Feeds:
Posts
Comments

Archive for the ‘mRNA Therapeutics’ Category


2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021

The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy. Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.

About the World Medical Innovation Forum

Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation

Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next

https://worldmedicalinnovation.org/agenda/

Virtual | May 19–21, 2021

#WMIF2021

@MGBInnovation

Leaders in Pharmaceutical Business Intelligence (LPBI) Group

will cover the event in Real Time

Aviva Lev-Ari, PhD, RN

Founder LPBI 1.0 & LPBI 2.0

member_60221522 copy

will be in virtual attendance producing the e-Proceedings

and the Tweet Collection of this Global event expecting +15,000 attendees

@pharma_BI

@AVIVA1950

LPBI’s Eighteen Books in Medicine

https://lnkd.in/ekWGNqA

Among them, books on Gene and Cell Therapy include the following:

Topics for May 19 – 21 include:

Impact on Patient Care – Therapeutic and Potentially Curative GCT Developments

GCT Delivery, Manufacturing – What’s Next

GCT Platform Development

Oncolytic Viruses – Cancer applications, start-ups

Regenerative Medicine/Stem Cells

Future of CAR-T

M&A Shaping GCT’s Future

Market Priorities

Venture Investing in GCT

China’s GCT Juggernaut

Disease and Patient Focus: Benign blood disorders, diabetes, neurodegenerative diseases

Click here for the current WMIF agenda  

Plus:

Fireside Chats: 1:1 interviews with industry CEOs/C-Suite leaders including Novartis Gene Therapies, ThermoFisher, Bayer AG, FDA

First Look: 18 briefings on emerging GCT research from Mass General Brigham scientists

Virtual Poster Session: 40 research posters and presenters on potential GCT discoveries from Mass General Brigham

Announcement of the Disruptive Dozen, 12 GCT technologies likely to break through in the next few years

AGENDA

Wednesday, May 19, 2021

8:00 AM – 8:10 AM

Opening Remarks

Welcome and the vision for Gene and Cell Therapy and why it is a top Mass General Brigham priority. Introducer: Scott Sperling

  • Co-President, Thomas H. Lee Partners
  • Chairman of the Board of Directors, PHS

Presenter: Anne Klibanski, MD

  • CEO, Mass General Brigham

3,000 people joined 5/19 morning

30 sessions: Lab to Clinic,  academia, industry, investment community

May 22,23,24, 2022 – in Boston, in-person 2022 WMIF on CGT 8:10 AM – 8:30 AM

The Grand Challenge of Widespread GCT Patient Benefits

Co-Chairs identify the key themes of the Forum –  set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future. Moderator: Susan Hockfield, PhD

  • President Emerita and Professor of Neuroscience, MIT

GCT – poised to deliver therapies

Inflection point as Panel will present

Doctors and Patients – Promise for some patients 

Barriers for Cell & Gene

Access for patients to therapies like CGT Speakers: Nino Chiocca, MD, PhD

  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic virus triple threat: Toxic, immunological, combine with anti cancer therapies

Polygenic therapy – multiple genes involved, plug-play, Susan Slaugenhaupt, PhD

  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS

Ravi Thadhani, MD

  • CAO, Mass General Brigham
  • Professor, Medicine and Faculty Dean, HMS

Role of academia special to spear head the Polygenic therapy – multiple genes involved, plug-play, 

Access critical, relations with IndustryLuk Vandenberghe, PhD

  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

Pharmacology Gene-Drug, Interface academic centers and industry

many CGT drugs emerged in Academic center 8:35 AM – 8:50 AM FIRESIDE

Gene and Cell Therapy 2.0 – What’s Next as We Realize their Potential for Patients

Dave Lennon, PhD

  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations Moderator: Julian Harris, MD

  • Partner, Deerfield

Promise of CGT realized, what part?

