Advertisements
Feeds:
Posts
Comments

Posts Tagged ‘Signal transduction’

Proteomics, Metabolomics, Signaling Pathways, and Cell Regulation: a Compilation of Articles in the Journal http://pharmaceuticalintelligence.com


Compilation of References by Leaders in Pharmaceutical Business Intelligence in the Journal http://pharmaceuticalintelligence.com about
Proteomics, Metabolomics, Signaling Pathways, and Cell Regulation

Curator: Larry H Bernstein, MD, FCAP

Proteomics

  1. The Human Proteome Map Completed

Reporter and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/28/the-human-proteome-map-completed/

  1. Proteomics – The Pathway to Understanding and Decision-making in Medicine

Author and Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/06/24/proteomics-the-pathway-to-
understanding-and-decision-making-in-medicine/

3. Advances in Separations Technology for the “OMICs” and Clarification of Therapeutic Targets

Author and Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/10/22/advances-in-separations-technology-for-the-omics-and-clarification-         of-therapeutic-targets/

  1. Expanding the Genetic Alphabet and Linking the Genome to the Metabolome

Author and Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/09/24/expanding-the-genetic-alphabet-and-linking-the-genome-to-the-                metabolome/

5. Genomics, Proteomics and standards

Larry H Bernstein, MD, FCAP, Author and Curator

https://pharmaceuticalintelligence.com/2014/07/06/genomics-proteomics-and-standards/

6. Proteins and cellular adaptation to stress

Larry H Bernstein, MD, FCAP, Author and Curator

https://pharmaceuticalintelligence.com/2014/07/08/proteins-and-cellular-adaptation-to-stress/

 

Metabolomics

  1. Extracellular evaluation of intracellular flux in yeast cells

Larry H. Bernstein, MD, FCAP, Reviewer and Curator

https://pharmaceuticalintelligence.com/2014/08/25/extracellular-evaluation-of-intracellular-flux-in-yeast-cells/

  1. Metabolomic analysis of two leukemia cell lines. I.

Larry H. Bernstein, MD, FCAP, Reviewer and Curator

https://pharmaceuticalintelligence.com/2014/08/23/metabolomic-analysis-of-two-leukemia-cell-lines-_i/

  1. Metabolomic analysis of two leukemia cell lines. II.

Larry H. Bernstein, MD, FCAP, Reviewer and Curator

https://pharmaceuticalintelligence.com/2014/08/24/metabolomic-analysis-of-two-leukemia-cell-lines-ii/

  1. Metabolomics, Metabonomics and Functional Nutrition: the next step in nutritional metabolism and biotherapeutics

Reviewer and Curator, Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/22/metabolomics-metabonomics-and-functional-nutrition-the-next-step-          in-nutritional-metabolism-and-biotherapeutics/

  1. Buffering of genetic modules involved in tricarboxylic acid cycle metabolism provides homeomeostatic regulation

Larry H. Bernstein, MD, FCAP, Reviewer and curator

https://pharmaceuticalintelligence.com/2014/08/27/buffering-of-genetic-modules-involved-in-tricarboxylic-acid-cycle-              metabolism-provides-homeomeostatic-regulation/

Metabolic Pathways

  1. Pentose Shunt, Electron Transfer, Galactose, more Lipids in brief

Reviewer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/21/pentose-shunt-electron-transfer-galactose-more-lipids-in-brief/

  1. Mitochondria: More than just the “powerhouse of the cell”

Ritu Saxena, PhD

https://pharmaceuticalintelligence.com/2012/07/09/mitochondria-more-than-just-the-powerhouse-of-the-cell/

  1. Mitochondrial fission and fusion: potential therapeutic targets?

Ritu saxena

https://pharmaceuticalintelligence.com/2012/10/31/mitochondrial-fission-and-fusion-potential-therapeutic-target/

4.  Mitochondrial mutation analysis might be “1-step” away

Ritu Saxena

https://pharmaceuticalintelligence.com/2012/08/14/mitochondrial-mutation-analysis-might-be-1-step-away/

  1. Selected References to Signaling and Metabolic Pathways in PharmaceuticalIntelligence.com

Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/14/selected-references-to-signaling-and-metabolic-pathways-in-                     leaders-in-pharmaceutical-intelligence/

  1. Metabolic drivers in aggressive brain tumors

Prabodh Kandal, PhD

https://pharmaceuticalintelligence.com/2012/11/11/metabolic-drivers-in-aggressive-brain-tumors/

  1. Metabolite Identification Combining Genetic and Metabolic Information: Genetic association links unknown metabolites to functionally related genes

Writer and Curator, Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2012/10/22/metabolite-identification-combining-genetic-and-metabolic-                        information-genetic-association-links-unknown-metabolites-to-functionally-related-genes/

  1. Mitochondria: Origin from oxygen free environment, role in aerobic glycolysis, metabolic adaptation

Larry H Bernstein, MD, FCAP, author and curator

https://pharmaceuticalintelligence.com/2012/09/26/mitochondria-origin-from-oxygen-free-environment-role-in-aerobic-            glycolysis-metabolic-adaptation/

  1. Therapeutic Targets for Diabetes and Related Metabolic Disorders

Reporter, Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2012/08/20/therapeutic-targets-for-diabetes-and-related-metabolic-disorders/

10.  Buffering of genetic modules involved in tricarboxylic acid cycle metabolism provides homeomeostatic regulation

Larry H. Bernstein, MD, FCAP, Reviewer and curator

https://pharmaceuticalintelligence.com/2014/08/27/buffering-of-genetic-modules-involved-in-tricarboxylic-acid-cycle-              metabolism-provides-homeomeostatic-regulation/

11. The multi-step transfer of phosphate bond and hydrogen exchange energy

Larry H. Bernstein, MD, FCAP, Curator:

https://pharmaceuticalintelligence.com/2014/08/19/the-multi-step-transfer-of-phosphate-bond-and-hydrogen-                          exchange-energy/

12. Studies of Respiration Lead to Acetyl CoA

https://pharmaceuticalintelligence.com/2014/08/18/studies-of-respiration-lead-to-acetyl-coa/

13. Lipid Metabolism

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/15/lipid-metabolism/

14. Carbohydrate Metabolism

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/13/carbohydrate-metabolism/

15. Update on mitochondrial function, respiration, and associated disorders

Larry H. Bernstein, MD, FCAP, Author and Curator

https://pharmaceuticalintelligence.com/2014/07/08/update-on-mitochondrial-function-respiration-and-associated-                   disorders/

16. Prologue to Cancer – e-book Volume One – Where are we in this journey?

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/04/13/prologue-to-cancer-ebook-4-where-are-we-in-this-journey/

17. Introduction – The Evolution of Cancer Therapy and Cancer Research: How We Got Here?

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/04/04/introduction-the-evolution-of-cancer-therapy-and-cancer-research-          how-we-got-here/

18. Inhibition of the Cardiomyocyte-Specific Kinase TNNI3K

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/11/01/inhibition-of-the-cardiomyocyte-specific-kinase-tnni3k/

19. The Binding of Oligonucleotides in DNA and 3-D Lattice Structures

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/05/15/the-binding-of-oligonucleotides-in-dna-and-3-d-lattice-structures/

20. Mitochondrial Metabolism and Cardiac Function

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/04/14/mitochondrial-metabolism-and-cardiac-function/

21. How Methionine Imbalance with Sulfur-Insufficiency Leads to Hyperhomocysteinemia

Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/04/04/sulfur-deficiency-leads_to_hyperhomocysteinemia/

22. AMPK Is a Negative Regulator of the Warburg Effect and Suppresses Tumor Growth In Vivo

Author and Curator: Stephen J. Williams, PhD

https://pharmaceuticalintelligence.com/2013/03/12/ampk-is-a-negative-regulator-of-the-warburg-effect-and-suppresses-         tumor-growth-in-vivo/

23. A Second Look at the Transthyretin Nutrition Inflammatory Conundrum

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/03/a-second-look-at-the-transthyretin-nutrition-inflammatory-                         conundrum/

24. Mitochondrial Damage and Repair under Oxidative Stress

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/10/28/mitochondrial-damage-and-repair-under-oxidative-stress/

25. Nitric Oxide and Immune Responses: Part 2

Author and Curator: Aviral Vatsa, PhD, MBBS

https://pharmaceuticalintelligence.com/2012/10/28/nitric-oxide-and-immune-responses-part-2/

26. Overview of Posttranslational Modification (PTM)

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/07/29/overview-of-posttranslational-modification-ptm/

27. Malnutrition in India, high newborn death rate and stunting of children age under five years

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/07/15/malnutrition-in-india-high-newborn-death-rate-and-stunting-of-                   children-age-under-five-years/

28. Update on mitochondrial function, respiration, and associated disorders

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/07/08/update-on-mitochondrial-function-respiration-and-associated-                  disorders/

29. Omega-3 fatty acids, depleting the source, and protein insufficiency in renal disease

Larry H. Bernstein, MD, FCAP, Curator

https://pharmaceuticalintelligence.com/2014/07/06/omega-3-fatty-acids-depleting-the-source-and-protein-insufficiency-         in-renal-disease/

30. Introduction to e-Series A: Cardiovascular Diseases, Volume Four Part 2: Regenerative Medicine

Larry H. Bernstein, MD, FCAP, writer, and Aviva Lev- Ari, PhD, RN

https://pharmaceuticalintelligence.com/2014/04/27/larryhbernintroduction_to_cardiovascular_diseases-                                  translational_medicine-part_2/

31. Epilogue: Envisioning New Insights in Cancer Translational Biology
Series C: e-Books on Cancer & Oncology

Author & Curator: Larry H. Bernstein, MD, FCAP, Series C Content Consultant

https://pharmaceuticalintelligence.com/2014/03/29/epilogue-envisioning-new-insights/

32. Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone                         and Neurotransmitter

Writer and Curator: Larry H Bernstein, MD, FCAP and
Curator and Content Editor: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-                    hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocy

33. Cardiac Contractility & Myocardial Performance: Therapeutic Implications of Ryanopathy (Calcium Release-                           related Contractile Dysfunction) and Catecholamine Responses

Author, and Content Consultant to e-SERIES A: Cardiovascular Diseases: Justin Pearlman, MD, PhD, FACC
Author and Curator: Larry H Bernstein, MD, FCAP
and Article Curator: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-      and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-                    contractile/

34. Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Author and Curator: Larry H Bernstein, MD, FCAP Author: Stephen Williams, PhD, and Curator: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

35. Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP, Author and Curator

https://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-                           cytoskeleton/

36. Advanced Topics in Sepsis and the Cardiovascular System at its End Stage

Author: Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-Sepsis-and-the-Cardiovascular-System-at-its-              End-Stage/

37. The Delicate Connection: IDO (Indolamine 2, 3 dehydrogenase) and Cancer Immunology

Demet Sag, PhD, Author and Curator

https://pharmaceuticalintelligence.com/2013/08/04/the-delicate-connection-ido-indolamine-2-3-dehydrogenase-and-               immunology/

38. IDO for Commitment of a Life Time: The Origins and Mechanisms of IDO, indolamine 2, 3-dioxygenase

Demet Sag, PhD, Author and Curator

https://pharmaceuticalintelligence.com/2013/08/04/ido-for-commitment-of-a-life-time-the-origins-and-mechanisms-of-             ido-indolamine-2-3-dioxygenase/

39. Confined Indolamine 2, 3 dioxygenase (IDO) Controls the Homeostasis of Immune Responses for Good and Bad

Curator: Demet Sag, PhD, CRA, GCP

https://pharmaceuticalintelligence.com/2013/07/31/confined-indolamine-2-3-dehydrogenase-controls-the-hemostasis-           of-immune-responses-for-good-and-bad/

40. Signaling Pathway that Makes Young Neurons Connect was discovered @ Scripps Research Institute

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/06/26/signaling-pathway-that-makes-young-neurons-connect-was-                     discovered-scripps-research-institute/

41. Naked Mole Rats Cancer-Free

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/06/20/naked-mole-rats-cancer-free/

42. Late Onset of Alzheimer’s Disease and One-carbon Metabolism

Reporter and Curator: Dr. Sudipta Saha, Ph.D.

https://pharmaceuticalintelligence.com/2013/05/06/alzheimers-disease-and-one-carbon-metabolism/

43. Problems of vegetarianism

Reporter and Curator: Dr. Sudipta Saha, Ph.D.

https://pharmaceuticalintelligence.com/2013/04/22/problems-of-vegetarianism/

44.  Amyloidosis with Cardiomyopathy

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/03/31/amyloidosis-with-cardiomyopathy/

45. Liver endoplasmic reticulum stress and hepatosteatosis

Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2013/03/10/liver-endoplasmic-reticulum-stress-and-hepatosteatosis/

46. The Molecular Biology of Renal Disorders: Nitric Oxide – Part III

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/11/26/the-molecular-biology-of-renal-disorders/

47. Nitric Oxide Function in Coagulation – Part II

Curator and Author: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/11/26/nitric-oxide-function-in-coagulation/

48. Nitric Oxide, Platelets, Endothelium and Hemostasis

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/11/08/nitric-oxide-platelets-endothelium-and-hemostasis/

49. Interaction of Nitric Oxide and Prostacyclin in Vascular Endothelium

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/09/14/interaction-of-nitric-oxide-and-prostacyclin-in-vascular-endothelium/

50. Nitric Oxide and Immune Responses: Part 1

Curator and Author:  Aviral Vatsa PhD, MBBS

https://pharmaceuticalintelligence.com/2012/10/18/nitric-oxide-and-immune-responses-part-1/

51. Nitric Oxide and Immune Responses: Part 2

Curator and Author:  Aviral Vatsa PhD, MBBS

https://pharmaceuticalintelligence.com/2012/10/28/nitric-oxide-and-immune-responses-part-2/

52. Mitochondrial Damage and Repair under Oxidative Stress

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/10/28/mitochondrial-damage-and-repair-under-oxidative-stress/

53. Is the Warburg Effect the cause or the effect of cancer: A 21st Century View?

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/10/17/is-the-warburg-effect-the-cause-or-the-effect-of-cancer-a-21st-                 century-view/

54. Ubiquinin-Proteosome pathway, autophagy, the mitochondrion, proteolysis and cell apoptosis

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/10/30/ubiquinin-proteosome-pathway-autophagy-the-mitochondrion-                  proteolysis-and-cell-apoptosis/

55. Ubiquitin-Proteosome pathway, Autophagy, the Mitochondrion, Proteolysis and Cell Apoptosis: Part III

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2013/02/14/ubiquinin-proteosome-pathway-autophagy-the-mitochondrion-                   proteolysis-and-cell-apoptosis-reconsidered/

56. Nitric Oxide and iNOS have Key Roles in Kidney Diseases – Part II

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/11/26/nitric-oxide-and-inos-have-key-roles-in-kidney-diseases/

57. New Insights on Nitric Oxide donors – Part IV

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/11/26/new-insights-on-no-donors/

58. Crucial role of Nitric Oxide in Cancer

Curator and Author: Ritu Saxena, Ph.D.

https://pharmaceuticalintelligence.com/2012/10/16/crucial-role-of-nitric-oxide-in-cancer/

59. Nitric Oxide has a ubiquitous role in the regulation of glycolysis -with a concomitant influence on mitochondrial function

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/09/16/nitric-oxide-has-a-ubiquitous-role-in-the-regulation-of-glycolysis-with-         a-concomitant-influence-on-mitochondrial-function/

60. Targeting Mitochondrial-bound Hexokinase for Cancer Therapy

Curator and Author: Ziv Raviv, PhD, RN 04/06/2013

https://pharmaceuticalintelligence.com/2013/04/06/targeting-mitochondrial-bound-hexokinase-for-cancer-therapy/

61. Biochemistry of the Coagulation Cascade and Platelet Aggregation – Part I

Curator and Author: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/11/26/biochemistry-of-the-coagulation-cascade-and-platelet-aggregation/

Genomics, Transcriptomics, and Epigenetics

  1. What is the meaning of so many RNAs?

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/06/what-is-the-meaning-of-so-many-rnas/

  1. RNA and the transcription the genetic code

Larry H. Bernstein, MD, FCAP, Writer and Curator

https://pharmaceuticalintelligence.com/2014/08/02/rna-and-the-transcription-of-the-genetic-code/

  1. A Primer on DNA and DNA Replication

Writer and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/07/29/a_primer_on_dna_and_dna_replication/

4. Synthesizing Synthetic Biology: PLOS Collections

Reporter: Aviva Lev-Ari

https://pharmaceuticalintelligence.com/2012/08/17/synthesizing-synthetic-biology-plos-collections/

5. Pathology Emergence in the 21st Century

Author and Curator: Larry Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/03/pathology-emergence-in-the-21st-century/

6. RNA and the transcription the genetic code

Writer and Curator, Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/02/rna-and-the-transcription-of-the-genetic-code/

7. A Great University engaged in Drug Discovery: University of Pittsburgh

Larry H. Bernstein, MD, FCAP, Reporter and Curator

https://pharmaceuticalintelligence.com/2014/07/15/a-great-university-engaged-in-drug-discovery/

8. microRNA called miRNA-142 involved in the process by which the immature cells in the bone  marrow give                              rise to all the types of blood cells, including immune cells and the oxygen-bearing red blood cells

Aviva Lev-Ari, PhD, RN, Author and Curator

https://pharmaceuticalintelligence.com/2014/07/24/microrna-called-mir-142-involved-in-the-process-by-which-the-                   immature-cells-in-the-bone-marrow-give-rise-to-all-the-types-of-blood-cells-including-immune-cells-and-the-oxygen-             bearing-red-blood-cells/

9. Genes, proteomes, and their interaction

Larry H. Bernstein, MD, FCAP, Writer and Curator

https://pharmaceuticalintelligence.com/2014/07/28/genes-proteomes-and-their-interaction/

10. Regulation of somatic stem cell Function

Larry H. Bernstein, MD, FCAP, Writer and Curator    Aviva Lev-Ari, PhD, RN, Curator

https://pharmaceuticalintelligence.com/2014/07/29/regulation-of-somatic-stem-cell-function/

11. Scientists discover that pluripotency factor NANOG is also active in adult organisms

Larry H. Bernstein, MD, FCAP, Reporter

https://pharmaceuticalintelligence.com/2014/07/10/scientists-discover-that-pluripotency-factor-nanog-is-also-active-in-           adult-organisms/

12. Bzzz! Are fruitflies like us?

Larry H Bernstein, MD, FCAP, Author and Curator

https://pharmaceuticalintelligence.com/2014/07/07/bzzz-are-fruitflies-like-us/

13. Long Non-coding RNAs Can Encode Proteins After All

Larry H Bernstein, MD, FCAP, Reporter

https://pharmaceuticalintelligence.com/2014/06/29/long-non-coding-rnas-can-encode-proteins-after-all/

14. Michael Snyder @Stanford University sequenced the lymphoblastoid transcriptomes and developed an
allele-specific full-length transcriptome

Aviva Lev-Ari, PhD, RN, Author and Curator

https://pharmaceuticalintelligence.com/014/06/23/michael-snyder-stanford-university-sequenced-the-lymphoblastoid-            transcriptomes-and-developed-an-allele-specific-full-length-transcriptome/

15. Commentary on Biomarkers for Genetics and Genomics of Cardiovascular Disease: Views by Larry H                                     Bernstein, MD, FCAP

Author: Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/07/16/commentary-on-biomarkers-for-genetics-and-genomics-of-                        cardiovascular-disease-views-by-larry-h-bernstein-md-fcap/

16. Observations on Finding the Genetic Links in Common Disease: Whole Genomic Sequencing Studies

Author an curator: Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/05/18/observations-on-finding-the-genetic-links/

17. Silencing Cancers with Synthetic siRNAs

Larry H. Bernstein, MD, FCAP, Reviewer and Curator

https://pharmaceuticalintelligence.com/2013/12/09/silencing-cancers-with-synthetic-sirnas/

18. Cardiometabolic Syndrome and the Genetics of Hypertension: The Neuroendocrine Transcriptome Control Points

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/12/12/cardiometabolic-syndrome-and-the-genetics-of-hypertension-the-neuroendocrine-transcriptome-control-points/

19. Developments in the Genomics and Proteomics of Type 2 Diabetes Mellitus and Treatment Targets

Larry H. Bernstein, MD, FCAP, Reviewer and Curator

https://pharmaceuticalintelligence.com/2013/12/08/developments-in-the-genomics-and-proteomics-of-type-2-diabetes-           mellitus-and-treatment-targets/

