Funding, Deals & Partnerships: BIOLOGICS & MEDICAL DEVICES; BioMed e-Series; Medicine and Life Sciences Scientific Journal – http://PharmaceuticalIntelligence.com
Is SARS-COV2 Hijacking the Complement and Coagulation Systems?
Reporter: Stephen J. Williams, PhD
In a recent Nature Medicine paper “Immune complement and coagulation dysfunction in adverse outcomes of SARS-CoV-2 infection” Ramlall et al. demonstrate, in a retrospective study, that a significant number of patients presenting SARS-CoV2 complications had prior incidences of macular degeneration and coagulation disorders and these previous indications are risk factors for COVID-related complications.
Abstract
Understanding the pathophysiology of SARS-CoV-2 infection is critical for therapeutic and public health strategies. Viral–host interactions can guide discovery of disease regulators, and protein structure function analysis points to several immune pathways, including complement and coagulation, as targets of coronaviruses. To determine whether conditions associated with dysregulated complement or coagulation systems impact disease, we performed a retrospective observational study and found that history of macular degeneration (a proxy for complement-activation disorders) and history of coagulation disorders (thrombocytopenia, thrombosis and hemorrhage) are risk factors for SARS-CoV-2-associated morbidity and mortality—effects that are independent of age, sex or history of smoking. Transcriptional profiling of nasopharyngeal swabs demonstrated that in addition to type-I interferon and interleukin-6-dependent inflammatory responses, infection results in robust engagement of the complement and coagulation pathways. Finally, in a candidate-driven genetic association study of severe SARS-CoV-2 disease, we identified putative complement and coagulation-associated loci including missense, eQTL and sQTL variants of critical complement and coagulation regulators. In addition to providing evidence that complement function modulates SARS-CoV-2 infection outcome, the data point to putative transcriptional genetic markers of susceptibility. The results highlight the value of using a multimodal analytical approach to reveal determinants and predictors of immunity, susceptibility and clinical outcome associated with infection.
Introduction
As part of a separate study, the authors mapped over 140 cellular proteins that are structurally mimicked by coronaviruses (CoVs) and identified complement and coagulation pathways as targets of this strategy across all CoV strains4. The complement system is a critical defense against pathogens, including viruses5 and when dysregulated (by germline variants or acquired through age-related effects or excessive tissue damage) can contribute to pathologies mediated by inflammation5,6,7.
“So, virally encoded structural mimics of complement and coagulation factors may contribute to CoV-associated immune-mediated pathology and indicate sensitivities in antiviral defenses.”
Methods and Results
Between 1 February 2020 and 25 April 2020, 11,116 patients presented to New York-Presbyterian/Columbia University Irving Medical Center with suspected SARS-CoV-2 infection, of which 6,398 tested positive
Electronic health records (EHRs) were used to define sex, age and smoking history status as well as histories of macular degeneration, coagulatory disorders (thrombocytopenia, thrombosis and hemorrhage), hypertension, type 2 diabetes (T2D), coronary artery disease (CAD) and obesity (see Methods). A Python algorithm was used to analyze all confounders.
identified 88 patients with history of macular degeneration, 4 with complement deficiency disorders and 1,179 with coagulatory disorders).
observed a 35% mortality rate among patients that were put on mechanical ventilation and that 31% of deceased patients had been on mechanical respiration.
patients with AMD (a proxy for complement activation disorders) and coagulation disorders (thrombocytopenia, thrombosis and hemorrhage) were at significantly increased risk of adverse clinical outcomes (including mechanical respiration and death) following SARS-CoV-2 infection
650 NP swabs from control and SARS-CoV-2-infected patients who presented to Weill-Cornell Medical Center were evaluated by RNA-Seq. Gene set enrichment analysis (GSEA) of Hallmark gene sets found that SARS-CoV-2 infection (as defined by presence of SARS-CoV-2 RNA and stratified into ‘positive’, ‘low’, ‘medium’ or ‘high’ based on viral load; induces genes related to pathways with known immune modulatory functions (Fig. 2a). Moreover, among the most enriched gene sets, SARS-CoV-2 infection induces robust activation of the complement cascade (false discovery rate (FDR) P < 0.001), with increasing enrichment and significance with viral load (FDR P < 0.0001).
KEGG Pathway Analysis revealed KEGG_Complement_and_Coagulation_Cascades’, ‘GO_Coagulation’ and ‘Reactome_initial_triggering_of_complement’ to be significantly enriched in expression profiles of SARS-CoV-2-infected samples
conducted a candidate-driven study to evaluate whether genetic variation within a 60-Kb window around 102 genes with known roles in regulating complement or coagulation cascades (2,888 genetic variants fulfill this criteria of the 805,426 profiled in the UK Biobank) is associated with poor SARS-CoV-2 clinical outcome
identified 11 loci representing seven genes with study-wide significance. A variant of coagulation factor III (F3), variant rs72729504, was found to be associated with increased risk of adverse clinical outcome associated with SARS-CoV-2 infection. The analysis also identified that four variants previously reported to be associated with AMD (rs45574833, rs61821114, rs61821041 and rs12064775)15predispose carriers to hospitalization following SARS-CoV-2 infection
As authors state:
“Among the implications, the data warrant heightened public health awareness for the most vulnerable individuals and further investigation into an existing menu of complement and coagulation targeting therapies that were recently shown to be beneficial in a small cohort of patients with SARS-CoV-2 infection.” 26,27.
References
Ramlall, V., Thangaraj, P.M., Meydan, C. et al. Immune complement and coagulation dysfunction in adverse outcomes of SARS-CoV-2 infection. Nat Med (2020). https://doi.org/10.1038/s41591-020-1021-2
4.
Lasso, G., Honig, B. & Shapira, S. D. A sweep of earth’s virome reveals host-guided viral protein structural mimicry; with implications for human disease. Preprint at bioRxivhttps://doi.org/10.1101/2020.06.18.159467 (2020).
SUMMARY
Viruses deploy an array of genetically encoded strategies to coopt host machinery and support viral replicative cycles. Molecular mimicry, manifested by structural similarity between viral and endogenous host proteins, allow viruses to harness or disrupt cellular functions including nucleic acid metabolism and modulation of immune responses. Here, we use protein structure similarity to scan for virally encoded structure mimics across thousands of catalogued viruses and hosts spanning broad ecological niches and taxonomic range, including bacteria, plants and fungi, invertebrates and vertebrates. Our survey identified over 6,000,000 instances of structural mimicry, the vast majority of which (>70%) cannot be discerned through protein sequence. The results point to molecular mimicry as a pervasive strategy employed by viruses and indicate that the protein structure space used by a given virus is dictated by the host proteome. Interrogation of proteins mimicked by human-infecting viruses points to broad diversification of cellular pathways targeted via structural mimicry, identifies biological processes that may underly autoimmune disorders, and reveals virally encoded mimics that may be leveraged to engineer synthetic metabolic circuits or may serve as targets for therapeutics. Moreover, the manner and degree to which viruses exploit molecular mimicry varies by genome size and nucleic acid type, with ssRNA viruses circumventing limitations of their small genomes by mimicking human proteins to a greater extent than their large dsDNA counterparts. Finally, we identified over 140 cellular proteins that are mimicked by CoV, providing clues about cellular processes driving the pathogenesis of the ongoing COVID-19 pandemic.
26.
Risitano, A. M. Complement as a target in COVID-19?. Nat. Rev. Immunol.20, 343–344 (2020).
27.
Mastaglio, S. et al. The first case of COVID-19 treated with the complement C3 inhibitor AMY-101. Clin. Immunol.215, 108450 (2020).
28.
Polubriaginof, F. C. G. et al. Challenges with quality of race and ethnicity data in observational databases. J. Am. Med. Inf. Assoc.26, 730–736 (2019).
Warfarin and Dabigatran, Similarities and Differences
Author and Curator: Danut Dragoi, PhD
What anticoagulants do?
An anticoagulant helps your body control how fast your blood clots; therefore, it prevents clots from forming inside your arteries, veins or heart during certain medical conditions.
If you have a blood clot, an anticoagulant may prevent the clot from getting larger. It also may prevent a piece of the clot from breaking off and traveling to your lungs, brain or heart. The anticoagulant medication does not dissolve the blood clot. With time, however, this clot may dissolve on its own.
Blood tests you will need
The blood tests for clotting time are called prothrombin time (Protime, PT) and international normalized ratio (INR). These tests help determine if your medication is working. The tests are performed at a laboratory, usually once a week to once a month, as directed by your doctor. Your doctor will help you decide which laboratory you will go to for these tests.
The test results help the doctor decide the dose of warfarin (Coumadin) that you should take to keep a balance between clotting and bleeding.
Important things to keep in mind regarding blood tests include:
Have your INR checked when scheduled.
Go to the same laboratory each time. (There can be a difference in results between laboratories).
If you are planning a trip, talk with your doctor about using another laboratory while traveling.
Dosage
The dose of medication usually ranges from 1 mg to 10 mg once daily. The doctor will prescribe one strength and change the dose as needed (your dose may be adjusted with each INR).
The tablet is scored and breaks in half easily. For example: if your doctor prescribes a 5 mg tablet and then changes the dose to 2.5 mg (2½ mg), which is half the strength, you should break one of the 5 mg tablets in half and take the half-tablet. If you have any questions about your dose, talk with your doctor or pharmacist.
What warfarin (Coumadin) tablets look like
Warfarin is made by several different drug manufacturers and is available in many different shapes. Each color represents a different strength, measured in milligrams (mg). Each tablet has the strength imprinted on one side, and is scored so you can break it in half easily to adjust your dose as your doctor instructed.
Today, on the basis of 4 clinical trials involving over 9,000 patients, PRADAXA is approved to treat blood clots in the veins of your legs(deep vein thrombosis, or DVT) or lungs (pulmonary embolism, or PE)in patients who have been treated with blood thinner injections, and to reduce the risk of them occurring again.
In these trials, PRADAXA was compared to warfarin or to placebo (sugar pills) for the treatment of DVT and PE patients.
Warfarin (NB-which goes by the brand name Coumadin, see link in here) reduces the risk of stroke in patients with atrial fibrillation (NB- atrial fibrillation (also called AFib or AF) is a quivering or irregular heartbeat (arrhythmia) that can lead to blood clots, stroke, heart failure and other heart-related complications. Some people refer to AF as a quivering heart, see link here) but increases the risk of hemorrhage and is difficult to use.
Dabigatran is a new oral direct thrombin inhibitor (NB-direct thrombin inhibitors are a class of medication that act as anticoagulants by directly inhibiting the enzyme thrombin). Some are in clinical use, while others are undergoing clinical development), see link in here.
Some international large clinical trials, see link in here, show results for patients with atrial fibrillation, dabigatran given at a dose of 110 mg was associated with rates of stroke and systemic embolism that were similar to those associated with warfarin, as well as lower rates of major hemorrhage. Dabigatran administered at a dose of 150 mg, as compared with warfarin, was associated with lower rates of stroke and systemic embolism but similar rates of major hemorrhage.
Picture below shows a deep vein thrombosis which is a blood clot that forms inside a vein, usually deep within the leg. About half a million Americans every year get one, and up to 100,000 die because of it. The danger is that part of the clot can break off and travel through your bloodstream. It could get stuck in your lungs and block blood flow, causing organ damage or death, see link in here.
The behaviour of blood thinning drugs is dependent on their physico-chemical properties and since a significant proportion of drugs contain ionisable centers a knowledge of their pKa (NB-pKa was introduced as an index to express the acidity of weak acids, where pKa is defined as follows. For example, the Ka constant for acetic acid (CH3C00H) is 0.0000158 (= 10-4.8), but the pKa constant is 4.8, which is a simpler expression. In addition, the smaller the pKa value, the stronger the acid, see link in here ) is essential, see link in here. The pKa is defined as the negative log of the dissociation constant, see link in here:
pka=-log10(Ka) (1)
where the dissociation constant is defined thus:
Ka=[A][H+]/[AH]
Most drugs have pKa in the range 0-12, and whilst it is possible to calculate pKa it is desirable to experimentally measure the value for representative examples. There are a number of instruments that are capable of measuring pKa utilising Sirius T3 instrument, see link in here .
Table 1 below shows the pka values for warfarin, see link in here and dabigatran, see link in here.
Table 1
==========================
Anticoagulant pka
warfarin 4.99
dabigatran 4.24 11.51*
==========================
* dabigatran possess both acidic and basic functionality.
Both groups are at ionized at blood pH and exist as zwitterionic
Adding physico-chemical features of anticoagulants utilized in “dissolving” blood clots is important for better understanding the de-blocking process within the veins utilizing anticoagulants.
The Relation between Coagulation and Cancer affects Supportive Treatments
Demet Sag, PhD
Coagulation and Cancer
There are several supportive therapies for cancer patients. One of the most important one is controlling the blood intake. This is sometimes observe keeping the blood cell count at certain levels, or providing safe blood/blood products to avoid any contaminations or infections,
The relation between cancer and coagulation was known for a long time but it was becoming clear recently. Having coagulapathies also reduce the survival of patients since they can’t response to given treatments. Thus, it is necessary to give supportive therapies to control the coagulation. Problems in coagulation may develop from inherited (genetics), or acquired due to given therapies that cause varying abnormalities towards bleeding or thrombose at many levels. The thrombotic events are important since they are the second leading cause of death in cancer patients (after cancer itself). The presence of these coagulopathies determines the survival rate, length of survival either short-term or long-term, as well as relapses.
Cancer and Coagulation from start to finish:
Thrombotic risk factors in cancer patients
Patient related
Cancer related
Treatment related
.
Patient Related:
Older age
Bed rest
Obesity
Previous thrombosis
Prothrombotic mutations
High leukocyte and platelet counts
Comorbidities
Cancer related:
a. Site of cancer:
brain,
pancreas,
kidney,
stomach,
lung,
bladder,
gynecologic,
hematologic malignancies
b. Stage of cancer:
advanced stage and
initial period after diagnosis
Treatments:
Hospitalization
Surgery
Chemo- and
hormonal therapy
Anti-angiogenic therapy
Erythropoiesis stimulating agents
Blood transfusions
CVC, central venous catheters
Radiations
Thromboembolic events can be venous or arterial.
Venous events include
deep vein thrombosis (DVT),
pulmonary embolism (PE)
together categorized as venous thromboembolism (VTE).
Arterial events, include
stroke, myocardial infarction and
arterial embolism.
Increase in the rate of venous thromboembolism (VTE) over time. Results are presented as annual rates of deep venous thrombosis (DVT), pulmonary embolism (PE) without deep venous thrombosis, and both between 1995 and 2003. Significant trends for increasing rates were observed for all 3 diagnoses (P < .0001). The rate of increase was found to be greater in the subgroup of patients who received chemotherapy. Error bars represent 95% confidence intervals.
There is an increase in both venous and arterial eventsrecently with “unacceptably high” event rates documented in the most contemporary studies:
There are significant consequences to the occurrence of thromboembolism in this setting:
requirement for long-term anticoagulation,
a 12% annual risk of bleeding complications,
an up to 21% annual risk of recurrent VTEand
potential impact on chemotherapy delivery and patient quality of life.
Therapeutic interventions enhance the risk of VTE in cancer.
Cancer patients undergoing surgery have a two-fold increased risk of postoperative VTE as compared to non-cancer patients, and this elevation in risk can persist for a period up to 7 weeks
Hospitalization also substantially increases the risk of developing VTE in cancer patients (OR 2.34, 95% CI 1.63 – 3.36)
The use of systemic chemotherapy is associated with a 2-to 6-fold increased risk of VTE compared to the general population.
Anti-angiogenic agents, particularly thalidomide and lenalidomide, have been associated with high rates of VTE when given in combination with dexamethasone or chemotherapy.
Bevacizumab-containing regimens have been associated with increased risk for an arterial thromboembolic event (hazard ratio [HR] 2.0, 95% CI 1.05- 3.75) but the data for risk of VTE are conflicting
Sunitinib and sorafenib, agents targeting the angiogenesis pathway, have also similarly been associated with elevated risk for arterial (but not venous) events [RR 3.03 (95% CI, 1.25 to 7.37)]
Anticoagulants and Cancer Coagulopathies
There are many studies on coagulation and use of anti-coagulants yet the same patient may also thrombose at any given time so the coagulant therapies should be under close surveillance. The study (PMID:111278600) by Palereti et all in 2000 to many compared this issue.
fig1_10.1002_cncr.23062
Palereti et al. showed that:
“The outcome of anticoagulation courses in 95 patients with malignancy with those of 733 patients without malignancy. All patients were participants in a large, nation-wide population study and were prospectively followed from the initiation of their oral anticoagulant therapy.
Based on 744 patient-years of treatment and follow-up, the rates of major (5.4% vs 0.9%), minor (16.2% vs 3.6%) and total (21.6% vs 4.5%) bleeding were statistically significantly higher in cancer patients compared with patients without cancer.
Bleeding was also a more frequent cause of early anticoagulation withdrawal in patients with malignancy (4.2% vs. 0.7%; p <0.01; RR 6.2 (95% CI 1.95-19.4). There was a trend towards a higher rate of thrombotic complications in cancer patients (6.8% vs. 2.5%; p = 0.058; RR 2.5 [CI 0.96-6.5]) but this did not achieve statistical significance”.
They concluded that “patients with malignancy treated with oral anticoagulants have a higher rate of bleeding and possibly an increased risk of recurrent thrombosis compared with patients without malignancy.”
Cancer and Coagulation in more detail at Molecular Level:
Cancer is a complex disease from its initiation to its treatment. In the body the response to drugs generates side effects for being foreign (immune responses and inflammation), toxic, or disturbing the hemostasis of the coagulation system. In addition, activation of oncogenic pathways cab also be activated that may not only effect the development of the cancer but also may induce oncogenes to activate dormant cancer cells. In the coagulation system the balance is important to keep anti-coagulant state, with oversimplification, such as having certain number of tissue factor (TF) that is a receptor determines the anticoagulant state. However, certain pro-oncogenic genes like RAS, EGFR, HER2, MET, SHH and loss of tumor suppressors (PTEN, TP53) change the gene regulation so they alter the expression, activity and vesicular release of coagulation effectors, as exemplified by tissue factor (TF). As a result, there is a bridge between the coagulation-related genes (coagulome) and specific cancer coagulapathies, such as in glioblastoma multiforme (GBM), medulloblastoma (MB), etc. Therefore, these coagulome can be a great target not only to inhibit angiogenesis and tumor growth but also prevent any coagulopathies, use in single genomics/circulating cancer cells as well as grading the level of cancer specifically.
Tumor-hemostatic system interactions. Tumor cells activate the hemostatic system in multiple ways. Tumor cells may release procoagulant tissue factor, cancer procoagulant and microparticles (MP) that can directly activate the coagulation cascade. Tumor cells may also activate the host’s hemostatic cells (endothelial cells and platelets), by either release of soluble factors or by direct adhesive contact, thus further enhancing clotting activation.
Microparticle (MP) production and activities in cancer. Tumor cells actively release MP but also promote MP formation by platelets. Tissue factor (TF) and phosphatidylserine (PS) expression on the surfaces of both platelet- and tumor-derived MP are involved in blood clotting activation and thrombus formation. On the other hand, the elevated content of proangiogenic factors in platelet-derived MP (VEGF, vascular endothelial growth factor, FGF, fibroblast growth factor, PDGF, platelet-derived growth factor), render these elements also important mediators of the neangiogenesis process. Finally, intracellular transfer of MP may occur between cancer cells, leading to a horizontal propagation of oncogenes and amplification of their angiogenic phenotype.
Immune Response and Cancer with Coagulopathies:
I. Goufman et al also suggested that plasma level of IgG autoantibodies to plasminogen changes during cancer coagulopathies.
Their data based on ELISA measurements of their patients:
with benign prostatic hyperplasia (n=25),
prostatic cancer (n=17),
lung cancer (n=15), and
healthy volunteers (n=44).
High levels of IgG to plasminogen were found
in 2 (12%) of 17 healthy women, in 1 (3.6%) of 27 specimens in a healthy man,
in 17 (68%) of 25 specimens in prostatic cancer,
in 10 (59%) of 17 specimens in lung cancer,
in 5 (30%) of 15 specimens in benign prostatic hyperplasia.
Comparison of plasma levels of anti-plasminogen IgG by affinity chromatography showed 3-fold higher levels in patients with prostatic cancer vs. healthy men.
Structure and function of platelet receptors initiating blood clotting.
There is a missed or overlooked concept about coagulation and cancer. In their article they mainly focused on the structure and function of key platelet receptors taking role in the thorombus formation and coagulation.
At the clinical level, recent studies reveal the link between coagulation and other pathophysiological processes, including platelet activation, inflammation, cancer, the immune response, and/or infectious diseases. These links are likely to underpin the coagulopathy associated with risk factors for venous thromboembolic (VTE) and deep vein thrombosis (DVT). At the molecular level, the interactions between platelet-specific receptors and coagulation factors could help explain coagulopathy associated with aberrant platelet function, as well as revealing new approaches targeting platelet receptors in diagnosis or treatment of VTE or DVT. Glycoprotein (GP)Ibα, the major ligand-binding subunit of the platelet GPIb-IX-V complex, that binds the adhesive ligand, von Willebrand factor (VWF), is co-associated with the platelet-specific collagen receptor, GPVI. The GPIb-IX-V/GPVI adheso-signaling complex not only initiates platelet activation and aggregation (thrombus formation) in response to vascular injury or disease but GPIbα also regulates coagulation through a specific interaction with thrombin and other coagulation factors.
Clinical Data and Some Samples of Biomarkers:
Development of biomarkers and management of cancer coagulapathies are underway since there are times this coagulapathies may be as deadly as the cancer itself.
*Pancreatic cancer patients are assigned a score of 2 based on site of cancer and therefore there were no patients in the low-risk category
**included 4-weekly screening ultrasonography
***enrolled only high-risk patients
Table 4
ASCO and NCCN Recommendations for Treatment of VTE in Cancer
ASCO
NCCN
Initial treatment
LMWH is the preferred approach for the initial 5-10 days
LMWH, UFH or factor Xa antagonists according to patient’s characteristics and clinical situation
Long term treatment
LMWH for at least 6 months is preferred.
LMWH is preferred
VKA are acceptable when LMWH is not available.
Indefinite anticoagulation in patients with active cancer or persistent risk factors
Indefinite anticoagulation in patients with active cancer.
Thrombolytic therapy in initial treatment
Restricted to patients with life- or limb-threatening thrombotic events
Restricted to massive or submassive PE with moderate or severe right ventricular enlargement or dysfunction
Inferior vena cava filters
Restricted to patients with contraindications to anticoagulation or recurrent VTE despite adequate long-term LMWH
Restricted to patients with contraindications to or failure of anticoagulation, cardiac or pulmonary dysfunction severe enough to make any new PE life-threatening or multiple PE with chronic pulmonary hypertension
Treatment of catheter-related thrombosis
NA
LMWH or VKA for as long as catheter is in place or for 1 to 3 months after catheter removal
Phenotype similarity clustering of cases according to HPO terms. Heat map showing pairwise phenotypic similarity among affected members of pedigrees, cases with classical syndromes and cases with variants in ACTN1. The groups are ordered through complete-linkage hierarchical clustering within each class and P values of phenotypic similarity are shown in a scatterplot superimposed over a histogram showing the distribution of P values.
Phenotype clusters 18 and 29. Illustrative subgraphs of the HPO showing terms for the phenotype clusters 18 (15 cases) and 29 (16 cases). Arrows indicate direct (solid) or indirect (dashed) is a relations between terms in the ontology. DMPV: decreased mean platelet volume; PA: phenotypic abnormality; Plt-agg: platelet aggregation abnormality.
Westbury et al.Genome Medicine 2015 7:36 doi:10.1186/s13073-015-0151-5
Rare variants identified inMYH9and validated by Sanger sequencing
Case
Transcript variant ENST00000216181
Protein variant ENSP00000216181
HGMD variant
Classification
PLT, ×109/L
MPV, fL and/or presence of macrothrombocytes
OtherMYH9-RD characteristics
B200760
22:36744995 G/A
S96L
Yes
PV
180
Macrothrombocytes
None
B200771
22:36705438 C/A
D578Y
No
VUS
184
10.1
None
B200423
22:36696237 G/A
A971V
No
VUS
262
10.2
None
B200024
22:36691696 A/G
S1114P
Yes
VUS
164
NA
None
B200245
VUS
53
11.1, Macrothrombocytes
None
B200243
22:36691115 G/A
R1165C
Yes
PV
22
Macrothrombocytes
None
B200594
PV
46
Macrothrombocytes
None
B200595a
PV
61
Macrothrombocytes
None
B200614
22:36688151 C/T
D1409N
No
VUS
319
9.8
None
B200752
VUS
149
10.1, Macrothrombocytes
None
B200855
VUS
95
16.8, Macrothrombocytes
None
B200208
22:36688106 C/T
D1424N
Yes
PV
99
13.6
None
B200010
22:36685249 G/C
S1480W
No
VUS
244
NA
None
B200244
22:36678800 G/A
R1933X
Yes
PV
26
Macrothrombocytes
Döhle inclusions
Other MYH9-RD characteristics sought were the presence of Döhle inclusions, cataract, deafness or renal pathology.
aFather of B200594.
Westbury et al.
Westbury et al.Genome Medicine 2015 7:36 doi:10.1186/s13073-015-0151-5
Pathogenic and likely pathogenic variants identified in genes associated with autosomal recessive and X-linked recessive bleeding and platelet disorders
Case
Position
Gene
Ref
Alt
Genotype
HGMD
Effecta
Haematological HPO terms
Other HPO terms
Classification:
Variant
Phenotype
B200286
3:148881737
HPS3
G
C
C|C
Yes
Abnormal splicing
Bleeding with minor or no trauma, subcutaneous haemorrhage, menorrhagia, postpartum haemorrhage, impaired ADP-induced platelet aggregation, impaired epinephrine-induced platelet aggregation, epistaxis, prolonged bleeding after surgery, prolonged bleeding after dental extraction, increased mean platelet volume.
Impaired epinephrine-induced platelet aggregation, bleeding with minor or no trauma, subcutaneous haemorrhage, epistaxis, menorrhagia, prolonged bleeding after surgery, abnormal dense granules.
Reduced factor IX activity, impaired ADP-induced platelet aggregation, bleeding with minor or no trauma, spontaneous haematomas, abnormal number of dense granules.
PV
Partially explained
B200452
X:154124407
F8
C
G
G
Yes
S2125T
Reduced factor VIII activity, persistent bleeding after trauma, prolonged bleeding after surgery, prolonged bleeding after dental extraction, bleeding requiring red cell transfusion, impaired collagen-induced platelet aggregation, bleeding with minor or no trauma, joint haemorrhage, abnormal platelet shape, abnormal number of dense granules.
PV
Partially explained
B200772
X:154176011
F8
A
G
G
No
F692S
Reduced factor VIII activity, bruising susceptibility, impaired ADP-induced platelet aggregation, impaired collagen-induced platelet aggregation, impaired thromboxane A2 agonist-induced platelet aggregation, impaired ristocetin-induced platelet aggregation, impaired arachidonic acid-induced platelet aggregation, impaired thrombin-induced platelet aggregation, abnormal platelet granules, bleeding with minor or no trauma.
LPV
Possibly partially explained
Alt: alternative; Ref: reference.
aEffect considered relative to the Consensus Coding Sequence (CCDS) for each gene.
Westbury et al.
Westbury et al.Genome Medicine 2015 7:36 doi:10.1186/s13073-015-0151-5
Table 2
TFPI and TF tumor mRNA expression across clinicopathological breast cancer subtypes
mRNA expression (tumor)
Protein levels (plasma)
Characteristic
Groups
Total TFPI (α + β)
P
TFPIα
P
TFPIβ
P
TF
P
Total TFPI
P
Free TFPI
P
TF
P
T-status
T1
−0.146
0.054
−0.135
0.257
−0.084
0.201
−0.023
0.652
72.01
0.013
10.82
0.997
4.14
0.125
T2-T3
0.085
0.018
0.060
0.054
65.02
10.82
4.66
Grade
G1-G2
−0.022
0.850
−0.005
0.424
−0.033
0.743
0.271
0.003
71.04
0.082
10.66
0.682
4.63
0.557
G3
−0.045
−0.113
0.004
−0.229
66.12
10.97
4.14
N-status
Negative
−0.109
0.091
−0.136
0.127
−0.082
0.104
0.005
0.881
69.93
0.183
10.77
0.869
4.95
0.282
Positive
0.104
0.078
0.110
0.032
66.00
10.90
4.14
ER status
Positive
−0.067
0.317
−0.082
0.557
−0.056
0.183
0.001
0.784
69.42
0.240
10.91
0.671
4.42
0.409
PR status
Negative
0.076
0.011
0.123
0.057
65.44
10.52
5.28
Positive
−0.131
0.021
−0.145
0.075
−0.112
0.014
0.085
0.244
69.81
0.195
11.19
0.175
4.32
0.246
HER2-status
Negative
0.161
0.108
0.182
−0.127
65.92
10.08
5.04
Negative
−0.072
0.054
−0.101
0.073
−0.041
0.154
0.004
0.731
68.45
0.893
10.68
0.287
4.47
0.428
Positive
0.313
0.301
0.228
0.103
69.09
12.05
4.78
HR status
Yes
0.076
0.326
0.007
0.587
0.114
0.221
0.016
0.991
64.78
0.161
10.41
0.568
5.26
0.470
No
−0.066
−0.080
−0.052
0.014
69.57
10.94
4.47
Triple-negative status
Yes
−0.051
0.886
−0.110
0.718
0.041
0.635
−0.158
0.326
63.21
0.072
10.06
0.345
5.23
0.969
No
−0.029
−0.048
−0.027
0.055
69.73
10.99
4.57
Median values for TFPI and TF mRNA expression in tumors and protein levels in plasma according to clinically defined groups. Corresponding P-values (unadjusted) are shown. Significant P-values in bold. TFPI, tissue factor pathway inhibitor; TF, tissue factor; HER2, human epidermal growth factor receptor 2.Abbreviations: T, tumor; G, grade; N, node; ER, estrogen receptor; PR, progesterone receptor; HR, hormone receptor.