FDA role and interaction in CGT

Manufacturing aspects which is critical Speaker: Dave Lennon, PhD

  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

  • Q&A 8:55 AM – 9:10 AM  

8:55 AM – 9:20 AM

The Patient and GCT

GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates. Moderator: Patricia Musolino, MD, PhD

  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial Speakers: Jack Hogan

  • Patient, MEE

Jeanette Hogan

  • Parent of Patient, MEE

Jim Holland

  • CEO, Backcountry.com

Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical Barbara Lavery

  • Chief Program Officer, ACGT Foundation

Advocacy agency beginning of work Global Genes educational content and out reach to access the information 

Patient has the knowledge of the symptoms and recording all input needed for diagnosis by multiple clinicians Early application for CGTDan Tesler

  • Clinical Trial Patient, BWH/DFCC

Experimental Drug clinical trial patient participation in clinical trial is very important to advance the state of scienceSarah Beth Thomas, RN

  • Professional Development Manager, BWH

Outcome is unknown, hope for good, support with resources all advocacy groups, 

  • Q&A 9:25 AM – 9:40 AM  

9:25 AM – 9:45 AM FIRESIDE

GCT Regulatory Framework | Why Different?

  Moderator: Vicki Sato, PhD

  • Chairman of the Board, Vir Biotechnology

Diversity of approaches

Process at FDA generalize from 1st entry to rules more generalizable  Speaker: Peter Marks, MD, PhD

  • Director, Center for Biologics Evaluation and Research, FDA

Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work

Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance  T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance

Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation 

  • Q&A 9:50 AM – 10:05 AM  

9:50 AM – 10:15 AM

Building a GCT Platform for Mainstream Success

This panel of GCT executives, innovators and investors explore how to best shape a successful GCT strategy. Among the questions to be addressed:

  • How are GCT approaches set around defining and building a platform?
  • Is AAV the leading modality and what are the remaining challenges?
  • What are the alternatives?
  • Is it just a matter of matching modalities to the right indications?

Moderator: Jean-François Formela, MD

  • Partner, Atlas Venture

Established core components of the Platform Speakers: Katherine High, MD

  • President, Therapeutics, AskBio

Three drugs approved in Europe in the Gene therapy space

Regulatory Infrastructure exists for CGT drug approval – as new class of therapeutics

Participants investigators, regulators, patients i. e., MDM 

Hemophilia in male most challenging

Human are natural hosts for AV safety signals Dave Lennon, PhD

  • President, Novartis Gene Therapies

big pharma has portfolios of therapeutics not one drug across Tx areas: cell, gene iodine therapy 

collective learning infrastructure features manufacturing at scale early in development Acquisitions strategy for growth # applications for scaling Rick Modi

  • CEO, Affinia Therapeutics

Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP 

Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific Louise Rodino-Klapac, PhD

  • EVP, Chief Scientific Officer, Sarepta Therapeutics

AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years

Safety to clinic vs speed to clinic, difference of vectors to trust

  • Q&A 10:20 AM – 10:35 AM  

10:20 AM – 10:45 AM

AAV Success Studies | Retinal Dystrophy | Spinal Muscular Atrophy

Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.

The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.

  • Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
  • Lessons learned from these first-in-class approvals.
  • Challenges to broaden this modality to similar indications.
  • Reflections on safety signals in the clinical studies?

Moderator: Joan Miller, MD

  • Chief, Ophthalmology, MEE
  • Cogan Professor & Chair of Ophthalmology, HMS

Retina specialist, Luxturna success FMA condition cell therapy as solution

Lessons learned

Safety Speakers: Ken Mills

  • CEO, RegenXBio

Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years 

Cell therapy vs transplant therapy no immunosuppressionEric Pierce, MD, PhD

  • Director, Ocular Genomics Institute, MEE
  • Professor of Ophthalmology, HMS

Laxterna success to be replicated platform, paradigms measurement visual improved

More science is needed to continue develop vectors reduce toxicity,

AAV can deliver different cargos reduce adverse events improve vectorsRon Philip

  • Chief Operating Officer, Spark Therapeutics

The first retinal gene therapy, voretigene neparvovec-rzyl (Luxturna, Spark Therapeutics), was approved by the FDA in 2017.Meredith Schultz, MD

