Topical Bovine Thrombin Induces Vascular Cell Proliferation
Demet Sağ, Kamran Baig*, Steven Hanish*, Jeffrey Lawson
Running Foot:
Use of bovine thrombin induces the cell proliferation at anastomosis
Department of Surgery
Duke University Medical Center
Durham, NC 27710
United States of America
* Equally worked
Review Profs and correspondence should be addressed to:
Dr. Jeffrey Lawson
Duke University Medical Center
Room 481 MSRB/ Box 2622
Research Drive
Durham, NC 27710
Phone (919) 681-6432
Fax (919) 681-1094
Email: lawso717@duke.edu
demet.sag@gmail.com
Topical Bovine Thrombin Induces Vascular Cell Proliferation
Abstract:
Specific Aim: The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.
Methods and Results: Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery. Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting. Expression of PAR (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR. All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin. These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK. Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.
Conclusion: Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair. Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.
Abbreviations: ERK, extracellular regulated kinase; ES, embryonic stem cells; JIP, JNK-interacting protein; JNK, c-Jun NH2-terminal kinase; JNKK, JNK kinase; JNKBP, JNK binding protein; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MEK, MAPK/ERK kinase; MEKK, MEK kinase; MKK, MAPK kinase.
Keywords: Hemostatics, Signal transduction; Thrombin, PTGF
————————————————————————————————————
Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4]. It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI during various surgical procedures. Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6]. Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].
Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin. It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9]. Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10]. Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.
Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs. Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].
Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself. There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs) [24-27].
Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33]. To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure. We had tested the impact of topical bovine thrombin affect at the anastomosis.
Materials and Methods:
Surgical Procedure: We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency. Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine. Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days. In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used. Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.
Ki67 Immunostaining: The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks. The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0). The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum. The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast. As a result, positive tissues became brown and negatives were red.
MAPKs Immunostaining: The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody. The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.
Immunoblotting: Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h. Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS. The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).
RNA isolation and RT-PCR: The harvested vessels were kept in RNAlater (Ambion, Austin, TX). The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.
The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166). At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification. At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler. The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse); PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT 3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).
CTGF and Cyr61: The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers. For CTGF the primers were forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward) GGAAGCCTTGCT CATTCTTGA and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR. The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.
RESULTS:
First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin. Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs. We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment. These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr treatment with BT. This data the hypothesis for the function of PAR receptors in vascular tissues that they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.
TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:
Next question was to make linear correlation between the expressions of PARs to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues. Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes. Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared. If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min. Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli. The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls. Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.
Proliferation of the tissue depends on pERK
PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen. Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured. As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.
First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues). We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins. The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls. This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.
The next target was JNK that plays a role in the inflammation, stress, and differentiation. In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application. This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients. The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots. Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.
Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues. The expression of p38 was higher than JNK but much lower than ERK. Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.
In general, all MAPKs showed increased in their phosphorylation level. The level of activated MAPK expression was increased 200% in the tested animal. The order of expression from high to low would be ERK, JNK, and p38.
The genetic expression change
The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement. Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection. The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment. Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.
DISCUSSION:
The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access that leads to the cell proliferation and inflammation through MAPKs as well as downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.
From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues. We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding. This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.
It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions. In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent. Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.
The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used. The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle. In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase. During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.
Next, level of evidence was the signaling pathway analysis from membrane to the nucleus. As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK, pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel. Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK). The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation. In our data we had detected the elvation of ERK more than the other MAPKs. In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.
Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis. The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.
Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair. Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.
REFERENCES:
1. Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.
2. Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.
3. TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.
4. Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.
5. Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.
6. Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.
7. Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.
8. Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.
9. Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.
10. Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.
11. Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.
12. Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.
13. Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.
14. Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.
15. Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.
16. Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.
17. Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.
18. Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.
19. Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.
20. Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.
21. Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.
22. Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.
23. Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.
24. Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.
25. Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.
26. Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.
27. Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.
28. Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.
29. Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.
30. Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.
31. Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.
32. Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.
33. McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.
34. Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.
35. Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.
36. Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.
37. Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.
38. Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.
39. Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.
40. Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.
41. Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.
Figure Legends:
Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR. PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr
Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation
Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues
Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues
Figure 5: The activity of p38. (A) Immunostaining of total and activated p38. Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues
Figure 6: The Expression of CTGF and Cyr61 after Thrombin Treatment. (A)CTGF (B) Cyr61 expressions of treated and un-treated with TBT veins at 24h and 7 days.Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment
… mechanisms. Part II. Summary: This is the second of a coagulation series on PharmaceuticalIntelligence(wordpress.com) treating the diverse effects of NO on
… Nitric Oxide: Platelets, Circulatory Disorders, and Coagulation Effects. (Part I) Larry H. Bernstein, MD, FCAP, … is the first of a two part treatment of platelets,
… mechanisms. Part II. Summary: This is the second of a coagulation series on PharmaceuticalIntelligence(wordpress.com) treating the diverse effects of NO on pla
… and Evolution Biomarkers & Medical Diagnostics Coagulation Therapy and Internal Bleeding Cell Biology, Signaling & Cell … Lab, Microbial Screening and tests, Biochemistry: Coagulation Tests, Enzyme Kinetics, Chromatography, High Throughput Screening, …
… cells, smooth muscle cells and monocytes induce thrombin generation via different pathways Smooth Muscle Cells Role of …
… are based on the scientifically proven hemostatic power of thrombin. Our Vari-Lase endovenous laser system is designed to help physicians …
Like this:
Like Loading...
Read Full Post »
2012pharmaceutical
sjwilliamspa