20. Loss of normal growth regulation

Larry H Bernstein, MD, FCAP, Curator

https://pharmaceuticalintelligence.com/2014/07/06/loss-of-normal-growth-regulation/

21. CT Angiography & TrueVision™ Metabolomics (Genomic Phenotyping) for new Therapeutic Targets to Atherosclerosis

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/11/15/ct-angiography-truevision-metabolomics-genomic-phenotyping-for-           new-therapeutic-targets-to-atherosclerosis/

22.  CRACKING THE CODE OF HUMAN LIFE: The Birth of BioInformatics & Computational Genomics

Genomics Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/08/30/cracking-the-code-of-human-life-the-birth-of-bioinformatics-                      computational-genomics/

23. Big Data in Genomic Medicine

Author and Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/12/17/big-data-in-genomic-medicine/

24. From Genomics of Microorganisms to Translational Medicine

Author and Curator: Demet Sag, PhD

https://pharmaceuticalintelligence.com/2014/03/20/without-the-past-no-future-but-learn-and-move-genomics-of-                      microorganisms-to-translational-medicine/

25. Summary of Genomics and Medicine: Role in Cardiovascular Diseases

Author and Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/01/06/summary-of-genomics-and-medicine-role-in-cardiovascular-diseases/

 26. Genomic Promise for Neurodegenerative Diseases, Dementias, Autism Spectrum, Schizophrenia, and Serious                      Depression

Author and Curator, Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/02/19/genomic-promise-for-neurodegenerative-diseases-dementias-autism-        spectrum-schizophrenia-and-serious-depression/

 27.  BRCA1 a tumour suppressor in breast and ovarian cancer – functions in transcription, ubiquitination and DNA repair

Sudipta Saha, PhD

https://pharmaceuticalintelligence.com/2012/12/04/brca1-a-tumour-suppressor-in-breast-and-ovarian-cancer-functions-         in-transcription-ubiquitination-and-dna-repair/

28. Personalized medicine gearing up to tackle cancer

Ritu Saxena, PhD

https://pharmaceuticalintelligence.com/2013/01/07/personalized-medicine-gearing-up-to-tackle-cancer/

29. Differentiation Therapy – Epigenetics Tackles Solid Tumors

Stephen J Williams, PhD

      https://pharmaceuticalintelligence.com/2013/01/03/differentiation-therapy-epigenetics-tackles-solid-tumors/

30. Mechanism involved in Breast Cancer Cell Growth: Function in Early Detection & Treatment

     Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/01/17/mechanism-involved-in-breast-cancer-cell-growth-function-in-early-          detection-treatment/

31. The Molecular pathology of Breast Cancer Progression

Tilde Barliya, PhD

https://pharmaceuticalintelligence.com/2013/01/10/the-molecular-pathology-of-breast-cancer-progression

32. Gastric Cancer: Whole-genome reconstruction and mutational signatures

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2012/12/24/gastric-cancer-whole-genome-reconstruction-and-mutational-                   signatures-2/

33. Paradigm Shift in Human Genomics – Predictive Biomarkers and Personalized Medicine –                                                       Part 1 (pharmaceuticalintelligence.com)

Aviva  Lev-Ari, PhD, RN

http://pharmaceuticalntelligence.com/2013/01/13/paradigm-shift-in-human-genomics-predictive-biomarkers-and-personalized-medicine-part-1/

34. LEADERS in Genome Sequencing of Genetic Mutations for Therapeutic Drug Selection in Cancer                                         Personalized Treatment: Part 2

A Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/01/13/leaders-in-genome-sequencing-of-genetic-mutations-for-therapeutic-       drug-selection-in-cancer-personalized-treatment-part-2/

35. Personalized Medicine: An Institute Profile – Coriell Institute for Medical Research: Part 3

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/01/13/personalized-medicine-an-institute-profile-coriell-institute-for-medical-        research-part-3/

36. Harnessing Personalized Medicine for Cancer Management, Prospects of Prevention and Cure: Opinions of                           Cancer Scientific Leaders @http://pharmaceuticalintelligence.com

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/01/13/7000/Harnessing_Personalized_Medicine_for_ Cancer_Management-      Prospects_of_Prevention_and_Cure/

37.  GSK for Personalized Medicine using Cancer Drugs needs Alacris systems biology model to determine the in silico
effect of the inhibitor in its “virtual clinical trial”

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2012/11/14/gsk-for-personalized-medicine-using-cancer-drugs-needs-alacris-             systems-biology-model-to-determine-the-in-silico-effect-of-the-inhibitor-in-its-virtual-clinical-trial/

38. Personalized medicine-based cure for cancer might not be far away

Ritu Saxena, PhD

  https://pharmaceuticalintelligence.com/2012/11/20/personalized-medicine-based-cure-for-cancer-might-not-be-far-away/

39. Human Variome Project: encyclopedic catalog of sequence variants indexed to the human genome sequence

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2012/11/24/human-variome-project-encyclopedic-catalog-of-sequence-variants-         indexed-to-the-human-genome-sequence/

40. Inspiration From Dr. Maureen Cronin’s Achievements in Applying Genomic Sequencing to Cancer Diagnostics

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/01/10/inspiration-from-dr-maureen-cronins-achievements-in-applying-                genomic-sequencing-to-cancer-diagnostics/

41. The “Cancer establishments” examined by James Watson, co-discoverer of DNA w/Crick, 4/1953

Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/01/09/the-cancer-establishments-examined-by-james-watson-co-discover-         of-dna-wcrick-41953/

42. What can we expect of tumor therapeutic response?

Author and curator: Larry H Bernstein, MD, FACP

https://pharmaceuticalintelligence.com/2012/12/05/what-can-we-expect-of-tumor-therapeutic-response/

43. Directions for genomics in personalized medicine

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/01/27/directions-for-genomics-in-personalized-medicine/

44. How mobile elements in “Junk” DNA promote cancer. Part 1: Transposon-mediated tumorigenesis.

Stephen J Williams, PhD

https://pharmaceuticalintelligence.com/2012/10/31/how-mobile-elements-in-junk-dna-prote-cancer-part1-transposon-            mediated-tumorigenesis/

45. mRNA interference with cancer expression

Author and Curator, Larry H. Bernstein, MD, FCAP

 https://pharmaceuticalintelligence.com/2012/10/26/mrna-interference-with-cancer-expression/

46. Expanding the Genetic Alphabet and linking the genome to the metabolome

Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2012/09/24/expanding-the-genetic-alphabet-and-linking-the-genome-to-the-               metabolome/

47. Breast Cancer, drug resistance, and biopharmaceutical targets

Author and Curator: Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/09/18/breast-cancer-drug-resistance-and-biopharmaceutical-targets/

48.  Breast Cancer: Genomic profiling to predict Survival: Combination of Histopathology and Gene Expression                            Analysis

Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2012/12/24/breast-cancer-genomic-profiling-to-predict-survival-combination-of-           histopathology-and-gene-expression-analysis

49. Gastric Cancer: Whole-genome reconstruction and mutational signatures

Aviva  Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2012/12/24/gastric-cancer-whole-genome-reconstruction-and-mutational-                   signatures-2/

50. Genomic Analysis: FLUIDIGM Technology in the Life Science and Agricultural Biotechnology

Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2012/08/22/genomic-analysis-fluidigm-technology-in-the-life-science-and-                   agricultural-biotechnology/

51. 2013 Genomics: The Era Beyond the Sequencing Human Genome: Francis Collins, Craig Venter, Eric Lander, et al.

Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/2013_Genomics

52. Paradigm Shift in Human Genomics – Predictive Biomarkers and Personalized Medicine – Part 1

Aviva Lev-Ari, PhD, RD

https://pharmaceuticalintelligence.com/Paradigm Shift in Human Genomics_/

Signaling Pathways

  1. Proteins and cellular adaptation to stress

Larry H Bernstein, MD, FCAP, Curator

https://pharmaceuticalintelligence.com/2014/07/08/proteins-and-cellular-adaptation-to-stress/

  1. A Synthesis of the Beauty and Complexity of How We View Cancer:
    Cancer Volume One – Summary

Author and Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2014/03/26/a-synthesis-of-the-beauty-and-complexity-of-how-we-view-cancer/

  1. Recurrent somatic mutations in chromatin-remodeling and ubiquitin ligase complex genes in
    serous endometrial tumors

Sudipta Saha, PhD

https://pharmaceuticalintelligence.com/2012/11/19/recurrent-somatic-mutations-in-chromatin-remodeling-ad-ubiquitin-           ligase-complex-genes-in-serous-endometrial-tumors/

4.  Prostate Cancer Cells: Histone Deacetylase Inhibitors Induce Epithelial-to-Mesenchymal Transition

Stephen J Williams, PhD

https://pharmaceuticalintelligence.com/2012/11/30/histone-deacetylase-inhibitors-induce-epithelial-to-mesenchymal-              transition-in-prostate-cancer-cells/

5. Ubiquinin-Proteosome pathway, autophagy, the mitochondrion, proteolysis and cell apoptosis

Author and Curator: Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2012/10/30/ubiquinin-proteosome-pathway-autophagy-the-mitochondrion-                   proteolysis-and-cell-apoptosis/

6. Signaling and Signaling Pathways

Larry H. Bernstein, MD, FCAP, Reporter and Curator

https://pharmaceuticalintelligence.com/2014/08/12/signaling-and-signaling-pathways/

7.  Leptin signaling in mediating the cardiac hypertrophy associated with obesity

Larry H. Bernstein, MD, FCAP, Reporter and Curator

https://pharmaceuticalintelligence.com/2013/11/03/leptin-signaling-in-mediating-the-cardiac-hypertrophy-associated-            with-obesity/

  1. Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP, Reporter and Curator

https://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

  1. The Final Considerations of the Role of Platelets and Platelet Endothelial Reactions in Atherosclerosis and Novel
    Treatments

Larry H. Bernstein, MD, FCAP, Reporter and Curator

https://pharmaceuticalintelligence.com/2013/10/15/the-final-considerations-of-the-role-of-platelets-and-platelet-                      endothelial-reactions-in-atherosclerosis-and-novel-treatments

10.   Platelets in Translational Research – Part 1

Larry H. Bernstein, MD, FCAP, Reporter and Curator

https://pharmaceuticalintelligence.com/2013/10/07/platelets-in-translational-research-1/

11.  Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and
Cardiovascular Calcium Signaling Mechanism

Author and Curator: Larry H Bernstein, MD, FCAP, Author, and Content Consultant to e-SERIES A:
Cardiovascular Diseases: Justin Pearlman, MD, PhD, FACC and Curator: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-             smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

12. The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and
Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia,
Similarities and Differences, and Pharmaceutical Targets

     Author and Curator: Larry H Bernstein, MD, FCAP, Author, and Content Consultant to
e-SERIES A: Cardiovascular Diseases: Justin Pearlman, MD, PhD, FACC and
Curator: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-       kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-           differen/

13.  Nitric Oxide Signalling Pathways

Aviral Vatsa, PhD, MBBS

https://pharmaceuticalintelligence.com/2012/08/22/nitric-oxide-signalling-pathways/

14. Immune activation, immunity, antibacterial activity

Larry H. Bernstein, MD, FCAP, Curator

https://pharmaceuticalintelligence.com/2014/07/06/immune-activation-immunity-antibacterial-activity/

15.  Regulation of somatic stem cell Function

Larry H. Bernstein, MD, FCAP, Writer and Curator    Aviva Lev-Ari, PhD, RN, Curator

https://pharmaceuticalintelligence.com/2014/07/29/regulation-of-somatic-stem-cell-function/

16. Scientists discover that pluripotency factor NANOG is also active in adult organisms

Larry H. Bernstein, MD, FCAP, Reporter

https://pharmaceuticalintelligence.com/2014/07/10/scientists-discover-that-pluripotency-factor-nanog-is-also-active-in-adult-organisms/

Advertisements

Read Full Post »


Signaling transduction tutorial

Larry H. Bernstein, MD, FCAP, Reporter and Curator
Leaders in Pharmaceutical Intelligence

https://pharmaceuticalintelligence.com/8-10-2014/Signaling transduction tutorial

This portion of the discussion is a series of articles on signaling and signaling pathways. Many of the protein-protein interactions or protein-membrane interactions and associated regulatory features have been referred to previously, but the focus of the discussion or points made were different.  I considered placing this after the discussion of proteins and how they play out their essential role, but this is quite a suitable place for a progression to what follows.  This is introduced by material taken from Wikipedia, which will be followed by a series of mechanisms and examples from the current literature, which give insight into the developments in cell metabolism, with the later goal of separating views introduced by molecular biology and genomics from functional cellular dynamics that are not dependent on the classic view.  The work is vast, and this discussion does not attempt to cover it in great depth.  It is the first in a series.  This discussion, in particular is a tutorial on signaling transduction that was already available, and relevant.  One may note that all of the slides used herein were also used in the previous blog, but in a different construction.  I shall tweak the contents, as I find helpful.

  1. Signaling and signaling pathways
  2. Signaling transduction tutorial.
  3. Carbohydrate metabolism
  4. Lipid metabolism
  5. Protein synthesis and degradation
  6. Subcellular structure
  7. Impairments in pathological states: endocrine disorders; stress hypermetabolism; cancer.

 

Signal Transduction Tutorial

The goal of this tutorial is for you to gain an understanding of how cell signaling occurs in a cell.  Upon completion of the tutorial,

  • you will have a basic understanding signal transduction and
  • the role of phosphorylation in signal transduction.

You will also have detailed knowledge of

  • the role of Tyrosine kinases and
  • G protein-coupled receptors in cell signaling.
  1. Description of Signal Transduction

As living organisms

  • we are constantly receiving and interpreting signals from our environment.

These signals can come

  • in the form of light, heat, odors, touch or sound.

The cells of our bodies are also

  • constantly receiving signals from other cells.

These signals are important to

  • keep cells alive and functioning as well as
  • to stimulate important events such as
  • cell division and differentiation.

Signals are most often chemicals that can be found

  • in the extracellular fluid around cells.

These chemicals can come

  • from distant locations in the body (endocrine signaling by hormones), from
  • nearby cells (paracrine signaling) or can even
  • be secreted by the same cell (autocrine signaling).
intercellular signaling

intercellular signaling

http://www.hartnell.edu/tutorials/biology/images/intercellularsignaling.jpg

Signaling molecules may trigger any number of cellular responses, including

  • changing the metabolism of the cell receiving the signal or
  • result in a change in gene expression (transcription) within the nucleus of the cell or both.

Overview of Cell Signaling

Cell signaling can be divided into 3 stages.

  1. Reception: A cell detects a signaling molecule from the outside of the cell. A signal is detected when the chemical signal (also known as a ligand) binds to a receptor protein on the surface of the cell or inside the cell.
  2. Transduction: When the signaling molecule binds the receptor it changes the receptor protein in some way. This change initiates the process of transduction. Signal transduction is usually a pathway of several steps. Each relay molecule in the signal transduction pathway changes the next molecule in the pathway.
  3. Response: Finally, the signal triggers a specific cellular response.
signal transduction_simple

signal transduction_simple

http://www.hartnell.edu/tutorials/biology/images/signaltransduction_simple.jpg

Reception

Signal Transduction - ligand binds to surface receptor

Signal Transduction – ligand binds to surface receptor

 

 

Membrane receptors function by binding the signal molecule (ligand) and causing the production of a second signal (also known as a second messenger) that then causes a cellular response. These types of receptors transmit information from the extracellular environment to the inside of the cell

  • by changing shape or
conformational-rearrangements

conformational-rearrangements

Enzyme_Model  allosterism

Enzyme_Model allosterism

  • by joining with another protein
  • once a specific ligand binds to it.

Examples of membrane receptors include

  • G Protein-Coupled Receptors and
membrane_receptor_g protein

membrane_receptor_g protein

 

 

 

 

  • Receptor Tyrosine Kinases.
activation of receptor Tyrosine Kinase

activation of receptor Tyrosine Kinase

http://www.hartnell.edu/tutorials/biology/images/membrane_receptor_tk.jpg

Intracellular receptors are found inside the cell, either in the cytopolasm or in the nucleus of the target cell (the cell receiving the signal).

Chemical messengers that are hydrophobic or very small (steroid hormones for example) can

  • pass through the plasma membrane without assistance and
  • bind these intracellular receptors.

Once bound and activated by the signal molecule,

  • the activated receptor can initiate a cellular response, such as a
  • change in gene expression.

Note that this is the first time that change in gene expression is stated.  Is the change in gene expression implication of a change in the genetic information – such as – mutation?  That does not have to be the case in the normal homeostatic case.  This might only be

  • a change in the rate of a transcription or a suppression of expression through RNA.
intracellular_receptor_steroid

intracellular_receptor_steroid

http://www.hartnell.edu/tutorials/biology/images/intracellular_receptor_steroid.jpg

Transduction

Since signaling systems need to be

  • responsive to small concentrations of chemical signals and act quickly,
  • cells often use a multi-step pathway that transmits the signal quickly,
  • while amplifying the signal to numerous molecules at each step.
Signal transduction cascades amplify the signal output

Signal transduction cascades amplify the signal output

Steps in the signal transduction pathway often involve

  • the addition or removal of phosphate groups which results in the activation of proteins.
  • Enzymes that transfer phosphate groups from ATP to a protein are called protein kinases.

Many of the relay molecules in a signal transduction pathway are protein kinases and

  • often act on other protein kinases in the pathway. Often
  • this creates a phosphorylation cascade, where
  • one enzyme phosphorylates another, which then phosphorylates another protein, causing a chain reaction.
phosphorylation-cascade

phosphorylation-cascade

Also important to the phosphorylation cascade are

  • a group of proteins known as protein phosphatases.

Protein phosphatases are enzymes that can rapidly remove phosphate groups from proteins (dephosphorylation) and thus inactivate protein kinases. Protein phosphatases are

  • the “off switch” in the signal transduction pathway.

Phosphorylation Dephosphorylation

 

Turning the signal transduction pathway off when the signal is no longer present is important

  • to ensure that the cellular response is regulated appropriately.

Dephosphorylation also makes protein kinases

  • available for reuse and
  • enables the cell to respond again when another signal is received.

Kinases are not the only tools used by cells in signal transduction. Small, nonprotein, water-soluble molecules or ions called second messengers (the ligand that binds the receptor is the first messenger) can also

  • relay signals received by receptors on the cell surface
  • to target molecules in the cytoplasm or the nucleus.
membrane protein receptor binds with hormone

membrane protein receptor binds with hormone

 

insulin receptor and and insulin receptor signaling pathway (IRS)

insulin receptor and and insulin receptor signaling pathway (IRS)

 

 

binding-proteins-and-bioavailable-25-hydroxyvitamin-d

binding-proteins-and-bioavailable-25-hydroxyvitamin-d

 

 

Examples of second messengers include cyclic AMP (cAMP) and calcium ions.

membrane_receptor_g protein

membrane_receptor_g protein

http://www.hartnell.edu/tutorials/biology/images/membrane_receptor_gprotein.jpg

Response

Cell signaling ultimately leads to the regulation of one or more cellular activities. Regulation of gene expression (turning transcription of specific genes on or off) is a common outcome of cell signaling. A signaling pathway may also

  • regulate the activity of a protein, for example
ion-transporters-and-channels-in-mammalian-choroidal-epithelium

ion-transporters-and-channels-in-mammalian-choroidal-epithelium

Ca(2+) and contraction

Ca(2+) and contraction

 

transepithelial-electrogenic-ion-transport

transepithelial-electrogenic-ion-transport

 

calcium release flux

calcium release flux

 

coupled receptors

 

 

 

 

  1. opening or closing an ion channel in the plasma membrane or
  2. promoting a change in cell metabolism such as catalyzing the breakdown of glycogen.

Signaling pathways can also lead to important cellular events such as

  • cell division or apoptosis (programmed cell death).
ubiquitylation-is-a-multistep-reaction.

ubiquitylation-is-a-multistep-reaction.

 

Involvement of VSMCs apoptosis in fibrous plaque rupture.

Involvement of VSMCs apoptosis in fibrous plaque rupture.

 

 

 

 

 

 

 

 

 

 

 

 

G- Protein-Coupled Receptor

 

membrane_receptor_g protein

membrane_receptor_g protein

Arrestin binding to active GPCR kinase (GRK)-phosphorylated GPCRs blocks G protein coupling

Arrestin binding to active GPCR kinase (GRK)-phosphorylated GPCRs blocks G protein coupling

Signal Transduction Tutorial bDr. Katherine Harris is licensed under a Creative Commons Attribution-NonCommercial-ShareAlike 3.0 Unported License.