  • Executive Medical Director, Lead TME, Novartis Gene Therapies

Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise

Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information

  • Q&A 10:50 AM – 11:05 AM  

10:45 AM – 10:55 AM

Break

  10:55 AM – 11:05 AM FIRST LOOK

Control of AAV pharmacology by Rational Capsid Design

Luk Vandenberghe, PhD

  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,

Pathway for rational AAV rational design, curated smart variant libraries, AAV  sequence screen multiparametric , data enable liver (de-) targeting unlock therapeutics areas: cochlea 

  • Q&A 11:05 AM – 11:25 AM  

11:05 AM – 11:15 AM FIRST LOOK

Enhanced gene delivery and immunoevasion of AAV vectors without capsid modification

Casey Maguire, PhD

  • Associate Professor of Neurology, MGH & HMS

Virus Biology: Enveloped (e) or not 

enveloped for gene therapy eAAV platform technology: tissue targets and Indications commercialization of eAAV 

  • Q&A 11:15 AM – 11:35 AM  

11:20 AM – 11:45 AM HOT TOPICS

AAV Delivery

This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed? Moderators: Xandra Breakefield, PhD

  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS

Florian Eichler, MD

  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS

Speakers: Jennifer Farmer

  • CEO, Friedreich’s Ataxia Research Alliance

Ataxia requires therapy targeting multiple organ with one therapy, brain, spinal cord, heart several IND, clinical trials in 2022Mathew Pletcher, PhD

  • SVP, Head of Gene Therapy Research and Technical Operations, Astellas

Work with diseases poorly understood, collaborations needs example of existing: DMD is a great example explain dystrophin share placedo data 

Continue to explore large animal guinea pig not the mice, not primates (ethical issues) for understanding immunogenicity and immune response Manny Simons, PhD

  • CEO, Akouos

AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model 

Biology across species nerve ending in the cochlea

engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones

  • Q&A 11:50 AM – 12:05 PM  

11:50 AM – 12:15 PM

M&A | Shaping GCT Innovation

The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up? Moderator: Adam Koppel, MD, PhD

  • Managing Director, Bain Capital Life Sciences

What acquirers are looking for??

What is the next generation vs what is real where is the industry going? Speakers:

Debby Baron,

  • Worldwide Business Development, Pfizer 

CGT is an important area Pfizer is active looking for innovators, advancing forward programs of innovation with the experience Pfizer has internally 

Scalability and manufacturing  regulatory conversations, clinical programs safety in parallel to planning getting drug to patients

Kenneth Custer, PhD

  • Vice President, Business Development and Lilly New Ventures, Eli Lilly and Company

Marianne De Backer, PhD

Head of Strategy, Business Development & Licensing, and Member of the Executive Committee, Bayer

Absolute Leadership in Gene editing, gene therapy, via acquisition and strategic alliance 

Operating model of the acquired company discussed , company continue independence

Sean Nolan

  • Board Chairman, Encoded Therapeutics & Affinia

Executive Chairman, Jaguar Gene Therapy & Istari Oncology

As acquiree multiple M&A: How the acquirer looks at integration and cultures of the two companies 

Traditional integration vs jump start by external acquisition 

AAV – epilepsy, next generation of vectors 

  • Q&A 12:20 PM – 12:35 PM  

12:15 PM – 12:25 PM FIRST LOOK

Gene Therapies for Neurological Disorders: Insights from Motor Neuron Disorders

Merit Cudkowicz, MD

  • Chief of Neurology, MGH

ALS – Man 1in 300, Women 1 in 400, next decade increase 7% 

10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters 

Q&A

  • 12:25 PM – 12:45 PM  

12:25 PM – 12:35 PM FIRST LOOK

Gene Therapy for Neurologic Diseases

Patricia Musolino, MD, PhD

  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

Cerebral Vascular disease – ACTA2 179H gene smooth muscle cell proliferation disorder

no surgery or drug exist –

Cell therapy for ACTA2 Vasculopathy  in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis 

  • Q&A 12:35 PM – 12:55 PM  

12:35 PM – 1:15 PM

Lunch

  1:15 PM – 1:40 PM

Oncolytic Viruses in Cancer | Curing Melanoma and Beyond

Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story.  They will explore why and how Imlygic became approved and its path to commercialization.  Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers.  Why? Is there a limitation to what and which cancers can target?  Is the mode of administration a problem?

No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why?  Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?