Table 3
Significant association betweenTFPIsingle nucleotide polymorphisms (SNPs) and clinicopathological characteristics and molecular subtypes
Characteristic
SNP
Risk allele
Odds ratio
95% CI
P
False discovery rate
T status
T1
Reference
Reference
Reference
Reference
T2 to T3
rs10153820
A
3.14
1.44, 6.86
0.004
0.056
TN status (ER-/PR-/HER2-negative)
No
Reference
Reference
Reference
Reference
Yes
rs8176541a
G
2.62
1.11, 5.35
0.026
0.092
rs3213739a
G
2.58
1.34, 4.99
0.005
0.033
rs8176479a
C
3.10
1.24, 7.72
0.015
0.071
rs2192824a
T
2.44
1.39, 4.93
0.002
0.033
N status
Positive
Reference
Reference
Reference
Reference
Negative
rs10179730
G
3.34
1.42, 7.89
0.006
0.083
Basal tumor subtype
Non-basal
Reference
Reference
Reference
Reference
Basal
rs3213739a
G
2.23
1.15, 4.34
0.018
0.107
rs8176479a
C
2.79
1.12, 6.96
0.028
0.107
rs2192824a
T
2.41
1.24, 4.65
0.009
0.107
rs10187622a
C
5.20
1.17, 23.20
0.031
0.107
Luminal B tumor subtype
Non-luminal B
Reference
Reference
Reference
Reference
Luminal B
rs16829086a
T
2.09
1.03, 4.25
0.041
0.191
rs10179730a
G
3.53
1.47, 8.46
0.005
0.066
rs10187622a
T
2.73
1.24, 6.03
0.013
0.091
Normal-like tumor subtype
Non-normal-like
Reference
Reference
Reference
Reference
Normal-like
rs5940
T
22.17
4.43, 110.8
0.0002
0.003
aSNPs representing a haplotype effect. SNPs are listed by ascending chromosome positions. TFPI, tissue factor pathway inhibitor; ER, estrogen receptor; PR, progesterone receptor; HER2, human epidermal growth factor 2.
Table 4
Significant correlations betweenTFPIsingle nucleotide polymorphisms (SNPs) andTFPImRNA expression in breast tumors
Probe
SNP
Region
Allelesa
Minor allele frequency
Beta
r
P
False discovery rate
TFPIα
rs2192824b
Intronic
C:T
0.490
−0.209
−0.180
0.029
0.200
TFPIα
rs7594359b
Intronic
C:T
0.483
−0.219
−0.184
0.025
0.200
TFPIβ
rs3213739b
Intronic
G:T
0.417
0.187
0.213
0.010
0.032
TFPIβ
rs8176479b
Intronic
C:A
0.238
0.184
0.192
0.021
0.049
TFPIβ
rs2192824b
Intronic
C:T
0.490
−0.267
−0.273
0.001
0.011
TFPIβ
rs12613071b
Intronic
T:C
0.158
0.284
0.208
0.011
0.032
TFPIβ
rs2192825b
Intronic
T:C
0.466
−0.251
−0.249
0.002
0.012
TFPIβ
rs7594359b
Intronic
C:T
0.483
−0.248
−0.247
0.002
0.012
TFPIα + β
rs2192824b
Intronic
C:T
0.490
−0.168
−0.161
0.050
0.187
TFPIα + β
rs12613071b
Intronic
T:C
0.158
0.238
0.164
0.048
0.187
TFPIα + β
rs7594359b
Intronic
C:T
0.483
−0.190
−0.178
0.030
0.187
aMajor:minor. bSNPs representing a haplotype effect. mRNA expression was assayed by the Agilent Human V2 Gene Expression 8x60k array, and probes for tissue factor pathway inhibitor (TFPI)α, TFPIβ and total TFPI (TFPIα + β) mRNA were analyzed. Alleles for the positive DNA strand (UCSC annotated) are shown, and SNPs are listed by ascending chromosome positions.
“Eight TFPI SNPs were found to be correlated to total TFPI protein levels in patient plasma (Table 5). The A-T-A-C-T-A-C-G haplotype composed of these eight SNPs (rs8176541-rs3213739-rs8176479-rs2192824-rs2192825-rs16829088-rs7594359-rs10153820) represented a common haplotype (frequency 0.19) with quite strong correlation to total TFPI protein; r = 0.481 (B = 14.62, P = 6.35 × 10−10). No correlation between TFPI SNPs and free TFPI protein, or between TF SNPs and TF protein in plasma was observed (P >0.05, data not shown). Adjusting for age had no effect on the correlation (data not shown).”
Table 5
Significant correlations betweenTFPIsingle nucleotide polymorphisms (SNPs) and total TFPI protein levels in plasma
Protein
SNP
Region
Allelesa
Minor allele frequency
Beta
r
P
False discovery rate
Total TFPI
rs8176541b
Intronic
G:A
0.283
15.64
0.571
7.69 × 10−14
1.08 × 10−12
Total TFPI
rs3213739b
Intronic
G:T
0.417
11.35
0.488
5.38 × 10−10
3.77 × 10−9
Total TFPI
rs8176479b
Intronic
C:A
0.238
12.22
0.480
1.20 × 10−9
5.62 × 10−9
Total TFPI
rs2192824b
Intronic
C:T
0.490
−9.88
−0.404
3.81 × 10−7
1.07 × 106
Total TFPI
rs2192825b
Intronic
T:C
0.466
−7.55
−0.301
2.40 × 10−4
5.30 × 10−4
Total TFPI
rs16829088b
Intronic
G:A
0.250
11.23
0.424
1.00 × 10−7
3.51 × 10−7
Total TFPI
rs7594359b
Intronic
C:T
0.483
−6.90
−0.275
6.90 × 10−4
0.001
Total TFPI
rs10153820b
Near 5UTR
G:A
0.125
−7.79
−0.215
0.009
0.016
aMajor:minor. bSNPs representing a haplotype effect for total tissue factor pathway inhibitor (TFPI). Alleles for the positive DNA strand (UCSC annotated) are shown.
In sum, combination of molecular physiology and genomics will improve the conditions of the patients not only to diagnose early or to monitor the disease but also to streamline the current drugs to be more efficient and therapeutic.
I. Goufman, V. N. Yakovlev, N. B. Tikhonova, R. B. Aisina, K. N. Yarygin, L. I. Mukhametova, K. B. Gershkovich, D. A. Gulin,Autoantibodies to Plasminogen and Their Role in Tumor Diseases, Bulletin of Experimental Biology and Medicine, 2015, 158,4, 493
Sarah K Westbury, Ernest Turro, Daniel Greene, Claire Lentaigne, Anne M Kelly, Tadbir K Bariana, Ilenia Simeoni, Xavier Pillois, Antony Attwood, Steve Austin, Sjoert BG Jansen, Tamam Bakchoul, Abi Crisp-Hihn, Wendy N Erber, Rémi Favier,Nicola Foad, Michael Gattens, Jennifer D Jolley, Ri Liesner, Stuart Meacham, Carolyn M Millar, Alan T Nurden, Kathelijne Peerlinck, David J Perry, Pawan Poudel, Sol Schulman, Harald Schulze, Jonathan C Stephens, Bruce Furie, Peter N Robinson, Chris van Geet, Augusto Rendon, Keith Gomez, Michael A Laffan, Michele P Lambert, Paquita Nurden, Willem H Ouwehand, Sylvia Richardson, Andrew D Mumford, Kathleen Freson, Human phenotype ontology annotation and cluster analysis to unravel genetic defects in 707 cases with unexplained bleeding and platelet disorders, Genome Medicine, 2015, 7,1
A common complication of patients on Warfarin (coumadin) is massive hematoma associated with a fall. Warfarin is an inhibitor of the liver production of prothrombin. Inadequate Warfarin dosing results in a risk of thromboembolism to the lungs or the brain, depending on where the clot is initiated. However, there is a pharmacogenomic problem in that there are individuals who have a genetic polymorphism (CYP2C9 and VKORC1) that affects the coagulation effect of the coumadin. This introduces the question of whether such individuals should be identified and dosed according to pharmacogenomic testing. The usual measurement of the effect of the drug is the International Normalized Ratio (INR) from the Prothrombin Time (PT). The existence of chronic liver disease and the use of coumadin are perhaps almost the exclusive value for the PT.
A similar question arises for the genotyping of clopidogrel for antiplatelet guidance. Does it reduce risk in stenting?
Stephen E. Kimmel, M.D., Benjamin French, Ph.D., Scott E. Kasner, M.D., Julie A. Johnson, Pharm.D., and others
Center for Therapeutic Effectiveness Research, Philadelphia, PA 19104-6021, or at stevek@mail.med.upenn.edu.
A complete list of investigators and committees in the Clarification of Optimal Anticoagulation through Genetics (COAG) trial is provided in the Supplementary Appendix, available at NEJM.org.
The clinical utility of genotype-guided (pharmacogenetically based) dosing of warfarin has been tested only in small clinical trials or observational studies, with equivocal results.
Methods
We randomly assigned 1015 patients to receive doses of warfarin during the first 5 days of therapy that were determined according to a dosing algorithm that included both clinical variables and genotype data or to one that included clinical variables only. All patients and clinicians were unaware of the dose of warfarin during the first 4 weeks of therapy. The primary outcome was the percentage of time that the international normalized ratio (INR) was in the therapeutic range from day 4 or 5 through day 28 of therapy.
Results
At 4 weeks, the mean percentage of time in the therapeutic range was 45.2% in the genotype-guided group and 45.4% in the clinically guided group (adjusted mean difference, [genotype-guided group minus clinically guided group], −0.2; 95% confidence interval, −3.4 to 3.1; P=0.91). There also was no significant between-group difference among patients with a predicted dose difference between the two algorithms of 1 mg per day or more. There was, however, a significant interaction between dosing strategy and race (P=0.003). Among black patients, the mean percentage of time in the therapeutic range was less in the genotype-guided group than in the clinically guided group. The rates of the combined outcome of any INR of 4 or more, major bleeding, or thromboembolism did not differ significantly according to dosing strategy.
Conclusions
Genotype-guided dosing of warfarin did not improve anticoagulation control during the first 4 weeks of therapy. (Funded by the National Heart, Lung, and Blood Institute and others; COAG ClinicalTrials.gov number, NCT00839657.)
Figure 1 Distribution of Time in the Therapeutic Range.
The need for clinical trials before widespread adoption of genotype-guided drug dosing and selection remains widely debated.1-4 Warfarin therapy has served as a model for the potential for pharmacogenetics to improve patient care.1 Observational studies have identified two genes, CYP2C9 and VKORC1, that are associated with variation in warfarin maintenance doses. However, the clinical utility of starting warfarin at the maintenance dose predicted by genotype-guided algorithms has been tested only in small trials, none of which were definitive.5-8 In contrast, observational studies have suggested potential benefits from genotype-guided dosing.9,10 In addition, previous clinical trials could not determine the usefulness of current dosing algorithms among black patients, for whom genotype-guided algorithms perform less well than for other populations.11-13
On the basis of available data, the Food and Drug Administration (FDA) has updated the label for warfarin twice, suggesting that variants in CYP2C9 and VKORC1 may be taken into consideration when choosing the initial warfarin dose. However, the Centers for Medicare and Medicaid Services did not find sufficient evidence to cover the cost of genotyping for warfarin dosing.14 Our study, called the Clarification of Optimal Anticoagulation through Genetics (COAG) trial, was designed to test the effect of genotype-guided dosing on anticoagulation control.
Methods
Study Design and Oversight
The COAG trial was a multicenter, double-blind, randomized, controlled trial that compared a genotype-guided warfarin-dosing strategy with a clinically based dosing strategy during the first 5 days of therapy among patients initiating warfarin treatment.15-17 The study was designed by the authors and approved by the institutional review board at the University of Pennsylvania and at each participating clinical center. The data were collected, analyzed, and interpreted by the authors. A steering committee provided oversight of the trial (for details, see the Supplementary Appendix, available with the full text of this article at NEJM.org). An independent data and safety monitoring board monitored the trial and made recommendations to the National Heart, Lung, and Blood Institute. The first two authors wrote the first draft of the manuscript, which was edited and approved by all the authors. The National Heart, Lung, and Blood Institute supported this study. Bristol-Myers Squibb donated Coumadin (warfarin). GenMark Diagnostics and AutoGenomics loaned genotyping platforms to the clinical centers. None of the companies supporting the trial had any role in the design of the protocol or in the collection, analysis, or interpretation of the data. The authors vouch for the data and the analyses, and for the fidelity of this report to the trial protocol, which is available at NEJM.org.
Study Patients and Randomization
From September 2009 through April 2013, we enrolled both inpatients and outpatients at 18 clinical centers in the United States. All the patients were adults initiating warfarin therapy with a target international normalized ratio (INR) of 2 to 3. Detailed inclusion and exclusion criteria are provided in the Supplementary Appendix. All patients provided written informed consent.
Patients were randomly assigned, in a 1:1 ratio, to the use of a dosing algorithm that included both clinical variables and genotype data or to a clinically guided dosing strategy. Randomization was stratified according to clinical center and self-reported race (black vs. nonblack).
Genotyping for CYP2C9 and VKORC1 at each clinical center was performed with the use of one of two FDA-approved platforms, the GenMark Dx eSensor XT-8 or the AutoGenomics INFINITI Analyzer. Per protocol, genotyping was performed in all patients immediately after blood-sample collection to maintain blinding to the treatment assignment. Genotyping was repeated at the central laboratory with the use of either pyrosequencing or real-time polymerase-chain-reaction assay to measure the accuracy at clinical centers.
Study Intervention and Follow-up
The study intervention period was the first 5 days of warfarin therapy. During this period, the prespecified algorithms were used to determine the warfarin dose. For each dosing strategy, a dose-initiation algorithm was used during the first 3 days of therapy, and a dose-revision algorithm was used on day 4, 5, or both. The algorithms for the genotype-guided dosing strategy12,18 included clinical variables and genotype data for CYP2C9*2, CYP2C9*3, and VKORC1. The algorithms for the clinically based dosing strategy included clinical variables only. The dosing algorithms are provided in the Supplementary Appendix. If genotype information was not available for a patient in the genotype-guided dosing group before the administration of warfarin on any given day in the first 5 days, the clinical algorithm was used on that day.
During the first 4 weeks of therapy, patients and clinicians were unaware of the actual dose of warfarin that was administered, because the pills were encapsulated to prevent identification of the dose (see the Supplementary Appendix). After the 5-day initiation period, we adjusted the dose during the first 4 weeks using standardized dose-adjustment techniques,5,10 starting with the doses predicted by the algorithms and making the same relative adjustments on the basis of the INR in the two study groups. Clinicians were informed of the relative dose change (e.g., a 10% dose increase) at each INR measurement but not the actual dose of warfarin. Clinicians could contact the medical monitor (who was aware of the study-group assignments) to request an override of these relative dose changes without being informed of the actual dose. All patients were to be followed for a total of 6 months.
Study Outcomes
The primary outcome was the percentage of time in the therapeutic range (INR, 2 to 3) from the completion of the intervention period (day 4 or 5) through day 28 of therapy. We calculated the percentage of time in the therapeutic range using a standard linear interpolation method between successive INR values,19 as detailed in the Supplementary Appendix. Each clinical center measured INRs with the use of instruments certified by the Clinical Laboratory Improvement Amendments and following strict quality assurance.
Secondary outcomes included a composite outcome of any INR of 4 or more, major bleeding, or thromboembolism in the first 4 weeks (principal secondary outcome); the time to the first therapeutic INR; the time to the determination of a maintenance dose (which was defined as the time to the first of two consecutive INR measurements, measured at least 1 week apart, that were in the therapeutic range without a dose change); and the time to an adverse event (death from any cause, major bleeding, thromboembolism, or any clinically relevant nonmajor bleeding event20,21) in the first 4 weeks. Two physicians who were unaware of the study-group assignments adjudicated major bleeding and thromboembolic serious adverse events. The definitions of major bleeding,22 clinically relevant nonmajor bleeding, and thromboembolism are provided in the Supplementary Appendix.
Statistical Analysis
We analyzed the primary outcome in the modified intention-to-treat population, which included all patients who underwent randomization with the exception of patients for whom INR data were not available (Fig. S1 in the Supplementary Appendix). Safety outcomes were analyzed in the entire cohort, regardless of whether patients received the study drug. We used regression models to analyze the primary and secondary outcomes, using linear regression for the percentage of time in the therapeutic range and Cox regression for time-to-event outcomes. The protocol specified that we conduct coprimary analyses in which we evaluated the primary outcome in all patients and in a primary subgroup, which comprised patients who had an absolute difference of 1.0 mg or more in the predicted initial daily dose between the genotype-guided dosing algorithm and the clinical dosing algorithm. We used an alpha allocation approach, which formally allows for the evaluation of the treatment benefit in an enriched subgroup as a coprimary end point. In this approach, the overall type I error rate of 0.05 for the primary outcome was split between the analyses performed among all patients and among those in the primary subgroup.17 All models were adjusted for the stratification variables (center and race). Additional subgroups, which were prespecified, were race (black vs. nonblack), sex, and the total number of allelic variants (1 variant vs. 0 or >1 variant in either CYP2C9 or VKORC1 5). All statistical tests were two-sided. All analyses were performed with the use of the R statistical package, version 3.0.1 (R Development Core Team).
We specified a minimum detectable difference of 5.5% in the mean percentage of time in the therapeutic range between the genotype-guided group and the clinically guided group in the entire study population.16 We assumed a standard deviation for the percentage of time in therapeutic range of 25% and a potential dropout rate of 10%. On the basis of recruitment rates,15 the initial sample size of 1238 patients was revised to 1022 patients on September 16, 2012 (with the approval of the data and safety monitoring board). The revised sample size provided a power of at least 80% to detect a between-group difference of 5.5% at a type I error rate of 0.04 among all patients and a 9.0% difference at a type I error rate of 0.01 among patients in the coprimary analysis.
Results
Patients, Genotyping, and Follow-up
A total of 1015 patients were enrolled and randomly assigned to either the genotype-guided dosing algorithm or the clinically guided dosing algorithm (Fig.S1 in the Supplementary Appendix). There were no significant between-group differences at baseline (Table 1Table 1Characteristics of the Patients at Baseline.). The characteristics of the patients according to self-reported race are provided in Table S1 in the Supplementary Appendix. A total of 60 participants (30 in each group) withdrew before completing the intervention period and did not have an available percentage of time in the therapeutic range, resulting in an analytic sample size of 955. A median of six INRs were measured during the first 4 weeks in each of the two study groups. Dispensed doses during the intervention period are summarized in Table S2 in the Supplementary Appendix.
Genotype data were available in the genotype-guided group for 45% of the patients before the first warfarin dose, for 94% before the second warfarin dose, and for 99% before the application of the dose-revision algorithm on day 4 or 5. The mean (±SD) difference between the dose calculated for patients without genotype data on day 1, as compared with the dose they would have received if genotype data had been available, was −0.1±0.4 mg per day during the first 3 days. The central laboratory confirmed 99.8% of all genotyping results from the clinical centers. All genotype distributions were in Hardy–Weinberg equilibrium (P>0.20 for all comparisons).
Primary Outcome
At 4 weeks, there was no significant between-group difference in the mean percentage of time in the therapeutic range: 45.2% in the genotype-guided group and 45.4% in the clinically guided group (adjusted mean difference [genotype-guided group minus clinically guided group], −0.2%; 95% confidence interval, −3.4 to 3.1; P=0.91) (Table 2Table 2Percentage of Time in the Therapeutic INR Range through Week 4 of Therapy, According to Subgroup. and Figure 1Figure 1Distribution of Time in the Therapeutic Range.). There was also no significant between-group difference in the percentage of time in the therapeutic range among patients in the coprimary analysis (Table 2). When the 4-week trial was divided into two 2-week intervals, there was also no significant difference between the groups in either interval (Table 2).
However, there was a significant interaction between race and dosing strategy (P=0.003) (Table 2). Among black patients, the mean percentage of time in the therapeutic range was less in the genotype-guided group than in the clinically guided group (35.2% vs. 43.5%; adjusted mean difference, −8.3%; P=0.01). Among nonblack patients, the mean percentage of time in the therapeutic range was slightly higher in the genotype-guided group than in the clinically guided group (48.8% vs. 46.1%; adjusted mean difference, 2.8%; P=0.15). There were no significant differences in the percentage of time in the therapeutic range according to sex or the total number of genetic variants (Table 2).
Anticoagulation Control and Dose Prediction
There were no significant between-group differences in the mean percentage of time above the therapeutic range (INR, >3) or below the therapeutic range (INR, <2) (Figure 2Figure 2Range of INRs during the 4-Week Study., and Table S3 in the Supplementary Appendix). However, black patients in the genotype-guided group were more likely to have INRs above the therapeutic range than were those in the clinically guided group (Fig. S2 and Table S3 in the Supplementary Appendix).
There was no overall between-group difference in the time to the first INR in the therapeutic range (Table S4 in the Supplementary Appendix). However, black patients in the genotype-guided group took longer on average to reach the first therapeutic INR than did those in the clinically guided group (Table S4 and Fig. S3 in the Supplementary Appendix). The time to the determination of the maintenance dose did not differ significantly between the two groups overall or according to the primary subgroup, race, or total number of genetic variants (Table S5 in the Supplementary Appendix).
The performance characteristics of the dosing algorithms with respect to the maintenance dose that was determined are shown in Table S6 (which includes the accuracy of a hypothetical, empirical dosing strategy of 5 mg per day) and in Fig. S4, both in the Supplementary Appendix. The genotype-guided algorithms performed better at predicting the maintenance dose among nonblack patients than among black patients. Dose overrides during the first 4 weeks were rare, occurring in only 3.9% of doses in the genotype-guided group and 3.6% of those in the clinically guided group; rates of overrides did not differ according to race.
Adverse Events
At 4 weeks, there were no significant between-group differences in the principal secondary outcome (the time to any INR of ≥4, major bleeding, or thromboembolism) or any other adverse events (Table 3Table 3Adverse Events through Day 28 of Warfarin Therapy., and Table S7 in the Supplementary Appendix). Safety data for the entire duration of follow-up (i.e., past the primary outcome duration) are provided in Table S8 in the Supplementary Appendix.
Discussion
In our study, we found no benefit of genotype-guided dosing of warfarin with respect to the primary outcome of the percentage of time in the therapeutic INR range, either overall or among patients with a predicted dose difference between the genotype-guided algorithm and the clinically guided algorithm of at least 1 mg per day. Our findings exclude a meaningful effect of genotype-guided dosing on the percentage of time in the therapeutic range during the first month of warfarin treatment. However, there was a significant difference in the effects of the algorithms in the prespecified subgroup of black patients, as compared with nonblack patients. Although the interaction between race and dosing strategy with respect to the primary outcome could be due to chance, the analysis was prespecified and was consistent with our a priori hypothesis that there would be race-based differences.
The dosing algorithms that we used in the trial have been validated and account for race (specifically black vs. nonblack).11-13,18 The genotype-guided algorithm performed as well as anticipated on the basis of previous studies,5,8,10-12,18,23 with an R2 of 0.48 and a mean absolute error of 1.3 mg per day for the dose-initiation algorithm and an R2 of 0.69 and a mean absolute error of 1.0 mg per day for the dose-revision algorithm. Despite this accuracy in predicting maintenance doses, there was no benefit of genotype-guided dosing with respect to anticoagulation control.
Observational studies have shown an association between the use of genetic algorithms and improved outcomes, but because of limitations in the study design, they were unable to assess whether the observed associations were causal.1,9,10 Previous clinical trials have produced equivocal results,5-8 but these trials were limited by a small size and lack of blinding to the warfarin dose. The two trials that suggested possible benefit also were limited by large numbers of dropouts6 and a comparison with nonalgorithm-based dosing.8 Previous studies also enrolled either no black patients6-8 or a minimal number of black patients5 (a total of 3) (Anderson J: personal communication).
The average percentage of time in the therapeutic range of 45% in our study is similar to that in other trials, taking into account the range of INRs used for the calculation and the timing and duration of therapy (Tables S9A and S9B in the Supplementary Appendix).5,10,24,25 Unlike previous trials that used only a baseline genotype-guided algorithm, our study used both a dose-initiation and a dose-revision algorithm. A recent study comparing a similar initiation algorithm with a combined initiation and revision algorithm showed no effect on the percentage of time in the therapeutic range with the addition of the revision algorithm.10
There are several questions that our study was not designed to answer. First, the trial did not compare genotype-based dosing with usual care or a fixed initial dose (e.g., 5 mg per day). However, such a comparison could not have discerned whether differences in outcomes were due to the marginal benefit of genetic information or to the use of the clinical information that is included in all genotype-guided dosing algorithms. Second, our study does not address the question of whether a longer duration of genotype-guided dosing would have improved INR control,26 an issue that is being addressed in another trial.27 Third, the dosing algorithms that we used included the three single-nucleotide polymorphisms among the two genes that are most likely to influence warfarin dosing. Although other genes may contribute to warfarin dosing, it is unlikely that they have a substantial effect, particularly in white populations.28 Fourth, although there were no significant between-group differences in the rates of bleeding or thromboembolic events during the primary follow-up period of 4 weeks, the trial was not powered for these outcomes. Fifth, the first dose of warfarin was not informed by genotyping in 55% of the patients; whether this influenced the results is unknown. However, the effect of missing genetics data on day 1 on the dose administered during the first 3 days of therapy was trivial.
In conclusion, our findings do not support the hypothesis that initiating warfarin therapy at a genotype-guided maintenance dose for the first 5 days, as compared with initiating warfarin at a clinically predicted maintenance dose, improves anticoagulation control during the first 4 weeks of therapy. Our results emphasize the importance of performing randomized trials for pharmacogenetics, particularly for complex regimens such as warfarin.
References
1 Ginsburg GS, Voora D. The long and winding road to warfarin pharmacogenetic testing. J Am Coll Cardiol 2010;55:2813-2815
2 Burke W, Laberge AM, Press N. Debating clinical utility. Public Health Genomics 2010;13:215-223
3 Ashley EA, Hershberger RE, Caleshu C, et al. Genetics and cardiovascular disease: a policy statement from the American Heart Association. Circulation 2012;126:142-157
4 Woodcock J, Lesko LJ. Pharmacogenetics — tailoring treatment for the outliers. N Engl J Med 2009;360:811-813
5 Anderson JL, Horne BD, Stevens SM, et al. Randomized trial of genotype-guided versus standard warfarin dosing in patients initiating oral anticoagulation. Circulation 2007;116:2563-2570
6 Caraco Y, Blotnick S, Muszkat M. CYP2C9 genotype-guided warfarin prescribing enhances the efficacy and safety of anticoagulation: a prospective randomized controlled study. Clin Pharmacol Ther 2008;83:460-470
A complete list of investigators and committees in the Clarification of Optimal Anticoagulation through Genetics (COAG) trial is provided in the Supplementary Appendix, available at NEJM.org.
Editorial
Do Pharmacogenetics Have a Role in the Dosing of Vitamin K Antagonists?
Vitamin K plays a single role in human biology — as a cofactor for the synthesis of γ-carboxyglutamic acid. This amino acid is a component of at least 14 proteins, including 4 blood-coagulation proteins (factor IX, factor VII, factor X, and prothrombin) and 2 regulatory proteins (protein C and protein S), and it is critical for the physiologic function of these proteins. Humans do not synthesize vitamin K. Rather, we ingest it in our diet. The vitamin K quinone is reduced to the semiquinone, and this reduced vitamin K is a cofactor that is required for the conversion of specific glutamic-acid residues on the vitamin K–dependent proteins to γ-carboxyglutamic acid by the vitamin K–dependent carboxylase. Vitamin K epoxide, a product of this reaction, is converted back to the vitamin K quinone by the vitamin K epoxide reductase, otherwise known as VKOR. This vitamin K cycle can be broken, and a state of vitamin K deficiency at the carboxylase level effected, by the inhibition of VKOR by vitamin K antagonists, including warfarin.
Warfarin and its analogues have been used as oral anticoagulant agents for more than 50 years. By targeting VKOR, the post-translational modification of the vitamin K–dependent blood-coagulation proteins is impaired. A reduced functional level of factor IX, factor VII, factor X, and prothrombin leads to delayed blood coagulation. This inhibition is monitored in the clinical laboratory with the use of the prothrombin time and is corrected for the varied potencies of tissue factor used in the assay by means of a calibration factor, yielding the international normalized ratio (INR). The intensity of therapy with vitamin K antagonists varies according to the indication for anticoagulation, and the INR is adjusted by varying the dose of the vitamin K antagonist.
The goal of therapy is to keep the INR in the therapeutic range, since patients with an INR that is subtherapeutic are at increased risk for thrombosis and patients with an INR that is supratherapeutic are at increased risk for bleeding. Keeping the INR within the therapeutic range can be challenging. Warfarin binds to albumin, and only about 3% is free and pharmacologically active. A number of medications can displace warfarin, leading to its increased activity and subsequent increased rate of degradation. Diet, specifically the intake of foods containing vitamin K, can offset the effect of the daily dose of the vitamin K antagonist. Age, weight, and sex are other factors that influence the dose.