Funded by the U.S. Department of Education, College Cost Reduction and Access (CCRAA) grant award # P031C080096.

http://creativecommons.org/licenses/by-nc-sa/3.0/

  • NonCommercial — You may not use the material for commercial purposes.
  • ShareAlike — If you remix, transform, or build upon the material, you must distribute your contributions under the same license as the original.

Adapt — remix, transform, and build upon the material

hormone + receptor signaling

http://home.earthlink.net/~dayvdanls/SignalTrans.gif

Signal-Transduction-Pathway

http://pi-silico.hkbu.edu.hk/wp-content/uploads/2012/12/Signal-Transduction-Pathway.png

http://upload.wikimedia.org/wikipedia/commons/a/a4/1Signal_Transduction_Pathways_Model.jpg

Akt mTOR pathway

Akt mTOR pathway

http://cc.scu.edu.cn/G2S/eWebEditor/uploadfile/20120810155043970.jpg

Quia – 9AP Chapter 11 – Cell Commun

http://www.quia.com/files/quia/users/lmcgee/membranetransport/cell_communication/reception_transduction_resp.gif

http://cc.scu.edu.cn/G2S/eWebEditor/uploadfile/20120810155043970.jpg

HER2 in Breast Cancer–What Does it Mean?

http://img.medscape.com/fullsize/migrated/editorial/clinupdates/2000/681/tu02.fig2.jpg

Protease signalling: the cutting edge

http://emboj.embopress.org/content/embojnl/31/7/1630/F5.large.jpg

Quia – 9AP Chapter 11 – Cell Commun

http://www.quia.com/files/quia/users/lmcgee/membranetransport/cell_communication/phosphorylation-cascade.gif

 

Signal Transduction in Autism

http://www.mun.ca/biology/desmid/brian/BIOL2060/BIOL2060-14/1403.jpg

The multiple protein-dependent steps in signal transduction

http://www.nature.com/nrm/journal/v1/n2/images/nrm1100_145a_i2.gif

CONVERSING AT THE CELLULAR LEVEL: AN INTRODUCTION TO SIGNAL …

  1. scq.ubc.ca

 

http://www.scq.ubc.ca/wp-content/uploads/2006/07/transduction.gif

 

Biology 1710 > Davis > Flashcards > exam 1 | StudyBlue

  1. studyblue.com

 

http://classconnection.s3.amazonaws.com/602/flashcards/1005602/png/bio101332955375817.png

 

Read Full Post »

Prologue to Cancer – e-book Volume One – Where are we in this journey?


Prologue to Cancer – e-book Volume One – Where are we in this journey?

Author and Curator: Larry H. Bernstein, MD, FCAP

Consulting Reviewer and Contributor:  Jose Eduardo de Salles Roselino, MD

 

LH Bernstein

LH Bernstein

Jose Eduardo de Salles Roselino

LES Roselino

 

 

This is a preface to the fourth in the ebook series of Leaders in Pharmaceutical Intelligence, a collaboration of experienced doctorate medical and pharmaceutical professionals.  The topic is of great current interest, and it entails a significant part of current medical expenditure by a group of neoplastic diseases that may develop at different periods in life, and have come to supercede infections or even eventuate in infectious disease as an end of life event.  The articles presented are a collection of the most up-to-date accounts of the state of a now rapidly emerging field of medical research that has benefitted enormously by progress in immunodiagnostics,  radiodiagnostics, imaging, predictive analytics, genomic and proteomic discovery subsequent to the completion of the Human Genome Project, advances in analytic methods in qPCR, gene sequencing, genome mapping, signaling pathways, exome identification, identification of therapeutic targets in inhibitors, activators, initiators in the progression of cell metabolism, carcinogenesis, cell movement, and metastatic potential.  This story is very complicated because we are engaged in trying to evoke from what we would like to be similar clinical events, dissimilar events in their expression and classification, whether they are within the same or different anatomic class.  Thus, we are faced with constructing an objective evidence-based understanding requiring integration of several disciplinary approaches to see a clear picture.  The failure to do so creates a high risk of failure in biopharmaceutical development.

The chapters that follow cover novel and important research and development in cancer related research, development, diagnostics and treatment, and in balance, present a substantial part of the tumor landscape, with some exceptions.  Will there ever be a unifying concept, as might be hoped for? I certainly can’t see any such prediction on the horizon.  Part of the problem is that disease classification is a human construct to guide us, and so are treatments that have existed and are reexamined for over 2,000 years.  In that time, we have changed, our afflictions have been modified, and our environment has changed with respect to the microorganisms within and around us, viruses, the soil, and radiation exposure, and the impacts of war and starvation, and access to food.  The outline has been given.  Organic and inorganic chemistry combined with physics has given us a new enterprise in biosynthetics that is and will change our world.  But let us keep in mind that this is a human construct, just as drug target development is such a construct, workable with limitations.

What Molecular Biology Gained from Physics

We need greater clarity and completeness in defining the carcinogenetic process.  It is the beginning, but not the end.  But we must first examine the evolution of the scientific structure that leads to our present understanding. This was preceded by the studies of anatomy, physiology, and embryology that had to occur as a first step, which was followed by the researches into bacteriology, fungi, sea urchins and the evolutionary creatures that could be studied having more primary development in scale.  They are still major objects of study, with the expectation that we can derive lessons about comparative mechanisms that have been passed on through the ages and have common features with man.  This became the serious intent of molecular biology, the discipline that turned to find an explanation for genetics, and to carry out controlled experiments modelled on the discipline that already had enormous success in physics, mathematics, and chemistry. In 1900, when Max Planck hypothesized that the frequency of light emitted by the black body depended on the frequency of the oscillator that emitted it, it had important ramifications for chemistry and biology (See Appendix II and Footnote 1, Planck equation, energy and oscillation).  The leading idea is to search below the large-scale observations of classical biology.

The central dogma of molecular biology where genetic material is transcribed into RNA and then translated into protein, provides a starting point, but the construct is undergoing revision in light of emerging novel roles for RNA and signaling pathways.   The term, coined by Warren Weaver (director of Natural Sciences for the Rockefeller Foundation), who observed an emergence of significant change given recent advances in fields such as X-ray crystallography. Molecular biology also plays important role in understanding formations, actions, regulations of various parts of cellswhich can be used efficiently for targeting new drugs, diagnosis of disease, physiology of the Cell. The Nobel Prize in Physiology or Medicine in 1969 was shared by Max Delbrück, Alfred D. Hershey, Salvador E. Luria, whose work with viral replication gave impetus to the field.  Delbruck was a physicist who trained in Copenhagen under Bohr, and specifically committed himself to a rigor in biology, as was in physics.

Dorothy Hodgkin  protein crystallography

Dorothy Hodgkin protein crystallography

Rosalind Franlin crystallographer double helix

Rosalind Franlin
crystallographer
double helix

 Max Delbruck         molecular biology

Max Delbruck        
molecular biology

Max Planck

Max Planck Quantum Physics

 

 

 

We then stepped back from classical (descriptive) physiology, with the endless complexity, to molecular biology.  This led us to the genetic code, with a double helix model.  It has recently been found insufficiently explanatory, with the recent construction of triplex and quadruplex models. They have a potential to account for unaccounted for building blocks, such as inosine, and we don’t know whether more than one model holds validity under different conditions .  The other major field of development has been simply unaccounted for in the study of proteomics, especially in protein-protein interactions, and in the energetics of protein conformation, first called to our attention by the work of Jacob, Monod, and Changeux (See Footnote 2).  Proteins are not just rigid structures stamped out by the monotonously simple DNA to RNA to protein concept.  Nothing is ever quite so simple. Just as there are epigenetic events, there are posttranslational events, and yet more.

JPChangeux-150x170

JP Changeux

 

 

 

 

 

 

 

 

The Emergence of Molecular Biology

I now return the discussion to the topic of medicine, the emergence of molecular biology and the need for convergence with biochemistry in the mid-20th century. Jose Eduardo de Salles Roselino recalls “I was previously allowed to make of the conformational energy as made by R Marcus in his Nobel lecture revised (J. of Electroanalytical  Chemistry 438:(1997) p251-259. (See Footnote 1) His description of the energetic coordinates of a landscape of a chemical reaction is only a two-dimensional cut of what in fact is a volcano crater (in three dimensions) (each one varies but the sum of the two is constant. Solvational+vibrational=100% in ordinate) nuclear coordinates in abcissa. In case we could represent it by research methods that allow us to discriminate in one by one degree of different pairs of energy, we would most likely have 360 other similar representations of the same phenomenon. The real representation would take into account all those 360 representations together. In case our methodology was not that fine, for instance it discriminates only differences of minimal 10 degrees in 360 possible, will have 36 partial representations of something that to be perfectly represented will require all 36 being taken together. Can you reconcile it with ATGC?  Yet, when complete genome sequences were presented they were described as though we will know everything about this living being. The most important problems in biology will be viewed by limited vision always and the awareness of this limited is something we should acknowledge and teach it. Therefore, our knowledge is made up of partial representations. If we had the entire genome data for the most intricate biological problems, they are still not amenable to this level of reductionism. But going from general views of signals andsymptoms we could get to the most detailed molecular view and in this case genome provides an anchor.”

“Warburg Effect” describes the preference of glycolysis and lactic acid fermentation rather than oxidative phosphorylation for energy production in cancer cells. Mitochondrial metabolism is an important and necessary component in the functioning and maintenance of the cell, and accumulating evidence suggests that dysfunction of mitochondrial metabolism plays a role in cancer. Progress has demonstrated the mechanisms of the mitochondrial metabolism-to-glycolysis switch in cancer development and how to target this metabolic switch.

 

 

Glycolysis

glycolysis

 

Otto Heinrich Warburg (1883-  )

Otto Warburg

435px-Louis_Pasteur,_foto_av_Félix_Nadar_Crisco_edit

Louis Pasteur

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

The expression “Pasteur effect” was coined by Warburg when inspired by Pasteur’s findings in yeast cells, when he investigated this metabolic observation (Pasteur effect) in cancer cells. In yeast cells, Pasteur had found that the velocity of sugar used was greatly reduced in presence of oxygen. Not to be confused, in the “Crabtree effect”, the velocity of sugar metabolism was greatly increased, a reversal, when yeast cells were transferred from the aerobic to an anaerobic condition. Thus, the velocity of sugar metabolism of yeast cells was shown to be under metabolic regulatory control in response to change in environmental oxygen conditions in growth. Warburg had to verify whether cancer cells and tissue related normal mammalian cells also have a similar control mechanism. He found that this control was also found in normal cells studied, but was absent in cancer cells. Strikingly, cancer cells continue to have higher anaerobic gycolysis despite the presence of oxygen in their culture media (See Footnote 3).

Taking this a step further, food is digested and supplied to cells In vertebrates mainly in the form of glucose, which is metabolized producing Adenosine Triphosphate (ATP) by two pathways. Glycolysis, occurs via anaerobic metabolism in the cytoplasm, and is of major significance for making ATP quickly, but in a minuscule amount (2 molecules).  In the presence of oxygen, the breakdown process continues in the mitochondria via the Krebs’s cycle coupled with oxidative phosphorylation, which is more efficient for ATP production (36 molecules). Cancer cells seem to depend on glycolysis. In the 1920s, Otto Warburg first proposed that cancer cells show increased levels of glucose consumption and lactate fermentation even in the presence of ample oxygen (known as “Warburg Effect”). Based on this theory, oxidative phosphorylation switches to glycolysis which promotes the proliferation of cancer cells. Many studies have demonstrated glycolysis as the main metabolic pathway in cancer cells.

Albert Szent Gyogy (Warburg’s student) and Otto Meyerhof both studied striated skeletal muscle metabolism invertebrates, and they found those changes observed in yeast by Pasteur. The description of the anaerobic pathway was largely credited to Emden and Meyerhof. Whenever there is increase in muscle work, energy need is above what can be provided by blood supply, the cell metabolism changes from aerobic (where  Acetyl CoA  provides the chemical energy for aerobic production of ATP) to anaerobic metabolism of glucose. In this condition, glucose is obtained directly from its muscle glycogen stores (not from hepatic glycogenolysis).  This is the sole source of chemical energy that is independent of oxygen supplied to the cell. It is a physiological change on muscle metabolism that favors autonomy. It does not depend upon the blood oxygen for aerobic metabolim or blood sources of carbon metabolites borne out from adipose tissue (free fatty acids) or muscle proteins (branched chain amino acids), or vascular delivery of glucose. On that condition, the muscle can perform contraction by its internal source of ATP and uses conversion of pyruvate to lactate in order to regenerate much-needed NAD (by hydride transfer from pyruvate) as a replacement for this mitochondrial function. This regulatory change, keeps glycolysis going at fast rate in order to meet ATP needs of the cell under low yield condition (only two or three ATP for each glucose converted into two lactate molecules). Therefore, it cannot last for long periods of time. This regulatory metabolic change is made in seconds, minutes and therefore happens with the proteins that are already presented in the cell. It does not requires the effect of transcription factors and/or changes in gene expression (See Footnote 1, 2).

In other types mammalian cells, like those from the lens of the eye (86% gycolysis + pentose shunt),  and red blood cells (RBC)[both lacking mitochondria], and also in the deep medullary layer of the kidneys, for lack of mitochondria in the first two cases and normally reduced blood perfusion in the third – A condition required for the counter current mechanism and our ability to concentrate urine also have, permanent higher anaerobic metabolism. In the case of RBC, it includes the ability to produce in a shunt of glycolytic pathway 2,3 diphospho- glycerate that is required to place the hemogloblin macromolecule in an unstable equilibrium between its two forms (R and T – Here presented as simplified accordingly to the model of Monod, Wyman and Changeux. The final model would be even much complex (see for instance, H-W and K review Nature 2007 vol 450: p 964-972 )

Any tissue under a condition of ischemia that is required for some medical procedures (open heart surgery, organ transplants, etc) displays this fast regulatory mechanism (See Footnote 1, 2). A display of these regulatory metabolic changes can be seen in: Cardioplegia: the protection of the myocardium during open heart surgery: a review. D. J. Hearse J. Physiol., Paris, 1980, 76, 751-756 (Fig 1).  The following points are made:

1-       It is a fast regulatory response. Therefore, no genetic mechanism can be taken into account.

2-       It moves from a reversible to an irreversible condition, while the cells are still alive. Death can be seen at the bottom end of the arrow. Therefore, it cannot be reconciled with some of the molecular biology assumptions:

A-       The gene and genes reside inside the heart muscle cells but, in order to preserve intact, the source of coded genetic information that the cell reads and transcribes, DNA must be kept to a minimal of chemical reactivity.

B-       In case sequence determines conformation, activity and function , elevated potassium blood levels could not cause cardiac arrest.

In comparison with those conditions here presented, cancer cells keep the two metabolic options for glucose metabolism at the same time. These cells can use glucose that our body provides to them or adopt temporarily, an independent metabolic form without the usual normal requirement of oxygen (one or another form for ATP generation).  ATP generation is here, an over-simplification of the metabolic status since the carbon flow for building blocks must also be considered and in this case oxidative metabolism of glucose in cancer cells may be viewed as a rich source of organic molecules or building blocks that dividing cells always need.

JES Roselino has conjectured that “most of the Krebs cycle reaction works as ideal reversible thermodynamic systems that can supply any organic molecule that by its absence could prevent cell duplication.” In the vision of Warburg, cancer cells have a defect in Pasteur-effect metabolic control. In case it was functioning normally, it will indicate which metabolic form of glucose metabolism is adequate for each condition. What more? Cancer cells lack differentiated cell function. Any role for transcription factors must be considered as the role of factors that led to the stable phenotypic change of cancer cells. The failure of Pasteur effect must be searched for among the fast regulatory mechanisms that aren’t dependent on gene expression (See Footnote 3).

Extending the thoughts of JES Roselino (Hepatology 1992;16: 1055-1060), reduced blood flow caused by increased hydrostatic pressure in extrahepatic cholestasis decreases mitochondrial function (quoted in Hepatology) and as part of Pasteur effect normal response, increased glycolysis in partial and/or functional anaerobiosis and therefore blocks the gluconeogenic activity of hepatocytes that requires inhibited glycolysis. In this case, a clear energetic link can be perceived between the reduced energetic supply and the ability to perform differentiated hepatic function (gluconeogenesis). In cancer cells, the action of transcription factors that can be viewed as different ensembles of kaleidoscopic pieces (with changing activities as cell conditions change) are clearly linked to the new stable phenotype. In relation to extrahepatic cholestasis mentioned above it must be reckoned that in case a persistent chronic condition is studied a secondary cirrhosis is installed as an example of persistent stable condition, difficult to be reversed and without the requirement for a genetic mutation. (See Footnote 4).

 The Rejection of Complexity

Most of our reasoning about genes was derived from scientific work in microorganisms. These works have provided great advances in biochemistry.

250px-DNA_labeled  DNA diagram showing base pairing

double helix

 

hgp_hubris_220x288_72  genome cartoon

Dna triplex pic

Triple helix

 

formation of a triplex DNA structure

formation of triple helix

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

1-      The “Gelehrter idea”: No matter what you are doing you will always be better off, in case you have a gene (In chapter 7 Principles of Medical Genetics Gelehrter and Collins Williams & Wilkins 1990).

2-      The idea that everything could be found following one gene one enzyme relationship that works fine for our understanding of the metabolism, in all biological problems.

3-      The idea that everything that explains biochemistry in microorganisms explains also for every living being (J Nirenberg).

4-      The idea that biochemistry may not require that time should be also taken into account. Time must be considered only for genetic and biological evolution studies (S Luria. In Life- The unfinished experiment 1977 C Scribner´s sons NY).

5-      Finally, the idea that everything in biology, could be found in the genome. Since all information in biology goes from DNA through RNA to proteins. Alternatively, are in the DNA, in case the strict line that includes RNA is not included.

This last point can be accepted in case it is considered that ALL GENETIC information is in our DNA. Genetics as part of life and not as its total expression.

For example, when our body is informed that the ambient temperature is too low or alternatively is too high, our body is receiving an information that arrives from our environment. This external information will affect our proteins and eventually, in case of longer periods in a new condition will cause adaptive response that may include conformational changes in transcription factors (proteins) that will also, produce new readings on the DNA. However, it is an information that moves from outside, to proteins and not from DNA to proteins. The last pathway, when transcription factors change its conformation and change DNA reading will follow the dogmatic view as an adaptive response (See Footnotes 1-3).

However, in case, time is taken into account, the first reactions against cold or warmer temperatures will be the ones that happen through change in protein conformation, activities and function before any change in gene expression can be noticed at protein level. These fast changes, in seconds, minutes cannot be explained by changes in gene expression and are strongly linked to what is needed for the maintenance of life.

“It is possible”, says Roselino, “desirable, to explain all these fast biochemical responses to changes in a living being condition as the sound foundation of medical practices without a single mention to DNA. In case a failure in any mechanism necessary to life is found to be genetic in its origin, the genome in context with with this huge set of transcription factors must be taken into account. This is the biochemical line of reasoning that I have learned with Houssay and Leloir. It would be an honor to see it restored in modern terms.”

More on the Mechanism of Metabolic Control

It was important that genomics would play such a large role in medical research for the last 70 years. There is also good reason to rethink the objections of the Nobelists James Watson and Randy Schekman in the past year, whatever discomfort it brings.  Molecular biology has become a tautology, and as a result deranged scientific rigor inside biology.

Crick & Watson with their DNA model, 1953

Eatson and Crick

Randy-Schekman Berkeley

Randy-Schekman Berkeley

 

 

According to JES Roselino, “consider that glycolysis is oscillatory thanks to the kinetic behavior of Phosphofructokinase. Further, by its effect upon Pyruvate kinase through Fructose 1,6 diphosphate oscillatory levels, the inhibition of gluconeogenesis is also oscillatory. When the carbon flow through glycolysis is led to a maximal level gluconeogenesis will be almost completely blocked. The reversal of the Pyruvate kinase step in liver requires two enzymes (Pyruvate carboxylase (maintenance of oxaloacetic levels) + phosphoenolpyruvate carboxykinase (E.C. 4.1.1.32)) and energy requiring reactions that most likely could not as an ensemble, have a fast enough response against pyruvate kinase short period of inhibition during high frequency oscillatory periods of glycolytic flow. Only when glycolysis oscillates at low frequency the opposite reaction could enable gluconeogenic carbon flow.”