The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses.  It will also assess the extent pre-clinical development challenges have slowed the development of OVs. Moderator: Nino Chiocca, MD, PhD

  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Challenges of manufacturing at Amgen what are they? Speakers: Robert Coffin, PhD

  • Chief Research & Development Officer, Replimune

2002 in UK promise in oncolytic therapy GNCSF

Phase III melanoma 2015 M&A with Amgen

oncolytic therapy remains non effecting on immune response 

data is key for commercialization 

do not belief in systemic therapy achieve maximum immune response possible from a tumor by localized injection Roger Perlmutter, MD, PhD

  • Chairman, Merck & Co.

response rates systemic therapy like PD1, Keytruda, OPTIVA well tolerated combination of Oncolytic with systemic 

GMP critical for manufacturing David Reese, MD

  • Executive Vice President, Research and Development, Amgen

Inter lesion injection of agent vs systemic therapeutics 

cold tumors immune resistant render them immune susceptible 

Oncolytic virus is a Mono therapy

addressing the unknown Ann Silk, MD

  • Physician, Dana Farber-Brigham and Women’s Cancer Center
  • Assistant Professor of Medicine, HMS

Which person gets oncolytics virus if patient has immune suppression due to other indications

Safety of oncolytic virus greater than Systemic treatment

series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential 

  • Q&A 1:45 PM – 2:00 PM  

1:45 PM – 2:10 PM

Market Interest in Oncolytic Viruses | Calibrating

There are currently two oncolytic virus products on the market, one in the USA and one in China.  As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II.   Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:

What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?

  • Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
  • Why are these companies pursuing OVs while several others are taking a pass?

Moderators: Martine Lamfers, PhD

  • Visiting Scientist, BWH

Challenged in development of strategies 

Demonstrate efficacyRobert Martuza, MD

  • Consultant in Neurosurgery, MGH
  • William and Elizabeth Sweet Distinguished Professor of Neurosurgery, HMS

Modulation mechanism Speakers: Anlong Li, MD, PhD

  • Clinical Director, Oncology Clinical Development, Merck Research Laboratories

IV delivery preferred – delivery alternative are less aggereable Jeffrey Infante, MD

  • Early development Oncolytic viruses, Oncology, Janssen Research & Development

oncologic virus if it will generate systemic effects the adoption will accelerate

What areas are the best efficacious 

Direct effect with intra-tumor single injection with right payload 

Platform approach  Prime with 1 and Boost with 2 – not yet experimented with 

Do not have the data at trial design for stratification of patients 

Turn off strategy not existing yetLoic Vincent, PhD

  • Head of Oncology Drug Discovery Unit, Takeda

R&D in collaboration with Academic

Vaccine platform to explore different payload

IV administration may not bring sufficient concentration to the tumor is administer  in the blood stream

Classification of Patients by prospective response type id UNKNOWN yet, population of patients require stratification

  • Q&A 2:15 PM – 2:30 PM  

2:10 PM – 2:20 PM FIRST LOOK

Oncolytic viruses: turning pathogens into anticancer agents

Nino Chiocca, MD, PhD

  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic therapy DID NOT WORK Pancreatic Cancer and Glioblastoma 

Intra- tumoral heterogeniety hinders success 

Solution: Oncolytic VIRUSES – Immunological “coldness”

GADD-34 20,000 GBM 40,000 pancreatic cancer

  • Q&A 2:25 PM – 2:40 PM  

2:20 PM – 2:45 PM

Entrepreneurial Growth | Oncolytic Virus

In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:

  •  How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
  • Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
  • Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space?  Would they bring any real advantages?