In addition, the catabolic rate of the vitamin K antagonists appears to have a genetic basis. Genetic polymorphisms in the cytochrome P-450 enzyme CYP2C9 include two variants, C144R in CYP2C9*2 and I359L in CYP2C9*3. These variants have substantially reduced activity, as compared with CYP2C9*1, and are associated with reduced clearance and thus a decrease in the warfarin-dose requirement.1 Similarly, mutations in VKOR, the target of the vitamin K antagonists, lead to various degrees of warfarin resistance. Polymorphisms in VKORC1, the gene encoding this protein, lead to variability in the sensitivity to vitamin K antagonists.2
Might genotyping of CYP2C9 and VKORC1 in patients initiating anticoagulant therapy with vitamin K antagonists lead to more precise dosing and, by extrapolation, reduce the risk of thrombotic and bleeding complications? Numerous anecdotal, observational, and small clinical trials have been published on the use of this information, with many authorities promoting this approach.
The results of three large, randomized clinical trials that test this hypothesis have now been published in the Journal.3-5 Although they vary in organization and structure (duration of study, vitamin K antagonist used, double-blind vs. single-blind design, racial characteristics of the study group, and method for dosing in the control group), they are also similar (large, multicenter, randomized studies; primary end point of the time in the therapeutic range; genotyping of CYP2C9 and VKORC1; and the use of the INR target as a biomarker for the risk of bleeding and thrombosis). Importantly, these trials all examine the initiation of therapy with vitamin K antagonists and use as a primary end point the percentage of time that a patient is within the therapeutic range during the initial phase of treatment. The more important end point, the rate of bleeding and thrombotic complications, was beyond the power design of these trials.
Despite design differences, the conclusions of the three studies are similar. In an initial period of 4 weeks of anticoagulation with warfarin, the randomized, double-blind study by Kimmel et al.3 showed results in the study group that included pharmacogenetic information to supplement clinically guided dosing that were nearly identical to the results in the group that used clinically guided dosing alone (percentage of time in the therapeutic INR range, 45.2% vs. 45.4%). In the 12 weeks after the initiation of anticoagulation with acenocoumarol and phenprocoumon, Verhoef et al.4 used a new point-of-care device and found that a genotype-guided algorithm that included clinical variables yielded results that were similar to those achieved with an algorithm based on clinical variables (61.6% vs. 60.2% at 12 weeks). Pirmohamed et al.5 compared genotype-guided dosing of warfarin, also using a point-of-care device, with standard dosing methods used in clinical practice. The results at 12 weeks were 67.4% and 60.3%, which are significantly different albeit similar, indicating a modest improvement.
What can we conclude from these trials? First, we must recall that these trials address the process of the initiation of anticoagulant therapy — during the very first week — and not an approach to intermediate or long-term anticoagulation. Second, it would appear that, despite the variation in trial design, these trials indicate that this pharmacogenetic testing has either no usefulness in the initial dosing of vitamin K antagonists or, at best, marginal usefulness, given the cost and effort required to perform this testing.
Improved safety with the use of vitamin K antagonists is nonetheless an important goal, and it remains so, despite the introduction of new oral anticoagulants. Perhaps we should concentrate on improvements in the infrastructure for INR testing, including better communication among the laboratory, the physician, and the patient (e.g., through social media); in the use of formal algorithms for dosing, without concern for genotype; in patient adherence to therapy and possibly more responsibility for dosing being assumed by the patient; and in increased diligence by medical and paramedical personnel in testing, monitoring, and dosing on the basis of the INR, given the high percentage of medical mismanagement associated with these anticoagulant agents. http://dx.doi.org/nejm1313682.pdf
References
1 Aithal GP, Day CP, Kesteven PJ, Daly AK. Association of polymorphisms in the cytochrome P450 CYP2C9 with warfarin dose requirement and risk of bleeding complications. Lancet 1999;353:717-719
2 D’Andrea G, D’Ambrosio RL, Di Perna P, et al. A polymorphism in the VKORC1 gene is associated with an interindividual variability in the dose-anticoagulant effect of warfarin. Blood 2005;105:645-649
3 Kimmel SE, French B, Kasner SE, et al. A pharmacogenetic versus a clinical algorithm for warfarin dosing. N Engl J Med 2013. DOI: 10.1056/NEJMoa1310669.
4 Verhoef TI, Ragia G, de Boer A, et al. A randomized trial of genotype-guided dosing of acenocoumarol and phenprocoumon. N Engl J Med 2013. DOI: 10.1056/NEJMoa1311388.
5 Pirmohamed M, Burnside G, Eriksson N, et al. A randomized trial of genotype-guided dosing of warfarin. N Engl J Med 2013. DOI: 10.1056/NEJMoa1311386.
Rapid Warfarin Reversal With 4-Factor Prothrombin Complex Concentrate
Samuel Z. Goldhaber, MD Nov 07, 2013 Clotblog at theheart.org
Hello. This is Dr. Sam Goldhaber from the Clotblog at theheart.org, speaking to you from Brigham and Women’s Hospital and Harvard Medical School on the important topic of 4-factor prothrombin complex concentrate (4F-PCC), which is the optimal approach to urgent warfarin reversal.
The US Food and Drug Administration only recently approved 4F-PCC to reverse excessive bleeding from warfarin. We have had 3-factor PCC around for a long time but it doesn’t have much factor XII in it. Our European colleagues have had 4F-PCC for the past few years.
I was very pleased recently to have had the opportunity to use 4F-PCC to reverse an intracranial hemorrhage in a patient who had an international normalized ratio (INR) of 2.8 and a spontaneous head bleed. She was receiving warfarin for anticoagulation, and within about 15 minutes the 4F-PCC, along with 10 mg of intravenous vitamin K, returned her INR to normal. Of greater importance, the head bleeding stopped and she regained virtually all of her neurologic function. It seemed miraculous to me and it happened so quickly that it was very gratifying.
Almost simultaneously with my clinical experience, we published an observational study in Circulation [1] with about 300 patients who bled on warfarin. Approximately 80% of these patients were on warfarin because of permanent atrial fibrillation, and they had an average age in the 70s. Initially patients received fresh frozen plasma (before 4F-PCC became available in Canada) and their outcomes with fresh frozen plasma were tracked very carefully. When 4F-PCC came along and practice switched to that therapy, those outcomes were tracked as well.
Clopidogrel Genotyping for Antiplatelet Guidance in MI Stenting: Maybe Reduced Ischemic Risk
Steve Stiles Nov 06, 2013
SAN FRANCISCO, CA — A novel study of genotype-guided antiplatelet therapy in patients who received a stent for acute MI saw a sharp drop in ischemic events over one year among those who tested positive for a clopidogrel loss-of-function (LOF) gene pattern and had their originally prescribed antiplatelet therapy altered based on the assay results.
In the prospective GIANT trial with 1445 patients, reported here at TCT 2013 , it was discretionary whether clinicians raised the clopidogrel dosage or switched thienopyridine agents based on the assay results, which they had in hand within 48 hours after stenting. Such changes were made in 86% of the 316 who tested positive for the LOF genotype, a group known to be at increased ischemic risk on standard clopidogrel-containing antiplatelet therapy after stenting.
Among those 272 patients with assay-guided antiplatelet changes, the one-year composite risk of death, MI, or stent thrombosis closely matched that of patients lacking the high-risk genotype, according to co–principal investigator Dr Bernard R Chevalier (L’Institut CardioVasculaire Paris-Sud, Massy, France), who presented the study.
Dr Bernard R Chevalier
Of note, the composite end point was about five times higher for the remaining 14% of LOF-genotype patients whose antiplatelet therapy wasn’t changed based the assay.
“These are really the first clinical-trial data in the genotype space compared with the phenotype space, and I think it’s long overdue,” according to Dr Daniel I Simon (University Hospitals Case Medical Center, Cleveland, OH), speaking from the panel charged with critiquing GIANT after its formal presentation. As did many throughout TCT 2013, Simon was weighing two different approaches to sharpening thienopyridine selection for dual-agent antiplatelet therapy after coronary interventions, specifically those focusing on genotyping for the CYP2C19 clopidogrel loss-of-function variant vs platelet-function assays like VerifyNow (Accumetrics).
Such platelet-function testing with coronary stenting has its supporters and detractors but hasn’t found a consistent role in managing patients undergoing PCI, even for acute coronary syndromes, as heartwire has long reported.
One-Year Rates (%) of Primary End Point (Death, MI, or Stent Thrombosis) by Clopidogrel LOF Genotype Status
End point Normal
LOF, treatment is adjusted LOF, treatment is not adjusted
n=1118 n=272 n=55
Primary 3.04 3.3* 15.6
*p=0.83 vs normal; p<0.0001 for noninferiority; p=0.04 vs LOF-treatment-is-not-adjusted
“I think these are amazing results,” Dr Cindy L Grines (Detroit Medical Center Cardiovascular Institute, MI) said at a press briefing on GIANT, referring to both the high event rate in LOF-genotype patients whose treatment wasn’t changed and similarly lower event rates in the other two groups. “Both of those [findings] are a little bit unexpected, I’d guess?” She asked Chevalier why clinicians did not modify antiplatelet therapy in 14% of patients positive for the LOF genotype.
In GIANT, said Chevalier in his presentation, investigators were “strongly recommended” to give such patients prasugrel (Effient, Lilly/Daiichi-Sanyo) or, if they had contraindications to prasugrel, to double their clopidogrel dosage.
But prasugrel, a more potent antiplatelet than clopidogrel, had already been chosen for initial antiplatelet therapy in more than half of patients in the study. Perhaps clinicians believed such patients would benefit from it regardless of their ultimate genotype status. Indeed, some patients later found not to have the clopidogrel LOF genotype were switched from prasugrel to clopidogrel, perhaps satisfied by the assay that the latter drug would be adequate after all.
Chevalier speculated that clinicians also may not have boosted antiplatelet therapy in some LOF-genotype patients if it was considered too risky, such as for those with bleeding risk factors. The high event rate in patients with the LOF genotype whose antiplatelet therapy wasn’t adjusted, therefore, may be more related to how sick the patient was, rather than any cues from genotyping. He said his group is currently looking for the answer in further analyses.
Prevalence of Thienopyridine Use and Dosages, Before and After Genotyping, by Assay Outcome
Thienopyridine and dosage by timing
n=1118 treatment is adjusted, (%) n=272 (%)
Normal, LOF p
Clopidogrel 75 mg/d (preassay) 35.6 34.7 NS
Clopidogrel 75 mg/d (postassay) 44.5 0 <0.001
Clopidogrel 150 mg/d (preassay) 10 9.1 NS
Clopidogrel 150 mg/d (postassay) 8.9 16.8 <0.05
Prasugrel 10 mg/d (preassay) 53.3 55.5 NS
Prasugrel 10 mg/d (postassay) 46.1 83.1 <0.001
NS=nonsignificant
GIANT was funded by Biotronik. Chevalier discloses consulting for or receiving research grants or speaker fees from Abbott Vascular, Asahi, Astra Zeneca, AVI, Boston Scientific, Biotronik, Colibri, Cook, Cordis, Daiichi Sankyo, Eli-Lilly, Iroko, Medtronic, and Terumo and being general director of and owning equity interest in the European Cardiovascular Research Center.
Bivalirudin Started during Emergency Transport for Primary PCI
Philippe Gabriel Steg, M.D., Arnoud van ‘t Hof, M.D., Ph.D., Christian W. Hamm, M.D., Peter Clemmensen, M.D., Ph.D., Frédéric Lapostolle, M.D., Ph.D., Pierre Coste, M.D., Jurrien Ten Berg, M.D., Ph.D., Pierre Van Grunsven, M.D., Gerrit Jan Eggink, M.D., Lutz Nibbe, M.D., Uwe Zeymer, M.D., Marco Campo dell’ Orto, M.D., Holger Nef, M.D., Jacob Steinmetz, M.D., Ph.D., Louis Soulat, M.D., Kurt Huber, M.D., Efthymios N. Deliargyris, M.D., Debra Bernstein, Ph.D., Diana Schuette, Ph.D., Jayne Prats, Ph.D., Tim Clayton, M.Sc., Stuart Pocock, Ph.D., Martial Hamon, M.D., and Patrick Goldstein, M.D. for the EUROMAX Investigators
N Engl J Med 2013; 369:2207-2217December 5, 2013DOI: 10.1056/NEJMoa1311096
Background
Bivalirudin, as compared with heparin and glycoprotein IIb/IIIa inhibitors, has been shown to reduce rates of bleeding and death in patients undergoing primary percutaneous coronary intervention (PCI). Whether these benefits persist in contemporary practice characterized by prehospital initiation of treatment, optional use of glycoprotein IIb/IIIa inhibitors and novel P2Y12 inhibitors, and radial-artery PCI access use is unknown.
Methods
We randomly assigned 2218 patients with ST-segment elevation myocardial infarction (STEMI) who were being transported for primary PCI to receive either bivalirudin or unfractionated or low-molecular-weight heparin with optional glycoprotein IIb/IIIa inhibitors (control group). The primary outcome at 30 days was a composite of death or major bleeding not associated with coronary-artery bypass grafting (CABG), and the principal secondary outcome was a composite of death, reinfarction, or non-CABG major bleeding.
Results
Bivalirudin, as compared with the control intervention, reduced the risk of the primary outcome (5.1% vs. 8.5%; relative risk, 0.60; 95% confidence interval [CI], 0.43 to 0.82; P=0.001) and the principal secondary outcome (6.6% vs. 9.2%; relative risk, 0.72; 95% CI, 0.54 to 0.96; P=0.02). Bivalirudin also reduced the risk of major bleeding (2.6% vs. 6.0%; relative risk, 0.43; 95% CI, 0.28 to 0.66; P<0.001). The risk of acute stent thrombosis was higher with bivalirudin (1.1% vs. 0.2%; relative risk, 6.11; 95% CI, 1.37 to 27.24; P=0.007). There was no significant difference in rates of death (2.9% vs. 3.1%) or reinfarction (1.7% vs. 0.9%). Results were consistent across subgroups of patients.
Conclusions
Bivalirudin, started during transport for primary PCI, improved 30-day clinical outcomes with a reduction in major bleeding but with an increase in acute stent thrombosis. (Funded by the Medicines Company; EUROMAX ClinicalTrials.gov number, NCT01087723.)
Source Information
The authors’ affiliations are listed in the Appendix.
Dr. Steg at Cardiologie, Département Hospitalo-Universitaire FIRE, Hôpital Bichat, Assistance Publique–Hôpitaux de Paris, Paris, France, or at gabriel.steg@bch.aphp.fr.
A complete list of the European Ambulance Acute Coronary Syndrome Angiography (EUROMAX) investigators is provided in the Supplementary Appendix, available at NEJM.org.
crystal structure of thrombin. (Photo credit: Wikipedia)
Review Profs and correspondence should be addressed to:
Dr. Jeffrey Lawson
Duke University Medical Center
Room 481 MSRB/ Boxes 2622
Research Drive
Durham, NC 27710
Phone (919) 681-6432
Fax (919) 681-1094
Email: lawso717@duke.edu, demet.sag@gmail.com
*Current Address: TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130
Abstract:
Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation. In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells. Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2. We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin. These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies. Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.
WORD COUNT OF ABSTRACT: 221
The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells
Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2). Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).
Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14). First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation. PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.
Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways. Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1. PAR couples with at least three G protein families Gq, Gi, and G12/13. With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling. Gi dependent signaling activates Ras, p42/44, Src/Fak, p42. Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin. These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).
Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription. The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel. Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36). Currently the most common topical products approved by FDA are bovine originated. Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.
In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs). We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue. Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.
MATERIALS AND METHODS:
Thrombins: Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).
Cell Culture: The pooled cells were received from Clonetics. Human endothelial cells (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF). The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5. Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.
RNA isolation and RT-PCR: The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol. The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166). At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification. At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min. The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.
The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward) GGAAGCCTTGCT CATTCTTGA and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR. The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.
Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism. This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product. HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h. The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa. The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.
BrDu incorporation:This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA. The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA. The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche). Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody. The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.
Nuclear Extract Preparation: The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD). For each treatment one 100mm plate were used per cell line.
EMSA: The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C. The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.
Immunoblotting: The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs. The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue). The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations. The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).
RESULTS:
The expression of PARs differs for the types of vascular cells.
Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not. The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs. We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).
The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated more on AoSMC than HUVECs (Figure 2 and Figure 3).
In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period. The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC.
In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable. Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11. This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.
Next, the proliferation through MAPK signaling had been tested by ERK activation. Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern. Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr. AoSMCs get phosphorylated at least 5 times more than HUVECs. This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).
Activation of DNA synthesis in AoSMCs.As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.
DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu. All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).
DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours. The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown).
DNA synthesis at AoSMCs With BrDu:We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5. The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h. At 3h time interval no difference between non-stimulated and stimulated by topical bovine thrombin AoSMC. At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown). This predicts that as well as the origin of the product the purity of the preparation is important.
Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs
Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression. PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes. HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins. As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs. PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%. PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%. These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when. This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)
The effects of thrombins on the transcription factors.Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs topical bovine thrombin causes elevation of ATF2 activation by 50% and c-Rel by 30%. Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs. As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.
Gene Interaction changes after the thrombin treatment both in vivo and in vitro: Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006). These genes have a predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61). In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression. The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin. The expression of beta actin is at least two-three times abundant in HUVECs than that of AoSMC. The CTGF is higher in AoSMCs than HUVEC. Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC. In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs. However, the Cyr61 expression adds up to the equal level of cDNA expression.
Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation. As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.
DISCUSSION:
In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells. We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin. For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs. Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.
Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin. As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.
Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most. As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel. Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.
The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45). Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2. Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg. However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin. In this report with the highlights of our data it seems that it is possibly an indirect response.
The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein. Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells. Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs. These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos. In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB but also T cell activation by ATF-2 observed.
CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I. Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11. The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP. Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk. NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.
The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations. It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.
In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs.The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation. Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression. In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought. Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin. The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).
Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.
All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.
References:
1. Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.
2. Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.
3. Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.
4. Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.
5. Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.
6. Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.
7. Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.
8. Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.
9. Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.
10. Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.
11. Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.
12. Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.
13. Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.
14. Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.
15. Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.
16. Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.
17. Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.
18. Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.
19. Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.
20. Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.
21. Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.
22. Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.
23. McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.
24. Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.
25. Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.
26. Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.
27. De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.
28. De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.
29. De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.
30. Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.
31. Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.
32. O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.
33. Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.
34. Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.
35. Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.
36. Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.
37. Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.
38. Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.
39. Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.
40. Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.
41. Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.
42. Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.
43. Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.
44. Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.
45. Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.
46. Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.
47. O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.
Figure Legends:
Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1
Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2
Figure 3: The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11 Figure 3
Figure 4: The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4
Figure 5: AoSMC proliferation after BrDu treatment. Figure 5
Figure 6: Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6
Figure 7: The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs. Figure 7
Figure 8: Gene interactions differ after ectopic IIa. (A) in the AoSMC, (B) In the HUVEC. Figure 8
Protein folding: amino-acid sequence of bovine BPTI (basic pancreatic trypsin inhibitor) in one-letter code, with its folded 3D structure represented by a stick model of the mainchain and sidechains (in gray), and the backbone and secondary structure by a ribbon colored blue to red from N- to C-terminus. 3D structure from PDB file 1BPI, visualized in Mage and rendered in Raster3D. (Photo credit: Wikipedia)
The Effects of Aprotinin on Endothelial Cell Coagulant Biology
Demet Sag, PhD*†, Kamran Baig, MBBS, MRCS; James Jaggers, MD, Jeffrey H. Lawson, MD, PhD
Introduction: Cardiopulmonary bypass is associated with a systemic inflammatory response syndrome, which is responsible for excessive bleeding and multisystem dysfunction. Endothelial cell activation is a key pathophysiological process that underlies this response. Aprotinin, a serine protease inhibitor has been shown to be anti-inflammatory and also have significant hemostatic effects in patients undergoing CPB. We sought to investigate the effects of aprotinin at the endothelial cell level in terms of cytokine release (IL-6), tPA release, tissue factor expression, PAR1 + PAR2 expression and calcium mobilization. Methods: Cultured Human Umbilical Vein Endothelial Cells (HUVECS) were stimulated with TNFa for 24 hours and treated with and without aprotinin (200KIU/ml + 1600KIU/ml). IL-6 and tPA production was measured using ELISA. Cellular expression of Tissue Factor, PAR1 and PAR2 was measured using flow cytometry. Intracellular calcium mobilization following stimulation with PAR specific peptides and agonists (trypsin, thrombin, Human Factor VIIa, factor Xa) was measured using fluorometry with Fluo-3AM. Results: Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNFa stimulated HUVECS (p=0.043). Aprotinin treatment of TNFa activated endothelial cells significantly reduce the amount of tPA released in a dose dependent manner (A200 p=0.0018, A1600 p=0.033). Aprotinin resulted in a significant downregulation of TF expression to baseline levels. At 24 hours, we found that aprotinin treatment of TNFa stimulated cells resulted in a significant downregulation of PAR-1 expression. Aprotinin significantly inhibited the effects of the protease thrombin upon PAR1 mediated calcium release. The effects of PAR2 stimulatory proteases such as human factor Xa, human factor VIIa and trypsin on calcium release was also inhibited by aprotinin. Conclusion: We have shown that aprotinin has direct anti-inflammatory effects on endothelial cell activation and these effects may be mediated through inhibition of proteolytic activation of PAR1 and PAR2. Abstract word count: 297
INTRODUCTION Each year it is estimated that 350,000 patients in the United States, and 650,000 worldwide undergo cardiopulmonary bypass (CPB). Despite advances in surgical techniques and perioperative management the morbidity and mortality of cardiac surgery related to the systemic inflammatory response syndrome(SIRS), especially in neonates is devastatingly significant. Cardiopulmonary bypass exerts an extreme challenge upon the haemostatic system as part of the systemic inflammatory syndrome predisposing to excessive bleeding as well as other multisystem dysfunction (1). Over the past decade major strides have been made in the understanding of the pathophysiology of the inflammatory response following CPB and the role of the vascular endothelium has emerged as critical in maintaining cardiovascular homeostasis (2).
CPB results in endothelial cell activation and initiation of coagulation via the Tissue Factor dependent pathway and consumption of important clotting factors. The major stimulus for thrombin generation during CPB has been shown to be through the tissue factor dependent pathway. As well as its effects on the fibrin and platelets thrombin has been found to play a role in a host of inflammatory responses in the vascular endothelium. The recent discovery of the Protease-Activated Receptors (PAR), one of which through which thrombin acts (PAR-1) has stimulated interest that they may provide a vital link between inflammation and coagulation (3).
Aprotinin is a nonspecific serine protease inhibitor that has been used for its ability to reduce blood loss and preserve platelet function during cardiac surgery procedures requiring cardiopulmonary bypass and thus the need for subsequent blood and blood product transfusions. However there have been concerns that aprotinin may be pro-thrombotic, especially in the context of coronary artery bypass grafting, which has limited its clinical use. These reservations are underlined by the fact that the mechanism of action of aprotinin has not been fully understood. Recently aprotinin has been shown to exert anti-thrombotic effects mediated by blocking the PAR-1 (4). Much less is known about its effects on endothelial cell activation, especially in terms of Tissue Factor but it has been proposed that aprotinin may also exert protective effects at the endothelial level via protease-activated receptors (PAR1 and PAR2). In this study we simulated in vitro the effects of endothelial cell activation during CPB by stimulating Human Umbilical Vein Endothelial Cells (HUVECs) with a proinflammatory cytokine released during CPB, Tumor Necrosis Factor (TNF-a) and characterize the effects of aprotinin treatment on TF expression, PAR1 and PAR2 expression, cytokine release IL-6 and tPA secretion. In order to investigate the mechanism of action of aprotinin we studied its effects on PAR activation by various agonists and ligands.
These experiments provide insight into the effects of aprotinin on endothelial related coagulation mechanisms in terms of Tissue Factor expression and indicate it effects are mediated through Protease-Activated Receptors (PAR), which are seven membrane spanning proteins called G-protein coupled receptors (GPCR), that link coagulant and inflammatory pathways. Therefore, in this study we examine the effects of aprotinin on the human endothelial cell coagulation biology by different-dose aprotinin, 200 and 1600units. The data demonstrates that aprotinin appears to directly alter endothelial expression of inflammatory cytokines, tPA and PAR receptor expression following treatment with TNF. The direct mechanism of action is unknown but may act via local protease inhibition directly on endothelial cells. It is hoped that with improved understanding of the mechanisms of action of aprotinin, especially an antithrombotic effect at the endothelial level the fears of prothrombotic tendency may be lessened and its use will become more routine.
METHODS Human Umbilical Vein Endothelial Cells (HUVECS) used as our model to study the effects of endothelial cell activation on coagulant biology. In order to simulate the effects of cardiopulmonary bypass at the endothelial cell interface we stimulated the cells with the proinflammatory cytokine TNFa. In the study group the HUVECs were pretreated with low (200kIU/mL) and high (1600kIU/mL) dosages of aprotinin prior to stimulation with TNFa and complement activation fragments. The effects of TNFa stimulation upon endothelial Tissue Factor expression, PAR1 and PAR2 expression, and tPA and IL6 secretion were determined and compared between control and aprotinin treated cells. In order to delineate whether aprotinin blocks PAR activation via its protease inhibition properties we directly activated PAR1 and PAR2 using specific agonist ligands such thrombin (PAR1), trypsin, Factor VIIa, Factor Xa (PAR2) in the absence and presence of aprotinin.
Endothelial Cell Culture HUVECs were supplied from Clonetics. The cells were grown in EBM-2 containing 2MV bullet kit, including 5% FBS, 100-IU/ml penicillin, 0.1mg/mL streptomycin, 2mmol/L L-glutamine, 10 U/ml heparin, 30µg/mL EC growth supplement (ECGS). Before the stimulation cells were starved in 0.1%BSA depleted with FBS and growth factors for 24 hours. Cells were sedimented at 210g for 10 minutes at 4C and then resuspended in culture media. The HUVECs to be used will be between 3 and 5 passages.
Assay of IL-6 and tPA production Levels of IL-6 were measured with an ELISA based kit (RDI, MN) according to the manufacturers instructions. tPA was measured using a similar kit (American Diagnostica).
Flow CytometryThe expression of transmembrane proteins PAR1, PAR2 and tissue factor were measured by single color assay as FITC labeling agent. Prepared suspension of cells disassociated trypsin free cell disassociation solution (Gibco) to be labeled. First well washed, and resuspended into “labeling buffer”, phosphate buffered saline (PBS) containing 0.5% BSA plus 0.1% NaN3, and 5% fetal bovine serum to block Fc and non-specific Ig binding sites. Followed by addition of 5mcl of antibody to approx. 1 million cells in 100µl labeling buffer and incubate at 4C for 1 hour. After washing the cells with 200µl with wash buffer, PBS + 0.1% BSA + 0.1% NaN3, the cells were pelletted at 1000rpm for 2 mins. Since the PAR1 and PAR2 were directly labeled with FITC these cells were fixed for later analysis by flow cytometry in 500µl PBS containing 1%BSA + 0.1% NaN3, then add equal volume of 4% formalin in PBS. For tissue factor raised in mouse as monoclonal primary antibody, the pellet resuspended and washed twice more as before, and incubated at 4C for 1 hour addition of 5µl donkey anti-mouse conjugated with FITC secondary antibody directly to the cell pellets at appropriate dilution in labeling buffer. After the final wash three times, the cell pellets were resuspended thoroughly in fixing solution. These fixed and labeled cells were then stored in the dark at 4C until there were analyzed. On analysis, scatter gating was used to avoid collecting data from debris and any dead cells. Logarithmic amplifiers for the fluorescence signal were used as this minimizes the effects of different sensitivities between machines for this type of data collection.
Intracellular Calcium Measurement
Measured the intracellular calcium mobilization by Fluo-3AM. HUVECs were grown in calcium and phenol free EBM basal media containing 2MV bullet kit. Then the cell cultures were starved with the same media by 0.1% BSA without FBS for 24 hour with or without TNFa stimulation presence or absence of aprotinin (200 and 1600KIU/ml). Next the cells were loaded with Fluo-3AM 5µg/ml containing agonists, PAR1 specific peptide SFLLRN-PAR1 inhibitor, PAR2 specific peptide SLIGKV-PAR2 inhibitor, human alpha thrombin, trypsin, factor VIIa, factor Xa for an hour at 37C in the incubation chamber. Finally the media was replaced by Flou-3AM free media and incubated for another 30 minutes in the incubation chamber. The readings were taken at fluoromatic bioplate reader. For comparison purposes readings were taken before and during Fluo-3AM loading as well.
RESULTSAprotinin reduces IL-6 production from activated/stimulated HUVECS The effects of aprotinin analyzed on HUVEC for the anti-inflammatory effects of aprotinin at cultured HUVECS with high and low doses. Figure 1 shows that TNF-a stimulated a considerable increase in IL-6 production, 370.95 ± 109.9 mg/mL. If the drug is used alone the decrease of IL-6 at the low dose is 50% that is 183.95 ng/ml and with the high dose of 20% that is 338.92 from 370.95ng/ml being compared value. TNFa-aprotinin results in reduction of the IL-6 expression from 370.95ng/ml to 58.6 (6.4fold) fro A200 and 75.85 (4.9 fold) ng/ml, for A1600. After the treatment the cells reach to the below baseline limit of IL-6 expression. Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNF-a stimulated HUVECS (p=0.043). Therefore, the aprotinin prevents inflammation as well as loss of blood.
Aprotinin reduces tPA production from stimulated HUVECS Whether aprotinin exerted part of its fibrinolytic effects through inhibition of tPA mediated plasmin generation examined by the effects on TNFa stimulated HUVECS. Figure 2 also demonstrates that the amount of tPA released from HUVECS under resting, non-stimulated conditions incubated with aprotinin are significantly different. Figure 2 represents that the resting level of tPA released from non-stimulated cells significantly, by 100%, increase following TNF-a stimulation for 24 hours. After application of aprotinin alone at two doses the tPA level goes down 25% of TNFa stimulated cells. However, aprotinin treatment of TNF-a activated endothelial cells significantly lower the amount of tPA release in a dose dependent manner that is low dose decreased 25 but high dose causes 50% decrease of tPA expression (A200 p=0.0018, A1600 p=0.033) This finding suggests that aprotinin exerts a direct inhibitory effect on endothelial cell tPA production.