In case it can be shown in a rather convincing way, the same reasoning could be applied to understand how simple replicative signals inducing Go to G1 transition in cells, could easily overcome more complex signals required for cell differentiation and differentiated function.

Perhaps the problem of overextension of the equivalence of the DNA and what happens to the organism is also related to the initial reliance on a single cell model to relieve the complexity (which isn’t fully the case).

For instance, consider this fragment:
“Until only recently it was assumed that all proteins take on a clearly defined three-dimensional structure – i.e. they fold in order to be able to assume these functions.”
Cold Spring Harbour Symp. Quant. Biol. 1973  p 187-193 J.C Seidel and J Gergely – Investigation of conformational changes in Spin-Labeled Myosin Model for muscle contraction:
Huxley, A. F. 1971 Proc. Roy. Soc (London) (B) 178:1
Huxley, A.F and R. M. Simmons,1971. Nature 233:633
J.C Haselgrove X ray Evidence for a conformational Change in the Actin-containing filaments…Cold Spring Harbour Symp Quant Biol.1972 v 37: p 341-352

Only a very small sample indicating otherwise. Proteins were held as interacting macromolecules, changing their conformation in regulatory response to changes in the microenvironment (See Footnote 2). DNA was the opposite, non-interacting macromolecules to be as stable as a library must be.

The dogma held that the property of proteins could be read in DNA alone. Consequenly, the few examples quoted above, must be ignored and all people must believe that DNA alone, without environmental factors roles, controls protein amino acid sequence (OK), conformation (not true), activity (not true) and function (not true).

It appeared naively to be correct from the dogma to conclude from interpreting your genome: You have a 50% increased risk of developing the following disease (deterministic statement).  The correct form must be: You belong to a population that has a 50% increase in the risk of….followed by –  what you must do to avoid increase in your personal risk and the care you should take in case you want to have longer healthy life.  Thus, genetics and non-genetic diseases were treated as the same and medical foundations were reinforced by magical considerations (dogmas) in a very profitable way for those involved besides the patient.

 Footnotes:

  1. There is a link of electricity with ions in biology and the oscillatory behavior of some electrical discharges.  In addition, the oscillatory form of electrical discharged may have allowed Planck to relate high energy content with higher frequencies and conversely, low energy content in low frequency oscillatory events.  One may think of high density as an indication of great amount of matter inside a volume in space.  This helps the understanding of Planck’s idea as a high-density-energy in time for a high frequency phenomenon.
  1. Take into account a protein that may have its conformation restricted by an S-S bridge. This protein also, may move to another more flexible conformation in case it is in HS HS condition when the S-S bridge is broken. Consider also that, it takes some time for a protein to move from one conformation for instance, the restricted conformation (S-S) to other conformations. Also, it takes a few seconds or minutes to return to the S-S conformation (This is the Daniel Koshland´s concept of induced fit and relaxation time used by him in order to explain allosteric behavior of monomeric proteins- Monod, Wyman and Changeux requires tetramer or at least, dimer proteins).
  1. In case you have glycolysis oscillating in a frequency much higher than the relaxation time you could lead to the prevalence of high NADH effect leading to high HS /HS condition and at low glycolytic frequency, you could have predominance of S-S condition affecting protein conformation. In case you have predominance of NAD effect upon protein S-S you would get the opposite results.  The enormous effort to display the effect of citrate and over Phosphofructokinase conformation was made by others. Take into account that ATP action as an inhibitor in this case, is a rather unusual one. It is a substrate of the reaction, and together with its action as activator  F1,6 P (or its equivalent F2,6 P) is also unusual. However, it explains oscillatory behaviour of glycolysis. (Goldhammer , A.R, and Paradies: PFK structure and function, Curr. Top Cell Reg 1979; 15:109-141).
  1. The results presented in our Hepatology work must be viewed in the following way: In case the hepatic (oxygenated) blood flow is preserved, the bile secretory cells of liver receive well-oxygenated blood flow (the arterial branches bath secretory cells while the branches originated from portal vein irrigate the hepatocytes.  During extra hepatic cholestasis the low pressure, portal blood flow is reduced and the hepatocytes do not receive enough oxygen required to produce ATP that gluconeogenesis demands. Hepatic artery do not replace this flow since, its branches only join portal blood fluxes after the previous artery pressure  is reduced to a low pressure venous blood – at the point where the formation of hepatic vein is. Otherwise, the flow in the portal vein would be reversed or, from liver to the intestine. It is of no help to take into account possible valves for this reasoning since minimal arterial pressure is well above maximal venous pressure and this difference would keep this valve in permanent close condition. In low portal blood flow condition, the hepatocyte increases pyruvate kinase activity and with increased pyruvate kinase activity Gluconeogenesis is forbidden (See Walsh & Cooper revision quoted in the Hepatology as ref 23). For the hemodynamic considerations, role of artery and veins in hepatic portal system see references 44 and 45 Rappaport and Schneiderman and Rappapaport.

 

 Appendix I.

metabolic pathways

metabolic pathways

Signals Upstream and Targets Downstream of Lin28 in the Lin28 Pathway

Signals Upstream and Targets Downstream of Lin28 in the Lin28 Pathway

 

 

 

 

 

 

 

 

1.  Functional Proteomics Adds to Our Understanding

Ben Schuler’s research group from the Institute of Biochemistry of the University of Zurich has now established that an increase in temperature leads to folded proteins collapsing and becoming smaller. Other environmental factors can trigger the same effect. The crowded environments inside cells lead to the proteins shrinking. As these proteins interact with other molecules in the body and bring other proteins together, understanding of these processes is essential “as they play a major role in many processes in our body, for instance in the onset of cancer”, comments study coordinator Ben Schuler.

Measurements using the “molecular ruler”

“The fact that unfolded proteins shrink at higher temperatures is an indication that cell water does indeed play an important role as to the spatial organisation eventually adopted by the molecules”, comments Schuler with regard to the impact of temperature on protein structure. For their studies the biophysicists use what is known as single-molecule spectroscopy. Small colour probes in the protein enable the observation of changes with an accuracy of more than one millionth of a millimetre. With this “molecular yardstick” it is possible to measure how molecular forces impact protein structure.

With computer simulations the researchers have mimicked the behaviour of disordered proteins. They want to use them in future for more accurate predictions of their properties and functions.

Correcting test tube results

That’s why it’s important, according to Schuler, to monitor the proteins not only in the test tube but also in the organism. “This takes into account the fact that it is very crowded on the molecular level in our body as enormous numbers of biomolecules are crammed into a very small space in our cells”, says Schuler. The biochemists have mimicked this “molecular crowding” and observed that in this environment disordered proteins shrink, too.

Given these results many experiments may have to be revisited as the spatial organisation of the molecules in the organism could differ considerably from that in the test tube according to the biochemist from the University of Zurich. “We have, therefore, developed a theoretical analytical method to predict the effects of molecular crowding.” In a next step the researchers plan to apply these findings to measurements taken directly in living cells.

Explore further: Designer proteins provide new information about the body’s signal processesMore information: Andrea Soranno, Iwo Koenig, Madeleine B. Borgia, Hagen Hofmann, Franziska Zosel, Daniel Nettels, and Benjamin Schuler. Single-molecule spectroscopy reveals polymer effects of disordered proteins in crowded environments. PNAS, March 2014. DOI: 10.1073/pnas.1322611111

 

Effects of Hypoxia on Metabolic Flux

  1. Glucose-6-phosphate dehydrogenase regulation in the hepatopancreas of the anoxia-tolerantmarinemollusc, Littorina littorea

JL Lama , RAV Bell and KB Storey

Glucose-6-phosphate dehydrogenase (G6PDH) gates flux through the pentose phosphate pathway and is key to cellular antioxidant defense due to its role in producing NADPH. Good antioxidant defenses are crucial for anoxia-tolerant organisms that experience wide variations in oxygen availability. The marine mollusc, Littorina littorea, is an intertidal snail that experiences daily bouts of anoxia/hypoxia with the tide cycle and shows multiple metabolic and enzymatic adaptations that support anaerobiosis. This study investigated the kinetic, physical and regulatory properties of G6PDH from hepatopancreas of L. littorea to determine if the enzyme is differentially regulated in response to anoxia, thereby providing altered pentose phosphate pathway functionality under oxygen stress conditions.

Several kinetic properties of G6PDH differed significantly between aerobic and 24 h anoxic conditions; compared with the aerobic state, anoxic G6PDH (assayed at pH 8) showed a 38% decrease in K G6P and enhanced inhibition by urea, whereas in pH 6 assays Km NADP and maximal activity changed significantly.

All these data indicated that the aerobic and anoxic forms of G6PDH were the high and low phosphate forms, respectively, and that phosphorylation state was modulated in response to selected endogenous protein kinases (PKA or PKG) and protein phosphatases (PP1 or PP2C). Anoxia-induced changes in the phosphorylation state of G6PDH may facilitate sustained or increased production of NADPH to enhance antioxidant defense during long term anaerobiosis and/or during the transition back to aerobic conditions when the reintroduction of oxygen causes a rapid increase in oxidative stress.

Lama et al.  Peer J 2013.   http://dx.doi.org/10.7717/peerj.21

 

  1. Structural Basis for Isoform-Selective Inhibition in Nitric Oxide Synthase

    TL. Poulos and H Li

In the cardiovascular system, the important signaling molecule nitric oxide synthase (NOS) converts L-arginine into L-citrulline and releases nitric oxide (NO). NO produced by endothelial NOS (eNOS) relaxes smooth muscle which controls vascular tone and blood pressure. Neuronal NOS (nNOS) produces NO in the brain, where it influences a variety of neural functions such as neural transmitter release. NO can also support the immune system, serving as a cytotoxic agent during infections. Even with all of these important functions, NO is a free radical and, when overproduced, it can cause tissue damage. This mechanism can operate in many neurodegenerative diseases, and as a result the development of drugs targeting nNOS is a desirable therapeutic goal.

However, the active sites of all three human isoforms are very similar, and designing inhibitors specific for nNOS is a challenging problem. It is critically important, for example, not to inhibit eNOS owing to its central role in controlling blood pressure. In this Account, we summarize our efforts in collaboration with Rick Silverman at Northwestern University to develop drug candidates that specifically target NOS using crystallography, computational chemistry, and organic synthesis. As a result, we have developed aminopyridine compounds that are 3800-fold more selective for nNOS than eNOS, some of which show excellent neuroprotective effects in animal models. Our group has solved approximately 130 NOS-inhibitor crystal structures which have provided the structural basis for our design efforts. Initial crystal structures of nNOS and eNOS bound to selective dipeptide inhibitors showed that a single amino acid difference (Asp in nNOS and Asn in eNOS) results in much tighter binding to nNOS. The NOS active site is open and rigid, which produces few large structural changes when inhibitors bind. However, we have found that relatively small changes in the active site and inhibitor chirality can account for large differences in isoform-selectivity. For example, we expected that the aminopyridine group on our inhibitors would form a hydrogen bond with a conserved Glu inside the NOS active site. Instead, in one group of inhibitors, the aminopyridine group extends outside of the active site where it interacts with a heme propionate. For this orientation to occur, a conserved Tyr side chain must swing out of the way. This unanticipated observation taught us about the importance of inhibitor chirality and active site dynamics. We also successfully used computational methods to gain insights into the contribution of the state of protonation of the inhibitors to their selectivity. Employing the lessons learned from the aminopyridine inhibitors, the Silverman lab designed and synthesized symmetric double-headed inhibitors with an aminopyridine at each end, taking advantage of their ability to make contacts both inside and outside of the active site. Crystal structures provided yet another unexpected surprise. Two of the double-headed inhibitor molecules bound to each enzyme subunit, and one molecule participated in the generation of a novel Zn site that required some side chains to adopt alternate conformations. Therefore, in addition to achieving our specific goal, the development of nNOS selective compounds, we have learned how subtle differences in and structure can control proteinligand interactions and often in unexpected ways.

 

300px-Nitric_Oxide_Synthase

Nitric oxide synthase

arginine-NO-citulline cycle

arginine-NO-citulline cycle

active site of eNOS (PDB_1P6L) and nNOS (PDB_1P6H).

active site of eNOS (PDB_1P6L) and nNOS (PDB_1P6H).

 

 

NO - muscle, vasculature, mitochondria

NO – muscle, vasculature, mitochondria

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Figure:  (A) Structure of one of the early dipeptide lead compounds, 1, that exhibits excellentisoform selectivity. (B, C) show the crystal structures of the dipeptide inhibitor 1 in the active site of eNOS (PDB: 1P6L) and nNOS (PDB: 1P6H). In nNOS, the inhibitor “curls” which enables the inhibitor R-amino group to interact with both Glu592 and Asp597. In eNOS, Asn368 is the homologue to nNOS Asp597.

Accounts in Chem Res 2013; 46(2): 390-98.

  1. Jamming a Protein Signal

Interfering with a single cancer-promoting protein and its receptor can open this resistance mechanism by initiating autophagy of the affected cells,  according to researchers at The University of Texas MD Anderson Cancer Center  in the journal Cell Reports.  According to Dr. Anil Sood and Yunfei Wen, lead and first authors, blocking  prolactin, a potent growth factor for ovarian cancer, sets off downstream events that result in cell by autophagy, the process  recycles damaged organelles and proteins for new use by the cell through the phagolysozome. This in turn, provides a clinical rationale for blocking prolactin and its receptor to initiate sustained autophagy as an alternative strategy for treating cancers.

Steep reductions in tumor weight

Prolactin (PRL) is a hormone previously implicated in ovarian, endometrial and other cancer development andprogression. When PRL binds to its cell membrane receptor, PRLR, activation of cancer-promoting cell signaling pathways follows.  A variant of normal prolactin called G129R blocks the reaction between prolactin and its receptor. Sood and colleagues treated mice that had two different lines of human ovarian cancer, both expressing the prolactin receptor, with G129R. Tumor weights fell by 50 percent for mice with either type of ovarian cancer after 28 days of treatment with G129R, and adding the taxane-based chemotherapy agent paclitaxel cut tumor weight by 90 percent. They surmise that higher doses of G129R may result in even greater therapeutic benefit.

 

3D experiments show death by autophagy

 

[video width=”1280″ height=”720″ mp4=”https://pharmaceuticalintelligence.files.wordpress.com/2014/04/1741-7007-11-65-s1-macromolecular-juggling-by-ubiquitylation-enzymes1.mp4″][/video]

 

Next the team used the prolactin-mimicking peptide to treat cultures of cancer spheroids which sharply reduced their numbers, and blocked the activation of JAK2 and STAT signaling pathways.

Protein analysis of the treated spheroids showed increased presence of autophagy factors and genomic analysis revealed increased expression of a number of genes involved in autophagy progression and cell death.  Then a series of experiments using fluorescence and electron microscopy showed that the cytosol of treated cells had large numbers of cavities caused by autophagy.

The team also connected the G129R-induced autophagy to the activity of PEA-15, a known cancer inhibitor. Analysis of tumor samples from 32 ovarian cancer patients showed that tumors express higher levels of the prolactin receptor and lower levels of phosphorylated PEA-15 than normal ovarian tissue. However, patients with low levels of the prolactin receptor and higher PEA-15 had longer overall survival than those with high PRLR and low PEA-15.

Source: MD Anderson Cancer Center

 

  1. Chemists’ Work with Small Peptide Chains of Enzymes

Korendovych and his team designed seven simple peptides, each containing seven amino acids. They then allowed the molecules of each peptide to self-assemble, or spontaneously clump together, to form amyloids. (Zinc, a metal with catalytic properties, was introduced to speed up the reaction.) What they found was that four of the seven peptides catalyzed the hydrolysis of molecules known as esters, compounds that react with water to produce water and acids—a feat not uncommon among certain enzymes.

“It was the first time that a peptide this small self-assembled to produce an enzyme-like catalyst,” says Korendovych. “Each enzyme has to be an exact fit for its respective substrate,” he says, referring to the molecule with which an enzyme reacts. “Even after millions of years, nature is still testing all the possible combinations of enzymes to determine which ones can catalyze metabolic reactions. Our results make an argument for the design of self-assembling nanostructured catalysts.”

Source: Syracuse University

Here are three articles emphasizing the value of combinatorial analysis, which can be formed from genomic, clinical, and proteomic data sets.

 

  1. Comparative analysis of differential network modularity in tissue specific normal and cancer protein interaction networks

    F Islam , M Hoque , RS Banik , S Roy , SS Sumi, et al.

As most biological networks show modular properties, the analysis of differential modularity between normal and cancer protein interaction networks can be a good way to understand cancer more significantly. Two aspects of biological network modularity e.g. detection of molecular complexes (potential modules or clusters) and identification of crucial nodes forming the overlapping modules have been considered in this regard.

The computational analysis of previously published protein interaction networks (PINs) has been conducted to identify the molecular complexes and crucial nodes of the networks. Protein molecules involved in ten major cancer signal transduction pathways were used to construct the networks based on expression data of five tissues e.g. bone, breast, colon, kidney and liver in both normal and cancer conditions.

Cancer PINs show higher level of clustering (formation of molecular complexes) than the normal ones. In contrast, lower level modular overlapping is found in cancer PINs than the normal ones. Thus a proposition can be made regarding the formation of some giant nodes in the cancer networks with very high degree and resulting in reduced overlapping among the network modules though the predicted molecular complex numbers are higher in cancer conditions.

Islam et al. Journal of Clinical Bioinformatics 2013, 3:19-32

  1. A new 12-gene diagnostic biomarker signature of melanoma revealed by integrated microarray analysis

    Wanting Liu , Yonghong Peng and Desmond J. Tobin
    PeerJ 1:e49;        http://dx.doi.org/10.7717/peerj.49

Here we present an integrated microarray analysis framework, based on a genome-wide relative significance (GWRS) and genome-wide global significance (GWGS) model. When applied to five microarray datasets on melanoma published between 2000 and 2011, this method revealed a new signature of 200 genes. When these were linked to so-called ‘melanoma driver’ genes involved in MAPK, Ca2+, and WNT signaling pathways we were able to produce a new 12-gene diagnostic biomarker signature for melanoma (i.e., EGFR, FGFR2, FGFR3, IL8, PTPRF, TNC, CXCL13, COL11A1, CHP2, SHC4, PPP2R2C, andWNT4).We have begun to experimentally validate a subset of these genes involved inMAPK signaling at the protein level, including CXCL13, COL11A1, PTPRF and SHC4 and found these to be overexpressed inmetastatic and primarymelanoma cells in vitro and in situ compared to melanocytes cultured from healthy skin epidermis and normal healthy human skin.

 

catalytic amyloid forming particle

catalytic amyloid forming particle

 

 

 

 

 

 

 

        8.    PanelomiX: A threshold-based algorithm to create panels of biomarkers

X Robin , N Turck , A Hainard , N Tiberti, et al.
               Translational Proteomics 2013.    http://dx.doi.org/10.1016/j.trprot.2013.04.003

The PanelomiX toolbox combines biomarkers and evaluates the performance of panels to classify patients better than singlemarkers or other classifiers. The ICBTalgorithm proved to be an efficient classifier, the results of which can easily be interpreted.

Here are two current examples of the immense role played by signaling pathways in carcinogenic mechanisms and in treatment targeting, which is also confounded by acquired resistance.

 

  1. Triple-Negative Breast Cancer

  1. epidermal growth factor receptor (EGFR or ErbB1) and
  2. high activity of the phosphatidylinositol 3-kinase (PI3K)–Akt pathway

are both targeted in triple-negative breast cancer (TNBC).

  • activation of another EGFR family member [human epidermal growth factor receptor 3 (HER3) (or ErbB3)] may limit the antitumor effects of these drugs.

This study found that TNBC cell lines cultured with the EGFR or HER3 ligand EGF or heregulin, respectively, and treated with either an Akt inhibitor (GDC-0068) or a PI3K inhibitor (GDC-0941) had increased abundance and phosphorylation of HER3.

The phosphorylation of HER3 and EGFR in response to these treatments

  1. was reduced by the addition of a dual EGFR and HER3 inhibitor (MEHD7945A).
  2. MEHD7945A also decreased the phosphorylation (and activation) of EGFR and HER3 and
  3. the phosphorylation of downstream targets that occurred in response to the combination of EGFR ligands and PI3K-Akt pathway inhibitors.