Moderator: Reid Huber, PhD

  • Partner, Third Rock Ventures

Critical milestones to observe Speakers: Caroline Breitbach, PhD

  • VP, R&D Programs and Strategy, Turnstone Biologics

Trying Intra-tumor delivery and IV infusion delivery oncolytic vaccine pushing dose 

translation biomarkers program 

transformation tumor microenvironment Brett Ewald, PhD

  • SVP, Development & Corporate Strategy, DNAtrix

Studies gets larger, kicking off Phase III multiple tumors Paul Hallenbeck, PhD

  • President and Chief Scientific Officer, Seneca Therapeutics

Translation: Stephen Russell, MD, PhD

  • CEO, Vyriad

Systemic delivery Oncolytic Virus IV delivery woman in remission

Collaboration with Regeneron

Data collection: Imageable reporter secretable reporter, gene expression

Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors 

  • Q&A 2:50 PM – 3:05 PM  

2:45 PM – 3:00 PM

Break

  3:00 PM – 3:25 PM

CAR-T | Lessons Learned | What’s Next

Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:

  • Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
  • What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
  • Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
  • Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
  • Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
  • Moderator:
  • Marcela Maus, MD, PhD
    • Director, Cellular Immunotherapy Program, Cancer Center, MGH
    • Associate Professor, Medicine, HMSIs CAR-T Industry priority
  • Speakers:
  • Head of R&D, Atara BioTherapeutics
  • Phyno-type of the cells for hematologic cancers 
  • solid tumor 
  • inventory of Therapeutics for treating patients in the future 
  • Progressive MS program
  • EBBT platform B-Cells and T-Cells
    • Stefan Hendriks
      • Gobal Head, Cell & Gene, Novartis
      • yes, CGT is a strategy in the present and future
      • Journey started years ago 
      • Confirmation the effectiveness of CAR-T therapies, 1 year response prolonged to 5 years 26 months
      • Patient not responding – a lot to learn
      • Patient after 8 months of chemo can be helped by CAR-T
    • Christi Shaw
      • CEO, Kite
      • CAR-T is priority 120 companies in the space
      • Manufacturing consistency 
      • Patients respond with better quality of life
      • Blood cancer – more work to be done

Q&A

  • 3:30 PM – 3:45 PM  

3:30 PM – 3:55 PM HOT TOPICS

CAR-T | Solid Tumors Success | When?

The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:

  •  How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
  •  Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
  •  Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
  •  Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.

Moderator: Oladapo Yeku, MD, PhD

  • Clinical Assistant in Medicine, MGH

window of opportunities studies  Speakers: Jennifer Brogdon

  • Executive Director, Head of Cell Therapy Research, Exploratory Immuno-Oncology, NIBR

2017 CAR-T first approval

M&A and research collaborations

TCR tumor specific antigens avoid tissue toxicity Knut Niss, PhD

  • CTO, Mustang Bio

tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor Barbra Sasu, PhD

  • CSO, Allogene

T cell response at prostate cancer 

tumor specific 

cytokine tumor specific signals move from solid to metastatic cell type for easier infiltration

Where we might go: safety autologous and allogeneic Jay Short, PhD

  • Chairman, CEO, Cofounder, BioAlta, Inc.

Tumor type is not enough for development of therapeutics other organs are involved in the periphery

difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside 

Combination staggered key is try combination

  • Q&A 4:00 PM – 4:15 PM  

4:00 PM – 4:25 PM

GCT Manufacturing | Vector Production | Autologous and Allogeneic | Stem Cells | Supply Chain | Scalability & Management

The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027,  groups of products are emerging.  Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:

  • Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
  • For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
  • Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
  • How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?

Moderator: Michael Paglia

  • VP, ElevateBio

Speakers:

  • Dannielle Appelhans
    • SVP TechOps and Chief Technical Officer, Novartis Gene Therapies
  • Thomas Page, PhD
    • VP, Engineering and Asset Development, FUJIFILM Diosynth Biotechnologies
  • Rahul Singhvi, ScD
    • CEO and Co-Founder, National Resilience, Inc.
  • Thomas VanCott, PhD
    • Global Head of Product Development, Gene & Cell Therapy, Catalent
    • 2/3 autologous 1/3 allogeneic  CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized  allogeneic are health donors innovations in cell types in use improvements in manufacturing

Ropa Pike, Director,  Enterprise Science & Partnerships, Thermo Fisher Scientific 

Centralized biopharma industry is moving  to decentralized models site specific license 

  • Q&A 4:30 PM – 4:45 PM  

4:30 PM – 4:40 PM FIRST LOOK

CAR-T

Marcela Maus, MD, PhD

  • Director, Cellular Immunotherapy Program, Cancer Center, MGH
  • Assistant Professor, Medicine, HMS 