Aprotinin and receptor expression on activated HUVECS
TF is expressed when the cell in under stress such as TNFa treatments. The stimulated HUVECs with TNF-a tested for the expression of PAR1, PAR2, and tissue factor by single color flow cytometry through FITC labeled detection antibodies at 1, 3, and 24hs.
Tissue Factor expression is reduced:
Figure 3 demonstrates that there is a fluctuation of TF expression from 1 h to 24h that the TF decreases at first hour after aprotinin application 50% and 25%, A1600 and A200 respectively. Then at 3 h the expression come back up 50% more than the baseline. Finally, at 24h the expression of TF becomes almost as same as baseline. Moreover, TNFa stimulated cells remains 45% higher than baseline after at 3h as well as at 24h.
PAR1 decreased:
Figure 4 demonstrates that aprotinin reduces the PAR1 expression 80% at 24h but there is no affect at 1 and 3 h intervals for both doses.
During the treatment with aprotinin only high dose at 1 hour time interval decreases the PAR1 expression on the cells. This data explains that ECCB is affected due to the expression of PAR1 is lowered by the high dose of aprotinin.
PAR2 is decreased by aprotinin:
Figure 5 shows the high dose of aprotinin reduces the PAR2 expression close to 25% at 1h, 50% at 3h and none at 24h. This pattern is exact opposite of PAR1 expression. Figure 5 demonstrates the 50% decrease at 3h interval only. Does that mean aprotinin affecting the inflammation first and then coagulation?
This suggests that aprotinin may affect the PAR2 expression at early and switched to PAR1 reduction later time intervals. This fluctuation can be normal because aprotinin is not a specific inhibitor for proteases. This approach make the aprotinin work better the control bleeding and preventing the inflammation causing cytokine such as IL-6.
Aprotinin inhibits Calcium fluxes induced by PAR1/2 specific agonists
The specificity of aprotinin’s actions upon PAR studied the effects of the agent on calcium release following proteolytic and non-proteolytic stimulation of PAR1 and PAR2. Figure 6A (Figure 6) shows the stimulation of the cells with the PAR1 specific peptide (SFLLRN) results in release of calcium from the cells. Pretreatment of the cells with aprotinin has no significant effect on PAR1 peptide stimulated calcium release. This suggests that aprotinin has no effect upon the non-proteolytic direct activation of the PAR 1 receptor. Yet, Figure 6B (Figure 6) demonstrates human alpha thrombin does interact with the drug as a result the calcium release drops below base line after high dose (A1600) aprotinin used to zero but low dose does not show significant effect on calcium influx. Figure 7 demonstrates the direct PAR2 and indirect PAR2 stimulation by hFVIIa, hFXa, and trypsin of cells. Similarly, at Figure 7A aprotinin has no effect upon PAR2 peptide stimulated calcium release, however, at figures 7B, C, and D shows that PAR2 stimulatory proteases Human Factor Xa, Human Factor VIIa and Trypsin decreases calcium release. These findings indicate that aprotinin’s mechanism of action is directed towards inhibiting proteolytic cleavage and hence subsequent activation of the PAR1 and PAR2 receptor complexes. The binding site of the aprotinin on thrombin possibly is not the peptide sequence interacting with receptors.
Measurement of calcium concentration is essential to understand the mechanism of aprotinin on endothelial cell coagulation and inflammation because these mechanisms are tightly controlled by presence of calcium. For example, activation of PAR receptors cause activation of G protein q subunit that leads to phosphoinositol to secrete calcium from endoplasmic reticulum into cytoplasm or activation of DAG to affect Phospho Lipase C (PLC). In turn, certain calcium concentration will start the serial formation of chain reaction for coagulation. Therefore, treatment of the cells with specific factors, thrombin receptor activating peptides (TRAPs), human alpha thrombin, trypsin, human factor VIIa, and human factor Xa, would shed light into the effect of aprotinin on the formation of complexes for pro-coagulant activity. DISCUSSION There are two fold of outcomes to be overcome during cardiopulmonary bypass (CPB): mechanical stress and the contact of blood with artificial surfaces results in the activation of pro- and anticoagulant systems as well as the immune response leading to inflammation and systemic organ failure. This phenomenon causes the “postperfusion-syndrome”, with leukocytosis, increased capillary permeability, accumulation of interstitial fluid, and organ dysfunction. CPB is also associated with a significant inflammatory reaction, which has been related to complement activation, and release of various inflammatory mediators and proteolytic enzymes. CPB induces an inflammatory state characterized by tumor necrosis factor-alpha release. Aprotinin, a low molecular-weight peptide inhibitor of trypsin, kallikrein and plasmin has been proposed to influence whole body inflammatory response inhibiting kallikrein formation, complement activation and neutrophil activation (5, 6). But shown that aprotinin has no significant influence on the inflammatory reaction to CPB in men. Understanding the endothelial cell responses to injury is therefore central to appreciating the role that dysfunction plays in the preoperative, operative, and postoperative course of nearly all cardiovascular surgery patients. Whether aprotinin increases the risk of thrombotic complications remains controversial. The anti-inflammatory properties of aprotinin in attenuating the clinical manifestations of the systemic inflammatory response following cardiopulmonary bypass are well known(15) 16) However its mechanisms and targets of action are not fully understood. In this study we have investigated the actions of aprotinin at the endothelial cell level. Our experiments showed that aprotinin reduced TNF-a induced IL-6 release from cultured HUVECS. Thrombin mediates its effects through PAR-1 receptor and we found that aprotinin reduced the expression of PAR-1 on the surface of HUVECS after 24 hours incubation. We then demonstrated that aprotinin inhibited endothelial cell PAR proteolytic activation by thrombin (PAR-1), trypsin, factor VII and factor X (PAR-2) in terms of less release of Ca preventing the activation of coagulation. So aprotinin made cells produce less receptor, PAR1, PAR2, and TF as a result there would be less Ca++ release. Our findings provide evidence for anti-inflammatory as well as anti-coagulant properties of aprotinin at the endothelial cell level, which may be mediated through its inhibitory effects on proteolytic activation of PARs. IL6 Elevated levels of IL-6 have been shown to correlate with adverse outcomes following cardiac surgery in terms of cardiac dysfunction and impaired lung function(Hennein et al 1992). Cardiopulmonary bypass is associated with the release of the pro-inflammatory cytokines IL-6, IL-8 and TNF-a. IL-6 is produced by T-cells, endothelial cells as a result monocytes and plasma levels of this cytokine tend to increase during CPB (21, 22). In some studies aprotinin has been shown to reduce levels of IL-6 post CPB(23) Hill(5). Others have failed to demonstrate an inhibitory effect of aprotinin upon pro-inflammatory cytokines following CPB(24) (25). Our experiments showed that aprotinin significantly reduced the release of IL-6 from TNF-a stimulated endothelial cells, which may represent an important target of its anti-inflammatory properties. Its has been shown recently that activation of HUVEC by PAR-1 and PAR-2 agonists stimulates the production of IL-6(26). Hence it is possible that the effects of aprotinin in reducing IL-6 may be through targeting activation of such receptors. TPA Tissue Plasminogen activator is stored, ready made, in endothelial cells and it is released at its highest levels just after commencing CPB and again after protamine administration. The increased fibrinolytic activity associated with the release of tPA can be correlated to the excessive bleeding postoperatively. Thrombin is thought to be the major stimulus for release of t-PA from endothelial cells. Aprotinin’s haemostatic properties are due to direct inhibition of plasmin, thereby reducing fibrinolytic activity as well as inhibiting fibrin degradation. Aprotinin has not been shown to have any significant effect upon t-PA levels in patients post CPB(27), which would suggest that aprotinin reduced fibrinolytic effects are not the result of inhibition of t-PA mediated plasmin generation. Our study, however demonstrates that aprotinin inhibits the release of t-PA from activated endothelial cells, which may represent a further haemostatic mechanism at the endothelial cell level. TF Resting endothelial cells do not normally express tissue factor on their cell surface. Inflammatory mediators released during CPB such as complement (C5a), lipopolysaccharide, IL-6, IL-1, TNF-a, mitogens, adhesion molecules and hypoxia may induce the expression of tissue factor on endothelial cells and monocytes. The expression of TF on activated endothelial cells activates the extrinsic pathway of coagulation, ultimately resulting in the generation of thrombin and fibrin. Aprotinin has been shown to reduce the expression of TF on monocytes in a simulated cardiopulmonary bypass circuit (28).
We found that treatment of activated endothelial cells with aprotinin significantly reduced the expression of TF after 24 hours. This would be expected to result in reduced thrombin generation and represent an additional possible anticoagulant effect of aprotinin. In a previous study from our laboratory we demonstrated that there were two peaks of inducible TF activity on endothelial cells, one immediately post CPB and the second at 24 hours (29). The latter peak is thought to be responsible for a shift from the initial fibrinolytic state into a procoagulant state. In addition to its established early haemostatic and coagulant effect, aprotinin may also have a delayed anti-coagulant effect through its inhibition of TF mediated coagulation pathway. Hence its effects may counterbalance the haemostatic derangements, i.e. first bleeding then thrombosis caused by CPB. The anti-inflammatory effects of aprotinin may also be related to inhibition of TF and thrombin generation. PARs
It has been suggested that aprotinin may target PAR on other cells types, especially endothelial cells. We investigated the role of PARs in endothelial cell activation and whether they can be the targets for aprotinin. In recent study by Day group(30) demonstrated that endothelial cell activation by thrombin and downstream inflammatory responses can be inhibited by aprotinin in vitro through blockade of protease-activated receptor 1. Our results provide a new molecular basis to help explain the anti-inflammatory properties of aprotinin reported clinically. The finding that PAR-2 can also be activated by the coagulation enzymes factor VII and factor X indicates that PAR may represent the link between inflammation and coagulation. PAR-2 is believed to play an important role in inflammatory response. PAR-2 are widely expressed in the gastrointestinal tract, pancreas, kidney, liver, airway, prostrate, ovary, eye of endothelial, epithelial, smooth muscle cells, T-cells and neutrophils. Activation of PAR-2 in vivo has been shown to be involved in early inflammatory processes of leucocyte recruitment, rolling, and adherence, possibly through a mechanism involving platelet-activating factor (PAF) We investigated the effects of TNFa stimulation on PAR-1 and PAR-2 expression on endothelial cells. Through functional analysis of PAR-1 and PAR-2 by measuring intracellular calcium influx we have demonstrated that aprotinin blocks proteolytic cleavage of PAR-1 by thrombin and activation of PAR-2 by the proteases trypsin, factor VII and factor X. This confirms the previous findings on platelets of an endothelial anti-thrombotic effect through inhibition of proteolysis of PAR-1. In addition, part of aprotinin’s anti-inflammatory effects may be mediated by the inhibition of serine proteases that activate PAR-2. There have been conflicting reports regarding the regulation of PAR-1 expression by inflammatory mediators in cultured human endothelial cells. Poullis et al first showed that thrombin induced platelet aggregation was mediated by via the PAR-1(4) and demonstrated that aprotinin inhibited the serine protease thrombin and trypsin induced platelet aggregation. Aprotinin did not block PAR-1 activation by the non-proteolytic agonist peptide, SFLLRN indicating that the mechanism of action was directed towards inhibiting proteolytic cleavage of the receptor. Nysted et al showed that TNF did not affect mRNA and cell surface protein expression of PAR-1 (35), whereas Yan et al showed downregulation of PAR-1 mRNA levels (36). Once activated PAR1 and PAR2 are rapidly internalized and then transferred to lysosomes for degradation.
Endothelial cells contain large intracellular pools of preformed receptors that can replace the cleaved receptors over a period of approximately 2 hours, thus restoring the capacity of the cells to respond to thrombin. In this study we found that after 1-hour stimulation with TNF there was a significant upregulation in PAR-1 expression. However after 3 hours and 24 hours there was no significant change in PAR-1 expression suggesting that cleaved receptors had been internalized and replenished. Aprotinin was interestingly shown to downregulate PAR-1 expression on endothelial cells at 1 hour and increasingly more so after 24 hours TNF stimulation. These findings may suggest an effect of aprotinin on inhibiting intracellular cycling and synthesis of PAR-1.
Conclusions Our study has identified the anti-inflammatory and coagulant effects of aprotinin at the endothelial cell level. All together aprotinin affects the ECCB by reducing the t-PA, IL-6, PAR1, PAR 2, TF expressions. Our data correlates with the previous foundlings in production of tPA (7, (8) 9) 10), and decreased IL-6 levels (11) during coronary artery bypass graft surgery (12-14). We have importantly demonstrated that aprotinin may target proteolytic activation of endothelial cell associated PAR-1 to exert a possible anti-inflammatory effect. This evidence should lessen the concerns of a possible prothrombotic effect and increased incidence of graft occlusion in coronary artery bypass patients treated with aprotinin. Aprotinin may also inhibit PAR-2 proteolytic activation, which may represent a key mechanism for attenuating the inflammatory response at the critical endothelial cell level. Although aprotinin has always been known as a non-specific protease inhibitor we would suggest that there is growing evidence for a PAR-ticular mechanism of action.
REFERENCES
1. Levy, J. H., and Tanaka, K. A. Inflammatory response to cardiopulmonary bypass. Ann Thorac Surg. 75: S715-720, 2003.
2. Verrier, E. D., and Morgan, E. N. Endothelial response to cardiopulmonary bypass surgery. Ann Thorac Surg. 66: S17-19; discussion S25-18, 1998.
3. Cirino, G., Napoli, C., Bucci, M., and Cicala, C. Inflammation-coagulation network: are serine protease receptors the knot? Trends Pharmacol Sci. 21: 170-172, 2000. 4. Poullis, M., Manning, R., Laffan, M., Haskard, D. O., Taylor, K. M., and Landis, R. C. The antithrombotic effect of aprotinin: actions mediated via the proteaseactivated receptor 1. J Thorac Cardiovasc Surg. 120: 370-378, 2000.
5. Hill, G. E., Alonso, A., Spurzem, J. R., Stammers, A. H., and Robbins, R. A. Aprotinin and methylprednisolone equally blunt cardiopulmonary bypass-induced inflammation in humans. J Thorac Cardiovasc Surg. 110: 1658-1662, 1995.
6. Hill, G. E., Pohorecki, R., Alonso, A., Rennard, S. I., and Robbins, R. A. Aprotinin reduces interleukin-8 production and lung neutrophil accumulation after cardiopulmonary bypass. Anesth Analg. 83: 696-700, 1996. 7. Lu, H., Du Buit, C., Soria, J., Touchot, B., Chollet, B., Commin, P. L., Conseiller, C., Echter, E., and Soria, C. Postoperative hemostasis and fibrinolysis in patients undergoing cardiopulmonary bypass with or without aprotinin therapy. Thromb Haemost. 72: 438-443, 1994.
8. de Haan, J., and van Oeveren, W. Platelets and soluble fibrin promote plasminogen activation causing downregulation of platelet glycoprotein Ib/IX complexes: protection by aprotinin. Thromb Res. 92: 171-179, 1998.
9. Erhardtsen, E., Bregengaard, C., Hedner, U., Diness, V., Halkjaer, E., and Petersen, L. C. The effect of recombinant aprotinin on t-PA-induced bleeding in rats. Blood Coagul Fibrinolysis. 5: 707-712, 1994.
10. Orchard, M. A., Goodchild, C. S., Prentice, C. R., Davies, J. A., Benoit, S. E., Creighton-Kemsford, L. J., Gaffney, P. J., and Michelson, A. D. Aprotinin reduces cardiopulmonary bypass-induced blood loss and inhibits fibrinolysis without influencing platelets. Br J Haematol. 85: 533-541, 1993.
11. Tassani, P., Augustin, N., Barankay, A., Braun, S. L., Zaccaria, F., and Richter, J. A. High-dose aprotinin modulates the balance between proinflammatory and anti-inflammatory responses during coronary artery bypass graft surgery. J Cardiothorac Vasc Anesth.14: 682-686, 2000.
12. Asehnoune, K., Dehoux, M., Lecon-Malas, V., Toueg, M. L., Gonieaux, M. H., Omnes, L., Desmonts, J. M., Durand, G., and Philip, I. Differential effects of aprotinin and tranexamic acid on endotoxin desensitization of blood cells induced by circulation through an isolated extracorporeal circuit. J Cardiothorac Vasc Anesth. 16: 447-451, 2002.
13. Dehoux, M. S., Hernot, S., Asehnoune, K., Boutten, A., Paquin, S., Lecon-Malas, V., Toueg, M. L., Desmonts, J. M., Durand, G., and Philip, I. Cardiopulmonary bypass decreases cytokine production in lipopolysaccharide-stimulated whole blood cells: roles of interleukin-10 and the extracorporeal circuit. Crit Care Med. 28: 1721-1727, 2000.
14. Greilich, P. E., Brouse, C. F., Rinder, C. S., Smith, B. R., Sandoval, B. A., Rinder, H. M., Eberhart, R. C., and Jessen, M. E. Effects of epsilon-aminocaproic acid and aprotinin on leukocyte-platelet adhesion in patients undergoing cardiac surgery. Anesthesiology. 100: 225-233, 2004.
15. Mojcik, C. F., and Levy, J. H. Aprotinin and the systemic inflammatory response after cardiopulmonary bypass. Ann Thorac Surg. 71: 745-754, 2001.
16. Landis, R. C., Asimakopoulos, G., Poullis, M., Haskard, D. O., and Taylor, K. M. The antithrombotic and antiinflammatory mechanisms of action of aprotinin. Ann Thorac Surg. 72: 2169-2175, 2001.
17. Asimakopoulos, G., Kohn, A., Stefanou, D. C., Haskard, D. O., Landis, R. C., and Taylor, K. M. Leukocyte integrin expression in patients undergoing cardiopulmonary bypass. Ann Thorac Surg. 69: 1192-1197, 2000.
18. Landis, R. C., Asimakopoulos, G., Poullis, M., Thompson, R., Nourshargh, S., Haskard, D. O., and Taylor, K. M. Effect of aprotinin (trasylol) on the inflammatory and thrombotic complications of conventional cardiopulmonary bypass surgery. Heart Surg Forum. 4 Suppl 1: S35-39, 2001.
19. Asimakopoulos, G., Thompson, R., Nourshargh, S., Lidington, E. A., Mason, J. C., Ratnatunga, C. P., Haskard, D. O., Taylor, K. M., and Landis, R. C. An anti-inflammatory property of aprotinin detected at the level of leukocyte extravasation. J Thorac Cardiovasc Surg. 120: 361-369, 2000.
20. Asimakopoulos, G., Lidington, E. A., Mason, J., Haskard, D. O., Taylor, K. M., and Landis, R. C. Effect of aprotinin on endothelial cell activation. J Thorac Cardiovasc Surg. 122: 123-128, 2001.
21. Butler, J., Chong, G. L., Baigrie, R. J., Pillai, R., Westaby, S., and Rocker, G. M. Cytokine responses to cardiopulmonary bypass with membrane and bubble oxygenation. Ann Thorac Surg. 53: 833-838, 1992.
22. Hennein, H. A., Ebba, H., Rodriguez, J. L., Merrick, S. H., Keith, F. M., Bronstein, M. H., Leung, J. M., Mangano, D. T., Greenfield, L. J., and Rankin, J. S. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg. 108: 626-635, 1994.
23. Diego, R. P., Mihalakakos, P. J., Hexum, T. D., and Hill, G. E. Methylprednisolone and full-dose aprotinin reduce reperfusion injury after cardiopulmonary bypass. J Cardiothorac Vasc Anesth. 11: 29-31, 1997.
24. Ashraf, S., Tian, Y., Cowan, D., Nair, U., Chatrath, R., Saunders, N. R., Watterson, K. G., and Martin, P. G. “Low-dose” aprotinin modifies hemostasis but not proinflammatory cytokine release. Ann Thorac Surg. 63: 68-73, 1997.
25. Schmartz, D., Tabardel, Y., Preiser, J. C., Barvais, L., d’Hollander, A., Duchateau, J., and Vincent, J. L. Does aprotinin influence the inflammatory response to cardiopulmonary bypass in patients? J Thorac Cardiovasc Surg. 125: 184-190, 2003.
26. Chi, L., Li, Y., Stehno-Bittel, L., Gao, J., Morrison, D. C., Stechschulte, D. J., and Dileepan, K. N. Interleukin-6 production by endothelial cells via stimulation of protease-activated receptors is amplified by endotoxin and tumor necrosis factor-alpha. J Interferon Cytokine Res. 21: 231-240, 2001.
27. Ray, M. J., and Marsh, N. A. Aprotinin reduces blood loss after cardiopulmonary bypass by direct inhibition of plasmin. Thromb Haemost. 78: 1021-1026, 1997.
28. Khan, M. M., Gikakis, N., Miyamoto, S., Rao, A. K., Cooper, S. L., Edmunds, L. H., Jr., and Colman, R. W. Aprotinin inhibits thrombin formation and monocyte tissue factor in simulated cardiopulmonary bypass. Ann Thorac Surg. 68: 473-478, 1999.
29. Jaggers, J. J., Neal, M. C., Smith, P. K., Ungerleider, R. M., and Lawson, J. H. Infant cardiopulmonary bypass: a procoagulant state. Ann Thorac Surg. 68: 513-520, 1999.
30. Day, J. R., Taylor, K. M., Lidington, E. A., Mason, J. C., Haskard, D. O., Randi, A. M., and Landis, R. C. Aprotinin inhibits proinflammatory activation of endothelial cells by thrombin through the protease-activated receptor 1. J Thorac Cardiovasc Surg. 131: 21-27, 2006.
31. Vergnolle, N. Proteinase-activated receptor-2-activating peptides induce leukocyte rolling, adhesion, and extravasation in vivo. J Immunol. 163: 5064-5069, 1999.
32. Vergnolle, N., Hollenberg, M. D., Sharkey, K. A., and Wallace, J. L. Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2)-activating peptides in the rat paw. Br J Pharmacol. 127: 1083-1090, 1999.
33. McLean, P. G., Aston, D., Sarkar, D., and Ahluwalia, A. Protease-activated receptor-2 activation causes EDHF-like coronary vasodilation: selective preservation in ischemia/reperfusion injury: involvement of lipoxygenase products, VR1 receptors, and C-fibers. Circ Res. 90: 465-472, 2002.
34. Maree, A., and Fitzgerald, D. PAR2 is partout and now in the heart. Circ Res. 90: 366-368, 2002.
35. Nystedt, S., Ramakrishnan, V., and Sundelin, J. The proteinase-activated receptor 2 is induced by inflammatory mediators in human endothelial cells. Comparison with the thrombin receptor. J Biol Chem. 271: 14910-14915, 1996.
36. Yan, W., Tiruppathi, C., Lum, H., Qiao, R., and Malik, A. B. Protein kinase C beta regulates heterologous desensitization of thrombin receptor (PAR-1) in endothelial cells. Am J Physiol. 274: C387-395, 1998.
37. Shinohara, T., Suzuki, K., Takada, K., Okada, M., and Ohsuzu, F. Regulation of proteinase-activated receptor 1 by inflammatory mediators in human vascular endothelial cells. Cytokine. 19: 66-75, 2002.
FIGURES
Figure 1: IL-6 production following TNF-a stimulation Figure 1
Figure 2: tPA production following TNF-a stimulation Figure 2
Objectives.—To review the state of the art relating to elevated hemostatic factor levels as a potential risk factor for thrombosis, as reflected by the medical literature and the consensus opinion of recognized experts in the field, and to make recommendations for the use of specific measurements of hemostatic factor levels in the assessment of thrombotic risk in individual patients.
Data Sources.—Review of the medical literature, primarily from the last 10 years.
Data Extraction and Synthesis.—After an initial assessment of the literature, key points were identified. Experts were assigned to do an in-depth review of the literature and to prepare a summary of their findings and recommendations.
A draft manuscript was prepared and circulated to every participant in the College of American Pathologists Conference XXXVI: Diagnostic Issues in Thrombophilia prior to the conference. Each of the key points and associated recommendations was then presented for discussion at the conference. Recommendations were accepted if a consensus of the 27 experts attending the conference was reached. The results of the discussion were used to revise the manuscript into its final form.
Consensus was reached on 8 recommendations concerning the use of hemostatic factor levels in the assessment of thrombotic risk in individual patients.
The underlying premise for measuring elevated coagulation factor levels is that if the average level of the factor is increased in the patient long-term, then the patient may be at increased risk of thrombosis long-term. Both risk of thrombosis and certain factors increase with age (eg, fibrinogen, factor VII, factor VIII, factor IX, and von Willebrand factor). Are these effects linked or do we need age specific ranges? Do acquired effects like other diseases or medications affect factor levels, and do the same risk thresholds apply in these instances? How do we assure that the level we are measuring is a true indication of the patient’s average baseline level and not a transient change? Fibrinogen, factor VIII, and von Willebrand factor are all strong acute-phase reactants.
Risk of bleeding associated with coagulation factor levels increases with roughly log decreases in factor levels. Compared to normal (100%), 60% to 90% decreases in a coagulation factor may be associated with excess bleeding with major trauma, 95% to 98% decreases with minor trauma, and .99% decrease with spontaneous hemorrhage. In contrast, the difference between low risk and high risk for thrombosis may be separated by as little as 15% above normal.
It may be possible to define relative cutoffs for specific factors, for example, 50% above the mean level determined locally in healthy subjects for a certain factor. Before coagulation factor levels can be routinely used to assess individual risk, work must be done to better standardize and calibrate the assays used.
Detailed discussion of the rationale for each of these recommendations is presented in the article. This is an evolving area of research. While routine use of factor level measurements is not recommended, improvements in assay methodology and further clinical studies may change these recommendations in the future.
This study explores the behavior of a model system in response to perturbations in
tissue factor
thrombomodulin surface densities
tissue factor site dimensions
wall shear rate.
The classic time course is characterized by
initiation and
amplification of thrombin generation
the existence of threshold-like responses
This author defines a new parameter, the „effective prothrombotic zone‟, and its dependence on model parameters. It was found that prothrombotic effects may extend significantly beyond the dimensions of the spatially discrete site of tissue factor expression in both axial and radial directions. Furthermore, he takes advantage of the finite element modeling approach to explore the behavior of systems containing multiple spatially distinct sites of TF expression in a physiologic model. The computational model is applied to assess individualized thrombotic risk from clinical data of plasma coagulation factor levels. He proposes a systems-based parameter with deep venous thrombosis using computational methods in combination with biochemical panels to predict hypercoagulability for high risk populations.
The Vascular Surface
The ‘resting’ endothelium synthesizes and presents a number of antithrombogenic molecules including
heparan sulfate proteoglycans
ecto-adenosine diphosphatase
prostacyclin
nitric oxide
thrombomodulin.
In response to various stimuli
inflammatory mediators
hypoxia
oxidative stress
fluid shear stress
the cell surface becomes ‘activated’ and serves to organize membrane-associated enzyme complexes of coagulation.
Leipold et al. developed a model of the tissue factor pathway as a design aid for the development of exogenous serine protease inhibitors. In contrast, Guo et al. focused on the reactions of the contact, or intrinsic pathway, to study parameters relevant to material-induced thrombosis, including procoagulant surface area.
Alternative approaches to modeling the coagulation cascade have been pursued including the use of stochastic activity networks to represent the intrinsic, extrinsic, and common pathways through fibrin formation and a kinetic Monte Carlo simulation of TF-initiated thrombin generation. Generally, fluid phase models of the kinetics of coagulation are both computationally and experimentally less complex. As such, the computational models are able to incorporate a large number of species and their reactions, and empirical data is often available for regression analysis and model validation. The range of complexity and motivations for these models is wide, and the models have been used to describe various phenomena including the ‘all-or-none’ threshold behavior of thrombin generation. However, the role of blood flow in coagulation is well recognized in promoting the delivery of substrates to the vessel wall and in regulating the thrombin response by removing activated clotting factors.
Flow Based Models of Coagulation
In 1990, Basmadjian presented a mathematical analysis of the effect of flow and mass transport on a single reactive event at the vessel wall and consequently laid the foundation for the first flow-based models of coagulation. It was proposed that for vessels greater than 0.1 mm in diameter, reactive events at the vessel wall could be adequately described by the assumption of a concentration boundary layer very close to the reactive surface, within which the majority of concentration changes took place. The height of the boundary layer and the mass transfer coefficient that described transport to and from the vessel wall were shown to stabilize on a time scale much shorter than the time scale over which concentration changes were empirically observed. Thus, the vascular space could be divided into two compartments, a boundary volume and a bulk volume, and furthermore, changes within the bulk phase could be considered negligible, thereby reducing the previously intractable problem to a pseudo-one compartment model described by a system of ordinary differential equations.
Basmadjian et al. subsequently published a limited model of six reactions, including two positive feedback reactions and two inhibitory reactions, of the common pathway of coagulation triggered by exogenous factor IXa under flow. As a consequence of the definition of the mass transfer coefficient, the kinetic parameters were dependent on the boundary layer height. Furthermore, the model did not explicitly account for intrinsic tenase or prothrombinase formation, but rather derived a rate expression for reaction in the presence of a cofactor. The major finding of the study was the predicted effect of increased mass transport to enhance thrombin generation by decreasing the induction time up to a critical mass transfer rate, beyond which transport significantly decreased peak thrombin levels thereby reducing overall thrombin production.