In culture, inhibition of the PI3K-Akt pathway combined with either MEHD7945A or knockdown of HER3

  1. decreased cell proliferation compared with inhibition of the PI3K-Akt pathway alone.
  2. Combining either GDC-0068 or GDC-0941 with MEHD7945A inhibited the growth of xenografts derived from TNBC cell lines or from TNBC patient tumors, and
  3. this combination treatment was also more effective than combining either GDC-0068 or GDC-0941 with cetuximab, an EGFR-targeted antibody.
  4. After therapy with EGFR-targeted antibodies, some patients had residual tumors with increased HER3 abundance and EGFR/HER3 dimerization (an activating interaction).

Thus, we propose that concomitant blockade of EGFR, HER3, and the PI3K-Akt pathway in TNBC should be investigated in the clinical setting.

Reference: Antagonism of EGFR and HER3 Enhances the Response to Inhibitors of the PI3K-Akt Pathway in Triple-Negative Breast Cancer. JJ Tao, P Castel, N Radosevic-Robin, M Elkabets, et al.  Sci. Signal., 25 March 2014;
7(318), p. ra29   http://dx.doi.org/10.1126/scisignal.2005125

 

                  10.   Metastasis in RAS Mutant or Inhibitor-Resistant Melanoma Cells

The protein kinase BRAF is mutated in about 40% of melanomas, and BRAF inhibitors improve progression-free and overall survival in these patients. However, after a relatively short period of disease control, most patients develop resistance because of reactivation of the RAF–ERK (extracellular signal–regulated kinase) pathway, mediated in many cases by mutations in RAS. We found that BRAF inhibition induces invasion and metastasis in RAS mutant melanoma cells through a mechanism mediated by the reactivation of the MEK (mitogen-activated protein kinase kinase)–ERK pathway.

Reference: BRAF Inhibitors Induce Metastasis in RAS Mutant or Inhibitor-Resistant Melanoma Cells by Reactivating MEK and ERK Signaling. B Sanchez-Laorden, A Viros, MR Girotti, M Pedersen, G Saturno, et al., Sci. Signal., 25 March 2014;  7(318), p. ra30  http://dx.doi.org/10.1126/scisignal.2004815

Appendix II.

The world of physics in the twentieth century saw the end of determinism established by Newton. This is characterized by discrete laws that describe natural observations. These are in gravity and in eletricity. In an early phase of investigation, an era of galvanic or voltaic electricity represented a revolutionary break from the historical focus on frictional electricity. Alessandro Voltadiscovered that chemical reactions could be used to create positively charged anodes and negatively charged cathodes.  In 1790, Prof. Luigi Alyisio Galvani of Bologna, while conducting experiments on “animal electricity“, noticed the twitching of a frog’s legs in the presence of an electric machine. He observed that a frog’s muscle, suspended on an iron balustrade by a copper hook passing through its dorsal column, underwent lively convulsions without any extraneous cause, the electric machine being at this time absent.  Volta communicated a description of his pile to the Royal Society of London and shortly thereafter Nicholson and Cavendish (1780) produced the decomposition of water by means of the electric current, using Volta’s pile as the source of electromotive force.

Siméon Denis Poisson attacked the difficult problem of induced magnetization, and his results provided  a first approximation. His innovation required the application of mathematics to physics.  His memoirs on the theory of electricity and magnetism created a new branch of mathematical physics.  The discovery of electromagnetic induction was made almost simultaneously and independently by Michael Faraday and Joseph Henry. Michael Faraday, the successor of Humphry Davy, began his epoch-making research relating to electric and electromagnetic induction in 1831. In his investigations of the peculiar manner in which iron filings arrange themselves on a cardboard or glass in proximity to the poles of a magnet, Faraday conceived the idea of magnetic “lines of force” extending from pole to pole of the magnet and along which the filings tend to place themselves. On the discovery being made that magnetic effects accompany the passage of an electric current in a wire, it was also assumed that similar magnetic lines of force whirled around the wire. He also posited that iron, nickel, cobalt, manganese, chromium, etc., are paramagnetic (attracted by magnetism), whilst other substances, such as bismuth, phosphorus, antimony, zinc, etc., are repelled by magnetism or are diamagnetic.

Around the mid-19th century, Fleeming Jenkin‘s work on ‘ Electricity and Magnetism ‘ and Clerk Maxwell’s ‘ Treatise on Electricity and Magnetism ‘ were published. About 1850 Kirchhoff published his laws relating to branched or divided circuits. He also showed mathematically that according to the then prevailing electrodynamic theory, electricity would be propagated along a perfectly conducting wire with the velocity of light. Herman Helmholtz investigated the effects of induction on the strength of a current and deduced mathematical equations, which experiment confirmed. In 1853 Sir William Thomson (later Lord Kelvin) predicted as a result of mathematical calculations the oscillatory nature of the electric discharge of a condenser circuit.  Joseph Henry, in 1842 discerned  the oscillatory nature of the Leyden jardischarge.

In 1864 James Clerk Maxwell announced his electromagnetic theory of light, which was perhaps the greatest single step in the world’s knowledge of electricity. Maxwell had studied and commented on the field of electricity and magnetism as early as 1855/6 when On Faraday’s lines of force was read to the Cambridge Philosophical Society. The paper presented a simplified model of Faraday’s work, and how the two phenomena were related. He reduced all of the current knowledge into a linked set of differential equations with 20 equations in 20 variables. This work was later published as On Physical Lines of Force in1861. In order to determine the force which is acting on any part of the machine we must find its momentum, and then calculate the rate at which this momentum is being changed. This rate of change will give us the force. The method of calculation which it is necessary to employ was first given by Lagrange, and afterwards developed, with some modifications, by Hamilton’s equations. Now Maxwell logically showed how these methods of calculation could be applied to the electro-magnetic field. The energy of a dynamical systemis partly kinetic, partly potential. Maxwell supposes that the magnetic energy of the field is kinetic energy, the electric energy potential.  Around 1862, while lecturing at King’s College, Maxwell calculated that the speed of propagation of an electromagnetic field is approximately that of the speed of light.   Maxwell’s electromagnetic theory of light obviously involved the existence of electric waves in free space, and his followers set themselves the task of experimentally demonstrating the truth of the theory. By 1871, he presented the Remarks on the mathematical classification of physical quantities.

A Wave-Particle Dilemma at the Century End

In 1896 J.J. Thomson performed experiments indicating that cathode rays really were particles, found an accurate value for their charge-to-mass ratio e/m, and found that e/m was independent of cathode material. He made good estimates of both the charge e and the mass m, finding that cathode ray particles, which he called “corpuscles”, had perhaps one thousandth of the mass of the least massive ion known (hydrogen). He further showed that the negatively charged particles produced by radioactive materials, by heated materials, and by illuminated materials, were universal.  In the late 19th century, the Michelson–Morley experiment was performed by Albert Michelson and Edward Morley at what is now Case Western Reserve University. It is generally considered to be the evidence against the theory of a luminiferous aether. The experiment has also been referred to as “the kicking-off point for the theoretical aspects of the Second Scientific Revolution.” Primarily for this work, Albert Michelson was awarded theNobel Prize in 1907.

Wave–particle duality is a theory that proposes that all matter exhibits the properties of not only particles, which have mass, but also waves, which transfer energy. A central concept of quantum mechanics, this duality addresses the inability of classical concepts like “particle” and “wave” to fully describe the behavior of quantum-scale objects. Standard interpretations of quantum mechanics explain this paradox as a fundamental property of the universe, while alternative interpretations explain the duality as an emergent, second-order consequence of various limitations of the observer. This treatment focuses on explaining the behavior from the perspective of the widely used Copenhagen interpretation, in which wave–particle duality serves as one aspect of the concept of complementarity, that one can view phenomena in one way or in another, but not both simultaneously.  Through the work of Max PlanckAlbert EinsteinLouis de BroglieArthur Compton, Niels Bohr, and many others, current scientific theory holds that all particles also have a wave nature (and vice versa).

Beginning in 1670 and progressing over three decades, Isaac Newton argued that the perfectly straight lines of reflection demonstrated light’s particle nature, but Newton’s contemporaries Robert Hooke and Christiaan Huygens—and later Augustin-Jean Fresnel—mathematically refined the wave viewpoint, showing that if light traveled at different speeds in different, refraction could be easily explained. The resulting Huygens–Fresnel principle was supported by Thomas Young‘s discovery of double-slit interference, the beginning of the end for the particle light camp.  The final blow against corpuscular theory came when James Clerk Maxwell discovered that he could combine four simple equations, along with a slight modification to describe self-propagating waves of oscillating electric and magnetic fields. When the propagation speed of these electromagnetic waves was calculated, the speed of light fell out. While the 19th century had seen the success of the wave theory at describing light, it had also witnessed the rise of the atomic theory at describing matter.

Matter and Light

In 1789, Antoine Lavoisier secured chemistry by introducing rigor and precision into his laboratory techniques. By discovering diatomic gases, Avogadro completed the basic atomic theory, allowing the correct molecular formulae of most known compounds—as well as the correct weights of atoms—to be deduced and categorized in a consistent manner. The final stroke in classical atomic theory came when Dimitri Mendeleev saw an order in recurring chemical properties, and created a table presenting the elements in unprecedented order and symmetry.   Chemistry was now an atomic science.

Black-body radiation, the emission of electromagnetic energy due to an object’s heat, could not be explained from classical arguments alone. The equipartition theorem of classical mechanics, the basis of all classical thermodynamic theories, stated that an object’s energy is partitioned equally among the object’s vibrational modes. This worked well when describing thermal objects, whose vibrational modes were defined as the speeds of their constituent atoms, and the speed distribution derived from egalitarian partitioning of these vibrational modes closely matched experimental results. Speeds much higher than the average speed were suppressed by the fact that kinetic energy is quadratic—doubling the speed requires four times the energy—thus the number of atoms occupying high energy modes (high speeds) quickly drops off. Since light was known to be waves of electromagnetism, physicists hoped to describe this emission via classical laws. This became known as the black body problem. The Rayleigh–Jeans law which, while correctly predicting the intensity of long wavelength emissions, predicted infinite total energy as the intensity diverges to infinity for short wavelengths.

The solution arrived in 1900 when Max Planck hypothesized that the frequency of light emitted by the black body depended on the frequency of the oscillator that emitted it, and the energy of these oscillators increased linearly with frequency (according to his constant h, where E = hν). By demanding that high-frequency light must be emitted by an oscillator of equal frequency, and further requiring that this oscillator occupy higher energy than one of a lesser frequency, Planck avoided any catastrophe; giving an equal partition to high-frequency oscillators produced successively fewer oscillators and less emitted light. And as in the Maxwell–Boltzmann distribution, the low-frequency, low-energy oscillators were suppressed by the onslaught of thermal jiggling from higher energy oscillators, which necessarily increased their energy and frequency. Planck had intentionally created an atomic theory of the black body, but had unintentionally generated an atomic theory of light, where the black body never generates quanta of light at a given frequency with energy less than .

In 1905 Albert Einstein took Planck’s black body model in itself and saw a wonderful solution to another outstanding problem of the day: the photoelectric effect, the phenomenon where electrons are emitted from atoms when they absorb energy from light.   Only by increasing the frequency of the light, and thus increasing the energy of the photons, can one eject electrons with higher energy. Thus, using Planck’s constant h to determine the energy of the photons based upon their frequency, the energy of ejected electrons should also increase linearly with frequency; the gradient of the line being Planck’s constant. These results were not confirmed until 1915, when Robert Andrews Millikan, produced experimental results in perfect accord with Einstein’s predictions. While  the energy of ejected electrons reflected Planck’s constant, the existence of photons was not explicitly proven until the discovery of the photon antibunching effect  When Einstein received his Nobel Prizein 1921, it was  for the photoelectric effect, the suggestion of quantized light. Einstein’s “light quanta” represented the quintessential example of wave–particle duality. Electromagnetic radiation propagates following  linear wave equations, but can only be emitted or absorbed as discrete elements, thus acting as a wave and a particle simultaneously.

Radioactivity Changes the Scientific Landscape

The turn of the century also features radioactivity, which later came to the forefront of the activities of World War II, the Manhattan Project, the discovery of the chain reaction, and later – Hiroshima and Nagasaki.

Marie Curie

Marie Curie

 

 

 

Marie Skłodowska-Curie was a Polish and naturalized-French physicist and chemist who conducted pioneering research on radioactivity. She was the first woman to win a Nobel Prize, the only woman to win in two fields, and the only person to win in multiple sciences. She was also the first woman to become a professor at the University of Paris, and in 1995 became the first woman to be entombed on her own merits in the Panthéon in Paris. She shared the 1903 Nobel Prize in Physics with her husband Pierre Curie and with physicist Henri Becquerel. She won the 1911 Nobel Prize in Chemistry.  Her achievements included a theory of radioactivity (a term that she coined, techniques for isolating radioactive isotopes, and the discovery of polonium and radium. She named the first chemical element that she discovered – polonium, which she first isolated in 1898 – after her native country. Under her direction, the world’s first studies were conducted into the treatment of neoplasms using radioactive isotopes. She founded the Curie Institutes in Paris and in Warsaw, which remain major centres of medical research today. During World War I, she established the first military field radiological centres.  Curie died in 1934 due to aplastic anemia brought on by exposure to radiation – mainly, it seems, during her World War I service in mobile X-ray units created by her.

 

Read Full Post »


Aortic Aneurysm Pathogenesis: The Role of TGFβRIIb Mutations in  Altering Transforming Growth Factor β2 Signal Transduction

Reporter: Aviva Lev-Ari, PhD, RN

TGFβRIIb Mutations Trigger Aortic Aneurysm Pathogenesis by Altering Transforming Growth Factor β2 Signal Transduction

Katharine J. Bee, PhD, David C. Wilkes, PhD, Richard B. Devereux, MD, Craig T. Basson, MD, PhD and Cathy J. Hatcher, PhD

Author Affiliations

From the Center for Molecular Cardiology, Greenberg Division of Cardiology, Weill Cornell Medical College, New York, NY.

Correspondence to Cathy J. Hatcher, PhD, Greenberg Division of Cardiology, Weill Cornell Medical College, 525 E. 68th St, New York, NY 10065. E-mailcjhatche@med.cornell.edu

Abstract

Background—Thoracic aortic aneurysm (TAA) is a common progressive disorder involving gradual dilation of the ascending and/or descending thoracic aorta that eventually leads to dissection or rupture. Nonsydromic TAA can occur as a genetically triggered, familial disorder that is usually transmitted in a monogenic autosomal dominant fashion and is known as familial TAA. Genetic analyses of families affected with TAA have identified several chromosomal loci, and further mapping of familial TAA genes has highlighted disease-causing mutations in at least 4 genes: myosin heavy chain 11 (MYH11), α-smooth muscle actin (ACTA2), and transforming growth factor β receptors I and II (TGFβRI and TGFβRII).

Methods and Results—We evaluated 100 probands to determine the mutation frequency in MYH11ACTA2TGFβRI, and TGFβRII in an unbiased population of individuals with genetically mediated TAA. In this study, 9% of patients had a mutation in one of the genes analyzed, 3% of patients had mutations in ACTA2, 3% in MYH11, 1% in TGFβRII, and no mutations were found in TGFβRI. Additionally, we identified mutations in a 75 base pair alternatively spliced TGFβRII exon, exon 1a that produces the TGFβRIIb isoform and accounted for 2% of patients with mutations. Our in vitro analyses indicate that the TGFβRIIb activating mutations alter receptor function on TGFβ2 signaling.

Conclusions—We propose that TGFβRIIb expression is a regulatory mechanism for TGFβ2 signal transduction. Dysregulation of the TGFβ2 signaling pathway, as a consequence of TGFβRIIb mutations, results in aortic aneurysm pathogenesis.

SOURCE: 

Circulation: Cardiovascular Genetics.2012; 5: 621-629

Published online before print October 24, 2012,doi: 10.1161/ CIRCGENETICS.112.964064

 

Read Full Post »


Leptin signaling in mediating the cardiac hypertrophy associated with obesity

Larry H Bernstein, MD, FCAP, Reviewer, and Aviva Lev-Ari, PhD, RN

 

There has been a lot of interest in leptins and both insulin resistance and obesity for the last decade.  The association between obesity and cardiac hypertrophy is also known, but what drives this association.  We have covered heart disease from many aspects in a long series of articles.  The next is a pleasure to take in.

Importance of leptin signaling and signal transducer and activator of transcription-3 activation in mediating the cardiac hypertrophy associated with obesity

Maren Leifheit-Nestler12, Nana-Maria Wagner13, Rajinikanth Gogiraju1,Michael Didié14, Stavros Konstantinides15, Gerd Hasenfuss1 and Katrin Schäfer1*

1Department of Cardiology and Pulmonary Medicine, Heart Research Center, Georg August University Medicine Goettingen, Robert Koch Strasse 40, D-37075, Göttingen, Germany

2Current address: Department of Pediatric Kidney, Liver and Metabolic Diseases, Hannover Medical School, Hannover, Germany

3Current address: Clinic for Anesthesiology and Intensive Care Medicine, University Medicine Rostock, Rostock, Germany

4Department of Pharmacology, Georg August University Medicine Goettingen, Goettingen, Germany

5Current address: Center for Thrombosis and Hemostasis, University Medicine Mainz, Mainz, Germany

J Translational Medicine: Cardiovascular, Metabolic and Lipoprotein Translation. 2013; 11:170.  http://www.translational-medicine.com/content/11/1/170

http://dx.doi.org/10.1186/1479-5876-11-170

This is an Open Access article distributed under the terms of the Creative Commons Attribution License 
http://creativecommons.org/licenses/by/2.0

Abstract

Background

The adipokine leptin and its receptor are expressed in the heart, and

  • leptin has been shown to promote cardiomyocyte hypertrophy in vitro.

Obesity is associated with

  • hyperleptinemia 
  • hypothalamic leptin resistance and
  • an increased risk to develop cardiac hypertrophy and heart failure.

However, the role of cardiac leptin signaling in mediating the cardiomyopathy associated with increased body weight is unclear, in particular, whether it develops subsequently to cardiac leptin resistance or overactivation of hypertrophic signaling pathways via elevated leptin levels.

Methods

The cardiac phenotype of high-fat diet (HFD)-induced obese wildtype (WT) mice was examined and compared to age-matched genetically obese leptin receptor (LepR)-deficient (LepRdb/db) or lean WT mice. To study the role of leptin-mediated STAT3 activation during obesity-induced cardiac remodeling,

  • mice in which tyrosine residue 1138 within LepR had been replaced with a serine (LepRS1138) were also analyzed.

Results

Obesity was associated with hyperleptinemia and elevated cardiac leptin expression in both diet-induced and genetically obese mice.

  • Enhanced LepR and STAT3 phosphorylation levels were detected in hearts of obese WT mice, but not in those with LepR mutations, and
  • exogenous leptin continued to induce cardiac STAT3 activation in diet-induced obese mice.

Although echocardiography revealed signs of cardiac hypertrophy in all obese mice,

  • the increase in left ventricular (LV) mass and diameter was significantly more pronounced in LepRS1138 animals.

LepRS1138 mice also exhibited an increased activation of signaling proteins downstream of LepR, including Jak2 (1.8-fold), Src kinase (1.7-fold), protein kinase B (1.3-fold) or C (1.6-fold). Histological analysis of hearts revealed that the inability of leptin to activate STAT3 in LepRdb/db and LepRS1138 mice

  • was associated with reduced cardiac angiogenesis as well as increased apoptosis and fibrosis.

Conclusions

Our findings suggest that hearts from obese mice continue to respond to elevated circulating or cardiac leptin, which

  • may mediate cardioprotection via LepR-induced STAT3 activation, whereas
  • signals distinct from LepR-Tyr1138 promote cardiac hypertrophy.

On the other hand, the presence of cardiac hypertrophy in obese mice with complete LepR signal disruption indicates that additional pathways also play a role.

Keywords:

Heart; Hypertrophy; Leptin; Obesity; Signal transduction; STAT3

Background

Obesity is frequently associated with elevated circulating leptin levels [1] and an increased risk to develop cardiac hypertrophy [2,3] or heart failure [4]. Clinical studies demonstrated a positive correlation between serum leptin levels and left ventricular (LV) mass or wall thickness [5,6], independent of blood pressure levels, suggesting a direct role for leptin in the pathogenesis of obesity-associated cardiomyopathy. Furthermore, leptin was shown to promote hypertrophy of isolated rat or human ventricular cardiomyocytes [7,8], and

  • this effect could be prevented using neutralizing antibodies [9].