Fit-to-purpose CAR-T cells: 3 lead programs

Tr-fill 

CAR-T induce response myeloma and multiple myeloma GBM

27 patents on CAR-T

+400 patients treaded 40 Clinical Trials 

  • Q&A 4:40 PM – 5:00 PM  

4:40 PM – 4:50 PM FIRST LOOK

Repurposed Tumor Cells as Killers and Immunomodulators for Cancer Therapy

Khalid Shah, PhD

  • Vice Chair, Neurosurgery Research, BWH
  • Director, Center for Stem Cell Therapeutics and Imaging, HMS

Solid tumors are the hardest to treat because: immunosuppressive, hypoxic, Acidic Use of autologous tumor cells self homing ThTC self targeting therapeutic cells Therapeutic tumor cells efficacy pre-clinical models GBM 95% metastesis ThTC translation to patient settings

  • Q&A 4:50 PM – 5:10 PM  

4:50 PM – 5:00 PM FIRST LOOK

Other Cell Therapies for Cancer

David Scadden, MD

  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS

T-cell are made in bone marrow create cryogel  can be an off-the-shelf product repertoire on T Receptor CCL19+ mesenchymal cells mimic Tymus cells –

inter-tymic injection. Non human primate validation

Q&A

 

5:00 PM – 5:20 PM   5:00 PM – 5:20 PM FIRESIDE

Fireside with Mikael Dolsten, MD, PhD

  Introducer: Jonathan Kraft Moderator: Daniel Haber, MD, PhD

  • Chair, Cancer Center, MGH
  • Isselbacher Professor of Oncology, HMS

Vaccine Status Mikael Dolsten, MD, PhD

  • Chief Scientific Officer and President, Worldwide Research, Development and Medical, Pfizer

Deliver vaccine around the Globe, Israel, US, Europe.

3BIL vaccine in 2022 for all Global vaccination 

Bio Ntech in Germany

Experience with Biologics immuneoncology & allogeneic antibody cells – new field for drug discovery 

mRNA curative effort and cancer vaccine 

Access to drugs developed by Pfizer to underdeveloped countries 

  • Q&A 5:25 PM – 5:40 AM  

5:20 PM – 5:30 PM

Closing Remarks

Thursday, May 20, 2021

8:00 AM – 8:25 AM

GCT | The China Juggernaut

China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer.  Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents.  It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.

In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment.  In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.

The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.

This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market. Moderator: Min Wu, PhD

  • Managing Director, Fosun Health Fund

What are the area of CGT in China, regulatory similar to the US Speakers: Alvin Luk, PhD

  • CEO, Neuropath Therapeutics

Monogenic rare disease with clear genomic target

Increase of 30% in patient enrollment 

Regulatory reform approval is 60 days no delayPin Wang, PhD

  • CSO, Jiangsu Simcere Pharmaceutical Co., Ltd.

Similar starting point in CGT as the rest of the World unlike a later starting point in other biologicalRichard Wang, PhD

  • CEO, Fosun Kite Biotechnology Co., Ltd

Possibilities to be creative and capitalize the new technologies for innovating drug

Support of the ecosystem by funding new companie allowing the industry to be developed in China

Autologous in patients differences cost challengeTian Xu, PhD

  • Vice President, Westlake University

ICH committee and Chinese FDA -r regulation similar to the US

Difference is the population recruitment, in China patients are active participants in skin disease 

Active in development of transposome 

Development of non-viral methods, CRISPR still in D and transposome

In China price of drugs regulatory are sensitive Shunfei Yan, PhD

  • Investment Manager, InnoStar Capital

Indication driven: Hymophilia, 

Allogogenic efficiency therapies

Licensing opportunities 

  • Q&A 8:30 AM – 8:45 AM  

8:30 AM – 8:55 AM

Impact of mRNA Vaccines | Global Success Lessons

The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?

  • How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
  • How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
  • Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
  • Will cost-of-goods be reduced as the industry matures?
  • How does mRNA technology seek to compete with AAV and other gene therapy approaches?