Kuharsky and Fogelson formulated a more comprehensive, pseudo-one compartment model of tissue factor-initiated coagulation under flow, which included the description of 59 distinct fluid- and surface-bound species. In contrast to the Baldwin-Basmadjian model, which defined a mass transfer coefficient as a rate of transport to the vessel surface, the Kuharsky-Fogelson model defined the mass transfer coefficient as a rate of transport into the boundary volume, thus eliminating the dependence of kinetic parameters on transport parameters. The computational study focused on the threshold response of thrombin generation to the availability of membrane binding sites. Additionally, the model suggested that adhered platelets may play a role in blocking the activity of the TF/ VIIa complex. Fogelson and Tania later expanded the model to include the protein C and TFPI pathways.
Modeling surface-associated reactions under flow uses finite element method (FEM), which is a technique for solving partial differential equations by dividing the vascular space into a finite number of discrete elements. Hall et al. used FEM to simulate factor X activation over a surface presenting TF in a parallel plate flow reactor. The steady state model was defined by the convection-diffusion equation and Michaelis-Menten reaction kinetics at the surface. The computational results were compared to experimental data for the generation of factor Xa by cultured rat vascular smooth muscle cells expressing TF.
Based on discrepancies between numerical and experimental studies, the catalytic activity of the TF/ VIIa complex may be shear-dependent. Towards the overall objective of developing an antithrombogenic biomaterial, Tummala and Hall studied the kinetics of factor Xa inhibition by surface-immobilized recombinant TFPI under unsteady flow conditions. Similarly, Byun et al. investigated the association and dissociation kinetics of ATIII inactivation of thrombin accelerated by surface-immobilized heparin under steady flow conditions. To date, finite element models that detail surface-bound reactions under flow have been restricted to no more than a single reaction catalyzed by a single surface-immobilized species.
Models of Coagulation Incorporating Spatial Parameter
Major findings include the roles of these specific coagulation pathways in the
initiation
amplification
termination phases of coagulation.
Coagulation near the activating surface was determined by TF/VIIa catalyzed factor Xa production, which was rapidly inhibited close to the wall. In contrast, factor IXa diffused farther from the surface, and thus factor Xa generation and clot formation away from the reactive wall was dependent on intrinsic tenase (IXa/ VIIIa) activity. Additionally, the concentration wave of thrombin propagated away from the activation zone at a rate which was dependent on the efficiency of inhibitory mechanisms.
Experimental and ‘virtual’ addition of plasma-phase thrombomodulin resulted in dose-dependent termination of thrombin generation and provided evidence of spatial localization of clot formation by TM with final clot lengths of 0.2-2 mm under diffusive conditions.
These studies provide an interesting analysis of the roles of specific factors in relation to space due to diffusive effects, but neglect the essential role of blood flow in the transport analysis. Additionally, the spatial dynamics of clot localization by thrombomodulin would likely be affected by restricting the inhibitor to its physiologic site on the vessel surface.
Finite Element Modeling
Finite element method (FEM) is a numerical technique for solving partial differential equations. Originally proposed in the 1940s to approach structural analysis problems in civil engineering, FEM now finds application in a wide variety of disciplines. The computational method relies on mesh discretization of a continuous domain which subdivides the space into a finite number of ‘elements’. The physics of each element are defined by its own set of physical properties and boundary conditions, and the simultaneous solution of the equations describing the individual elements approximate the behavior of the overall domain.
Doctor of Philosophy in Biomedical Engineering. Emory University, Georgia Institute of Technology. May 2010. Under supervision of: Dr. Elliot L. Chaikof, Departments of Surgery and Biomedical Engineering.
Blood Coagulation (Thrombin) and Protein C Pathways (Blood_Coagulation_and_Protein_C_Pathways.jpg) (Photo credit: Wikipedia)
Coagulation cascade (Photo credit: Wikipedia)
Cardiovascular Physiology: Modeling, Estimation and Signal Processing
With cardiovascular diseases being among the main causes of death in the world, quantitative modeling, assessment and monitoring of cardiovascular dynamics, and functioning play a critical role in bringing important breakthroughs to cardiovascular care. Quantification of cardiovascular physiology and its control mechanisms from physiological recordings, by use of mathematical models and algorithms, has been proved to be of important value in understanding the causes of cardiovascular diseases and assisting the diagnostic and prognostic process. This E-Book is derived from the Frontiers in Computational Physiology and Medicine Research Topic entitled “Engineering Approaches to Study Cardiovascular Physiology: Modeling, Estimation and Signal Processing.”
There are two review articles. The first review article by Chen et al. (2012) presents a unified point process probabilistic framework to assess heart beat dynamics and autonomic cardiovascular control. Using clinical recordings of healthy subjects during Propofol anesthesia, the authors demonstrate the effectiveness of their approach by applying the proposed paradigm to estimate
instantaneous heart rate (HR),
heart rate variability (HRV),
respiratory sinus arrhythmia (RSA)
baroreflex sensitivity (BRS).
The second review article, contributed by Zhang et al. (2011), provides a comprehensive overview of tube-load model parameter estimation for monitoring arterial hemodynamics.
The remaining eight original research articles can be mainly classified into two categories. The two articles from the first category emphasize modeling and estimation methods. In particular, the paper “Modeling the autonomic and metabolic effects of obstructive sleep apnea: a simulation study” by Cheng and Khoo (2012), combines computational modeling and simulations to study the autonomic and metabolic effects of obstructive sleep apnea (OSA).
The second paper, “Estimation of cardiac output and peripheral resistance using square-wave-approximated aortic flow signal” by Fazeli and Hahn (2012), presents a model-based approach to estimate cardiac output (CO) and total peripheral resistance (TPR), and validates the proposed approach via in vivo experimental data from animal subjects.
The six articles in the second category focus on application of signal processing techniques and statistical tools to analyze cardiovascular or physiological signals in practical applications. the paper “Modulation of the sympatho-vagal balance during sleep: frequency domain study of heart rate variability and respiration” by Cabiddu et al. (2012), uses spectral and cross-spectral analysis of heartbeat and respiration signals to assess autonomic cardiac regulation and cardiopulmonary coupling variations during different sleep stages in healthy subjects.
The paper “increased non-gaussianity of heart rate variability predicts cardiac mortality after an acute myocardial infarction” by Hayano et al. (2011) uses a new non-gaussian index to assess the HRV of cardiac mortality using 670 post-acute myocardial infarction (AMI) patients. the paper “non-gaussianity of low frequency heart rate variability and sympathetic activation: lack of increases in multiple system atrophy and parkinson disease” by Kiyono et al. (2012), applies a non-gaussian index to assess HRV in patients with multiple system atrophy (MSA) and parkinson diseases and reports the relation between the non-gaussian intermittency of the heartbeat and increased sympathetic activity. The paper “Information domain approach to the investigation of cardio-vascular, cardio-pulmonary, and vasculo-pulmonary causal couplings” by Faes et al. (2011), proposes an information domain approach to evaluate nonlinear causality among heartbeat, arterial pressure, and respiration measures during tilt testing and paced breathing protocols. The paper “integrated central-autonomic multifractal complexity in the heart rate variability of healthy humans” by Lin and Sharif (2012), uses a relative multifractal complexity measure to assess HRV in healthy humans and discusses the related implications in central autonomic interactions. Lastly, the paper “Time scales of autonomic information flow in near-term fetal sheep” by Frasch et al. (2012), analyzes the autonomic information flow (AIF) with kullback–leibler entropy in fetal sheep as a function of vagal and sympathetic modulation of fetal HRV during atropine and propranolol blockade.
In summary, this Research Topic attempts to give a general panorama of the possible state-of-the-art modeling methodologies, practical tools in signal processing and estimation, as well as several important clinical applications, which can altogether help deepen our understanding about heart physiology and pathology and further lead to new scientific findings. We hope that the readership of Frontiers will appreciate this collected volume and enjoy reading the presented contributions. Finally, we are grateful to all contributed authors, reviewers, and editorial staffs who had all put tremendous effort to make this E-Book a reality.
fluctuations of cerebral blood flow and metabolic demand following hypoxia in neonatal brain
Most of the research investigating the pathogenesis of perinatal brain injury following hypoxia-ischemia has focused on excitotoxicity, oxidative stress and an inflammatory response, with the response of the developing cerebrovasculature receiving less attention. This is surprising as the presentation of devastating and permanent injury such as germinal matrix-intraventricular haemorrhage (GM-IVH) and perinatal stroke are of vascular origin, and the origin of periventricular leukomalacia (PVL) may also arise from poor perfusion of the white matter. This highlights that cerebrovasculature injury following hypoxia could primarily be responsible for the injury seen in the brain of many infants diagnosed with hypoxic-ischemic encephalopathy (HIE).
The highly dynamic nature of the cerebral blood vessels in the fetus, and the fluctuations of cerebral blood flow and metabolic demand that occur following hypoxia suggest that the response of blood vessels could explain both regional protection and vulnerability in the developing brain.
This review discusses the current concepts on the pathogenesis of perinatal brain injury, the development of the fetal cerebrovasculature and the blood brain barrier (BBB), and key mediators involved with the response of cerebral blood vessels to hypoxia.
remodeling of coronary and cerebral arteries and arterioles
Effects of hypertension on arteries and arterioles often manifest first as a thickened wall, with associated changes in passive material properties (e.g., stiffness) or function (e.g., cellular phenotype, synthesis and removal rates, and vasomotor responsiveness). Less is known, however, regarding the relative evolution of such changes in vessels from different vascular beds.
We used an aortic coarctation model of hypertension in the mini-pig to elucidate spatiotemporal changes in geometry and wall composition (including layer-specific thicknesses as well as presence of collagen, elastin, smooth muscle, endothelial, macrophage, and hematopoietic cells) in three different arterial beds, specifically aortic, cerebral, and coronary, and vasodilator function in two different arteriolar beds, the cerebral and coronary.
Marked geometric and structural changes occurred in the thoracic aorta and left anterior descending coronary artery within 2 weeks of the establishment of hypertension and continued to increase over the 8-week study period. In contrast, no significant changes were observed in the middle cerebral arteries from the same animals. Consistent with these differential findings at the arterial level, we also found a diminished nitric oxide-mediated dilation to adenosine at 8 weeks of hypertension in coronary arterioles, but not cerebral arterioles.
These findings, coupled with the observation that temporal changes in wall constituents and the presence of macrophages differed significantly between the thoracic aorta and coronary arteries, confirm a strong differential progressive remodeling within different vascular beds.
These results suggest a spatiotemporal progression of vascular remodeling, beginning first in large elastic arteries and delayed in distal vessels.
C-reactive protein oxidant-mediated release of pro-thrombotic factor
Inflammation and the generation of reactive oxygen species (ROS) have been implicated in the initiation and progression of atherosclerosis. Although C-reactive protein (CRP) has traditionally been considered to be a biomarker of inflammation, recent in vitro and in vivo studies have provided evidence that CRP, itself, exerts pro-thrombotic effects on vascular cells and may thus play a critical role in the development of atherothrombosis. Of particular importance is that CRP interacts with Fcγ receptors on cells of the vascular wall giving rise to the release of pro-thrombotic factors. The present review focuses on distinct sources of CRP-mediated ROS generation as well as the pivotal role of ROS in CRP-induced tissue factor expression. These studies provide considerable insight into the role of the oxidative mechanisms in CRP-mediated stimulation of pro-thrombotic factors and activation of platelets. Collectively, the available data provide strong support for ROS playing an important intermediary role in the relationship between CRP and atherothrombosis.
To determine whether the increase in plasma levels of C-Reactive Protein (CRP), a non-specifi c reactant in the acute-phase of systemic infl ammation, is associated with clinical severity of peripheral arterial disease (PAD).
This is a cross-sectional study at a referral hospital center of institutional practice in Madrid, Spain. These investigators took a stratifi ed random sampling of 3370 patients with symptomatic PAD from the outpatient vascular laboratory database in 2007 in the order of their clinical severity:
the fi rst group of patients with mild chronological clinical severity who did not require surgical revascularization,
the second group consisted of patients with moderate clinical severity who had only undergone only one surgical revascularization procedure and
the third group consisted of patients who were severely affected and had undergone two or more surgical revascularization procedures of the lower extremities in different areas or needed late re-interventions.
The Neyman affi xation was used to calculate the sample size with a fi xed relative error of 0.1.
A homogeneity analysis between groups and a unifactorial analysis of comparison of medians for CRP was done.
The groups were homogeneous for
age
smoking status
Arterial Hypertension
diabetes mellitus
dyslipemia
homocysteinemia and
specifi c markers of infl ammation.
In the unifactorial analysis of multiple comparisons of medians according to Scheffé, it was observed that
the median values of CRP plasma levels were increased in association with higher clinical severity of PAD
3.81 mg/L [2.14–5.48] vs.
8.33 [4.38–9.19] vs.
12.83 [9.5–14.16]; p 0.05
as a unique factor of tested ones.
Plasma levels of CRP are associated with not only the presence of atherosclerosis but also with its chronological clinical severity.
Elevated concentration of homocysteine (Hcy) in human tissues, defined as hyperhomocysteinemia has been correlated with some diseases, such as
cardiovascular
neurodegenerative
kidney disorders
L-Homocysteine (Hcy) is an endogenous amino acid, containing a free thiol group, which in healthy cells is involved in methionine and cysteine synthesis/resynthesis. Indirectly, Hcy participates in methyl, folate, and cellular thiol metabolism. Approximately 80% of total plasma Hcy is protein-bound, and only a small amount exists as a free reduced Hcy (about 0.1 μM). The majority of the unbound fraction of Hcy is oxidized, and forms dimers (homocystine) or mixed disulphides consisting of cysteine and Hcy.
Two main pathways of Hcy biotoxicity are discussed:
Hcy-dependent oxidative stress – generated during oxidation of the free thiol group of Hcy. Hcy binds via a disulphide bridge with
— plasma proteins
— or with other low-molecular plasma thiols
— or with a second Hcy molecule.
Accumulation of oxidized biomolecules alters the biological functions of many cellular pathways.
Hcy-induced protein structure modifications, named homocysteinylation.
Two main types of homocysteinylation exist: S-homocysteinylation and N-homocysteinylation; both considered as posttranslational protein modifications.
a) S-homocysteinylation occurs when Hcy reacts, by its free thiol group, with another free thiol derived from a cysteine residue in a protein molecule.
These changes can alter the thiol-dependent redox status of proteins.
b) N-homocysteinylation takes place after acylation of the free ε-amino lysine groups of proteins by the most reactive form of Hcy — its cyclic thioester (Hcy thiolactone — HTL), representing up to 0.29% of total plasma Hcy.
Homocysteine occurs in human blood plasma in several forms, including the most reactive one, the homocysteine thiolactone (HTL) — a cyclic thioester, which represents up to 0.29% of total plasma Hcy. In human blood, N-homocysteinylated (N-Hcy-protein) and S-homocysteinylated proteins (S-Hcy-protein) such as NHcy-hemoglobin, N-(Hcy-S-S-Cys)-albumin, and S-Hcyalbumin are known. Other pathways of Hcy biotoxicity might be apoptosis and excitotoxicity mediated through glutamate receptors. The relationship between homocysteine and risk appears to hold for total plasma concentrations of homocysteine between 10 and 30 μM.
Different forms of homocysteine present in human blood.
*Total level of homocysteine — the term “total homocysteine” describes the pool of homocysteine released by reduction of all disulphide bonds in the sample (Perla-Kajan et al., 2007; Zimny, 2008; Manolescu et al., 2010, modified).
The form of Hcy
The concentration in human blood
Homocysteine thiolactone (HTL)
0–35 nM
Protein N-linked homocysteine:
N-Hcy-hemoglobin, N-(Hcy-S-S-Cys)-albumin
about 15.5 μM: 12.7 μM, 2.8 μM
Protein S-linked homocysteine — S-Hcy-albumin
about 7.3 μM*
Homocystine (Hcy-S-S-Hcy) and combined with cysteine to from mixed disulphides (Hcy-S-S-Cys)
about 2 μM*
Free reduced Hcy
about 0.1 μM*
As early as in the 1960s it was noted that the risk of atherosclerosis is markedly increased in patients with homocystinuria, an inherited disease resulting from homozygous CBS deficiency and characterized by episodes of
— thromboembolism
— mental retardation
— lens dislocation
— hepatic steatosis
— osteoporosis.
— very high concentrations of plasma homocysteine and methionine.
Patients with homocystinuria have very severe hyperhomocysteinemia, with plasma homocysteine concentration reaching even 400 μM, and represent a very small proportion of the population (approximately 1 in 200,000 individuals). Heterozygous lack of CBS, CBS mutations and polymorphism of the methylenetetrahydrofolate reductase gene are considered to be the most probable causes of hyperhomocysteinemia.
The effects of hyperhomocysteinemia include the complex process of hemostasis, which regulates the properties of blood flow. Interactions of homocysteine and its different derivatives, including homocysteine thiolactone, with the major components of hemostasis are:
endothelial cells
platelets
fibrinogen
plasminogen
Elevated plasma Hcy (>15 μM; Hcy) is associated with an increased risk of cardiovascular diseases
thrombosis
thrombosis related diseases
ischemic brain stroke (independent of other, conventional risk factors of this disease)
Every increase of 2.5 μM in plasma Hcy may be associated with an increase of stroke risk of about 20%. Total plasma Hcy level above 20 μM are associated with a nine-fold increase of the myocardial infarction and stroke risk, in comparison to the concentrations below 9 μM. The increase of Hcy concentration has been also found in other human pathologies, including neurodegenerative diseases
Modifications of hemostatic proteins (N-homocysteinylation or S-homocysteinylation) induced by Hcy or its thiolactone seem to be the main cause of homocysteine biotoxicity in hemostatic abnormalities.
Hcy and HTL may act as oxidants, but various polyphenolic antioxidants are able to inhibit the oxidative damage induced by Hcy or HTL. Therefore, we have to consider the role of phenolic antioxidants in hyperhomocysteinemia –induced changes in hemostasis.
The synthesis of homocysteine thiolactone is associated with the activation of the amino acid by aminoacyl-tRNA synthetase (AARS). Hcy may also undergo erroneous activation, e.g. by methionyl-t-RNA synthetase (MetRS). In the first step of conversion of Hcy to HTL, MetRS misactivates Hcy giving rise to homocysteinyl-adenylate. In the next phase, the homocysteine side chain thiol group reacts with the activated carboxyl group and HTL is produced. The level of HTL synthesis in cultured cells depends on Hcy and Met levels.
Hyperhomocysteinemia and Changes in Fibrinolysis and Coagulation Process
The fibrinolytic activity of blood is regulated by specific inhibitors; the inhibition of fibrinolysis takes place at the level of plasminogen activation (by PA-inhibitors: plasminogen activator inhibitor type-1, -2; PAI-1 or PAI-2) or at the level of plasmin activity (mainly by α2-antiplasmin). Hyperhomocysteinemia disturbs hemostasis and shifts the hemostatic mechanisms in favor of thrombosis. The recent reports indicate that the prothrombotic state observed in hyperhomocysteinemia may arise not only due to endothelium dysfunction or blood platelet and coagulation activation, but also due to impaired fibrinolysis. Hcy-modified fibrinogen is more resistant to the fibrinolytic action. Oral methionine load increases total Hcy, but may diminish the fibrinolytic activity of the euglobulin plasma fraction. Homocysteine-lowering therapies may increase fibrinolytic activity, thereby, prevent atherothrombotic events in patients with cardiovascular diseases after the first myocardial infarction.
Homocysteine — Fibronectin Interaction and its Consequences
Fibronectin (Fn) plays key roles in
cell adhesion
migration
embryogenesis
differentiation
hemostasis
thrombosis
wound healing
tissue remodeling
Interaction of FN with fibrin, mediated by factor XIII transglutaminase, is thought to be important for cell adhesion or cell migration into fibrin clots. After tissue injury, a blood clot formation serves the dual role of restoring vascular integrity and serving as a temporary scaffold for the wound healing process. Fibrin and plasma FN, the major protein components of blood clots, are essential to perform these functions. In the blood clotting process, after fibrin deposition, plasma FN-fibrin matrix is covalently crosslinked, and it then promotes fibroblast adhesion, spreading, and migration into the clot.
Homocysteine binds to several human plasma proteins, including fibronectin. If homocysteine binds to fibronectin via a disulphide linkage, this binding results in a functional change, namely, the inhibition of fibrin binding by fibronectin. This inhibition may lead to a prolonged recovery from a thrombotic event and contribute to vascular occlusion.
Grape seeds are one of the richest plant sources of phenolic substances, and grape seed extract reduces the toxic effect of Hcys and HTL on fibrinolysis. The grape seed extract (12.5–50 μg/ml) supported plasminogen to plasmin conversion inhibited by Hcys or HTL. In vitro experiments showed in the presence of grape seed extract (at the highest tested concentration — 50 μg/ml) the increase of about 78% (for human plasminogen-treated with Hcys) and 56% (for human plasma-treated with Hcys). Thus, in the in vitro model system, that the grape seed extract (12.5–50 μg/ml) diminished the reduction of thiol groups and of lysine ε-amino groups in plasma proteins treated with Hcys (0.1 mM) or HTL (1 μM). In the presence of the grape seed extract at the concentration of 50 μg/ml, the level of reduction of thiol groups reached about 45% (for plasma treated with Hcys) and about 15% (for plasma treated with HTL).
In the presence of the grape seed extract at the concentration of 50 μg/ml, the level of reduction of thiol groups reached about 45% (for plasma treated with Hcys) and about 15% (for plasma treated with HTL).Very similar protective effects of the grape seed extract were observed in the measurements of lysine ε-amino groups in plasma proteins treated with Hcys or HTL. These results indicated that the extract from berries of Aronia melanocarpa (a rich source of phenolic substances) reduces the toxic effects of Hcy and HTL on the hemostatic properties of fibrinogen and plasma. These findings indicate a possible protective action of the A. melanocarpa extract in hyperhomocysteinemia-induced cardiovascular disorders. Moreover, the extract from berries of A. melanocarpa, due to its antioxidant action, significantly attenuated the oxidative stress (assessed by measuring of the total antioxidant status — TAS) in plasma in a model of hyperhomocysteinemia.
Proposed model for the protective role of phenolic antioxidants on selected elements of hemostasis during hyperhomocysteinemia.
various antioxidants (present in human diet), including phenolic compounds, may reduce the toxic effects of Hcy or its derivatives on hemostasis. These findings give hope for the develop development of dietary supplements, which will be capable of preventing thrombosis which occurs under pathological conditions, observed also in hyperhomocysteinemia, such as plasma procoagulant activity and oxidative stress.
Lipoprotein (a) (Lp(a)), for the first time described in 1963 by Berg belongs to the lipoproteins with the strongest atherogenic effect. Its importance for the development of various atherosclerotic vasculopathies (coronary heart disease, ischemic stroke, peripheral vasculopathy, abdominal aneurysm) was recognized considerably later.
Lipoprotein(a) (Lp(a)), an established risk marker of cardiovascular diseases, is independent from other risk markers. The main difference of Lp(a) compared to low density lipoprotein (LDL) is the apo(a) residue, covalently bound to apoB is covalently by a disulfide-bridge. Apo(a) synthesis is performed in the liver, probably followed by extracellular assembly to the apoB location of the LDL.
ApoB-100_______LDL¬¬___ S-S –
9
Apo(a) has been detected bound to triglyceride-rich lipoproteins (Very Low Density Lipoproteins; VLDL). Corresponding to the structural similarity to LDL, both particles are very similar to each other with regard to their composition. It is a glycoprotein which underlies a large genetic polymorphism caused by a variation of the kringle-IV-type-2 repeats of the protein, characterized by a structural homology to plasminogen. Apo(a)’s structural homology to plasminogen, shares the gene localization on chromosome 6. The kringle repeats present a particularly characteristic structure, which have a high similarity to kringle IV (K IV) of plasminogen. Apo(a) also has a kringle V structure of plasminogen and also a protease domain, which cannot be activated, as opposed to the one of plasminogen. At least 30 genetically determined apo(a) isoforms were identified in man.
Features:
Non covalent binding of kringle -4 types 7 and 8 of apo (a) to apo B
Disulfide bond at Cys4326 of ApoB (near its receptor binding domain ) and the only free cysteine group in K –IV type 9 (Cys4057) of apo(a )
Binding to fibrin and cell membranes
Enhancement by small isoforms ; high concentrations compared to plasminogen and homocysteine
Binding to different lysine rich components of the coagulation system (e. g. TFPI)
Intense homology to plasminogen but no protease activity
ApoB-100_______LDL¬¬___ S-S –
9
The synthesis of Lp(a), which thus occurs as part of an assembly, is a two-step process.
In a first step, which can be competitively inhibited by lysine analogues, the free sulfhydryl groups of apo(a) and apoB are brought close together.
The binding of apo(a) then occurs near the apoB domain which binds to the LDL receptor, resulting in a reduced affinity of Lp(a) to the LDL-receptor.
Particles that show a reduced affinity to the LDL receptor are not able to form stable compounds with apo(a). Thus the largest part of apo(a) is present as apo(a) bound to LDL. Only a small, quantitatively variable part of apo(a) remains as free apo(a) and probably plays an important role in the metabolism and physiological function of Lp(a).
The Lp(a) plasma concentration in the population is highly skewed and determined to more than 90 % by genetic factors. In healthy subjects the Lp(a)-concentration is correlated with its synthesis.
It is assumed that the kidney has a specific function in Lp(a) catabolizm, since nephrotic syndrome and terminal kidney failure are associated with an elevation of the Lp(a) plasma concentration. One consequence of the poor knowledge of the metabolic path of Lp(a) is the fact that so far pharmaceutical science has failed to develop drugs that are able to reduce elevated Lp(a) plasma concentrations to a desirable level.
Plasma concentrations of Lp(a) are affected by different diseases (e.g. diseases of liver and kidney), hormonal factors (e.g. sexual steroids, glucocorticoids, thyroid hormones), individual and environmental factors (e.g. age, cigarette smoking) as well as pharmaceuticals (e.g. derivatives of nicotinic acid) and therapeutic procedures (lipid apheresis). This review describes the physiological regulation of Lp(a) as well as factors influencing its plasma concentration.
Apart from its significance as an important agent in the development of atherosclerosis, Lp(a) has even more physiological functions, e.g. in
wound healing
angiogenesis
hemostasis
However, in the meaning of a pleiotropic mechanism the favorable action mechanisms are opposed by pathogenic mechanisms, whereby the importance of Lp(a) in atherogenesis is stressed.
Lp(a) in Atherosclerosis
In transgenic, hyperlipidemic and Lp(a) expressing Watanabe rabbits, Lp(a) leads to enhanced atherosclerosis. Under the influence of Lp(a), the binding of Lp(a) to glycoproteins, e.g. laminin, results – via its apo(a)-part – both in
an increased invasion of inflammatory cells and in
an activation of smooth vascular muscle cells
with subsequent calcifications in the vascular wall.
The inhibition of transforming growth factor-β1 (TGF-β1) activation is another mechanism via which Lp(a) contributes to the development of atherosclerotic vasculopathies. TGF-β1 is subject to proteolytic activation by plasmin and its active form leads to an inhibition of the proliferation and migration of smooth muscle cells, which play a central role in the formation and progression of atherosclerotic vascular diseases.
In man, Lp(a) is an important risk marker which is independent of other risk markers. Its importance, partly also under consideration of the molecular weight and other genetic polymorphisms, could be demonstrated by a high number of epidemiological and clinical studies investigating the formation and progression of atherosclerosis, myocardial infarction, and stroke.
Lp(a) in Hemostasis
Lp(a) is able to competitively inhibit the binding of plasminogen to fibrinogen and fibrin, and to inhibit the fibrin-dependent activation of plasminogen to plasmin via the tissue plasminogen activator, whereby apo(a) isoforms of low molecular weight have a higher affinity to fibrin than apo(a) isoforms of higher molecular weight. Like other compounds containing sulfhydryl groups, homocysteine enhances the binding of Lp(a) to fibrin.
Pleiotropic effect of Lp(a).
Prothrombotic :
Binding to fibrin
Competitive inhibition of plasminogen
Stimulation of plasminogen activator inhibitor I and II (PAI -I, PAI -II)
Inactivation of tissue factor pathway inhibitor (TFPI)
Antithrombotic :
Inhibition of platelet activating factor acetylhydrolase (PAF -AH)
Inhibition of platelet activating factor
Inhibition of collagen dependent platelet aggregation
Inhibition of secretion of serotonin und thromboxane
Lp(a) in Angiogenesis
Lp(a) is also important for the process of angiogenesis and the sprouting of new vessels.
angiogenesis starts with the remodelling of matrix proteins and
activation of matrix metalloproteinases (MMP).
The latter ones are usually synthesised as
inactive zymogens and
require activation by proteases,
Recall that Apo(a) is not activated by proteases. The angiogenesis is also accomplished by plasminogen. Lp(a) and apo(a) and its fragments has an antiangiogenetic and metastasis inhibiting effect related to the structural homology with plasminogen without the protease activity.
In 1985, Brown and Goldstein were awarded the Nobel Prize for medicine for their work on the regulation of cholesterol metabolism. On the basis of numerous studies, they were able to demonstrate that circulating low-density lipoprotein (LDL) is absorbed into the cell through receptor linked endocytosis. The absorption of LDL into the cell is specific and is mediated by a LDL receptor. In patients with familial hypercholesterolemia, this receptor is changed, and the LDL particles can no longer be recognized. Their absorption can thus no longer be mediated, leading to an accumulation of LDL in blood.
Furthermore, an excess supply of cholesterol also blocks the 3-hydrox-3 methylglutaryl-Co enzyme A (HMG CoA), reductase enzyme, which otherwise inhibits the cholesterol synthesis rate. Brown and Goldstein also determined the structure of the LDL receptor. They discovered structural defects in this receptor in many patients with familial hypercholesterolemia. Thus, familial hypercholesterolemia was the first metabolic disease that could be tracked back to the mutation of a receptor gene.