Cardiac hypertrophy also develops in obese rodents fed high-fat diet (HFD)[10,11], and

  • studies in mice with (functional) leptin deficiency suggested that the cardiac hypertrophy developing in states of chronic hyperleptinemia
  • may result from the inability to transduce anti-hypertrophic and/or cardioprotective effects of the adipokine [12,13].

The effects of leptin on cell shortening and intracellular Ca2+ transients were abrogated in cardiomyocytes isolated from HFD-fed obese rats [14], but then others found

  • a preserved signal transduction in response to leptin in hyperleptinemic obese mice [15,16] or rats[17].

The leptin receptor (LepR) belongs to the family of cytokine type I receptors that signal via activation of

  • Janus kinase (Jak)-2 and
  • signal transducer and
  • activator of transcription (STAT)-3 [18].

Analysis of cardiomyocytes ex vivo revealed leptin promotes hypertrophy via activation of p38 and p42/44 MAP kinases as well as protein kinase B (Akt) [19,20]. But it is unknown whether STAT-3 activation downstream of LepR is required to transmit the cardiac effects of leptin and whether it may be involved in mediating protective (i.e. anti-apoptotic, anti-fibrotic or pro-angiogenic) signals, as previously reported in mice with cardiomyocyte-specific STAT-3 deletion [21,22].

In this study, we examined the cardiac phenotype of diet-induced (i.e. with hypothalamic leptin resistance) and genetically obese (i.e. with systemic leptin receptor deficiency) hyperleptinemic mice, developing with age or after continuous β-adrenergic stimulation. Moreover, we determined

  • the importance of leptin-mediated STAT-3 activation
  • for the development of cardiac hypertrophy in obesity
  • by analyzing mice with targeted mutation of the STAT3 binding site within LepR.

Methods

Animals

C57Bl6/J leptin receptor-deficient db/db (LepRdb/db; BKS.Cg Leprdb/Leprdb) mice and C57Bl6/J wildtype (WT) controls were obtained from Harlan Winkelmann, Germany. Mice heterozygous mutant for the LepRS1138 allele (on the congenic B6.129/J background; 98- > 99% homozygous for C57Bl/6; [23]) were obtained from Professor Martin Myers (University of Michigan Medical School, Ann Arbor, USA) and bred at the animal facility of the University of Goettingen, Germany, to generate homozygous mutant obese LepRS1138 mice. Age- and gender-matched WT (LepR+/+) and heterozygous (LepRS/+) littermates were used as controls. To induce obesity, 3 months-old mice were switched to high-fat diet (HFD; D12451) for 4 months, while controls were maintained on normal rodent chow (D12450B; both Research Diets Inc.). The composition of both diets is shown in Additional file 1: Table S1. To examine the cardiac response to hypertrophic stimuli other than leptin, osmotic minipumps (Alzet®; model 2002; Charles River Laboratories) were filled with isoprenaline hydrochloride (Sigma; 20 mg/kg body weight [BW] per day) and implanted for 14 days under the dorsal skinfold of 2 months-old, 2% isoflurane anesthetized mice. At the time of tissue harvest, mice were weighed followed by intraperitoneal anesthesia with a mixture of 2% xylazine (6 mg/kg BW) and 10% ketamine hydrochloride (100 mg/kg BW), and blood was drawn by cardiac puncture. Hearts were rapidly excised, the atria removed and ventricles immediately processed for protein isolation or cryoembedding, respectively. All animal care and experimental procedures had been approved by the institutional Animal Research Committee and complied with national guidelines for the care and use of laboratory animals.

Additional file 1: Table S1. Diet composition.
Format: DOC Size: 33KB

Serum analysis

Freshly drawn blood was allowed to clot at room temperature (RT) for 30 min, followed by centrifugation for 10 min at 3,000 rpm. The supernatant was stored at -80°C pending analysis of serum leptin levels using specific enzyme-linked immunoassays (ELISA; R&D Systems).

Echocardiography

Echocardiography was performed by a blinded examiner at the day before tissue harvest in mice under 1.5% isoflurane anesthesia using the VisualSonics Vevo 2100 system (Visualsonics) equipped with a 30 MHz center frequency ultrasound transducer, as previously described [24]. M-mode echocardiographical recordings were used to determine the end-diastolic and end-systolic LV diameter (EDD and ESD, respectively) and the ventricular wall thickness (WTh), corresponding to the mean of the anterior and posterior WTh. LV mass was calculated using the formula: 1.055 × ([AWTh + EDD + PWTh]3 – EDD3). Fractional shortening (FS) was calculated as (EDD – ESD)/EDD × 100. B-mode echocardiography images were used to calculate the heart weight, using the equation: 1.05 × (5/6) × ((Episyst × (Lsyst + ((AWThsyst + PWThsyst)/2))) – (Areasyst × Lsyst)).

Histology and immunohistochemistry

Histochemical analyses were performed on 5 μm-thick frozen cross sections through the LV. For each mouse, 4 sections (approx. 500 μm apart) and 4 randomly selected viewing fields (at 200-fold magnification) per section were analyzed and findings averaged. Cardiac fibrosis was determined after overnight incubation in Bouin’s fixative followed by Masson’s trichrome (MTC) stain. Monoclonal rat antibodies against mouse CD31 (Santa Cruz Biotechnology) were used to detect endothelial cells [24,25]. Their number was manually counted by a person blinded to the mouse genotype and expressed per mm2 or cardiomyocyte, respectively.

Single cardiomyocytes were visualized by incubation with fluorescein-labeled wheat germ agglutinin (WGA; Molecular Probes), followed by determination of the cardiomyocyte cross-sectional area (CSA) using image analysis software (Image ProPlus). Per cross section, at least 10 randomly selected cardiomyocytes were evaluated and results averaged. Apoptosis was analyzed using the ‘In Situ Cell Death Detection kit’ (Roche). Cell nuclei were visualized using 4′,6-diamidino-2-phenylindole (DAPI; Sigma).

Immunoprecipitation and western blot analysis

Membranes were blocked in 1% bovine serum albumine (in TBS, containing 0.1% Tween-20) prior to incubation with antibodies against phosphorylated (p)-Akt (S473) and total Akt, p-Jak2 (Y1007/1008) and total Jak2, p-p38 (T180/Y182) and total p38, p-p42/44 (T202/Y204) and total p42/44, p-Src (Y416) and total Src, p-STAT3 (Y705) and total STAT3, or p-PKC (pan), respectively (all Cell Signaling Technologies), or against leptin (R&D Systems) and GAPDH (Biotrend), respectively. Protein bands were visualized using HRP-conjugated secondary antibodies (Amersham Biosciences), followed by detection with SuperSignal® West Pico Substrate (Pierce). For the analysis of LepR phosphorylation, 100 μg total heart tissue lysates were immunoprecipitated under rotation at 4°C with 2 μg anti-LepR antibody (against an internal domain present in the short and long isoforms of murine LepR; Santa Cruz Biotechnology) plus 50 μL nProtein A Sepharose™ 4 Fast Flow beads (GE Healthcare) followed by detection of phosphorylated tyrosines (p-Tyr [PY20]; Santa Cruz Biotechnology) or LepR. For the analysis of STAT3 phosphorylation in response to acute elevations of circulating leptin, mice were fasted overnight, injected with recombinant murine leptin (1 mg/kg BW i.p.) and hearts harvested 30 min later.

Statistical analysis

Quantitative data are presented as mean ± standard error of the mean (SEM). Normal data distribution was tested using the D’Agostino & Pearson omnibus normality test. When three or more groups were compared, ANOVA was employed, if samples were normally distributed, or Kruskal-Wallis test, if not. For post-hoc comparisons, ANOVA was followed by Bonferroni’s and Kruskal-Wallis by Dunn’s multiple comparison test. Differences before and after isoprenaline infusion were tested using Student’s t-test for paired means. Statistical significance was assumed when P reached a value less than 0.05. All statistical analyses were performed using GraphPad PRISM software, version 4.01 (GraphPad Software Inc).

Results

Clinical and experimental studies revealed that obesity is associated with LV hypertrophy [10,11], an important risk factor for the development of heart failure. As shown in Tables 1 and 2, WT mice fed HFD for 4 months (WT + HFD; mean body weight [BW], 44±1.9 g) to induce obesity exhibited a non-significant trend towards an increased mean heart weight, LV mass and WTh compared to age-matched lean controls fed normal chow (BW, 29±1.0 g). Marked LV hypertrophy was observed in 7 months-old obese LepRdb/db mice (Table 1 and 2), consistent with a previous report [12]. Longitudinal sections through hearts of WT, WT + HFD and LepRdb/db mice are shown in Figure 1A, representative M-mode echocardiography recordings in Figure 1B and cardiac cross-sections after WGA staining to delineate cardiomyocyte borders in Figure 1C. Of note, adiposity in mice with LepR deficiency was more pronounced compared to age-matched WT + HFD mice (Table 1; P < 0.001), in which obesity develops as result of hypothalamic resistance to chronically elevated leptin levels[26].

1479-5876-11-170-1  F1 Cardiac phenotype of lean and obese WT

Figure 1.Cardiac phenotype of lean and obese WT, WT + HFD, LepRS1138 and LepRdb/db mice.
(A)
Representative H&E-stained longitudinal sections through hearts of 7 months-old mice are shown. Magnification, ×10.(B) Representative M-mode echocardiographic recordings.(C) Representative images of wheat germ agglutinin (WGA)-stained myocardial cross sections. The mean cardiomyocyte cross-sectional areas are given in Table 1.

Table 1.Body, visceral fat and heart weights in 7 months-old mice

Table 2.Echocardiographic parameter in 7 months-old mice

The presence of cardiac hypertrophy in LepR-deficient and, to a lesser extent also in diet-induced obese mice, suggests that it develops as a result of the heart’s inability to respond to elevated systemic (Table 1) and/or cardiac (Figure 2A) leptin levels. In this regard, Western blot analysis revealed increased levels of phosphorylated (p-) LepR (Figure 2B) and STAT-3 (Figure 2C) protein in hearts of HFD-induced obese mice (P < 0.05 vs. WT for both), whereas findings in LepRdb/db mice did not differ from those in lean controls or were reduced compared to those in WT + HFD mice (P < 0.05 for differences in LepR phosphorylation). Moreover, both lean and HFD-induced obese WT mice responded to a single i.p. injection of recombinant murine leptin with a significant increase in the cardiac STAT-3 phosphorylation (Figure 2D), suggesting a preserved cardiac leptin signal transduction in hyperleptinemic, diet-induced obese mice.

???????

Figure 2.Cardiac leptin expression and signal transduction in lean and obese mice.
Protein was extracted from hearts of 7 months-old mice (n = 8 per group) and analyzed for the expression of
(A) leptin, (B)phosphorylated LepR (using immunoprecipitation of LepR, followed by the detection of total phosphotyrosines and LepR) and (C) phosphorylated STAT3. (D) Cardiac STAT3 phosphorylation in response (30 min later) to a single injection of recombinant murine leptin (1 mg/kg BW i.p.) was examined in WT (n = 4) and WT + HFD (n = 6) mice. Results are expressed as -fold increase of controls (black bars) after normalization for total protein and GAPDH expression. The mean ± SEM as well as representative Western blot results are shown. *P < 0.05 and **P < 0.01 vs. WT mice; #P < 0.05 vs. WT + HFD mice.

To further study the role of leptin signaling in the development of cardiac hypertrophy and also to determine, whether the inability of leptin to activate STAT3 contributes to the cardiac maladaptation in obesity, we examined mice in which tyrosine (Tyr)1138 within LepR had been replaced by a serine (LepRS1138). In these mice, leptin cannot signal via STAT3, but continues to be able to activate Jak2 and SH2 domain-containing adapter proteins. Western blot analysis revealed that p-LepR (Figure 2B) and p-STAT3 (Figure 2C) levels in hearts of LepRS1138 mice did not significantly differ from those in WT and LepRdb/db mice. Similar to mice with complete LepR deficiency, lack of LepR-mediated STAT3 activation resulted in severe adiposity, although serum leptin levels were lower than those in LepRdb/db mice (P < 0.001; Table 1). Interestingly, obese LepRS1138 exhibited a more pronounced increase in mean heart weights not only compared to lean or diet-induced obese WT mice, but also compared to LepRdb/db mice (P < 0.001 for all comparisons; Table 1), and differences persisted after normalization for body weight (P < 0.001) or tibia length (P < 0.001). Echocardiography confirmed increased LV mass (P < 0.01) or heart weights (P < 0.001) in LepRS1138 mice compared to their LepRdb/dbcounterparts (Table 2; please also see Figure 1A-C). Moreover, hearts of LepRS1138 mice exhibited elevated levels of phosphorylated Jak2 (P < 0.001 vs. WT; Figure 3A), Src kinase (P < 0.05 vs. WT, WT + HFD and LepRdb/db; Figure 3B), Akt (P < 0.001 vs. LepRdb/db; Figure 3C), PKC (P < 0.05 vs. WT and LepRdb/db, P < 0.01 vs. WT + HFD; Figure 3D) and p38 MAPK (P < 0.01 vs. LepRdb/db; Figure 3E), suggesting that an intact, Tyr1138-independent LepR activation in the presence of elevated leptin levels may have contributed to the pronounced cardiac hypertrophy present in these mice. On the other hand, cardiac levels of p-p42/44 MAPK did not significantly differ between the mouse groups (Figure 3F).

Figure 3. Hypertrophic signal transduction

Figure 3.Hypertrophic signal transduction in hearts of lean and obese mice. Protein was isolated from hearts of 7 months-old WT (n = 15), WT + HFD (n = 12), LepRS1138(n = 15) and LepRdb/db (n = 15) mice and analyzed for the expression of phosphorylated Jak2 (A), Src kinase (B), Akt (C), PKC (D), p38 (E) and p42/44 MAPK (F). Results are expressed as -fold increase of lean control mice (after normalization for total protein [with the exception of PKC] and GAPDH expression). The mean ± SEM as well as representative findings are shown. *P < 0.05, **P < 0.01 and ***P < 0.001 vs. WT mice; #P < 0.05 and ##P < 0.01 vs. WT + HFD mice; §P < 0.05, §§P < 0.01 and §§§P < 0.001 for the difference between LepRdb/db and LepRS1138 mice.

M-mode echocardiography also revealed significantly increased enddiastolic LV diameters in LepRS1138 mice (P < 0.01 vs. WT and LepRdb/db mice; Table 2; representative findings are shown in Figure 1B), suggesting that the observed (over-)activation of LepR signaling together with the inability to induce STAT3 may result in augmented hypertrophy and maladaptive cardiac remodeling. Of note, fractional shortening (FS) was not significantly altered in HFD-induced obese WT mice (P = n.s. vs. WT mice), but found to be increased in both LepRdb/db (P < 0.01 vs. WT and P < 0.001 vs. WT + HFD mice) and LepRS1138mice (P < 0.05 vs. WT and P < 0.001 vs. WT + HFD mice). Histological analyses revealed significantly reduced numbers of CD31-positive capillary endothelial cells in LepRdb/db, and to a lesser extent also in LepRS1138 mice (Figure 4A), whereas the number of TUNEL-positive apoptotic cells (Figure 4B) and the fibrotic tissue area (Figure 4C) were found to be significantly increased in hearts of both LepRS1138 and LepRdb/db mice compared to lean and diet-induced obese WT mice.

Figure 4.Histological analysis of angiogenesis, apoptosis and fibrosis in hearts of lean and obese mice.
Serial cross sections through the LV of WT, WT + HFD, LepR
S1138 and LepRdb/db mice (n = 10 per group) were immunostained and the number of (A) CD31-positive endothelial cells and (B) TUNEL-positive apoptotic cell nuclei determined. Results are expressed per cardiomyocyte and/or mm2.(C) The degree of cardiac fibrosis was quantified after Masson’s trichrome (MTC) staining. Results are expressed as % of total tissue area (at 200-fold magnification). The mean ± SEM as well as representative findings are shown. **P < 0.01 and ***P < 0.001 vs. WT; #P < 0.05, ##P < 0.01 and ###P < 0.001 vs. WT + HFD mice.

Figure 4.Histological analysis  (unable to post)

To examine the specificity of leptin’s hypertrophic action in obesity, the cardiac response of young, i.e. 2 months-old WT (n = 12; body weight, 22 ± 0.9 g), LepRS1138 (n = 9; 34 ± 1.1 g, P < 0.001 vs. WT) and LepRdb/db mice (n = 7; 40 ± 1.3 g; P < 0.001 vs. WT and P < 0.01 vs. LepRS1138) to chronic isoprenaline infusion (20 mg/kg BW per day) was examined. Under basal conditions, similar findings as those in 7 months-old mice were observed, i.e. LepRS1138 mice exhibited an increased heart weight (P < 0.05 vs. LepRdb/db; Figure 5A), LV mass (P < 0.01 vs. WT; Figure 5B) and mean WTh (P < 0.05 vs. WT; Figure 5C), whereas other changes, such as differences in fractional shortening (Figure 5D), ESD (Figure 5E) and EDD (Figure 5F) were not (yet) detected. On the other hand, all mouse groups responded to chronic β-adrenergic stimulation with significant cardiac hypertrophy, and no differences (with the exception of heart weight; Figure 5A) were observed between LepRS1138 and LepRdb/db mice. Representative M-mode echocardiography tracings are shown in Figure 6 and summarized in Additional file 2: Table S2.

1479-5876-11-170-5  F5 Echocardiography findings

Figure 5.Echocardiography findings in young lean and obese mice before and after chronic β-adrenergic stimulation.
Isoprenaline-filled osmotic minipumps were subcutaneously implanted into 2 months-old WT (n = 12), LepR
S1138 (n = 9) and LepRdb/db (n = 7) mice to examine the cardiac response to a hypertrophic stimulus other than leptin. Echocardiography (A-F) was performed immediately before (open bars) as well as at the time of tissue harvest 14 days later (dotted bars). *P < 0.05, *P < 0.01 and ***P < 0.001 for differences vs. WT mice; §P < 0.05 for differences between LepRdb/db and LepRS1138 mice. Significance levels for differences before and after isoprenaline stimulation (as determined using Student’s t test for paired means) are indicated within the graph.

???????

Figure 6.Representative M-mode echocardiography recordings.

Additional file 2: Table S2. Echocardiographic parameter in 2 months-old mice before and 14 days after isoprenaline infusion.

Format: DOCX Size: 22KB

Discussion

The adipocytokine leptin may link obesity with cardiac hypertrophy, an important risk factor for the development of heart failure. Studies in humans [2,3] and rodents [10,11] have shown that obesity is associated with LV hypertrophy, and body mass index was identified as a strong and independent predictor of LV mass [2,3]. Importantly, cardiac hypertrophy is also observed in normotensive obese subjects [6], and plasma leptin levels are associated with increased myocardial wall thickness independent of BW or blood pressure elevations [5], suggesting a causal role for leptin in the pathogenesis of cardiac hypertrophy.

Although the major source of leptin is adipose tissue, cardiomyocytes are also capable of synthesizing leptin [27], and increased cardiac leptin levels have been reported in mice or rats following coronary ligation [13,18] or in patients with heart failure [28]. In this study, elevated circulating as well as cardiac leptin levels were detected in both diet-induced and genetically obese mice, which may have acted on cardiomyocytes as well as other, non-cardiomyocyte cells expressing leptin receptors [29]. Although leptin serum levels were higher than in previous publications [30], we explain this findings with the higher age of the mice, a factor previously found to be associated with increased circulating leptin levels [31]. Leptin has been shown to stimulate the hypertrophy of cardiomyocytes isolated from rats [7,20] or humans [8,19]. Moreover, chronic leptin infusion increased cardiac ANP expression after myocardial infarction (MI) in mice [32], whereas neutralizing LepR antibodies abrogated the hypertrophy of the surviving myocardium after coronary artery ligation in rats [33]. On the other hand and as confirmed in our analysis, cardiac hypertrophy also develops in leptin- and LepR-deficient mice and may be reversed by leptin substitution[12]. Caloric restriction experiments suggested that the anti-hypertrophic effects of leptin had occurred in addition to weight loss [12], which itself may preserve heart function and attenuate LV remodeling [34]. Thus, it is unclear whether the cardiac hypertrophy in obesity is the consequence of pro-hypertrophic effects of the adipokine or rather the result of a resistance towards leptin’s preventive effects on hypertrophic cardiac remodeling. Of note, since body weight is markedly elevated in the diet-induced and particularly, the genetically obese mice, the heart-to-body weight ratio decreases, even though the absolute heart weight is increased (but to a relatively lesser extent).