Moderator: Lindsey Baden, MD

  • Director, Clinical Research, Division of Infectious Diseases, BWH
  • Associate Professor, HMS

In vivo delivery process regulatory cooperation new opportunities for same platform for new indication Speakers:

Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna

How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy 

45 days for Personalized cancer vaccine one per patient

1.6 Billion doses produced rare disease monogenic correct mRNA like CF multiple mutation infection disease and oncology applications

Platform allowing to swap cargo reusing same nanoparticles address disease beyond Big Pharma options for biotech

WHat strain of Flu vaccine will come back in the future when people do not use masks 

  • Kate Bingham, UK Vaccine Taskforce

July 2020, AAV vs mRNA delivery across UK local centers administered both types supply and delivery uplift 

  • Q&A 9:00 AM – 9:15 AM  

9:00 AM – 9:25 AM HOT TOPICS

Benign Blood Disorders

Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market? Moderator: Nancy Berliner, MD

  • Chief, Division of Hematology, BWH
  • H. Franklin Bunn Professor of Medicine, HMS

Speakers: Theresa Heggie

  • CEO, Freeline Therapeutics

Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered 

Potency and quality less quantity drug and greater potency

risk of delivery unwanted DNA, capsules are critical 

analytics is critical regulator involvement in potency definition

Close of collaboration is excitingGallia Levy, MD, PhD

  • Chief Medical Officer, Spark Therapeutics

Hemophilia CGT is the highest potential for Global access logistics in underdeveloped countries working with NGOs practicality of the Tx

Roche reached 120 Counties great to be part of the Roche GroupAmir Nashat, PhD

  • Managing Partner, Polaris Ventures

Suneet Varma

  • Global President of Rare Disease, Pfizer

Gene therapy at Pfizer small molecule, large molecule and CGT – spectrum of choice allowing Hemophilia patients to marry 

1/3 internal 1/3 partnership 1/3 acquisitions 

Learning from COVID-19 is applied for other vaccine development

review of protocols and CGT for Hemophelia

You can’t buy Time

With MIT Pfizer is developing a model for Hemopilia CGT treatment

  • Q&A 9:30 AM – 9:45 AM  

9:25 AM – 9:35 AM FIRST LOOK

Treating Rett Syndrome through X-reactivation

Jeannie Lee, MD, PhD

  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

200 disease X chromosome unlock for neurological genetic diseases: Rett Syndromeand other autism spectrum disorders female model vs male mice model

deliver protein to the brain 

restore own missing or dysfunctional protein

Epigenetic not CGT – no exogent intervention Xist ASO drug

Female model

  • Q&A 9:35 AM – 9:55 AM  

9:35 AM – 9:45 AM FIRST LOOK

Rare but mighty: scaling up success in single gene disorders

Florian Eichler, MD

  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS

Single gene disorder NGS enable diagnosis, DIagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology 

crosswalk from bone marrow matter 

New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers 

  • Q&A 9:45 AM – 10:05 AM  

9:50 AM – 10:15 AM HOT TOPICS

Diabetes | Grand Challenge

The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.

  •  Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
  • How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?

Moderator: Marie McDonnell, MD

  • Chief, Diabetes Section and Director, Diabetes Program, BWH
  • Lecturer on Medicine, HMS

Type 1 Diabetes cost of insulin for continuous delivery of drug

alternative treatments: 

The Future: neuropotent stem cells 

What keeps you up at night  Speakers: Tom Bollenbach, PhD

  • Chief Technology Officer, Advanced Regenerative Manufacturing Institute

Data managment sterility sensors, cell survival after implantation, stem cells manufacturing, process development in manufacturing of complex cells

Data and instrumentation the Process is the Product

Manufacturing tight schedules Manasi Jaiman, MD

  • Vice President, Clinical Development, ViaCyte
  • Pediatric Endocrinologist

continous glucose monitoring Bastiano Sanna, PhD

  • EVP, Chief of Cell & Gene Therapies and VCGT Site Head, Vertex Pharmaceuticals

100 years from discovering Insulin, Insulin is not a cure in 2021 – asking patients to partner more 

Produce large quantities of the Islet cells encapsulation technology been developed 