Dyslipoproteinemia in combination with diabetes mellitus causes a cumulative insult to the vasculature resulting in more severe disease which occurs at an earlier age in large and small vessels as well as capillaries. The most common clinical conditions resulting from this combination are myocardial infarction and lower extremity vascular disease. Ceriello et al. show an independent and cumulative effect of postprandial hypertriglyceridemia and hyperglycemia on endothelial function, suggesting oxidative stress as common mediator of such effect. The combination produces greater morbidity and mortality than either alone.
As an antiatherogenic factor, HDL cholesterol correlates inversely to the extent of postprandial lipemia. A high concentration of HDL is a sign that triglyceride-rich particles are quickly decomposed in the postprandial phase of lipemia. Conversely, with a low HDL concentration this decomposition is delayed. Thus, excessively high triglyceride concentrations are accompanied by very low HDL counts. This combination has also been associated with an increased risk of pancreatitis.
The importance of lipoprotein (a) (Lp(a)) as an atherogenic substance has also been recognized in recent years. Lp(a) is very similar to LDL. But it also contains Apo(a), which is very similar to plasminogen, enabling Lp(a) to bind to fibrin clots. Binding of plasminogen is prevented and fibrinolysis obstructed. Thrombi are integrated into the walls of the arteries and become plaque components.
Another strong risk factor for accelerated atherogenesis, which must be mentioned here, are the widespread high homocysteine levels found in dialysis patients. This risk factor is independent of classic risk factors such as high cholesterol and LDL levels, smoking, hypertension, and obesity, and much more predictive of coronary events in dialysis patients than are these better-known factors. Homocysteine is a sulfur aminoacid produced in the metabolism of methionine. Under normal conditions, about 50 percent of homocysteine is remethylated to methionine and the remaining via the transsulfuration pathway.
Defining hyperhomocysteinemia as levels greater than the 90th percentile of controls and elevated Lp(a) level as greater than 30mg/dL, the frequency of the combination increased with declining renal function. Fifty-eight percent of patients with a GFR less than 10mL/min had both hyperhomocysteinemia and elevated Lp(a) levels, and even in patients with mild renal impairment, 20 percent of patients had both risk factors present.
The prognosis of patients suffering from severe hyperlipidemia, sometimes combined with elevated lipoprotein (a) levels, and coronary heart disease refractory to diet and lipid-lowering drugs is poor. For such patients, regular treatment with low-density lipoprotein (LDL) apheresis is the therapeutic option. Today, there are five different LDL-apheresis systems available: cascade filtration or lipid filtration, immunoadsorption, heparin-induced LDL precipitation, dextran sulfate LDL adsorption, and the LDL hemoperfusion. The requirement that the original level of cholesterol is to be reduced by at least 60 percent is fulfilled by all these systems.
There is a strong correlation between hyperlipidemia and atherosclerosis. Besides the elimination of other risk factors, in severe hyperlipidemia therapeutic strategies should focus on a drastic reduction of serum lipoproteins. Despite maximum conventional therapy with a combination of different kinds of lipid-lowering drugs, sometimes the goal of therapy cannot be reached. Hence, in such patients, treatment with LDL-apheresis is indicated. Technical and clinical aspects of these five different LDL-apheresis methods are depicted. There were no significant differences with respect to or concerning all cholesterols, or triglycerides observed.
High plasma levels of Lp(a) are associated with an increased risk for atherosclerotic coronary heart disease
(CHD) by a mechanism yet to be determined. Because of its structural properties, Lp(a) can have both atherogenic and thrombogenic potentials. The means for correcting the high plasma levels of Lp(a) are still limited in effectiveness. All drug therapies tried thus far have failed. The most effective therapeutic methods in lowering Lp(a) are the LDL-apheresismethods. Since 1993, special immunoadsorption polyclonal antibody columns (Pocard, Moscow, Russia) containing sepharose bound anti-Lp(a) have been available for the treatment of patients with elevated Lp(a) serum concentrations.
With respect to elevated lipoprotein (a) levels, however, the immunoadsorption method seems to be most effective. The different published data clearly demonstrate that treatment with LDL-apheresis in patients suffering from severe hyperlipidemia refractory to maximum conservative therapy is effective and safe in long-term application.
LDL-apheresis decreases not only LDL mass but also improves the patient’s life expectancy. LDL-apheresis performed with different techniques decreases the susceptibility of LDL to oxidation. This decrease may be related to a temporary mass imbalance between freshly produced and older LDL particles. Furthermore, the baseline fatty acid pattern influences pretreatment and postreatment susceptibility to oxidation.
Bambauer R, Bambauer C, Lehmann B, Latza R, and Ralf Schiel R. LDL-Apheresis: Technical and Clinical Aspects. The Scientific World Journal 2012; Article ID 314283, pp 1-19. doi:10.1100/2012/314283
Summary: This discussion is a two part sequence that first establishes the known strong relationship between blood flow viscosity, shear stress, and plasma triglycerides (VLDL) as risk factors for hemostatic disorders leading to thromboembolic disease, and the association with atherosclerotic disease affecting the heart, the brain (via carotid blood flow), peripheral circulation,the kidneys, and retinopathy as well.
The second part discusses the modeling of hemostasis and takes into account the effects of plasma proteins involved with red cell and endothelial interaction, which is related to part I. The current laboratory assessment of thrombophilias is taken from a consensus document of the American Society for Clinical Pathology. The problems encountered are sufficient for the most common problems of coagulation testing and monitoring, but don’t address the large number of patients who are at risk for complications of accelerated vasoconstrictive systemic disease that precede serious hemostatic problems. Special attention is given to Lp(a) and to homocysteine. Lp(a) is a protein that has both prothrombotic and antithrombotic characteristics, and is a homologue of plasminogen and is composed of an apo(a) bound to LDL. Unlike plasminogen, it has no protease activity. Homocysteine elevation is a known risk factor for downstream myocardial infarct. Homocysteine is a mirror into sulfur metabolism, so an increase is an independent predictor of risk, not fully discussed here. The modification of risk is discussed by diet modification. In the most serious cases of lipoprotein disorders, often including Lp(a) the long term use of LDL-apheresis is described.
see Relevent article that appears in NEJM from American College of Cardiology
Apolipoprotein(a) Genetic Sequence Variants Associated With Systemic Atherosclerosis and Coronary Atherosclerotic Burden but Not With Venous Thromboembolism
Helgadottir A, Gretarsdottir S, Thorleifsson G, et al
J Am Coll Cardiol. 2012;60:722-729
Study Summary
The LPA gene codes for apolipoprotein(a), which, when linked with low-density lipoprotein particles, forms lipoprotein(a) [Lp(a)] — a well-studied molecule associated with coronary artery disease (CAD). The Lp(a) molecule has both atherogenic and thrombogenic effects in vitro , but the extent to which these translate to differences in how atherothrombotic disease presents is unknown.
LPA contains many single-nucleotide polymorphisms, and 2 have been identified by previous groups as being strongly associated with levels of Lp(a) and, as a consequence, strongly associated with CAD. However, because atherosclerosis is thought to be a systemic disease, it is unclear to what extent Lp(a) leads to atherosclerosis in other arterial beds (eg, carotid, abdominal aorta, and lower extremity), as well as to other thrombotic disorders (eg, ischemic/cardioembolic stroke and venous thromboembolism). Such distinctions are important, because therapies that might lower Lp(a) could potentially reduce forms of atherosclerosis beyond the coronary tree.
To answer this question, Helgadottir and colleagues compiled clinical and genetic data on the LPA gene from thousands of previous participants in genetic research studies from across the world. They did not have access to Lp(a) levels, but by knowing the genotypes for 2 LPA variants, they inferred the levels of Lp(a) on the basis of prior associations between these variants and Lp(a) levels. [1] Their studies included not only individuals of white European descent but also a significant proportion of black persons, in order to widen the generalizability of their results.
Their main findings are that LPA variants (and, by proxy, Lp(a) levels) are associated with CAD, peripheral arterial disease, abdominal aortic aneurysm, number of CAD vessels, age at onset of CAD diagnosis, and large-artery atherosclerosis-type stroke. They did not find an association with cardioembolic or small-vessel disease-type stroke; intracranial aneurysm; venous thrombosis; carotid intima thickness; or, in a small subset of individuals, myocardial infarction.
Viewpoint
The main conclusion to draw from this work is that Lp(a) is probably a strong causal factor in not only CAD, but also the development of atherosclerosis in other arterial trees. Although there is no evidence from this study that Lp(a) levels contribute to venous thrombosis, the investigators do not exclude a role for Lp(a) in arterial thrombosis.
Large-artery atherosclerosis stroke is thought to involve some element of arterial thrombosis or thromboembolism, [2] and genetic substudies of randomized trials of aspirin demonstrate that individuals with LPA variants predicted to have elevated levels of Lp(a) benefit the most from antiplatelet therapy. [3] Together, these data suggest that Lp(a) probably has clinically relevant effects on the development of atherosclerosis and arterial thrombosis.
Of note, the investigators found no association between Lp(a) and carotid intima thickness, suggesting that either intima thickness is a poor surrogate for the clinical manifestations of atherosclerosis or that Lp(a) affects a distinct step in the atherosclerotic disease process that is not demonstrable in the carotid arteries.
Although Lp(a) testing is available, these studies do not provide any evidence that testing for Lp(a) is of clinical benefit, or that screening for atherosclerosis should go beyond well-described clinical risk factors, such as low-density lipoprotein cholesterol levels, high-density lipoprotein levels, hypertension, diabetes, smoking, and family history. Until evidence demonstrates that adding information on Lp(a) levels to routine clinical practice improves the ability of physicians to identify those at highest risk for atherosclerosis, Lp(a) testing should remain a research tool. Nevertheless, these findings do suggest that therapies to lower Lp(a) may have benefits that extend to forms of atherothrombosis beyond the coronary tree.
Comment by Larry H Bernstein, MD:
The finding of this study is interesting:
[1] It consistent with Dr. William LaFramboise.. examination specifically at APO B100, which is part of Lp(a) with some 14 candidate predictors for a more accurate exclusion of patients who don’t need intervention. Apo B100 was not one of 5 top candidates.
William LaFramboise • Our study (http://www.ncbi.nlm.nih.gov/pubmed/23216991) comprised discovery research using targeted immunochemical screening of retrospective patient samples using both Luminex and Aushon platforms as opposed to shotgun proteomics. Hence the costs constrained sample numbers. Nevertheless, our ability to predict outcome substantially exceeded available methods:
The Framingham CHD scores were statistically different between groups (P <0.001, unpaired Student’s t test) but they classified only 16% of the subjects without significant CAD (10 of 63) at a 95% sensitivity for patients with CAD. In contrast, our algorithm incorporating serum values for OPN, RES, CRP, MMP7 and IFNγ identified 63% of the subjects without significant CAD (40 of 63) at 95% sensitivity for patients with CAD. Thus, our multiplex serum protein classifier correctly identified four times as many patients as the Framingham index.
This study is consistent with the concept of CAD, PVD, and atheromatous disease is a systemic vascular disease, but the point that is made is that it appears to have no relationship to venous thrombosis. The importance for predicting thrombotic events is considered serious. The venous flow does not have the turbulence of large arteries, so the conclusion is no surprise. The flow in capillary beds is a linear cell passage with minimal viscosity or turbulence. The finding of no association with carotid artery disease is interpreted to mean that the Lp(a) might be an earlier finding than carotid intimal thickness. It is reassuring to find a recommendation for antiplatelet therapy for individuals with LPA variants based on randomized trials of aspirin substudies.
If that is the conclusion from the studies, and based on the strong association between the prothrombotic (pleiotropic) effect and the association with hyperhomocysteinemia, my own impression is that the recommendation is short-sighted.
[2] Lp(a) is able to competitively inhibit the binding of plasminogen to fibrinogen and fibrin, and to inhibit the fibrin-dependent activation of plasminogen to plasmin via the tissue plasminogen activator, whereby apo(a) isoforms of low molecular weight have a higher affinity to fibrin than apo(a) isoforms of higher molecular weight. Like other compounds containing sulfhydryl groups, homocysteine enhances the binding of Lp(a) to fibrin.
Prothrombotic :
Binding to fibrin
Competitive inhibition of plasminogen
Stimulation of plasminogen activator inhibitor I and II (PAI -I, PAI -II)
Inactivation of tissue factor pathway inhibitor (TFPI)
Lowe GD, Lee AJ, Rumley A, et al. Blood viscosity and risk of cardiovascular events: the Edinburgh Artery Study. Br J Haematol 1997; 96:168-173.
Sloop GD. A unifying theory of atherogenesis. Med Hypotheses. 1996; 47:321-5. Smith WC, Lowe GD, et al. Rheological determinants of blood pressure in a Scottish adult population. J Hypertens 1992; 10:467-72.
Letcher RL, Chien S, et al. Direct relationship between blood pressure and blood viscosity in normal and hypertensive subjects. Role of fibrinogen and concentration. Am J Med 1981; 70:1195-1202.
Devereux RB, Case DB, Alderman MH, et al. Possible role of increased blood viscosity in the hemodynamics of systemic hypertension. Am J Cardiol 2000; 85:1265-1268.
Levenson J, Simon AC, Cambien FA, Beretti C. Cigarette smoking and hypertension. Factors independently associated with blood hyperviscosity and arterial rigidity. Arteriosclerosis 1987; 7:572-577.
Sloop GD, Garber DW. The effects of low-density lipoprotein and high-density lipoprotein on blood viscosity correlate with their association with risk of atherosclerosis in humans. Clin Sci 1997; 92:473-479.
Rosenson RS, Shott S, Tangney CC. Hypertriglyceridemia is associated with an elevated blood viscosity: triglycerides and blood viscosity. Atherosclerosis 2002; 161:433-9.
Stamos TD, Rosenson RS. Low high density lipoprotein levels are associated with an elevated blood viscosity. Atherosclerosis 1999; 146:161-5.
Hoieggen A, Fossum E, Moan A, Enger E, Kjeldsen SE. Whole-blood viscosity and the insulin-resistance syndrome. J Hypertens 1998; 16:203-10.
de Simone G, Devereux RB, Chien S, et al. Relation of blood viscosity to demographic and physiologic variables and to cardiovascular risk factors in apparently normal adults. Circulation 1990; 81:107-17.
Rosenson RS, McCormick A, Uretz EF. Distribution of blood viscosity values and biochemical correlates in healthy adults. Clin Chem 1996; 42:1189-95.
Tamariz LJ, Young JH, Pankow JS, et al. Blood viscosity and hematocrit as risk factors for type 2 diabetes mellitus: The Atherosclerosis Risk in Communities (ARIC) Study. Am J Epidemiol 2008; 168:1153-60.
Jax TW, Peters AJ, Plehn G, Schoebel FC. Hemostatic risk factors in patients with coronary artery disease and type 2 diabetes – a two year follow-up of 243 patients. Cardiovasc Diabetol 2009; 8:48.
Ernst E, Weihmayr T, et al. Cardiovascular risk factors and hemorheology. Physical fitness, stress and obesity. Atherosclerosis 1986; 59:263-9.
Hoieggen A, Fossum E, et al. Whole-blood viscosity and the insulin-resistance syndrome. J Hypertens 1998; 16:203-10.
Carroll S, Cooke CB, Butterly RJ. Plasma viscosity, fibrinogen and the metabolic syndrome: effect of obesity and cardiorespiratory fitness. Blood Coagul Fibrinolysis 2000; 11:71-8.
Ernst E, Koenig W, Matrai A, et al. Blood rheology in healthy cigarette smokers. Results from the MONICA project, Augsburg. Arteriosclerosis 1988; 8:385-8.
Lowe GD, Drummond MM, Forbes CD, Barbenel JC. The effects of age and cigarette-smoking on blood and plasma viscosity in men. Scott Med J 1980; 25:13-7.
Fowkes FG, Pell JP, Donnan PT, et al. Sex differences in susceptibility to etiologic factors for peripheral atherosclerosis. Importance of plasma fibrinogen and blood viscosity. Arterioscler Thromb 1994; 14:862-8.
Subtitle: Nitric oxide in hemostatic and bleeding mechanisms. Part II.
Summary: This is the second of a coagulation series on PharmaceuticalIntelligence(wordpress.com) treating the diverse effects of NO on platelets, the coagulation cascade, and protein-membrane interactions with low flow states, local and systemic inflammatory disease, oxidative stress, and hematologic disorders. It is highly complex as the distinction between intrinsic and extrinsic pathways become blurred as a result of endothelial shear stress, distinctly different than penetrating or traumatic injury. In addition, other factors that come into play are also considered.
The workhorse tests of the modern coagulation laboratory, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT), are the basis for the published extrinsic and intrinsic coagulation pathways. This is, however, a much simpler model than one encounters delving into the mechanism and interactions involved in hemostasis and thrombosis, or in hemorrhagic disorders.
We first note that there are three components of the hemostatic system in all vertebrates:
Platelets,
vascular endothelium, and
plasma proteins.
The liver is the largest synthetic organ, which synthesizes
albumin,
acute phase proteins,
hormonal and metal binding proteins,
albumin,
IGF-1, and
prothrombin, mainly responsible for the distinction between plasma and serum (defibrinated plasma).
Role of vascular endothelium.
I have identified the importance of prothrombin, thrombin, and the divalent cation Ca 2+ (1% of the total body pool), mention of heparin action, and of vitamin K (inhibited by warfarin). Endothelial functions are inherently related to procoagulation and anticoagulation. The subendothelial matrix is a complex of many materials, most important related to coagulation being collagen and von Willebrand factor.
What about extrinsic and intrinsic pathways? Tissue factor, when bound to factor VIIa, is the major activator of the extrinsic pathway of coagulation. Classically, tissue factor is not present in the plasma but only presented on cell surfaces at a wound site, which is “extrinsic” to the circulation. Or is it that simple?
Endothelium is the major synthetic and storage site for von Willebrand factor (vWF). vWF is…
secreted from the endothelial cell both into the plasma and also
abluminally into the subendothelial matrix, and
acts as the intercellular glue binding platelets to one another and also to the subendothelial matrix at an injury site.
acts as a carrier protein for factor VIII (antihemophilic factor).
It binds to the platelet glycoprotein Ib/IX/V receptor and
mediates platelet adhesion to the vascular wall under shear. [Lefkowitz JB. Coagulation Pathway and Physiology. Chapter I. in Hemostasis Physiology. In ( ???), pp1-12].
Ca++ and phospholipids are necessary for all of the reactions that result in the activation of prothrombin to thrombin. Coagulation is initiated by an extrinsic mechanism that
generates small amounts of factor Xa, which in turn
activates small amounts of thrombin.
The tissue factor/factorVIIa proteolysis of factor X is quickly inhibited by tissue factor pathway inhibitor (TFPI).The small amounts of thrombin generated from the initial activation feedback
to create activated cofactors, factors Va and VIIIa, which in turn help to
generate more thrombin.
Tissue factor/factor VIIa is also capable of indirectly activating factor X through the activation of factor IX to factor IXa.
Finally, as more thrombin is created, it activates factor XI to factor XIa, thereby enhancing the ability to ultimately make more thrombin.
The reconceptualization of hemostasis
The common theme in activation and regulation of plasma coagulation is the reduction in dimensionality. Most reactions take place in a 2D world that will increase the efficiency of the reactions dramatically. The localization and timing of the coagulation processes are also dependent on the formation of protein complexes on the surface of membranes. The coagulation processes can also be controlled by certain drugs that destroy the membrane binding ability of some coagulation proteins – these proteins will be lost in the 3D world and not able to form procoagulant complexes on surfaces.
Assembly of proteins on membranes – making a 3D world flat
• The timing and efficiency of coagulation processes are handled by reduction in dimensionality
– Make 3 dimensions to 2 dimensions
• Coagulation proteins have membrane binding capacity
• Membranes provide non-coagulant and procoagulant surfaces
– Intact cells/activated cells
• Membrane binding is a target for anticoagulant drugs
– Anti-vitamin K (e.g. warfarin)
Modern View
It can be divided into the phases of initiation, amplification and propagation.
In the initiation phase, small amounts of thrombin can be formed after exposure of tissue factor to blood.
In the amplification phase, the traces of thrombin will be inactivated or used for amplification of the coagulation process.
At this stage there is not enough thrombin to form insoluble fibrin. In order to proceed further thrombin activates platelets, which provide a procoagulant surface for the coagulation factors. Thrombin will also activate the vital cofactors V and VIII that will assemble on the surface of activated platelets. Thrombin can also activate factor XI, which is important in a feedback mechanism.
In the final step, the propagation phase, the highly efficient tenase and prothrombinase complexes have been assembled on the membrane surface. This yields large amounts of thrombin at the site of injury that can cleave fibrinogen to insoluble fibrin. Factor XI activation by thrombin then activates factor IX, which leads to the formation of more tenase complexes. This ensures enough thrombin is formed, despite regulation of the initiating TF-FVIIa complex, thus ensuring formation of a stable fibrin clot. Factor XIII stabilizes the fibrin clot through crosslinking when activated by thrombin.
Platelet Aggregation
The activities of adenylate and guanylate cyclase and cyclic nucleotide 3′:5′-phosphodiesterase were determined during the aggregation of human blood platelets with
The platelet guanylate cyclase activity during aggregation depends on the nature and mode of action of the inducing agent.
The membrane adenylate cyclase activity during aggregation is independent of the aggregating agent and is associated with a reduction of activity and
Cyclic nucleotide phosphodiesterase remains unchanged during the process of platelet aggregation and release.
The role of platelets in arterial thrombosis
Formation of a thrombus on a ruptured plaque is the product of a complex interaction between coagulation factors in the plasma and platelets.
Tissue factor (TF) released from the subendothelial tissue after endothelial damage induces a cascade of activation of coagulation factors ultimately leading to the formation of thrombin.
Thrombin cleaves fibrinogen to fibrin, which assembles into a mesh that supports the platelet aggregates.
The Platelet
The platelets are …
anucleated,
discoid shaped cell fragments
originating from megakaryocytes
fragmented as they are released from the bone marrow
Whether they can in circumstances be developed at extramedullary sites (liver sinusoid) is another matter. They have a lifespan of 7-10 days. Of special interest is:
They have a network of internal membranes forming a dense tubular system and the open canalicular system (OCS).
The plasma membrane is an extension of the OCS, thereby greatly increasing the surface area of the platelet.
The dense tubular system is comparable to the endoplasmatic reticulum in other cell types and is the main storage place of the majority of the platelet’s Ca2+.
Three types of secretory granules exist in platelets:
the dense granules
In the dense granules serotonin
adenosine diphosphate (ADP) and
Ca2+ are stored.
a-granules contain
P-selectin,
fibrinogen,
thrombospondin,
Von Willebrand Factor,
platelet factor 4 and
platelet derived growth factor
lysosomes.
Circulating platelets are kept in a resting state by endothelial cell derived
prostacyclin (PGI2) and
nitric oxide (NO).
PGI2 increases cyclic adenosine monophosphate (cAMP), the most potent platelet inhibitor.
Contact activation
The major regulator of the activation of the contact system is the plasma protease inhibitor, C1-INH, which inhibits activated fXII, kallikrein and fXIa. In addition, α2-macroglobulin is an important inhibitor of kallikrein and α1-antitrypsin for fXIa. Factor XII also converts the fXI to an active enzyme, fXIa, which, in turn, converts fIX to fIXa, thereby activating the intrinsic pathway of coagulation.
Activation
Several agonists can activate platelets;
ADP,
collagen,
thromboxane A2 (TxA2),
epinephrin,
serotonine and
thrombin,
which lead to activation previously referred to:
platelet shape change is
followed by aggregation and
granule secretion.
Upon activation the discoid shape changes into a spherical form.
Activation of platelets is increased by two positive feedback loops
arachidonic acid is cleaved from phospholipids and transformed by cyclooxygenase
(COX) to prostaglandin G2 and H2,
followed by the formation of TxA2, a potent platelet agonist.
2. the secretion of ADP by the dense granules,
resulting in activation of the ADP receptor P2Y12.
This causes inhibition of cyclic AMP and sustained aggregation.
Aggregation
The integrin receptor αIIbβ3 plays a vital role in platelet aggregation. The platelet agonists
induce a conformational change of the αIIbβ3 receptor and
exposition of binding domains for fibrinogen and von Willebrand Factor.
This allows cross-linking of platelets and the formation of aggregates.
In addition to shape change and aggregation, the membranes of the α- and dense granules fuse with the membranes of the OCS. This causes the release of their contents and the transportation of proteins embedded in their membrane to the plasma membrane.
This complex interaction between
endothelial cells
clotting factors
platelets and
other factors and cells
can be studied in both in vitro and in vivo model systems. The disadvantage of in vitro assays is that it studies the role of a certain protein or cell in isolation. Given the large number of participants and the complex interactions of thrombus formation there is need to study thrombosis and hemostasis in intact living animals, with all the components important for thrombus formation – a vessel wall and flowing blood – present.
Endothelial Damage and Role as “Primer”
Endothelial injury changes the permeability of the arterial wall.
This is followed by an influx of low-density lipoprotein (LDL).
This elicits an inflammatory response in the vascular wall.
Monocytes and T-cells bind to the endothelial cells promoting increased migration of the cells into the intima layer
The monocytes differentiate into macrophages, which take up modified lipoproteins and transform them into foam cells.
Concurrent with this process macrophages produce cytokines and proteases.
This is a vicious circle of lipid driven inflammation that leads to narrowing of the vessel’s lumen without early clinical consequences. Clinical manifestations of more advanced atherosclerotic disease are caused by destabilization of an atherosclerotic plaque formed as described.
The first recognizable lesion of the stable atherosclerotic plaque is the fatty streak, which consists of the above described foam cells and T-lymphocytes in the intima.
Further development of the lesion leads to the intermediate lesion, composed
of layers of macrophages and smooth muscle cells.
A more advanced stage is called the vulnerable plaque.
It has a large lipid core that is covered by a thin fibrous cap.
This cap separates the lipid contents of the plaque from the circulating blood.
The vulnerable plaque is prone to rupture, resulting in the formation of a thrombus on the site of disruption or the thrombus can be superimposed on plaque erosion without signs of plaque rupture.
The formation of a superimposed thrombus on a disrupted atherosclerotic plaque in the lumen of the artery leads to
an acute occlusion of the vessel
hypoxia of the downstream tissue.
Depending on the location of the atherosclerotic plaque this will cause a myocardial infarction, stroke or peripheral vascular disease.
Endothelial regulation of coagulation
The endothelium attenuates platelet activity by releasing
nitric oxide and
prostacyclin.
Several coagulation inhibitors are produced by endothelial cells.
Endothelium-derived TFPI (on its surface) is rapidly released into circulation after heparin administration, reducing the pro-coagulant activities of TF-fVIIa. Endothelial cells also secrete heparin-sulphate, a glycosaminoglycan which catalyzes anti-coagulant activity of AT. Plasma AT binds to heparin-sulphate located on the luminal surface and in the basement membrane of the endothelium. Thrombomodulin is another endothelium-bound protein with anti-coagulant and anti-inflammatory functions. In response to systemic pro-coagulant stimuli, tissue-type plasminogen activator (tPA) is transiently released from the Weibel-Palade bodies of endothelial cells to promote fibrinolysis. Downstream of the vascular injury, the complex of TF-fVIIa/fXa is inhibited by TFPI. Plasma (free) fXa and thrombin are rapidly neutralized by heparan-bound AT. Thrombin is also taken up by endothelial surface-bound thrombomodulin.
The protein C pathway works in hemostasis to control thrombin formation in the area surrounding the clot. Thrombin, generated via the coagulation pathway, is localized to the endothelium by binding to the integral membrane protein, thrombomodulin (TM). TM by occupying exosite I on thrombin, which is required for fibrinogen binding and cleavage, reduces thrombin’s pro-coagulant activities. TM bound thrombin on the endothelial cell surface is able to cleave PC producing activated protein C (APC), a serine protease. In the presence of protein S, APC inactivates FVa and FVIIIa. The proteolytic activity of APC is regulated predominantly by a protein C inhibitor.
Fibrinolytic pathway
Fibrinolysis is the physiological breakdown of fibrin to limit and resolve blood clots. Fibrin is degraded primarily by the serine protease, plasmin, which circulates as plasminogen. In an auto-regulatory manner, fibrin serves as both the co-factor for the activation of plasminogen and the substrate for plasmin. In the presence of fibrin, tissue plasminogen activator (tPA) cleaves plasminogen producing plasmin, which proteolyzes the fibrin. This reaction produces the protein fragment D-dimer, which is a useful marker of fibrinolysis, and a marker of thrombin activity because fibrin is cleaved from fibrinogen to fibrin.
Nitric Oxide and Platelet Energy Production
Nitric oxide (NO) has been increasingly recognized as an important intra- and intercellular messenger molecule with a physiological role in
vascular relaxation
platelet physiology
neurotransmission and
immune responses.
In vitro NO is a strong inhibitor of platelet adhesion and aggregation. In the blood stream, platelets remain in contact with NO that is permanently released from the endothelial cells and from activated macrophages. It has been suggested that the activated platelet itself is able to produce NO. It has been proposed that the main intracellular target for NO in platelets is soluble cytosolic guanylate cyclase. NO activates the enzyme. When activated, intracellular cGMP elevation inhibits platelet activation. Further, elevated cGMP may not be the sole factor directly involved in the inhibition of platelet activation.
The reaction mechanism of Nitric oxide synthase (Photo credit: Wikipedia)
Platelets are fairly active metabolically and have a total ATP turnover rate of about 3–8 times that of resting mammalian muscle. Platelets contain mitochondria which enable these cells to produce energy both in the oxidative and anaerobic pathways.
Under aerobic conditions, ATP is produced by aerobic glycolysis which can account for 30–50% of total ATP production,
by oxidative metabolism using glucose and glycogen (6–11%), amino-acids (7%) or free fatty acids (20–40%).