Obesity is associated with elevated circulating leptin levels and hypothalamic resistance to the weight-reducing effects of the adipokine, whereas the existence of a peripheral (e.g. cardiac) leptin resistance is controversial. For example, reduced cardiac LepR expression has been reported in HFD-fed rats[14], whereas others demonstrated unaltered cardiac STAT3 phosphorylation in diet-induced obese rodents following acute leptin administration [1517]. Our findings also suggest that hearts from diet-induced obese mice continue to respond to leptin in the presence of chronically elevated leptin levels and that the observed elevation of serum and cardiac leptin may thus contribute to the development of cardiac hypertrophy in obesity. For example, hearts of hyperleptinemic obese WT mice (i.e. those with intact leptin receptors) exhibited signs of activated leptin signaling, including elevated levels of phosphorylated LepR and STAT3, while they were unchanged or reduced in mice with mutated or truncated forms of LepR (i.e. LepRS1138 or LepRdb/db mice). Moreover, both lean and obese WT mice responded to a single leptin injection with increased cardiac STAT3 phosphorylation. Of note, we could not spatially dissect the cardiac responsiveness to leptin, since whole heart homogenates were examined. Possible explanations underlying the discrepancy between the present and some previous studies include the animal species, as the absence of a response to leptin in obesity has been so far primarily observed in rats[14]. In addition, age, sex and feeding status of the animals or the time of recombinant leptin administration may have influenced the results. Of note, previous studies in humans have reported the existence of individuals (up to 40%) exhibiting a blunted response to leptin [35], although it is unknown, whether such phenomenon also occurs in rodents.

Interestingly, hearts from LepRS1138 mice exhibited a marked overactivation of STAT3-independent leptin signaling pathways, including Jak2, Src kinase, Akt or p38 MAPK, i.e. factors previously shown to mediate the pro-hypertrophic effects of the adipokine in cardiomyocytes [19,20]. Importantly, overactivation of leptin signaling in hearts of LepRS1138 mice was accompanied by a pronounced cardiac hypertrophy, both at the organ and the single cardiomyocyte level, despite similar adiposity. Although leptin levels were found to be lower in LepRS1138compared to LepRdb/db mice, as previously reported [23], leptin continues to be able to activate LepR signal transduction in these mice, for example via LepR-Tyr985. Similar echocardiographical findings were obtained in young (i.e. 2 months-old) and older (i.e. 7 months-old) mice, arguing against the development of cardiac hypertrophy secondary to hemodynamic or other metabolic changes associated with obesity, although we cannot exclude the possible contribution of a more pronounced hyperinsulinemia [23] to the development of cardiac hypertrophy in LepRS1138 mice. On the other hand, hypertension had not been observed in ob/ob mice [12], and heart weight increase and concentric LV hypertrophy in obese mice and humans also occurs without systolic and diastolic blood pressure elevations [5,6,36].

Although a predominant cardiac expression of the short (i.e. without STAT3 binding site) over the long LepR isoform has been reported [7,29], previous studies have shown that stimulation of neonatal rat cardiomyocytes with leptin increased STAT3 phosphorylation, nuclear translocation and DNA binding activity [32]. Also, cardiac STAT3 activation after MI was blunted in leptin-deficient mice [13]. The observation that increased cardiac STAT3 phosphorylation in hyperleptinemic, diet-induced obese mice was reduced or almost completely abolished in LepRS1138 or LepRdb/db mice suggests that cardiac STAT3 activation in obesity largely occurs downstream of elevated leptin levels and that other cytokines, also elevated in obesity and known to signal via Jak2-STAT3, may be of minor importance. On the other hand, the importance of leptin-mediated STAT3 activation in the heart and its contribution to cardioprotective signaling pathways in vivo have not been directly examined so far.

STAT3 has been implicated in cardioprotection after various injuries. For example, cardiomyocyte-specific STAT3 deletion results in dilatative cardiomyopathy, characterized by increased apoptosis and interstitial fibrosis as well as reduced myocardial capillary density [21,22]. Previous studies suggested that leptin may exert beneficial effects on the heart. For example, administration of leptin was associated with smaller infarct size after ischemia/reperfusion injury [37], whereas ischemic postconditioning failed to induce cardioprotection in mice lacking leptin or its receptor [38]. Also, leptin deficiency was associated with a worsened cardiac function and survival after coronary artery ligation, which could be improved by leptin repletion [13]. Regarding possible mechanisms, increased cardiac myocyte apoptosis was observed in hearts from leptin (receptor)-deficient mice [39,40]. Similar findings were obtained in vitro, showing that leptin protects cardiomyocytes against apoptotic cell death induced by serum starvation [41]. Our analyses also revealed significantly elevated numbers of apoptotic cells in hearts of obese LepRS1138 and LepRdb/dbmice, consistent with a reduced activation of STAT3-responsive anti-apoptotic genes [40]. Although findings in mice with systemic defects in leptin signal transduction may have been confounded by the concomitant presence of obesity and associated metabolic and inflammatory alterations, adverse cardiac remodeling after MI [42] or lethal heart failure [43] were recently reported in mice with cardiomyocyte-specific LepR deletion. On the other hand, the beneficial effects of leptin-mediated STAT3 activation may not be restricted to cardiomyocytes. For example, we and others have shown that leptin promotes the angiogenic properties of endothelial (progenitor) cells [25,44], and cardiac angiogenesis was reduced in LepRS1138 and LepRdb/db mice. In addition, hearts of obese LepRS1138 and LepRdb/db mice exhibited increased interstitial fibrosis, which may have occurred secondary to increased cardiomyocyte loss, although previous studies have shown that leptin may also directly influence myocardial matrix metabolism [45]. On the functional level, the enhanced activation of pro-hypertrophic signaling pathways in the absence of STAT3-mediated cardioprotection may have contributed to the echocardiographic finding of LV cavity dilation in LepRS1138 compared to LepRdb/db mice.

Conclusions

Taken together, our findings suggest that hearts from diet-induced obese mice continue to respond to chronically elevated leptin levels and that increased systemic and/or local leptin and enhanced cardiac LepR activation contribute the development of cardiac hypertrophy. On the other hand, chronic overactivation of hypertrophic signaling mediators together with an inabilitity to activate STAT3-dependent cardioprotective pathways may promote maladaptive cardiac remodeling. Of note, our findings also indicate that leptin signaling is not a prerequisite to develop cardiac hypertrophy in obesity and that additional pathways also contribute to the increase in LV mass associated with higher body weight.

References

  1. Considine RV, Sinha MK, Heiman ML, Kriauciunas A, Stephens TW, Nyce MR, Ohannesian JP, Marco CC, McKee LJ, Bauer TL: Serum immunoreactive-leptin concentrations in normal-weight and obese humans.

    N Engl J Med 1996, 334:292-295. PubMed Abstract | Publisher Full Text OpenURL

  2. Gottdiener JS, Reda DJ, Materson BJ, Massie BM, Notargiacomo A, Hamburger RJ, Williams DW, Henderson WG: Importance of obesity, race and age to the cardiac structural and functional effects of hypertension. The department of veterans affairs cooperative study group on antihypertensive agents.

    J Am Coll Cardiol 1994, 24:1492-1498. PubMed Abstract |Publisher Full Text OpenURL

  3. Lauer MS, Anderson KM, Kannel WB, Levy D: The impact of obesity on left ventricular mass and geometry. The framingham heart study.

    JAMA 1991, 266:231-236. PubMed Abstract | Publisher Full Text OpenURL

  4. Kenchaiah S, Evans JC, Levy D, Wilson PW, Benjamin EJ, Larson MG, Kannel WB, Vasan RS: Obesity and the risk of heart failure.

    N Engl J Med 2002, 347:305-313. PubMed Abstract | Publisher Full Text OpenURL

  5. Paolisso G, Tagliamonte MR, Galderisi M, Zito GA, Petrocelli A, Carella C, de Divitiis O, Varricchio M: Plasma leptin level is associated with myocardial wall thickness in hypertensive insulin-resistant men.

    Hypertension 1999, 34:1047-1052. PubMed Abstract |Publisher Full Text OpenURL

  6. Perego L, Pizzocri P, Corradi D, Maisano F, Paganelli M, Fiorina P, Barbieri M, Morabito A, Paolisso G, Folli F, Pontiroli AE: Circulating leptin correlates with left ventricular mass in morbid (grade III) obesity before and after weight loss induced by bariatric surgery: a potential role for leptin in mediating human left ventricular hypertrophy.

    J Clin Endocrinol Metab 2005, 90:4087-4093. PubMed Abstract |Publisher Full Text OpenURL

  7. Rajapurohitam V, Gan XT, Kirshenbaum LA, Karmazyn M: The obesity-associated peptide leptin induces hypertrophy in neonatal rat ventricular myocytes.

    Circ Res 2003, 93:277-279. PubMed Abstract | Publisher Full Text OpenURL

  8. Madani S, De Girolamo S, Munoz DM, Li RK, Sweeney G: Direct effects of leptin on size and extracellular matrix components of human pediatric ventricular myocytes.

    Cardiovasc Res 2006, 69:716-725. PubMed Abstract | Publisher Full Text

 

Read Full Post »


Topical Bovine Thrombin Induces Vascular Cell Proliferation

Demet Sağ, Kamran Baig*, Steven Hanish*, Jeffrey Lawson

 

 

 

Running Foot:

Use of bovine thrombin induces the cell proliferation at anastomosis

Department of Surgery

Duke University Medical Center

Durham, NC 27710

United States of America

* Equally worked

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Box 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu

demet.sag@gmail.com

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Abstract:

Specific Aim:  The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.

Methods and Results:  Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery.    Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting.  Expression of PAR  (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR.  All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin.  These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK.  Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.

Conclusion:  Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.

Abbreviations: ERK, extracellular regulated kinase; ES, embryonic stem cells; JIP, JNK-interacting protein; JNK, c-Jun NH2-terminal kinase; JNKK, JNK kinase; JNKBP, JNK binding protein; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MEK, MAPK/ERK kinase; MEKK, MEK kinase; MKK, MAPK kinase.

Keywords: Hemostatics, Signal transduction; Thrombin, PTGF

————————————————————————————————————

Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4].  It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI  during various surgical procedures.  Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6].  Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].

Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin.  It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9].  Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10].  Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.

Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs.  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].

Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself.  There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs)   [24-27].

Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33].  To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure.  We had tested the impact of topical bovine thrombin affect at the anastomosis.

Materials and Methods:

Surgical Procedure:  We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency.  Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine.  Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days.  In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used.   Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.

Ki67 Immunostaining:  The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks.  The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0).  The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum.  The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast.  As a result, positive tissues became brown and negatives were red.

MAPKs Immunostaining:  The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody.  The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.

Immunoblotting:  Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h.  Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS.  The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).

RNA isolation and RT-PCR: The harvested vessels were kept in RNAlater (Ambion, Austin, TX).   The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.

The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler.  The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse); PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT  3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).

CTGF and Cyr61:  The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers.  For CTGF the primers were  forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.

RESULTS:

First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin.   Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs.   We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment.    These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr  treatment with BT.  This data  the hypothesis for the function of PAR receptors in vascular tissues that  they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.

 

TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:

Next question was to make linear correlation between the expressions of PARs  to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues.   Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes.  Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared.  If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min.  Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli.  The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls.    Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.

Proliferation of the tissue depends on pERK

PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen.   Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured.   As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.

First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues).  We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins.  The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls.  This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.

The next target was JNK that plays a role in the inflammation, stress, and differentiation.    In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application.  This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients.   The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots.  Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.

Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues.  The expression of p38 was higher than JNK but much lower than ERK.  Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.

In general, all MAPKs showed increased in their phosphorylation level.  The level of activated MAPK expression was increased 200% in the tested animal.  The order of expression from high to low would be  ERK, JNK, and p38.

The genetic expression change

The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement.   Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection.  The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment.  Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.

DISCUSSION:

The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access  that leads to the cell proliferation and inflammation  through MAPKs  as well as  downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.

From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues.  We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding.  This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.

It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions.  In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent.   Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.

The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used.  The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle.  In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase.  During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.

Next, level of evidence was the signaling pathway analysis from membrane to the nucleus.  As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK,  pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel.  Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK).  The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation.  In our data we had detected the elvation of ERK more than the other MAPKs.   In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.

Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis.  The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.  

Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered  thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.

 

 

 

 

 

 

 

REFERENCES:

1.         Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.

2.         Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.

3.         TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.

4.         Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.

5.         Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.

6.         Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.

7.         Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.

8.         Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.

9.         Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.

10.       Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.

11.       Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.

12.       Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.

13.       Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.

14.       Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.

15.       Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.

16.       Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.

17.       Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.

18.       Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.

19.       Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.

20.       Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.

21.       Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.

22.       Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.

23.       Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.

24.       Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.

25.       Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.

26.       Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.

27.       Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.

28.       Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.

29.       Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.

30.       Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.

31.       Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.

32.       Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.

33.       McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.

34.       Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.

35.       Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.

36.       Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.

37.       Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.

38.       Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.

39.       Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.

40.       Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.

41.       Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.

Figure Legends:

Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR.        PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr

Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation

Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues

Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues

Figure 5: The activity of p38. (A) Immunostaining of total and activated p38.  Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues

Figure 6: The Expression of CTGF and Cyr61 after Thrombin Treatment. (A)CTGF            (B) Cyr61 expressions of treated and un-treated with TBT veins at 24h and 7 days.Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment

Read Full Post »


Author: Ziv Raviv PhD

 

Part A: Introduction to the PI3K/Akt pathway

Background

Akt/Protein kinase B (PKB) is a cytosolic serine/threonine kinase that promotes cell survival by inactivation of targets of the apoptotic pathways [1], and is implicated in the execution of many other cellular processes including:  cell proliferation, angiogenesis, glucose metabolism [2], protein translation, and gene transcription, all are mediated by extracellular and intracellular signals. In many cancers Akt is overexpressed and has central role in cancer progression and cancer cell survival [3,4], what makes it an attractive target for cancer therapy.

The Akt signaling pathway

Upstream signaling:

The Akt signaling pathway is initiated by growth factors leading to the recruiting and activation of phosphoinositol-3-kinase (PI3K) on receptor tyrosine kinases (RTKs). PI3K is then translocated to the cell membrane where it phosphorylates inositol ring at the D3 position of phosphatidylinositol  to form phosphatidylinositol (3,4,5)-triphosphate (PIP3). PIP3 serves to anchor Akt to the plasma membrane where it is phosphorylated at Thr308 by PDK1 and is further completely activated by mTOR by phosphorylation of Ser473. In certain circumstances activated Ras can also activate PI3K.

Downstream signaling:

Upon activation Akt is transducing its signals to downstream substrates to induce various intracellular processes, among them are: Activation of mTOR and its downstream effector S6K – to facilitate activation of translation; Phosphorylation of Bad – that inhibits apoptosis ; Phosphorylation of the tumor suppressor gene FOXO1 – inducing its ubiquitination and subsequent degradation by the proteasome;  Inhibition by phosphorylation of glycogen synthase kinase 3 (GSK-3) – which results in increase of glycogen synthesis.   Regulation of cell growth and survival is executed also by blocking apoptosis by Akt-associated survivin (BRC5) upregulation and via the NF-κB pathway by activation of IκB kinase (IKK).

  • Watch a Video on Akt Signaling Pathway

Figure 1: The Akt signaling pathway

AKT_cClick on image to enlarge

Taken from: Targeting the PI3K-AKT-mTOR pathway: progress, pitfalls, and promises. Workman P et al. Curr Opin Pharmacol. 2008 Aug;8(4):393-412

Negative regulation:

PI3K-dependent Akt activation is negatively regulated by the tumor suppressor protein PTEN, which works essentially opposite to PI3K, namely,  PTEN acts as a phosphatase and dephosphorylates PIP3 back to PIP2. This step removes Akt from its membrane anchoring through PIP3 resulting in substantial decreased rate of Akt activation and consequently inactivation of Akt-depended downstream pathways. In addition, PIP3 can also be dephosphorylated by the SHIP family of inositol phosphatases form PIP2.

Involvement of Akt  in cancer

The PI3K/Akt pathway is frequently altered and deregulated in many human malignancies. Hyper-activation of AKT kinases is one of the most common molecular findings in human malignancies and account for malignant transformation. Mechanisms for Akt pathway activation include loss of tumor suppressor PTEN function, amplification or mutation of PI3K, amplification or mutation of Akt, activation of growth factor receptors, inactivation of the translation repressor protein 4E-BP1 [5], and exposure to carcinogens [3 ,4]. For instance, heterozygous deletion of PTEN in mice elicits spontaneous tumors attributed mainly to activation of Akt. In addition, the production PIP3 by PI3K is over-activated in a wide range of tumor types. On the other hand, Akt knockout mice demonstrate that Akt is required for both cancer cell survival and oncogenic transformation. That activation of Akt is oncogenic, could be explained by preventing normal apoptosis of cells, thereby enabling accumulation of more oncogenic mutations in these cells. In addition, activation of Akt can also abrogate cell cycle checkpoints and can overcome G2/M cell-cycle arrest mediated by DNA mismatch repair. Thus, cells in which Akt is activated can accumulate mutations because the G2 cell-cycle point is abrogated and survive and continue to divide because of the anti-apoptotic activity of Akt. It is, therefore, proposed that this dual activity of Akt activation may explain the frequent activation of Akt in human malignancies [6].

Taken together, Akt activation has an effective role in cancer and through its downstream substrates Akt controls many cancer related cellular processes such as cell metabolism, growth and survival, proliferation, and motility, all of which contribute to tumor initiation and progression. Therefore, this pathway is an attractive therapeutic target for cancer treatment because it serves as a convergence point for many growth stimuli. Moreover, activation of the PI3/Akt pathway confers resistance to many chemotherapeutic drags [6], and is a poor prognostic factor for many types of cancers. Therefore, small molecule agents that block PI3K/Akt signaling might block many aspects of the tumor-cell phenotype [7,8]. Indeed, the Akt pathway is a major target for anticancer drug development by pharmaceutical companies.

  • The below Part B review the efforts to develop targeted Akt therapies for cancer.

 

Part B: Clinically available/in clinical development PI3K/Akt/mTOR inhibitors 

As described in Part Athe PI3/Akt cascade is a major intracellular signaling route conferring pro-survival signals to the cell. In cancer, there are many conditions where the PI3K/Akt pathway is deregulated, an attribute that is contributing to cancer formation and propagation. Given that Akt servers as convergence point to many pro-survival signals together with it being deregulated frequently in cancers, make Akt as a valuable target for developing anti-cancer therapy.

In addition, Akt shortens patient survival by allowing cancer cells to escape the cytotoxic effects of standard chemotherapy drugs. The importance of the Akt pathway in cancer thus is also evident from its significant role in the resistance of tumors to chemotherapies. A considerable route in developing anti- Akt based therapies is thus combining Akt inhibitors with standard chemotherapy rather than the using of Akt inhibitors as single agents.

Even in targeted therapies for cancer, such those that target receptor tyrosine kinases (RTKs) and other signaling pathways, it has been demonstrated that when applying a targeted agent such as trastuzumab  (Herceptin) a compensation reaction of increasing of downstream and parallel signaling pathways components, among them Akt, occurs in response, which enables cancer cells to be spared the effects of these targeted drugs. Therefore a multi-targeting approach with selective inhibitors would be useful, and inhibiting Akt directly will restore sensitivity to agents such as trastuzumab.

