycoprotein IIIa occurred in fibrinoid plugs of mucosal capillaries in CD. In addition, intracapillary thrombus has been identified in biopsies from inflamed rectal mucosa from patients with CD. When combined with evidence of ongoing intravascular coagulation in both active and quiescent CD, the above data point toward a thrombotic element contributing to the pathogenesis of CD.

Not only are many different prothrombotic changes described in association with IBD, but they can also have multiple causes. Hyperhomocysteinemia, for example, is known to predispose to thrombosis, and patients with IBD are more likely to have hyperhomocysteinemia than control subjects. Hyperhomocysteinemia in IBD might be due to multiple possible causes, such as deficiencies of vitamin B12 as a result of terminal ileal disease or resection; B6, which is commonly reduced in IBD.  A vegan diet can’t be discarded either because of seriously deficient methyl donors (S-adenosyl methionine).

The realization that platelets are not only prothrombotic but also proinflammatory has stimulated interest in their role in both the pathogenesis and complications of IBD. The association between thrombocytosis and active IBD was first described more than 30 years ago. More recent observations link decreased or normal platelet survival to IBD-related thrombocytosis, possibly due to increased thrombopoiesis. This in turn could be driven by an interleukin-6 –induced increase in thrombopoietin synthesis in the liver. Spontaneous in vitro platelet aggregation occurs in platelets isolated from 30% of patients with IBD but not in platelets from control subjects. Moreover, collagen, arachidonic acid, ristocetin, and ADP-induced platelet activation are more marked in platelets from patients with active IBD than in those from healthy volunteers.

The roles of activated platelets and PLAs in mucosal inflammation. Activated platelets can interact with other cells involved in the inflammatory response either through direct contact or through the release of soluble mediators. Activated platelets interact directly with activated vascular endothelium, causing the latter to express adhesion molecules and release inflammatory and chemotactic cytokines.

Platelet activation might be pathogenic in IBD in several ways. Platelet activation might increase platelet aggregation, hence increasing the likelihood of thrombus formation at sites of vascular injury, for example, within the mesenteric circulation. P-selectin is the major ligand for leukocyte-endothelial interaction and is responsible for the rolling of platelets, leukocytes, and PLAs on vascular endothelium. Moreover, platelets adherent to injured vascular endothelium support leukocyte adhesion via P-selectin, an effect that could contribute to leukocyte emigration from the vasculature into the lamina propria in patients with IBD. In addition, P-selectin is the major platelet ligand for platelet-leukocyte interaction, which in turn causes both leukocyte activation and further platelet activation.

Platelet-Leukocyte Aggregation

Recently, studies showing that platelets and leukocytes that circulate together in aggregates (PLA) are more activated than those that circulate alone have generated interest in the role of PLA in various inflammatory and thrombotic conditions. PLA numbers are increased in patients with ischemic heart disease, systemic lupus erythematosus and rheumatoid arthritis, myeloproliferative disorders, and sepsis and are increased by smoking.

We have recently shown that patients with IBD have more PLAs than both healthy and inflammatory control subjects (patients with inflammatory arthritides).  As with platelet activation, there was no correlation with disease activity, suggesting that increased PLA formation might be an underlying abnormality. PLAs could contribute to the pathogenesis of IBD in a number of ways. As previously mentioned, TF is key to the initiation of thrombus formation. TF has recently been demonstrated on the surface of activated platelets and in platelet-derived microvesicles. Interaction between neutrophils and activated platelets or microvesicles vastly increases the activity of “intravascular” TF.

Conclusion        

It is becoming increasingly apparent that thrombosis and inflammation are intrinsically linked. Hence the involvement of thrombotic processes in the pathogenesis of IBD, although perhaps not as the primary event, seems likely. Indeed, with the recently mounting evidence of the role of activated platelets and of their interaction with leukocytes in the pathogenesis of IBD, it seems even more probable that thrombosis plays some role in the pathogenic process.

(Irving PM, Pasi KJ, and Rampton DS. Thrombosis and Inflammatory Bowel Disease. Clinical Gastroenterology and Hepatology 2005;3:617–628. PII: 10.1053/S1542-3565(05)00154-0.)

Bleeding in Patients with Renal Insufficiency

Approximately 20–40% of critically ill patients will have renal insufficiency at the time of admission or will develop it during their ICU stay, depending on the definition of renal insufficiency and the case mix of the ICU. Such patients are also predisposed to bleeding because of uremic platelet dysfunction, typically multiple comorbidities, coagulopathies and frequent concomitant treatment with antiplatelet or anticoagulant agents.

The impairment in hemostasis in uremic patients is multifactorial and includes physiological defects in platelet hemostasis, an imbalance of mediators of normal endothelial function and frequent comorbidities such as vascular disease, anemia and the frequent need for medical interventions required to treat such comorbidities. Physiologic alterations in uremia include:

  • decreased platelet glycoprotein IIb–IIIa binding to both von Willebrand factor (vWf) and fibrinogen, causing an impairment in platelet aggregation;
  • increased prostacyclin and nitric oxide production, both potent inhibitors of platelet activation and vasoconstriction; and
  • decreased levels of platelet adenosine diphosphate (ADP) and serotonin, causing an impairment in platelet secretion.

In addition to other factors, small peptides containing the RGD (Arg-Gly-Asp) sequence of amino acids have been shown to be inhibitors of platelet aggregation that act by competing with vWf and fibrinogen for binding to the glycoprotein IIb–IIIa receptor.

Conclusion

ICU patients have dynamic risks of thrombosis and bleeding. Invasive procedures may require temporary interruption of anticoagulants. Consequently, approaches to thromboprophylaxis require daily reevaluation.

(Cook DJ, Douketis J, Arnold D, and Crowther MA. Bleeding and venous thromboembolism in the critically ill with emphasis on patients with renal insufficiency. Curr Opin Pulm Med 2009;15:455–462.)

Epicrisis

I have covered a large amount of material on one of the most complex systems in medicine, and still not comprehensive, with a sufficient dash of repetition.  The task is to have some grasp of the cell-mediated imbalances inherent if coagulation and bleeding disorders.  The key points are:

  • inflammation and oxidative stress invariably lurk in the background
  • the Y-shaped model with an extrinsic, intrinsic, and common pathway has no basis in understanding
  • the current model is based on a cell-mediated concept of endothelial damage and platelet-endothelial interaction
  • the model has 3 components: Initiation, Amplification, Propagation
  • NO and prostacyclin have key roles in the process
  • The plasma proteins involved are in the serine-protease class of enzymes
  • The conversion of Protein C to APC has a central role as anti-coagulant

Part II goes into organ aystem abnormalities that are all related to impairment of the Nitric Oxide balance and dual platelet-endothelial roles.

Part III will explore therapeutic targets and opportunities.

Read Full Post »