The inhibition of mitochondrial respiration by removing oxygen or by respiratory chain blockers (antimycin A, cyanide, rotenone) results in the stimulation of glycolytic flux. This phenomenon indicates that in platelets glycolysis and mitochondrial respiration are tightly functionally connected. It has been reported that the activation of human platelets by high concentration of thrombin is accompanied by an acceleration of lactate production and an increase in oxygen consumption.
The results (in porcine platelets) indicate that:
NO is able to diminish mitochondrial energy production through the inhibition of cytochrome oxidase
The inhibitory effect of NO on platelet secretion (but not aggregation) can be attributed to the reduction of mitochondrial energy production.
Porcine blood platelets stimulated by collagen produce more lactate. This indicates that both glycolytic and oxidative ATP production supports platelet responses, and blocking of energy production in platelets may decrease their responses. It is well established that platelet responses have different metabolic energy (ATP) requirements increasing in the order:
Aggregation
< dense and alfa granule secretion
< acid hydrolase secretion.
In addition, exogenously added NO (in the form of NO donors) stimulates glycolysis in intact porcine platelets. Since in platelets glycolysis and mitochondrial respiration are tightly functionally connected, this indicates the stimulatory effect of NO on glycolysis in intact platelets may be produced by non-functional mitochondria.
Can this be the case?
NO donors are able to inhibit both mitochondrial respiration and platelet cytochrome oxidase.
Interestingly, the concentrations of NO donors inhibiting mitochondrial respiration and cytochrome oxidase were similar to those stimulating glycolysis in intact platelets.
Studies have shown that mitochondrial complex I is inhibited only after a prolonged (6–18 h) exposure to NO and
This inhibition appears to result from S-nitrosylation of critical thiols in the enzyme complex.
Further studies are needed to establish whether long term exposure of platelets to NO affects Mitochondrial complexes I and II.
Comparison of the concentrations of SNAP and SNP affecting cytochrome oxidase activity and mitochondrial respiration with those reducing the platelet responses indicates that NO does not reduce platelet aggregation through the inhibition of oxidative energy production. The concentrations of the NO donors inhibiting platelet secretion, mitochondrial respiration and cytochrome oxidase were similar. Thus, the platelet release reaction strongly depends on the oxidative energy production, and in porcine platelets NO inhibits mitochondrial energy production at the step of cytochrome oxidase.
Taking into account that platelets may contain NO synthase and are able to produce significant amounts of NO it seems possible that nitric oxide can function in these cells as a physiological regulator of mitochondrial energy production.
Key words: glycolysis, mitochondrial energy production, nitric oxide, porcine platelets.
Abbreviations: NO, nitric oxide; SNAP, S-nitroso-N-acetylpenicyllamine; SNP, sodium nitroprusside.
The adhesion of human platelets to monolayers of bovine endothelial cells in culture was studied to determine the role of endothelium-derived nitric oxide in the regulation of platelet adhesion. The adhesion of unstimulated and thrombin-stimulated platelets, washed and labelled with indium-111, was lower in the presence than in the absence of bradykinin or exogenous nitric oxide. The inhibitory action of both bradykinin and nitric oxide was abolished by hemoglobin, but not by aspirin, and was potentiated by superoxide dismutase to a similar degree. It appears that the effect of bradykinin is mediated by the release of nitric oxide from the endothelial cells, and that nitric oxide release contributes to the non-adhesive properties of vascular endothelium.
1 The interactions between endothelium-derived nitric oxide (NO) and prostacyclin as inhibitors of platelet aggregation were examined to determine whether release of NO accounts for the inhibition of platelet aggregation attributed to EDRF.
2 Porcine aortic endothelial cells treated with indomethacin and stimulated with bradykinin (10-100 nM) released NO in quantities sufficient to account for the inhibition of platelet aggregation attributed to endothelium-derived relaxing factor (EDRF).
3 In the absence of indomethacin, stimulation of the cells with bradykinin (1-3 nM) released small amounts of prostacyclin and EDRF which synergistically inhibited platelet aggregation.
4 EDRF and authentic NO also caused disaggregation of platelets aggregated either with collagen or with U46619.
5 A reciprocal potentiation of both the anti- and the disaggregating activity was also observed between low concentrations of prostacyclin and authentic NO or EDRF released from endothelial cells.
6 It is likely that interactions between prostacyclin and NO released by the endothelium play a role in the homeostatic regulation of platelet-vessel wall interactions.
Although primarily recognized for maintaining the hemostatic balance, blood proteases of the coagulation and fibrinolytic cascades elicit rapid cellular responses in
vascular
mesenchymal
inflammatory cell types.
Considerable effort has been devoted to elucidate the molecular interface between protease-dependent signaling and pleiotropic cellular responses. This led to the identification of several membrane protease receptors, initiating intracellular signal transduction and effector functions in vascular cells. In this context, thrombin receptor activation
generated second messengers in endothelium and smooth muscle cells,
released inflammatory cytokines from monocytes, fibroblasts, and endothelium, and
increased the expression of leukocyte-endothelial cell adhesion molecules.
Similarly, binding of factor Xa to effector cell protease receptor-1 (EPR-1) participated in
in vivo acute inflammatory responses,
platelet and brain pericyte prothrombinase activity, and
endothelial cell and smooth muscle cell signaling and proliferation.
Factor Xa stimulated a 5- to 10-fold increased release of nitric oxide (NO) in a dose-dependent reaction (0.1–2.5 mgyml) unaffected by the thrombin inhibitor hirudin but abolished by active site inhibitors, tick anticoagulant peptide, or Glu-Gly-Arg-chloromethyl ketone. In contrast, the homologous clotting protease factor IXa or another endothelial cell ligand, fibrinogen, was ineffective.
A factor Xa inter-epidermal growth factor synthetic peptide L83FTRKL88(G) blocking ligand binding to effector cell protease receptor-1 inhibited NO release by factor Xa in a dose-dependent manner, whereas a control scrambled peptide KFTGRLL was ineffective.
Catalytically active factor Xa induced hypotension in rats and vasorelaxation in the isolated rat mesentery, which was blocked by the NO synthase inhibitor L-NG-nitroarginine methyl ester (LNAME) but not by D-NAME. Factor Xa/NO signaling also produced a dose-dependent endothelial cell release of interleukin 6 (range 0.55–3.1 ngyml) in a reaction
inhibited by L-NAME and by the
inter-epidermal growth factor peptide Leu83–Leu88 but
unaffected by hirudin.
We observe that incubation of HUVEC monolayers with factor Xa which resulted in a concentration-dependent release of NO, as determined by cGMP accumulation in these cells, was inhibited by the nitric oxide synthase antagonist L-NAME.
Catalytically inactive DEGR-factor Xa or TAP-treated factor Xa failed to stimulate NO release by HUVEC.
To determine whether factor Xa-induced NO release could also modulate acute phase/inflammatory cytokine gene expression we examined potential changes in IL-6 release following HUVEC stimulation with factor Xa. HUVEC stimulation with factor Xa resulted in a concentration-dependent release of IL-6.
The specificity of factor Xa-induced cytokine release was investigated. Factor Xa-induced IL-6 release from HUVEC was quantitatively indistinguishable from that obtained with tumor necrosis factor-a or thrombin stimulation. This response was abolished by heat denaturation of factor Xa.
Maximal induction of interleukin 6 mRNA required a brief, 30-min stimulation with factor Xa, and was unaffected by subsequent addition of tissue factor pathway inhibitor (TFPI). These data suggest that factor Xa-induced NO release modulates endothelial cell-dependent vasorelaxation and IL-6 cytokine gene expression.
Here, we find that factor Xa induces the release of endothelial cell NO
regulating vasorelaxation in vivo and acute response cytokine gene expression in vitro.
This pathway requires a dual step cascade, involving
binding of factor Xa to EPR-1 and
a secondary as yet unidentified protease activated mechanism.
This pathway requiring factor Xa binding to effector cell protease receptor-1 and a secondary step of ligand-dependent proteolysis may preserve an anti-thrombotic phenotype of endothelium but also trigger acute phase responses during activation of coagulation in vivo.
In summary, these investigators have identified a signaling pathway centered on the ability of factor Xa to rapidly stimulate endothelial cell NO release. This involves a two-step cascade initiated by catalytic active site-independent binding of factor Xa to its receptor, EPR-1, followed by a second step of ligand dependent proteolysis.
Thrombocytopenia is a marked feature of chronic liver disease and cirrhosis. Traditionally, this thrombocytopenia was attributed to passive platelet sequestration in the spleen. More recent insights suggest an increased platelet breakdown and to a lesser extent decreased platelet production plays a more important role. Besides the reduction in number, other studies suggest functional platelet defects. This platelet dysfunction is probably both intrinsic to the platelets and secondary to soluble plasma factors. It reflects not only a decrease in aggregability, but also an activation of the intrinsic inhibitory pathways. (Witters P, Freson K, Verslype C, Peerlinck K, et al. Review article: blood platelet number and function in chronic liver disease and cirrhosis. Aliment Pharmacol Ther 2008; 27: 1017–1029).
The shortcomings of the old Y-shaped model of normal coagulation are nowhere more apparent than in its clinical application to the complex coagulation disorders of acute and chronic liver disease. In this condition, the clotting cascade is heavily influenced by numerous currents and counter-currents resulting in a mixture of pro- and anticoagulant forces that are themselves further subject to change with altered physiological stress such as super-imposed infection or renal failure.
Multiple mechanisms exist for thrombocytopenia common in patients with cirrhosis besides hypersplenism and expected altered thrombopoietin metabolism. Increased production of two important endothelial derived platelet inhibitors
nitric oxide and
prostacyclin
may contribute to defective platelet activation in vivo. On the other hand, high plasma levels of vWF in cirrhosis appear to support platelet adhesion.
Reduced levels of coagulation factors V, VII, IX, X, XI, and prothrombin are also commonly observed in liver failure. Vitamin K–dependent clotting factors (II, VII, IX, X) may be defective in function as a result of decreased y-carboxylation (from vitamin K deficiency or intrinsically impaired carboxylase activity). Fibrinogen levels are decreased with advanced cirrhosis and in patients with acute liver failure.
A hyperfibrinolytic state may develop when plasminogen activation by tPA is accelerated on the fibrin surface. Physiologic stress including infection may be key in tipping this process off through increased release of tPA. Not uncommonly, laboratory abnormalities in decompensated cirrhosis come to resemble disseminated intravascular coagulation (DIC). Relatively stable platelet levels and characteristically high factor VIII levels distinguish this process from DIC as does the absence of uncompensated thrombin generation. The features of both hyperfibrinolysis and DIC are often evident in the decompensated liver disease patient, and the term “accelerated intravascular coagulation and fibrinolysis” (AICF) has been proposed as a way to encapsulate the process under a single heading. The essence of AICF can be postulated to be the result of formation of a fibrin clot that is more susceptible to plasmin degradation due to elevated levels of tPA coupled with inadequate release of PAI to control tPA and lack of a-2 plasmin inhibitor to quench plasmin activity and the maintenance of high local concentrations of plasminogen on clot surfaces despite lower total plasminogen production. These normally balanced processes become pronounced when disturbed by additional stress such as infection.
Normal hemostasis and coagulation is now viewed as primarily a cell-based process wherein key steps in the classical clotting cascade
occur on the phospholipid membrane surface of cells (especially platelets)
beginning with activation of tissue factor and factor VII at the site of vascular breach
which produces an initial “priming” amount of thrombin and a
subsequent thrombin burst.
Coagulation and hemostasis in the liver failure patient is influenced by multiple, often opposing, and sometimes changing variables. A bleeding diathesis is usually predominant, but the assessment of bleeding risk based on conventional laboratory tests is inherently deficient.
Cardiac surgery with concomitant CPB can profoundly alter haemostasis, predisposing patients to major haemorrhagic complications and possibly early bypass conduit-related thrombotic events as well. Five to seven percent of patients lose more than 2 litres of blood within the first 24 hours after surgery, between 1% and 5% require re-operation for bleeding. Re-operation for bleeding increases hospital mortality 3 to 4 fold, substantially increases post-operative hospital stay and has a sizeable effect on health care costs. Nevertheless, re-exploration is a strong risk factor associated with increased operative mortality and morbidity, including sepsis, renal failure, respiratory failure and arrhythmias.
As the life expectancy of β-thalassemia patients has increased in the last decade, several new complications are being recognized. The presence of a high incidence of thromboembolic events, mainly in thalassemia intermedia patients, has led to the identification of a hypercoagulable state in thalassemia. Patients with thalassemia intermedia (TI) have, in general, a milder clinical phenotype than those with TM and remain largely transfusion independent. The pathophysiology of TI is characterized by extravascular hemolysis, with the release into the peripheral circulation of damaged red blood cells (RBCs) and erythroid precursors because of a high degree of ineffective erythropoiesis. This has also been recently attributed to severe complications such as pulmonary hypertension (PHT) and thromboembolic phenomena.
Many investigators have reported changes in the levels of coagulation factors and inhibitors in thalassemic patients. Prothrombin fragment 1.2 (F1.2), a marker of thrombin generation, is elevated in TI patients. The status of protein C and protein S was investigated in thalassemia in many studies and generally they were found to be decreased; this might be responsible for the occurrence of thromboembolic events in thalassemic patients.
The pathophysiological roles of hemolysis and the dysregulation of nitric oxide homeostasis are correlated with pulmonary hypertension in sickle cell disease and in thalassemia. Nitric oxide binds soluble guanylate cyclase, which converts GTP to cGMP, relaxing vascular smooth muscle and causing vasodilatation. When plasma hemoglobin liberated from intravascularly hemolyzed sickle erythrocytes consumes nitric oxide, the balance is shifted toward vasoconstriction. Pulmonary hypertension is aggravated and in sickle cell disease, it is linked to the intensity of hemolysis. Whether the same mechanism contributes to hypercoagulability in thalassemia is not yet known.
While there are diverse factors contributing to the hypercoagulable state observed in patients with thalassemia. In most cases, a combination of these abnormalities leads to clinical thrombosis. An argument has been made for the a higher incidence of thrombotic events in TI compared to TM patients attributed to transfusion for TM. The higher rate of thrombosis in transfusion-independent TI compared to polytransused TM patients suggests a potential role for transfusions in decreasing the rate of thromboembolic events (TEE). The reduction of TEE in adequately transfused patients may be the result of decreased numbers of pathological RBCs.
Severe sepsis, defined as sepsis associated with acute organ dysfunction, results from a generalized inflammatory and procoagulant host response to infection. Coagulopathy in severe sepsis is commonly associated with multiple organ dysfunction, and often results in death. The molecule that is central to these effects is thrombin, although it may also have anticoagulant and antithrombotic effects through the activation of Protein C and induction of prostacyclin. In recent years, it has been recognized that chemicals produced by endothelial cells play a key role in the pathogenesis of sepsis. Thrombomodulin on endothelial cells coverts Protein C to Activated Protein C, which has important antithrombotic, profibrinolytic and anti-inflammatory properties. A number of studies have shown that Protein C levels are reduced in patients with severe infection, or even in inflammatory states without infection. Because coagulopathy is associated with high mortality rates, and animal studies have indicated that therapeutic intervention may result in improved outcomes, it was rational to initiate clinical studies.
Considering the coagulation cascade as a whole, it is the extrinsic pathway (via TF and thrombin activation) rather than the intrinsic pathway that is of primary importance in sepsis. Once coagulation has been triggered by TF activation, leading to thrombin formation, this can have further procoagulant effects, because thrombin itself can activate factors VIII, IX and X. This is normally balanced by the production of anticoagulant factors, such as TF pathway inhibitor, antithrombin and Activated Protein C.
It has been recognized that endothelial cells play a key role in the pathogenesis of sepsis, and that they produce important regulators of both coagulation and inflammation. They can express or release a number of substances, such as TF, endothelin-1 and PAI-1, which promote the coagulation process, as well as other substances, such as antithrombin, thrombomodulin, nitric oxide and prostacyclin, which inhibit it.
Protein C is the source of Activated Protein C. Although Protein C is a biomarker or indicator of sepsis, it has no known specific biological activity. Protein C is converted to Activated Protein C in the presence of normal endothelium. In patients with severe sepsis, the vascular endothelium becomes damaged. The level of thrombomodulin is significantly decreased, and the body’s ability to convert Protein C to Activated Protein C diminishes. Only when activated does Protein C have antithrombotic, profibrinolytic and anti-inflammatory properties.
Blood Coagulation (Thrombin) and Protein C Pathways (Blood_Coagulation_and_Protein_C_Pathways.jpg) (Photo credit: Wikipedia)
Coagulation abnormalities can occur in all types of infection, including both Gram-positive and Gram-negative bacterial infections, or even in the absence of infection, such as in inflammatory states secondary to trauma or neurosurgery. Interestingly, they can also occur in patients with localized disease, such as those with respiratory infection. In a study by Günther et al., procoagulant activity in bronchial lavage fluid from patients with pneumonia or acute respiratory distress syndrome was found to be increased compared with that from control individuals, with a correlation between the severity of respiratory failure and level of coagulant activity.
Severe sepsis, defined as sepsis associated with acute organ dysfunction, results from a generalized inflammatory and procoagulant host response to infection. Once the endothelium becomes damaged, levels of endothelial thrombomodulin significantly decrease, and the body’s ability to convert Protein C to Activated Protein C diminishes. The ultimate cause of acute organ dysfunction in sepsis is injury to the vascular endothelium, which can result in microvascular coagulopathy.
During the past decade a unifying hypothesis has been developed to explain the vascular changes that occur in septic shock on the basis of the effect of inflammatory mediators on the vascular endothelium. The vascular endothelium plays a central role in the control of microvascular flow, and it has been proposed that widespread vascular endothelial activation, dysfunction and eventually injury occurs in septic shock, ultimately resulting in multiorgan failure. This has been characterized in various models of experimental septic shock. Now, direct and indirect evidence for endothelial cell alteration in humans during septic shock is emerging.
The vascular endothelium regulates the flow of nutrient substances, diverse biologically active molecules and the blood cells themselves. This role of endothelium is achieved through the presence of membrane-bound receptors for numerous molecules, including proteins, lipid transporting particles, metabolites and hormones, as well as through specific junction proteins and receptors that govern cell–cell and cell–matrix interactions. Endothelial dysfunction and/or injury with subendothelium exposure facilitates leucocyte and platelet aggregation, and aggravation of coagulopathy. Therefore, endothelial dysfunction and/or injury should favour impaired perfusion, tissue hypoxia and subsequent organ dysfunction.
Anatomical damage to the endothelium during septic shock has been assessed in several studies. A single injection of bacterial lipopolysaccharide (LPS) has long been demonstrated to be a nonmechanical technique for removing endothelium. In endotoxic rabbits, observations tend to demonstrate that EC surface modification occurs easily and rapidly, with ECs being detached from the internal elastic lamina with an indication of subendothelial oedema. Proinflammatory cytokines increase permeability of the ECs, and this is manifested approximately 6 hours after inflammation is triggered and becomes maximal over 12–24 hours as the combination of cytokines exert potentiating effects. Endothelial physical disruption allows inflammatory fluid and cells to shift from the blood into the interstitial space.
In sepsis
ECs become injured, prothrombotic and antifibrinolytic
They promote platelet adhesion
They promote leucocyte adhesion and inhibit vasodilation
An important point is that EC injury is sustained over time. In an endotoxic rabbit model, we demonstrated that endothelium denudation is present at the level of the abdominal aorta as early as after several hours following injury and persisted for at least 5 days afterward. After 21 days we observed that the endothelial surface had recovered. The de-endothelialized surface accounted for approximately 25% of the total surface.
Thrombomodulin and protein C activation at the microcirculatory level.
The endothelial cell surface thrombin (Th)-binding protein thrombomodulin (TM) is responsible for inhibition of thrombin activity. TM, when bound to Th, forms a potent protein C activator complex. Loss of TM and/or internalization results in Th–thrombin receptor (TR) interaction. Loss of TM and associated protein C activation represents the key event of decreased endothelial coagulation modulation ability and increased inflammation pathways.
( Iba T, Kidokoro A, Yagi Y: The role of the endothelium in changes in procoagulant activity in sepsis. J Am Coll Surg 1998; 187:321-329. Keywords: ATIII, antithrombin III; NF-κ, nuclear factor-κB; PAI,plasminogen activator inhibitor).
In order to test the role of the endothelial-derived relaxing factors NO and PGI2, we investigated, in dogs, the influence of a combination of NG-nitro-L-arginine methyl ester (an inhibitor of NO synthesis) and indomethacin (an inhibitor of PGI2 synthesis). In these dogs treated with indomethacin plus NG-nitro-L-arginine methyl ester, the severity of the oxygen extraction defect was lower than that observed in the deoxycholate-treated dogs, suggesting that other mediators and/or mechanisms may be involved in microcirculatory control during hypoxia. One of these mediators or mechanisms could be related to hyperpolarization. Membrane potential is an important determinant of vascular smooth muscle tone through its influence on calcium influx via voltage-gated calcium channels. Hyperpolarization (as well as depolarization) has been shown to be a means of cell–cell communication in upstream vasodilatation and microcirculatory coordination. It is important to emphasize that intercell coupling exclusively involves ECs.
Interestingly, it was recently shown that sepsis, a situation that is characterized by impaired tissue perfusion and abnormal oxygen extraction, is associated with abnormal inter-EC coupling and reduction in the arteriolar conducted response. An intra-organ defect in blood flow related to abnormal vascular reactivity, cell adhesion and coagulopathy may account for impaired organ oxygen regulation and function. If specific classes of microvessels must or must not be perfused to achieve efficient oxygen extraction during limitation in oxygen delivery, then impaired vascular reactivity and vessel injury might produce a pathological limitation in supply. In sepsis, the inflammatory response profoundly alters circulatory homeostasis, and this has been referred to as a ‘malignant intravascular inflammation’ that alters vasomotor tone and the distribution of blood flow among and within organs. These mechanisms might coexist with other types of sepsis associated cell dysfunction. For example, data suggest that endotoxin directly impairs oxygen uptake in ECs and indicate the importance of endothelium respiration in maintaining vascular homeostasis under conditions of sepsis.
Consistent with the hypothesis that alteration in endothelium plays a major in the pathophysiology of sepsis, it was observed that chronic ecNOS overexpression in the endothelium of mice resulted in resistance to LPS-induced hypotension, lung injury and death . This observation was confirmed by another group of investigators, who used transgenic mice overexpressing adrenomedullin – a vasodilating peptide that acts at least in part via an NO-dependent pathway. They demonstrated resistance of these animals to LPS-induced shock, and lesser declines in blood pressure and less severe organ damage than occurred in the control animals. It might therefore be of importance to favour ecNOS expression and function during sepsis. The recent negative results obtained with therapeutic strategies aimed at blocking inducible NOS with the nonselective NOS inhibitor NG-monomethyl-L-arginine in human septic shock further confirm the overall importance of favoring vessel dilatation.
An association between IBD and thrombosis has been recognized for more than 60 years. Not only are patients with IBD more likely to have thromboembolic complications, but it has also been suggested that thrombosis might be pathogenic in IBD.
Coagulation Described. See Part I. (Cascade)
Endothelial injury exposes TF, which forms a complex with factor VII. This complex activates factors X and, to a lesser extent, IX. TFPI prevents this activation progressing further; for coagulation to progress, factor Xa must be produced via factors IX and VIII. Thrombin, generated by the initial production of factor Xa, activates factor VIII and, through factor XI, factor IX, resulting in further activation of factor X. This positive feedback loop allows coagulation to proceed. Fibrin polymers are stabilized by factor XIIIa. Activated proteins CS (APCS) together inhibit factors VIIIa and Va, whereas antithrombin (AT) inhibits factors VIIa, IXa, Xa, and XIa. Fibrinolysis balances this system through the action of plasmin on fibrin. Plasminogen activator inhibitor controls the plasminogen activator-induced conversion of plasminogen to plasmin.
Inflammation and Thrombotic Processes Linked
Although interest has recently moved away from the proposal that ischemia is a primary cause of IBD, it has become increasingly clear that inflammatory and thrombotic processes are linked. A vascular component to the pathogenesis of CD was first proposed only a year after Crohn et al. described the condition. Subsequently, in 1989, a series of changes comprising vascular injury, focal arteritis, fibrin deposition, arterial occlusion, and then microinfarction or neovascularization was proposed as a possible pathogenetic sequence in CD. In this study, resin casts of the intestinal vasculature showed changes ranging from intravascular fibrin deposition to complete thrombotic occlusion. Furthermore, the early vascular changes appeared to precede mucosal changes, suggesting that they were more likely to cause rather than result from the pathologic features of CD. Subsequent studies showed that intravascular fibrin deposition occurred at the site of granulomatous destruction of mesenteric blood vessels, and positive immunostaining for platelet glycoprotein IIIa occurred in fibrinoid plugs of mucosal capillaries in CD. In addition, intracapillary thrombus has been identified in biopsies from inflamed rectal mucosa from patients with CD. When combined with evidence of ongoing intravascular coagulation in both active and quiescent CD, the above data point toward a thrombotic element contributing to the pathogenesis of CD.
Not only are many different prothrombotic changes described in association with IBD, but they can also have multiple causes. Hyperhomocysteinemia, for example, is known to predispose to thrombosis, and patients with IBD are more likely to have hyperhomocysteinemia than control subjects. Hyperhomocysteinemia in IBD might be due to multiple possible causes, such as deficiencies of vitamin B12 as a result of terminal ileal disease or resection; B6, which is commonly reduced in IBD. A vegan diet can’t be discarded either because of seriously deficient methyl donors (S-adenosyl methionine).
The realization that platelets are not only prothrombotic but also proinflammatory has stimulated interest in their role in both the pathogenesis and complications of IBD. The association between thrombocytosis and active IBD was first described more than 30 years ago. More recent observations link decreased or normal platelet survival to IBD-related thrombocytosis, possibly due to increased thrombopoiesis. This in turn could be driven by an interleukin-6 –induced increase in thrombopoietin synthesis in the liver. Spontaneous in vitro platelet aggregation occurs in platelets isolated from 30% of patients with IBD but not in platelets from control subjects. Moreover, collagen, arachidonic acid, ristocetin, and ADP-induced platelet activation are more marked in platelets from patients with active IBD than in those from healthy volunteers.
The roles of activated platelets and PLAs in mucosal inflammation. Activated platelets can interact with other cells involved in the inflammatory response either through direct contact or through the release of soluble mediators. Activated platelets interact directly with activated vascular endothelium, causing the latter to express adhesion molecules and release inflammatory and chemotactic cytokines.
Platelet activation might be pathogenic in IBD in several ways. Platelet activation might increase platelet aggregation, hence increasing the likelihood of thrombus formation at sites of vascular injury, for example, within the mesenteric circulation. P-selectin is the major ligand for leukocyte-endothelial interaction and is responsible for the rolling of platelets, leukocytes, and PLAs on vascular endothelium. Moreover, platelets adherent to injured vascular endothelium support leukocyte adhesion via P-selectin, an effect that could contribute to leukocyte emigration from the vasculature into the lamina propria in patients with IBD. In addition, P-selectin is the major platelet ligand for platelet-leukocyte interaction, which in turn causes both leukocyte activation and further platelet activation.
Platelet-Leukocyte Aggregation
Recently, studies showing that platelets and leukocytes that circulate together in aggregates (PLA) are more activated than those that circulate alone have generated interest in the role of PLA in various inflammatory and thrombotic conditions. PLA numbers are increased in patients with ischemic heart disease, systemic lupus erythematosus and rheumatoid arthritis, myeloproliferative disorders, and sepsis and are increased by smoking.
We have recently shown that patients with IBD have more PLAs than both healthy and inflammatory control subjects (patients with inflammatory arthritides). As with platelet activation, there was no correlation with disease activity, suggesting that increased PLA formation might be an underlying abnormality. PLAs could contribute to the pathogenesis of IBD in a number of ways. As previously mentioned, TF is key to the initiation of thrombus formation. TF has recently been demonstrated on the surface of activated platelets and in platelet-derived microvesicles. Interaction between neutrophils and activated platelets or microvesicles vastly increases the activity of “intravascular” TF.
Conclusion
It is becoming increasingly apparent that thrombosis and inflammation are intrinsically linked. Hence the involvement of thrombotic processes in the pathogenesis of IBD, although perhaps not as the primary event, seems likely. Indeed, with the recently mounting evidence of the role of activated platelets and of their interaction with leukocytes in the pathogenesis of IBD, it seems even more probable that thrombosis plays some role in the pathogenic process.
(Irving PM, Pasi KJ, and Rampton DS. Thrombosis and Inflammatory Bowel Disease. Clinical Gastroenterology and Hepatology 2005;3:617–628. PII: 10.1053/S1542-3565(05)00154-0.)
Bleeding in Patients with Renal Insufficiency
Approximately 20–40% of critically ill patients will have renal insufficiency at the time of admission or will develop it during their ICU stay, depending on the definition of renal insufficiency and the case mix of the ICU. Such patients are also predisposed to bleeding because of uremic platelet dysfunction, typically multiple comorbidities, coagulopathies and frequent concomitant treatment with antiplatelet or anticoagulant agents.
The impairment in hemostasis in uremic patients is multifactorial and includes physiological defects in platelet hemostasis, an imbalance of mediators of normal endothelial function and frequent comorbidities such as vascular disease, anemia and the frequent need for medical interventions required to treat such comorbidities. Physiologic alterations in uremia include:
decreased platelet glycoprotein IIb–IIIa binding to both von Willebrand factor (vWf) and fibrinogen, causing an impairment in platelet aggregation;
increased prostacyclin and nitric oxide production, both potent inhibitors of platelet activation and vasoconstriction; and
decreased levels of platelet adenosine diphosphate (ADP) and serotonin, causing an impairment in platelet secretion.