(i) Inhibitors that are in clinical use

Temsirolimus (CCI-779; marked as Torisel by Pfizer), an analog of sirolimus (rapamycin), is an immunophilin-binding antibiotic that blocks the initiation of the translation of mRNA by inhibiting mammalian target of rapamycin (mTOR) in a highly specific manner. Rapamycin itself is toxic and found in the clinic however as an immunosuppressant to prevent rejection in organ transplantation. Temsirolimus acts by interacting with mTOR, preventing the phosphorylation of eIF4E-BP1 and p70S6K, and thereby inhibiting the initiation of the translation of mRNA. The main mechanism of temsirolimus is inhibition of proliferation by G1 phase arrest induction, yet without inducing apoptosis. Temsirolimus was introduced only recently to treat renal cell carcinoma (RCC). In this cancer type HIF-1a levels are accumulated since its degradation is reduced significantly due to mutations of von Hippel Lindau tumor-suppressor gene and the activation of mTOR only worsen that accumulation of HIF1-a, which is its downstream effector. Therefore by blocking mTOR function temsirolimus is reducing the accumulation of HIF-1a. Temsirolimus has been generally well tolerated by advanced RCC patients that could be attributed to its high specificity toward mTOR. However, temsirolimus is associated with a small, but significant increased risk of developing a fatal adverse event. Nevertheless, temsirolimus benefit the overall patient population with the approved indications, including RCC. In the pivotal phase III study, temsirolimus demonstrated median overall survival (OS) in previously untreated patients of 10.9 months in patients with advanced RCC with poor prognostic risk, compared with 7.3 months for interferon-alpha. Temsirolimus remains the only treatment that shows a significant improvement in OSin treatment-naive, poor-risk patients with advanced RCC. Temsirolimus approved cancer indications are RCC and mantle cell lymphoma (MCL), and many other cancer conditions are found in advanced clinical development processes, including various solid tumors, diffused tumors (leukemias and lymphomas), and even in soft tissue sarcomas (STS).

Everolimus (RAD001; marketed by Novartis  as Afinitor) is an ester derivative of rapamycin and is also an inhibitor mTOR.  The drug inhibits oncogenic signaling in tumor cells and angiogenic signaling in vascular endothelial cells. Key features of everolimus include good tolerability, unique mechanism of action, G1 arrest, and induction of apoptosis. In vitro studies have demonstrated a cooperative effect between everolimus and gefitinib in various cancer cell lines. Treatment of human cancer cell lines with everolimus results in a decrease in p-4E-BP1, p-p70S6K, and p-S6 levels while increasing p-AKT levels. The rise of p-AKT is accompanied with a parallel increase in downstream p-GSK-3a/ß, suggesting feedback activation of the AKT pathway. Thus AKT activation could revert the antitumor activity of everolimus. Gefitinib completely prevents everolimus-induced p-AKT increase and markedly enhances the everolimus mediated decrease in p-4E-BP1 and p-p70S6K.

Everolimus is approved for the treatment of RCC, progressive pancreatic neuroendocrine tumors, breast cancer in post-menopausal women with advanced hormone receptor (HR)-positive/HER2-negative. In addition the drug is used as a preventive drug of organ rejection after renal transplantation. As with the case of temsirolimus, everolimus has also a slight increase of mortality risk over other drugs.

Cancer indications that are now in clinical development for treatment by everolimus, some of which are in advanced clinical studies, include various forms of leukemias and lymphomas such as AML, ALL CML, T-cell leukemia, diffuse large B-cell lymphoma (DLBCL), non-Hodgkin’s lymphoma (NHL), and MCL. Everolimus is particularly applicable to the treatment of leukemia because mTOR-related messengers, particularly PI3K, AKT, p70S6K kinase and 4E-BP1, are known to be both constitutively activated in hematologic malignancies and interfere with the activity of current anti-leukemia therapy. Solid tumors such as lung, breast, prostate, and colorectal at various stages, as well as brain cancers and STS are also in developmental stages for everolimus treatment.

(ii) Inhibitors that are in advanced clinical development (phase II/III)

Perifosine (KRX-0401) by AEterna Zentaris – among Akt inhibitors under development for cancer therapy, perifosine is found in advanced stages of clinical development and is moving toward phase III clinical trials. It belongs to alkylphosphocholines (ALP) – phospholipid-like molecules – which disrupt lipid-mediated signal transduction pathways that are necessary for tumor cell growth and survival. ALP induce apoptotic cell death in a variety of tumor cell lines. Perifosine primarily acts on the cell membrane where it inhibits signaling that could explain its capability to inhibit Akt, as Akt interaction with PIP3 in the cytosolic face of the plasma cell membrane is essential to its activation. In addition to Akt, perifosine inhibits also JNK and NF-kB, both are also associated with apoptosis, cell growth, differentiation, and survival. In addition to its potential efficacy as a single agent, perifosine may provide synergistic effects when combined with established cancer treatments such as radiotherapy, chemotherapy, tyrosine kinase inhibitors such as commercially available EGFR inhibitors, and endocrine therapies.

Many clinical trials were/are conducted with perifosine in various cancer conditions and settings. Especially successive phase II studies engaged perifosine were with colorectal cancer (CRC), where patients with metastatic disease treated with the combination of capecitabine and perifosine had more than doubled the median time to progression (TTP) of the disease, which led to an ongoing phase III study. Other solid cancer indications phase II studies employing perifosine that had encouraging results include metastatic RCC (mRCC) and non-small lung cancer (NSLC). Perifosine is also exmined in clinical trials with hematological cancers. Advanced stages clinical studies were conducted in multiple myeloma (MM), where patients treated with the combination of perifosine + bortezomib (proteasome inhibitor) and dexamethasone, in which after, a phase III study was conducted on that basis. However, that phase III study was terminated in March 2013 upon recommendation by data safety monitoring board to discontinue the experiment since it was highly unlikely that the trial would achieve a significant difference in progression-free survival (PFS).  Another potential benefit for perifosine has been documented in Waldenström’s macroglobulinemia (WM).  In addition, perifosine is examined in other hematologic cancers such as in AML, CLL and lymphomas.

MK-2206 – MK-2206 by Merck is an allosteric inhibitor of Akt that is currently widely examined in tens of clinical experimentation where some of them are in phase II status.  In preclinical experiments, MK-2206, demonstrated synergistic activity when combined with other targeted therapies, such as erlotinib in NSCLC cell lines, and lapatinib in breast cancer cell lines and in xenograft mice bearing ovarian cancer, MK-2206 treatment led to substantial growth inhibition and sustained inhibition of Akt.

Several phase II research studies employing MK-2206 are in progress, among them found a multicenter study with advanced ovarian cancer resistant to platinum therapy, and another multicenter study with breast cancer patients. Phase I/II study is conducted also for CLL patients. Many others phase I studies are in progress, among them trails testing the combinations of MK-2206 with other targeted drugs as well as chemotherapy. For instance an ongoing phase I study is evaluating the addition of MK-2206 to trastuzumab in patients with solid tumors HER2 positive, or another study is conducted to evaluate MK-2206 in combination with trastuzumab and lapatinib for the treatment of HER2 positive, advanced solid tumors. MK-2206 is testing also in advanced NSCLC with the combination of gefitinib in one study and with erlotinib in another. In another relatively large phase I study, patients with advanced solid tumors were randomized to MK-2206 either given with carboplatin and paclitaxel, docetaxel, or erlotinib. Another study with patients bearing locally advanced or metastatic solid tumors or metastatic breast cancer examined MK-2206 given with and paclitaxel (Taxol). Finally MK-2206 and selumetinib administration was tested in phase I studies in patients with advanced CRC. Other cancer indications that are investigated MK-2206 as single agent or in combination with chemotherapy in phase I studies include prostate cancer,  head and neck cancer, large B cell lymphoma, leukemias such as AML, and melanoma.

Ridaforolimus (AP23573/MK-8669,; Taltorvic by Merck) – Ridaforolimus is an oral mTOR inhibitor found in several clinical trials. A compressive phase III experiment was conducted with ridaforolimus in metastatic STS and metastatic bone sarcomas (SUCCEED – Sarcoma Multi-Center Clinical Evaluation of the Efficacy of Ridaforolimus) by Merck and Ariad Pharmaceuticals that had presented positive data at the beginning showing that patients that have received ridaforolimus had a median progression-free survival (PFC) – the primary endpoint of the study – of 17.7 weeks compared with 14.6 weeks for those received placebo. However, FDA’s oncologic drugs advisory committee (ODAC) panel (March 2012) did not approved the use of ridaforolimus as maintenance therapy for patients with metastatic soft-tissue sarcoma or bone sarcoma. The committee did not think that a significant difference was observed between the groups in terms of OS and although patients did experience a longer disease-free period before their cancer returned when receiving ridaforolimus, the delay was not significant. There was also a concern regarding side effects. In a complete response letter, (June 2012) the FDA did not approve the SUCCEED application in its present form, therefore, Merck formally withdrawn the marketing authorization application for ridaforolimus for sarcoma. However, Merck still continue experimenting ridaforolimus in other cancer indications. A phase II study is conducted in breast cancer patients examining ridaforolimus alone, ridaforolimus + dalotuzumab, or ridaforolimus + Exemestane. Another phase II study is conducted in female adult patients harboring recurrent or persistent endometrial cancer. A third Phase II study is examining ridaforolimus in patients with taxane-resistant androgen-independent prostate cancer. Many phase I experiments are conducted with ridaforolimus among them: experiment in pediatric patients with solid tumors treated with dalotuzumab given alone or in combination with ridaforolimus; Bicalutamide and ridaforolimus in men with prostate cancer; Combinations of carboplatin/paclitaxel/ridaforolimus in endometrial and ovarian tumors; Safety study examining ridaforolimus  in patients with progressive or recurrent glioma, and others. Given the consequences as with the SUCCEED experiment; it remains to see whether ridaforolimus alone or in combinations would be approved and be valid in the clinical arena.

RX-0201 (Archexin) by Rexahn Pharmaceuticals is an antisense oligonucleotide directed toward Akt1 mRNA. RX-0201 was demonstrated to significantly downregulated the expression of AKT1 at both the mRNA and protein levels. In addition combined treatment of RX-0201with several cytotoxic drugs resulted in an additive growth inhibition of Caki-1 clear cell carcinoma cells. In addition, preclinical experiments demonstrated that RX-0201 given at nano-molars as a single agent induced substantial growth inhibition in various types of human cancer cells. Furthermore, in vivo studies using nude mice xenografts have resulted in significant inhibition of tumor growth and tumor formation treated with RX-0201. Therefore RX-0201 was further tested in phase I studies in patients with solid tumors. The only dose limiting toxicity (DLT) observed was Grade 3 fatigue. Phase II studies of RX-0201 were approved thus in advanced RCC. Furthermore, another phase II study was completed last year with encouraging results.  This phase II trial was conducted in metastatic pancreatic cancer, assessing the combination of RX-0201 and gemcitabine. The study enrolled 31 patients and the primary endpoint was overall survival following 4 cycles of therapy with a 6-month follow-up. The study demonstrated that treatment with RX-0201 in combination with gemcitabine resulted in a median survival of 9.1 months compared to the published survival data of 5.65 months for gemcitabine given alone. The most frequently side effects were constipation, nausea, abdominal pain, and pyrexia, regardless of relatedness.

BKM120 – by Novartis is an oral selective class-I PI3K inhibitor, induces its inhibition in an ATP-competitive manner, thereby inhibiting the production of the secondary messenger PIP3 and activation of downstream signaling pathway. BKM120 was shown to induce pro-apoptotic effects in vitro and anti-tumor activity in vivo. BKM120 is enrolled in many clinical trials at all levels for several cancer indications. Phase I experiments are performed with the following cancers: CRC in combination with panitumumab; RCC; breast cancer (HR+/HER2+); breast cancer (triple negative, recurrent); ovarian cancer; and leukemias.  Phase II trials include: endometrial cancer; metastatic NSCLC; malignant melanoma (Braf V600 mutated); prostate; and glioblastoma multiforme (GBM).

A phase III study is currently enrolled with postmenopausal breast cancer patients with HR+/HER2- (local, advanced or metastatic), examining BKM120 in combination with fulvestrant. In preliminary clinical experiments activity was observed with BKM120 in patients with breast cancer, as a single agent or in combination with letrozole, or trastuzumab. In this phase III study, postmenopausal women with HR+/HER2- breast cancer whom were treated with aromatase inhibitor (AI), and are refractory to endocrine and mTOR inhibition (mTORi) combination therapy, are randomized to receive continuous BKM120 or placebo daily, with fulvestrant. The rational for this experiment is that the use of PI3K inhibition may overcome resistance to mTORi in breast cancer by targeting the PI3K pathway upstream.  The primary endpoint of the trail is PFS and the secondary endpoint is OS. Other secondary endpoints are overall response rate and clinical benefit rate, safety, pharmacokinetics of BKM120, and patient-reported quality of life.

CAL-101 (Idelalisib) – by Gilead Sciences is an orally bio-available, small molecule inhibitor of PI3K delta proposed for the treatment hematologic malignancies. In preclinical efficacy studies, CAL-101 inhibited the PI3K pathway and decreased cellular proliferation in primary CLL and AML cells, and in a range of NHL cell lines. The delta form of PI3K is expressed primarily in blood-cell lineages, including cells that cause or mediate hematologic malignancies, inflammation, autoimmune diseases and allergies. Therefore, CAL-101 as specific inhibitor of the PI3K-delta is expected to have therapeutic effects in these diseases without inhibiting PI3K signaling that is critical to the normal function of healthy cells. A variety of studies have shown that inhibition of other PI3K forms can cause significant toxicities, particularly with respect to glucose metabolism, which is essential for normal cell activity. CAL-101 was shown to block constitutive PI3K signaling, resulting in decreased phosphorylation of Akt and other downstream effectors, an increase in PARP and caspase cleavage, and an induction of apoptosis across a broad range of immature and mature B-cell malignancies. Importantly, CAL-101 does not promote apoptosis in normal T cells or NK cells, nor does it diminish antibody-dependent cellular cytotoxicity (ADCC) but decreased activated T-cell production of various inflammatory and anti-apoptotic cytokines. These findings provide rationale for the clinical development of CAL-101 as a first-in-class targeted therapy for CLL and related B-cell proliferative disorders. Indeed several clinical trials are currently enrolled for Hodgkin’s lymphoma, NHL, and CLL. Phase III clinical trials for CLL are now recruiting patients aimed to examine CAL-101 in combination with Bendamustine and Rituximab in one study;  CAL-101 + Rituximab;  and the combinations of CAL-101 with Ofatumumab in third phase III study. Both Rituximab and Ofatumumab are monoclonal Abs for CD20, which is primarily found on the surface of B cells. In addition, another phase III study of CAL-101 in combination with Bendamustine and Rituximab for indolent NHLs is also now recruiting patients.

(iii) Other Akt pathway inhibitors in clinical development.

There are dozens of agents targeting Akt pathway that are found at preclinical and clinical development. The various inhibitors are targeting various elements of the Akt pathway including: Akt itself, PI3K, mTOR, and PDK1. Most of these agents are small molecules inhibitors, some are extracts while others are synthetic, but also include an antisense oligonucleotide (RX-0201 to Akt).

The list below describes shortly agents which currently reached phase II stage and their relevant indications:

XL-147 – sponsored by Sanofi, small molecule-pan PI3K inhibitor for breast cancer and endometrial cancer.

XL-765 – also of Sanofi, inhibitor of the activity of PI3K and mTOR, for HR+/HER2- breast cancer patients.

BN108 – by Bionovo, an aqueous extract of Anemarrhena asphodeloides, is an orally available dual inhibitor, that induces apoptotic cancer cell death by rapid inactivation of both Akt and mTOR pathways, for breast cancer.

GDC-0068 – by Genentech, is an orally available small molecule pan-Akt inhibitor, for prostate cancer.

BEZ235 – by Novartis is a dual ATP-competitive PI3K and mTOR inhibitor, prevents PI3K signaling and inhibits growth of cancer cells with activating PI3K mutations. Phase II study is recruiting patients with metastatic or unresectable malignant PEComa (perivascular epithelioid cell tumors), other phase II include endometrial cancer indications and metastatic HR+/HER2-breast cancer patients.

BAY 80-6946 – is a pan class I PI3K inhibitor by BayerPhase II for NHL, currently recruiting.

Nelfinavir  – by ViiV Healthcare is an HIV protease inhibitor found to downregulate Akt phosphorylation by inhibiting proteasomal activity and inducing the unfolded protein response (UPR). HIV-1 protease inhibitor was found induces growth arrest and apoptosis of human prostate cancer cells in vitro and in vivo in conjunction with blockade of androgen receptor, STAT3 and AKT signaling. A phase I/II trial is enrolled for patients with locally advanced CRC to test Nelfinavir in combination with chemo/radiotherapy.

Triciribine  Triciribine phosphate monohydrate (TCN-PM) is a specific AKT inhibitor used also in the basic research arena but undergo also several clinical studies. Currently a phase II sponsored by Cahaba Pharmaceuticals is recruiting, to examine triciribine with paclitaxel in patients with locally advanced breast cancer. And a phase I/II experiment of combination with carboplatin in ovarian patients is planned.

GSK2110183 – by GlaxoSmithKline  is an oral panAkt inhibitor. Phase II is recruiting subjects with solid tumors and hematologic malignancies.

(iv) Conclusive remarks

Given the broaden arsenal of agents targeting Akt that are in pre-clinical and clinical development, it is extremely important to figure out how to use them optimally and to elucidate carefully which of them have the greatest potential to proceed into advanced stages of clinical trials and to clinical approval.  One of the various considerations in developing valid Akt inhibitors for the clinic use should be choosing a relevant cancer in which Akt has a central role in its development/propagation (e.g. mRCC). Since there is cross-talk between the Akt pathway to other pathways especially by involvement of RTKs (e.g. VEGFR), there is a rational to apply Akt inhibitions in cancer indications that had good results with inhibition of RTKs where combinations of Akt with agents such as sunitinib, could results in a synergistic anti-cancer effect. The combinations of Akt inhibitors with RTKs inhibitors could also overcome the compensate reaction to agents such as Herceptin that confer resistance. It is important to introduce efficient Akt inhibitor on the background of existing anti-cancer chemotherapies where Akt inhibitors can complement these therapies by circumvent frequent resistance to these drugs. Finally, the developing of biomarkers for a validation of the efficacy of candidate Akt inhibitor to be developed in further advance clinical studies for specific cancer indications is essentially needed, to ensure that accurate efforts would be invested at the most validate Akt inhibitors. Such biomarkers could be levels of phosphorylated Akt in blood or mRNA levels to be monitored upon treatment with Akt inhibitors and the correlation to the efficacy of these inhibitors, and that is besides of their prognostic value. The status of mutations of PI3K and PTEN could also serve as a marker for the efficiency of Akt inhibitors and how to use them optimally.

 

References

1. Song G, Ouyang G, Bao S (2005) The activation of Akt/PKB signaling pathway and cell survival. J Cell Mol Med 9 (1):59-71

2. Gonzalez E, McGraw TE (2009) The Akt kinases: isoform specificity in metabolism and cancer. Cell Cycle 8 (16):2502-2508

3. Vivanco I, Sawyers CL (2002) The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2 (7):489-501

4. Altomare DA, Testa JR (2005) Perturbations of the AKT signaling pathway in human cancer. Oncogene 24 (50):7455-7464

5. She QB, Halilovic E, Ye Q, Zhen W, Shirasawa S, Sasazuki T, Solit DB, Rosen N (2010) 4E-BP1 is a key effector of the oncogenic activation of the AKT and ERK signaling pathways that integrates their function in tumors. Cancer Cell 18 (1):39-51

6. Kim D, Dan HC, Park S, Yang L, Liu Q, Kaneko S, Ning J, He L, Yang H, Sun M, Nicosia SV, Cheng JQ (2005) AKT/PKB signaling mechanisms in cancer and chemoresistance. Front Biosci 10:975-987

7. Pal SK, Reckamp K, Yu H, Figlin RA (2010) Akt inhibitors in clinical development for the treatment of cancer. Expert Opin Investig Drugs 19 (11):1355-1366

8. Hsieh AC, Truitt ML, Ruggero D (2011) Oncogenic AKTivation of translation as a therapeutic target. Br J Cancer 105 (3):329-336

9. Alexander W (2011) Inhibiting the Akt pathway in cancer treatment. P T.  April; 36(4): 225–227

10. LoPiccolo J, Blumenthal GM, Bernstein WB, Dennis PA.(2008) Targeting the PI3K/Akt/mTOR pathway: effective combinations and clinical considerations. Drug Resist Updat.  Feb-Apr;11(1-2):32-50

11. Weigelt B and Downward J (2012) Genomic Determinants of PI3K Pathway Inhibitor Response in Cancer. Front Oncol. 2012;2:109

12. Janna Elizabeth Hutz. Genetic analysis of the PI3k/AKT/mTOR signaling pathway. udini.proquest.com

Resources

New medicine Oncology KnowledgeBASE (nmOK)

ClinicalTrials.gov

Related articles on this Open Access Online Scientific Journal

AKT signaling variable effects. Reporter: Larry H Bernstein, MD

Read Full Post »

Older Posts »