In addition to other factors, small peptides containing the RGD (Arg-Gly-Asp) sequence of amino acids have been shown to be inhibitors of platelet aggregation that act by competing with vWf and fibrinogen for binding to the glycoprotein IIb–IIIa receptor.
Conclusion
ICU patients have dynamic risks of thrombosis and bleeding. Invasive procedures may require temporary interruption of anticoagulants. Consequently, approaches to thromboprophylaxis require daily reevaluation.
I have covered a large amount of material on one of the most complex systems in medicine, and still not comprehensive, with a sufficient dash of repetition. The task is to have some grasp of the cell-mediated imbalances inherent if coagulation and bleeding disorders. The key points are:
inflammation and oxidative stress invariably lurk in the background
the Y-shaped model with an extrinsic, intrinsic, and common pathway has no basis in understanding
the current model is based on a cell-mediated concept of endothelial damage and platelet-endothelial interaction
the model has 3 components: Initiation, Amplification, Propagation
NO and prostacyclin have key roles in the process
The plasma proteins involved are in the serine-protease class of enzymes
The conversion of Protein C to APC has a central role as anti-coagulant
Part II has explored organ system abnormalities that are all related to impairment of the Nitric Oxide balance and dual platelet-endothelial roles.
Computational models are very efficient tools to understand complex reactions like NO towards physiological conditions. Among them wall shear stress is one of the major factors which is reviewed in the article – “Differential Distribution of Nitric Oxide – A 3-D Mathematical Model”.
Sickle Cell disease patients, a hereditary disease, are also known to have decreased levels of NO which can become physiologically challenging. In USA alone, there are 90,000 people who are affected by Sickle cell disease.
Sickle cell disease is breakage of red blood cells (RBC) membrane and resulting release of the hemoglobin (Hb) into blood plasma. This process is also known as Hemolysis. Sickle cell disease is caused by single mutation of Hb which changes RBC from round shape to sickle or crescent shapes (Figure 1).
Figure 1 (A) shows normal red blood cells flowing freely through veins. The inset shows a cross section of a normal red blood cell with normal hemoglobin.
Figure 1 (B) shows abnormal, sickled red blood cells The inset image shows a cross-section of a sickle cell with long polymerized HbS strands stretching and distorting the cell shape.
Image Source: http://en.wikipedia.org/wiki/Sickle-cell_disease
RBCs generally breakdown and release Hbs in blood plasma after they reach their end of life span. Thus, in case of Sickle cell disease, there is more cell free Hb than normal. Furthermore, it is known that NO has a very high affinity towards Hbs, which is one of the ways free NO is regulated in blood. As a result presence of larger amounts of cell free Hb in Sickle cell disease lead to less availability of NO.
As to “a quantitative relationship between cell free Hb and depletion of NO”, Deonikar and Kavdia (J. Appl. Physiol., 2012) addressed this question by developing a model of a single idealized arteriole, with different layers of blood vessels diffusing nutrients to tissue layers (Figure 2: Deonikar and Kavdia Figure 1).
The model and its parameters are explained in the previously published paper by same authors Deonikar and Kavdia, Annals of Biomed., 2010, who reported that the reaction rate between NO and RBC is 0.2 x 105, M-1 s-1 than 1.4 x 105, M-1 s-1 as previously reported by Butler et.al., Biochim. Biophys. Acta, 1998. Their results show that even small increase in cell free Hb, 0.5uM, can decrease NO concentrations by 3-7 fold. Their mathematical analysis shows that the increase in diffusion resistance of NO from vascular lumen to cell free zone has no effect on NO distribution and concentration with available levels of cell free Hb.
Deonikar and Kavdia’s model, a simple representation shows that for SC disease patients, decrease in levels of bioavailable NO is attributed to cell free Hb, which is in abundant for these patients. Their results show that small increase by 0.5 uM in cell free Hb can cause a large decrease in NO concentrations.
Coagulation: Transition from a familiar model tied to Laboratory Testing, and the New Cellular-driven Model
Curator: Larry H. Bernstein, MD, FCAP
Short Title: Coagulation viewed from Y to cellular biology.
PART I.
Summary: This portion of the series on PharmaceuticalIntelligence(wordpress.com) isthe first of a three part treatment of the diverse effects on platelets, the coagulation cascade, and protein-membrane interactions. It is highly complex as the distinction between intrinsic and extrinsic pathways become blurred as a result of endothelial shear stress, distinctly different than penetrating or traumatic injury. In addition, other factors that come into play are also considered. The second part will be directed toward low flow states, local and systemic inflammatory disease, oxidative stress, and hematologic disorders, bringing NO and the role of NO synthase in the process. A third part will be focused on management of these states.
The workhorse tests of the modern coagulation laboratory, the prothrombin time (PT) and the activated partial thromboplastin time (aPTT), are the basis for the published extrinsic and intrinsic coagulation pathways. This is, however, a much simpler model than one encounters delving into the mechanism and interactions involved in hemostasis and thrombosis, or in hemorrhagic disorders.
We first note that there are three components of the hemostatic system in all vertebrates:
Platelets,
vascular endothelium, and
plasma proteins.
The liver is the largest synthetic organ, which synthesizes
albumin,
acute phase proteins,
hormonal and metal binding proteins,
albumin,
IGF-1, and
prothrombin, mainly responsible for the distinction between plasma and serum (defibrinated plasma).
According to WH Seegers [Seegers WH, Postclotting fates of thrombin. Semin Thromb Hemost 1986;12(3):181-3], prothrombin is virtually all converted to thrombin in clotting, but Factor X is not. Large quantities of thrombin are inhibited by plasma and platelet AT III (heparin cofactor I), by heparin cofactor II, and by fibrin. Antithrombin III, a serine protease, is a main inhibitor of thrombin and factor Xa in blood coagulation. The inhibitory function of antithrombin III is accelerated by heparin, but at the same time antithrombin III activity is also reduced. Heparin retards the thrombin-fibrinogen reaction, but otherwise the effectiveness of heparin as an anticoagulant depends on antithrombin III in laboratory experiments, as well as in therapeutics. The activation of prothrombin is inhibited, thereby inactivating any thrombin or other vulnerable protease that might otherwise be generated. [Seegers WH, Antithrombin III. Theory and clinical applications. H. P. Smith Memorial Lecture. Am J Clin Pathol. 1978;69(4):299-359)]. With respect to platelet aggregation, platelets aggregate with thrombin-free autoprothrombin II-A. Aggregation is dependent on an intact release mechanism since inhibition of aggregation occurred with adenosine, colchicine, or EDTA. Autoprothrombin II-A reduces the sensitivity of platelets to aggregate with thrombin, but enhances epinephrine-mediated aggregation. [Herman GE, Seegers WH, Henry RL. Autoprothrombin ii-a, thrombin, and epinephrine: interrelated effects on platelet aggregation. Bibl Haematol 1977;44:21-7.]
A tetrapeptide, residues 6 to 9 in normal prothrombin, was isolated from the NH(2)-terminal, Ca(2+)-binding part of normal prothrombin. The peptide contained two residues of modified glutamic acid, gamma-carboxyglutamic acid. This amino acid gives normal prothrombin the Ca(2+)-binding ability that is necessary for its activation.
Abnormal prothrombin, induced by the vitamin K antagonist, dicoumarol, lacks these modified glutamic acid residues and that this is the reason why abnormal prothrombin does not bind Ca(2+) and is nonfunctioning in blood coagulation. [Stenflo J, Fernlund P, Egan W, Roepstorff P. Vitamin K dependent modifications of glutamic acid residues in prothrombin. Proc Natl Acad Sci U S A. 1974;71(7):2730-3.]
Interestingly, a murine monoclonal antibody (H-11) binds a conserved epitope found at the amino terminal of the vitamin K-dependent blood proteins prothrombin, factors VII and X, and protein C. The sequence of polypeptide recognized contains 2 residues of gamma-carboxyglutamic acid, and binding of the antibody is inhibited by divalent metal ions. The antibody bound specifically to a synthetic peptide corresponding to residues 1-12 of human prothrombin that was synthesized as the gamma-carboxyglutamic acid-containing derivative, but binding to the peptide was not inhibited by calcium ion. This suggested that binding by divalent metal ions is not due simply to neutralization of negative charge by Ca2+. [Church WR, Boulanger LL, Messier TL, Mann KG. Evidence for a common metal ion-dependent transition in the 4-carboxyglutamic acid domains of several vitamin K-dependent proteins. J Biol Chem. 1989;264(30):17882-7.]
Role of vascular endothelium.
I have identified the importance of prothrombin, thrombin, and the divalent cation Ca 2+ (1% of the total body pool), mention of heparin action, and of vitamin K (inhibited by warfarin). Endothelial functions are inherently related to procoagulation and anticoagulation. The subendothelial matrix is a complex of many materials, most important related to coagulation being collagen and von Willebrand factor.
What about extrinsic and intrinsic pathways? Tissue factor, when bound to factor VIIa, is the major activator of the extrinsic pathway of coagulation. Classically, tissue factor is not present in the plasma but only presented on cell surfaces at a wound site, which is “extrinsic” to the circulation. Or is it that simple?
Endothelium is the major synthetic and storage site for von Willebrand factor (vWF). vWF is…
secreted from the endothelial cell both into the plasma and also
abluminally into the subendothelial matrix, and
acts as the intercellular glue binding platelets to one another and also to the subendothelial matrix at an injury site.
acts as a carrier protein for factor VIII (antihemophilic factor).
It binds to the platelet glycoprotein Ib/IX/V receptor and
mediates platelet adhesion to the vascular wall under shear. [Lefkowitz JB. Coagulation Pathway and Physiology. Chapter I. in Hemostasis Physiology. In ( ???), pp1-12].
Ca++ and phospholipids are necessary for all of the reactions that result in the activation of prothrombin to thrombin. Coagulation is initiated by an extrinsic mechanism that
generates small amounts of factor Xa, which in turn
activates small amounts of thrombin.
The tissue factor/factorVIIa proteolysis of factor X is quickly inhibited by tissue factor pathway inhibitor (TFPI).The small amounts of thrombin generated from the initial activation feedback
to create activated cofactors, factors Va and VIIIa, which in turn help to
generate more thrombin.
Tissue factor/factor VIIa is also capable of indirectly activating factor X through the activation of factor IX to factor IXa.
Finally, as more thrombin is created, it activates factor XI to factor XIa, thereby enhancing the ability to ultimately make more thrombin.
Coagulation cascade (Photo credit: Wikipedia)
Coagulation Cascade
The procoagulant plasma coagulation cascade has traditionally been divided into the intrinsic and extrinsic pathways. The Waterfall/Cascade model consists of two separate initiations,
intrinsic (contact)and
The intrinsic pathway is initiated by a complex activation process of the so-called contact phase components,
prekallikrein,
high-molecular weight kininogen (HMWK) and
factor XII
Activation of the intrinsic pathway is promoted by non-biological surfaces, such as glass in a test tube, and is probably not of physiological importance, at least not in coagulation induced by trauma.
Instead, the physiological activation of coagulation is mediated exclusively via the extrinsic pathway, also known as the tissue factor pathway.
extrinsic pathways
Tissue factor (TF) is a membrane protein which is normally found in tissues. TF forms a procoagulant complex with factor VII, which activates factor IX and factor X.
common pathway which ultimately merge at the level of Factor Xa
Regulation of thrombin generation. Coagulation is triggered (initiation) by circulating trace amounts of fVIIa and locally exposed tissue factor (TF). Subsequent formations of fXa and thrombin are regulated by a tissue factor pathway inhibitor (TFPI) and antithrombin (AT). When the threshold level of thrombin is exceeded, thrombin activates platelets, fV, fVIII, and fXI to augment its own generation (propagation).
Activated factors IX and X (IXa and Xa) will activate prothrombin to thrombin and finally the formation of fibrin. Several of these reactions are much more efficient in the presence of phospholipids and protein cofactors factors V and VIII, which thrombin activates to Va and VIIIa by positive feedback reactions.
We depict the plasma coagulation emphasizing the importance of membrane surfaces for the coagulation processes. Coagulation is initiated when tissue factor (TF), an integral membrane protein, is exposed to plasma. TF is expressed on subendothelial cells (e.g. smooth muscle cells and fibroblasts), which are exposed after endothelium damage. Activated monocytes are also capable of exposing TF.
A small amount, approximately 1%, of activated factor VII (VIIa) is present in circulating blood and binds to TF. Free factor VIIa has poor enzymatic activity and the initiation is limited by the availability of its cofactor TF. The first steps in the formation of a blood clot is the specific activation of factor IX and X by the TF-VIIa complex. (Initiation of coagulation: Factor VIIa binds to tissue factor and activates factors IX and X). Coagulation is propagated by procoagulant enzymatic complexes that assemble on the negatively charged membrane surfaces of activated platelets. (Propagation of coagulation: Activation of factor X and prothrombin). Once thrombin has been formed it will activate the procofactors, factor V and factor VIII, and these will then assemble in enzyme complexes. Factor IXa forms the tenase complex together with its cofactor factor VIIIa, and factor Xa is the enzymatic component of the prothrombinase complex with factor Va as cofactor.
Activation of protein C takes place on the surface of intact endothelial cells. When thrombin (IIa) reaches intact endothelium it binds with high affinity to a specific receptor called thrombomodulin. This shifts the specific activity of thrombin from being a procoagulant enzyme to an anticoagulant enzyme that activates protein C to activated protein C (APC). The localization of protein C to the thrombin-thrombomodulin complex can be enhanced by the endothelial protein C receptor (EPCR), which is a transmembrane protein with high affinity for protein C. Activated protein C (APC) binds to procoagulant surfaces such as the membrane of activated platelets where it finds and degrades the procoagulant cofactors Va and VIIIa, thereby shutting down the plasma coagulation. Protein S (PS) is an important nonenzymatic cofactor to APC in these reactions. (Degradation of factors Va and VIIIa).
Blood Coagulation (Thrombin) and Protein C Pathways (Blood_Coagulation_and_Protein_C_Pathways.jpg) (Photo credit: Wikipedia)
The common theme in activation and regulation of plasma coagulation is the reduction in dimensionality. Most reactions take place in a 2D world that will increase the efficiency of the reactions dramatically. The localization and timing of the coagulation processes are also dependent on the formation of protein complexes on the surface of membranes. The coagulation processes can also be controlled by certain drugs that destroy the membrane binding ability of some coagulation proteins – these proteins will be lost in the 3D world and not able to form procoagulant complexes on surfaces.
Activated protein C resistance (Photo credit: Wikipedia)
Assembly of proteins on membranes – making a 3D world flat
The timing and efficiency of coagulation processes are handled by reduction in dimensionality
– Make 3 dimensions to 2 dimensions
Coagulation proteins have membrane binding capacity
Membranes provide non-coagulant and procoagulant surfaces
– Intact cells/activated cells
Membrane binding is a target for anticoagulant drugs
– Anti-vitamin K (e.g. warfarin)
Modern View
It can be divided into the phases of initiation, amplification and propagation.
In the initiation phase, small amounts of thrombin can be formed after exposure of tissue factor to blood.
In the amplification phase, the traces of thrombin will be inactivated or used for amplification of the coagulation process.
At this stage there is not enough thrombin to form insoluble fibrin. In order to proceed further thrombin activates platelets, which provide a procoagulant surface for the coagulation factors. Thrombin will also activate the vital cofactors V and VIII that will assemble on the surface of activated platelets. Thrombin can also activate factor XI, which is important in a feedback mechanism.
In the final step, the propagation phase, the highly efficient tenase and prothrombinase complexes have been assembled on the membrane surface. This yields large amounts of thrombin at the site of injury that can cleave fibrinogen to insoluble fibrin. Factor XI activation by thrombin then activates factor IX, which leads to the formation of more tenase complexes. This ensures enough thrombin is formed, despite regulation of the initiating TF-FVIIa complex, thus ensuring formation of a stable fibrin clot. Factor XIII stabilizes the fibrin clot through crosslinking when activated by thrombin.
Platelet Aggregation
The activities of adenylate and guanylate cyclase and cyclic nucleotide 3′:5′-phosphodiesterase were determined during the aggregation of human blood platelets with
The activity of guanylate cyclase is altered to a much larger degree than adenylate cyclase, while cyclic nucleotide phosphodiesterase activity remains unchanged. During the early phases of thrombin- and ADP-induced platelet aggregation a marked activation of the guanylate cyclase occurs whereas aggregation induced by arachidonic acid or epinephrine results in a rapid diminution of this activity. In all four cases, the adenylate cyclase activity is only slightly decreased when examined under identical conditions.
Platelet aggregation induced by a wide variety of aggregating agents including collagen and platelet isoantibodies results in the “release” of only small amounts (1–3%) of guanylate cyclase and cyclic nucleotide phosphodiesterase and no adenylate cyclase. The guanylate cyclase and cyclic nucleotide phosphodiesterase activities are associated almost entirely with the soluble cytoplasmic fraction of the platelet, while the adenylate cyclase is found exclusively in a membrane bound form. ADP and epinephrine moderately inhibit guanylate and adenylate cyclase in subcellular preparations, while arachidonic and other unsaturated fatty acids moderately stimulate (2–4-fold) the former.
The platelet guanylate cyclase activity during aggregation depends on the nature and mode of action of the inducing agent.
The membrane adenylate cyclase activity during aggregation is independent of the aggregating agent and is associated with a reduction of activity and
Cyclic nucleotide phosphodiesterase remains unchanged during the process of platelet aggregation and release.
The basic principles concerning mechanical stress demonstrated by Robert Hooke (1635-1703) proved to be essential for the understanding of pathophysiological mechanisms in the vascular bed.
In physics, stress is the internal distribution of forces within a body that balance and react to the external loads applied to it. Stress is a 2nd order tensor. The hemodynamic conditions inside blood vessels lead to the development of superficial stresses near the vessel walls, which can be divided into two categories:
a) circumferential stress due to pulse pressure variation inside the vessel;
b) shear stress due to blood flow.
The direction of the shear stress vector is determined by the direction of the blood flow velocity vector very close to the vessel wall. Shear stress is applied by the blood against the vessel wall. Friction is the force applied by the wall to the blood and has a direction opposite to the blood flow. The tensions acting against the vessel wall are likely to be determined by blood flow conditions. Shear stresses are most complicated during turbulent flow, regions of flow recirculation or flow separation.
The notions of shear rate and fluid viscosity should be first clearly apprehended, since they are crucial for the assessment and development of shear stress. Shear rate is defined as the rate at which adjacent layers of fluid move with respect to each other, usually expressed as reciprocal seconds. The size of the shear rate gives an indication of the shape of the velocity profile for a given situation. The determination of shear stresses on a surface is based on the fundamental assumption of fluid mechanics, according to which the velocity of fluid upon the surface is zero (no-slip condition). Assuming that the blood is an ideal Newtonian fluid with constant viscosity, the flow is steady and laminar and the vessel is straight, cylindrical and inelastic, which is not the case. Under ideal conditions a parabolic velocity profile could be assumed.
The following assumptions have been made:
The blood is considered as a Newtonian fluid.
The vessel cross sectional area is cylindrical.
The vessel is straight with inelastic walls.
The blood flow is steady and laminar.
The Haagen-Poisseuille equation indicates that shear stress is directly proportional to blood flow rate and inversely proportional to vessel diameter.
Viscosity is a property of a fluid that offers resistance to flow, and it is a measure of the combined effects of adhesion and cohesion. It increases as temperature decreases. Blood viscosity (non-Newtonian fluid) depends on shear rate, which is determined by blood platelets, red cells, etc. Moreover, it is slightly affected by shear rate changes at low levels of hematocrit. In contrast, as hematocrit increases, the effect of shear rate changes on blood viscosity becomes greater. Blood viscosity measurement is required for the accurate calculation of shear stress in veins or microcirculation.
It has to be emphasised that the dependence of blood viscosity on hematocrit is more pronounced in the microcirculation than in larger vessels, due to hematocrit variations observed in small vessels (lumen diameter <100 Ìm). The significant change of hematocrit in relation to vessel diameter is associated with the tendencyof red blood cells to travel closer to the centre of the vessels. Thus, the greater the decrease in vessel lumen, the smaller the number of red blood cells that pass through, resulting in a decrease in blood viscosity.
Shear stress and vascular endothelium
Endothelium responds to shear stress through various pathophysiological mechanisms depending on the kind and the magnitude of shear stresses. More specifically, the exposure of vascular endothelium to shear forces in the normal value range stimulates endothelial cells to release agents with direct or indirect antithrombotic properties, such as prostacyclin, nitric oxide (NO), calcium, thrombomodulin, etc. The possible existence of so-called “mechanoreceptors” has provoked a number of research groups to propose receptors which “translate” mechanical forces into biological signals.
Under normal shear conditions, endothelial as well as smooth muscle cells have a rather low rate of proliferation. Changes in shear stress magnitude activate cellular proliferation mechanisms as well as vascular remodeling processes. More specifically, a high grade of shear stress increases wall thickness and expands the vessel’s diameter, so that shear stress values return to their normal values. In contrast, low shear stress induces a reduction in vessel diameter. Shear stresses stimulate vasoregulatory mechanisms which, together with alterations of arterial diameter, serves to maintain a mean shear stress level of about 15 dynes/cm2. The presence of low shear stresses is frequently accompanied by unstable flow conditions (e.g. turbulence flow, regions of blood recirculation, “stagnant” blood areas).
Leukocyte adhesion under flow in the microvasculature is mediated by binding between cell surface receptors and complementary ligands expressed on the surface of the endothelium. Leukocytes adhere to endothelium in a two-step mechanism: rolling (primarily mediated by selectins) followed by firm adhesion (primarily mediated by integrins). These investigators simulated the adhesion of a cell to a surface in flow, and elucidated the relationship between receptor–ligand functional properties and the dynamics of adhesion using a computational method called ‘‘Adhesive Dynamics.’’ This relationship was expressed in a one-to-one map between the biophysical properties of adhesion molecules and various adhesive behaviors.
Behaviors that are observed in simulations include firm adhesion, transient adhesion (rolling), and no adhesion. They varied the dissociative properties, association rate, bond elasticity, and shear rate and found that the unstressed dissociation rate, kro, and the bond interaction length, γ, are the most important molecular properties controlling the dynamics of adhesion.
The study of the effect of leukocyte adhesion on blood flow in small vessels is of primary interest to understand the resistance changes in venular microcirculation when blood is considered as a homogeneous Newtonian fluid. When studying the effect of leukocyte adhesion on the non-Newtonian Casson fluid flow of blood in small venules; the Casson model represents the effect of red blood cell aggregation. In this model the blood vessel is considered as a circular cylinder and the leukocyte is considered as a truncated spherical protrusion in the inner side of the blood vessel. Numerical simulations demonstrated that for a Casson fluid with hematocrit of 0.4 and flow rate Q = 0:072 nl/s, a single leukocyte increases flow resistance by 5% in a 32 m diameter and 100 m long vessel. For a smaller vessel of 18 m, the flow resistance increases by 15%.
Biologists have identified many of the molecular constituents that mediate adhesive interactions between white blood cells, the cell layer that lines blood vessels, blood components, and foreign bodies. However, the mechanics of how blood cells interact with one another and with biological or synthetic surfaces is quite complex: owing to the deformability of cells, the variation in vessel geometry, and the large number of competing chemistries present (Lipowski et al., 1991, 1996).
Adhesive interactions between white blood cells and the interior surface of the blood vessels they contact is important in inflammation and in the progression of heart disease. Parallel-plate microchannels have been useful in characterizing the strength of these interactions, in conditions that are much simplified over the complex environment these cells experience in the body. Recent computational and experimental work by several laboratories have attempted to bridge this gap between behavior observed in flow chamber experiments, and cell surface interactions observed in the microvessels of anesthetized animals.
We have developed a computational simulation of specific adhesive interactions between cells and surfaces under flow. In the adhesive dynamics formulation, adhesion molecules are modeled as compliant springs. One well-known model used to describe the kinetics of single biomolecular bond failure is due to Bell, which relates the rate of dissociation kr to the magnitude of the force on the bond F. The rate of formation directly follows from the Boltzmann distribution for affinity. The expression for the binding rate must also incorporate the effect of the relative motion of the two surfaces. Unless firmly adhered to a surface, white blood cells can be effectively modeled as rigid spherical particles, as evidenced by the good agreement between bead versus cell in vitro experiments (Chang and Hammer, 2000).
Various in vitro, in vivo, and computational methods have been developed to understand the complex range of transient interactions between cells, neighboring cells, and bounding surfaces under flow. Knowledge gained from studying physiologically realistic flow systems may prove useful in microfluidic applications where the transport of blood cells and solubilized, bioactive molecules is needed, or in miniaturized diagnostic devices where cell mechanics or binding affinities can be correlated with clinical pathologies.
(King MR. Cell-Surface Adhesive Interactions in Microchannels and Microvessels. First International Conference on Microchannels and Minichannels. 2003, Rochester, NY. Pp 1-6. ICMM2003-1012.
P-selectin role in adhesion of leukocytes and sickle cells blocked by heparin
Vascular occlusion is responsible for much of the morbidity associated with sickle cell disease. Although the underlying cause of sickle cell disease is a single nucleotide mutation that directs the production of an easily polymerized hemoglobin protein, both the erythrocyte sickling caused by hemoglobin polymerization and the interactions between a proadhesive population of sickle cells and the vascular endothelium are essential to vascular occlusion.
Interactions between sickle cells and the endothelium use several cell adhesion molecules. Sickle red cells express adhesion molecules including integrin, CD36, band 3 protein, sulfated glycolipid, Lutheran protein, phosphatidylserine, and integrin-associated protein. The proadhesive sickle cells may bind to endothelial cell P-selectin, E-selectin, vascular cell adhesion molecule-1 (VCAM-1), CD36, and integrins. Activation of endothelial cells by specific agonists enhances adhesion by inducing the expression of cellular adhesion molecules and by causing cell contraction, which exposes extracellular matrix proteins, such as thrombospondin (TSP), laminin, and fibronectin. Initial events likely involve the adhesion of sickle erythrocytes to activated endothelial cells under laminar flow. The resultant adhesion of cells to the vascular wall creates nonlaminar and arrested flow, which propagates vascular occlusion by both static and flow adhesion mechanisms. It is likely too that the distinct mechanisms of adhesion and of regulation of endothelial cell adhesivity pertain under dissimilar types of flow.
The expression of adhesion molecules by endothelial cells is affected by cell agonists such as thrombin, histamine, tumor necrosis factor (TNF-), interleukin 1 (IL-1), platelet activating factor (PAF), erythropoietin, and vascular endothelial growth factor (VEGF), and by local environmental factors such as hypoxia, reperfusion, flow, as well as by sickle erythrocytes themselves. An important effector in sickle cell vascular occlusion is thrombin. Increased thrombin activity correlates with sickle cell disease pain episodes. In addition to generating fibrin clot, thrombin also acts on specific thrombin receptors on endothelial cells and platelets. Work from our laboratory has demonstrated that thrombin treatment causes a rapid increase of endothelial cell adhesivity for sickle erythrocytes under static conditions
We have also reported that sickle cell adhesion to endothelial cells under static conditions involves P-selectin. Although P-selectin plays a major role in the tethering, rolling, and firm adhesion of leukocytes to activated endothelial cells, its contribution to the initial steps is singular and essential to the overall adhesion process. Upon stimulation of endothelial cells by thrombin, P-selectin rapidly translocates from Weibel-Palade bodies to the luminal surface of the cells. Others have shown that sickle cell adhesion is decreased by unfractionated heparin, but the molecular target of this inhibition has not been defined. We postulated that the adhesion of sickle cells to P-selectin might be the pathway blocked by unfractionated heparin. Heparin is known to block certain types of tumor cell adherence, TSP-independent sickle cell adherence, and coagulation processes that are active in sickle cell disease. In one uncontrolled study, prophylactic administration of heparin reduced the frequency of sickle cell pain crises. The role of P-selectin in the endothelial adhesion of sickle red blood cells, the capacity of heparin to block selected P-selectin–mediated adhesive events, and the effect of heparin on sickle cell adhesion suggest an association among these findings.
We postulate that, in a manner similar to that seen for neutrophil adhesion, P-selectin may play a role in the tethering and rolling adhesion of sickle cells. As with neutrophils, integrins may then mediate the firm adhesion of rolling sickle erythrocytes. The integrin is expressed on sickle reticulocytes and can mediate adhesion to endothelial cells, possibly via endothelial VCAM-4. The endothelial integrin, V3, also mediates sickle cell adhesion to endothelial cells. Other 1 and 3 integrins may also fulfill this role.
In this report we demonstrate that the flow adherence of sickle cells to thrombin-treated human vascular endothelial cells also uses P-selectin and that this component of adhesion is inhibited by unfractionated heparin. We also demonstrate that sickle cells adhere to immobilized recombinant P-selectin under flow conditions. This adhesion too was inhibited by unfractionated heparin, in a concentration range that is clinically attainable. These findings and the general role of P-selectin in initiating adhesion of blood cells to the endothelium suggest that unfractionated heparin may be useful in preventing painful vascular occlusion. A clinical trial to test this hypothesis is indicated.
MacFarlane RG (1964). “An enzyme cascade in the blood clotting mechanism, and its function as a biochemical amplifier”. Nature202 (4931): 498–9. doi:10.1038/202498a0. PMID14167839.
David Lillicrap; Nigel Key; Michael Makris; Denise O’Shaughnessy (2009).Practical Hemostasis and Thrombosis. Wiley-Blackwell. pp. 1–5. ISBN1-4051-8460-4.
Alan D. Michelson (26 October 2006). Platelets. Academic Press. pp. 3–5. ISBN978-0-12-369367-9. Retrieved 18 October 2012.