Scaling up is a challengeRogerio Vivaldi, MD

  • CEO, Sigilon Therapeutics

Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression 

Volume to have of-the-shelf inventory oxegenation in location lymphatic and vascularization conrol the whole process modular platform learning from others

  • Q&A 10:20 AM – 10:35 AM  

10:20 AM – 10:40 AM FIRESIDE

Building A Unified GCT Strategy

  Introducer: John Fish

  • CEO, Suffolk
  • Chairman of Board Trustees, Brigham Health

Moderator: Meg Tirrell

  • Senior Health and Science Reporter, CNBC

Last year, what was it at Novartis Speaker: Jay Bradner, MD

  • President, NIBR

Keep eyes open, waiting the Pandemic to end and enable working back on all the indications 

Portfolio of MET, Mimi Emerging Therapies 

Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis

Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy 

Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic

Protein degradation organization constraint valuation by parties in a partnership 

Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate

Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter

  • Q&A 10:45 AM – 11:00 AM  

10:40 AM – 10:50 AM

Break

  10:50 AM – 11:00 AM FIRST LOOK

Getting to the Heart of the Matter: Curing Genetic Cardiomyopathy

Christine Seidman, MD

  • Director, Cardiovascular Genetics Center, BWH
  • Smith Professor of Medicine & Genetics, HMS

The Voice of Dr. Seidman – Her abstract is cited below

The ultimate opportunity presented by discovering the genetic basis of human disease is accurate prediction and disease prevention. To enable this achievement, genetic insights must enable the identification of at-risk

individuals prior to end-stage disease manifestations and strategies that delay or prevent clinical expression. Genetic cardiomyopathies provide a paradigm for fulfilling these opportunities. Hypertrophic cardiomyopathy (HCM) is characterized by left ventricular hypertrophy, diastolic dysfunction with normal or enhanced systolic performance and a unique histopathology: myocyte hypertrophy, disarray and fibrosis. Dilated cardiomyopathy (DCM) exhibits enlarged ventricular volumes with depressed systolic performance and nonspecific histopathology. Both HCM and DCM are prevalent clinical conditions that increase risk for arrhythmias, sudden death, and heart failure. Today treatments for HCM and DCM focus on symptoms, but none prevent disease progression. Human molecular genetic studies demonstrated that these pathologies often result from dominant mutations in genes that encode protein components of the sarcomere, the contractile unit in striated muscles. These data combined with the emergence of molecular strategies to specifically modulate gene expression provide unparalleled opportunities to silence or correct mutant genes and to boost healthy gene expression in patients with genetic HCM and DCM. Many challenges remain, but the active and vital efforts of physicians, researchers, and patients are poised to ensure success.

Hypertrophic and Dilated Cardiomyopaies ‘

10% receive heart transplant 12 years survival 

Mutation puterb function

TTN: contribute 20% of dilated cardiomyopaty

Silence gene 

pleuripotential cells deliver therapies 

  • Q&A 11:00 AM – 11:20 AM  

11:00 AM – 11:10 AM FIRST LOOK

Unlocking the secret lives of proteins in health and disease

Anna Greka, MD, PhD

  • Medicine, BWH
  • Associate Professor, Medicine, HMS

Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech 

Q&A

  • 11:10 AM – 11:30 AM  

11:10 AM – 11:35 AM

Rare and Ultra Rare Diseases | GCT Breaks Through

One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.

  • What is driving the interest in rare diseases?
  • What are the biggest barriers to making breakthroughs ‘routine and affordable?’
  • What is the role of retrospective and prospective natural history studies in rare disease?  When does the expected value of retrospective disease history studies justify the cost?
  • Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases?  How does this impact the collection of natural history data?

Moderator: Susan Slaugenhaupt, PhD

  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS

Speakers: Leah Bloom, PhD

  • SVP, External Innovation and Strategic Alliances, Novartis Gene Therapies

Ultra rare (less than 100) vs rare difficulty to recruit patients and to follow up after treatment Bobby Gaspar, MD, PhD

  • CEO, Orchard Therapeutics

Study of rare condition have transfer to other larger diseases – delivery of therapeutics genes, like immune disorders 

Patient testimonials just to hear what a treatment can make Emil Kakkis, MD, PhD

  • CEO, Ultragenyx

Do 100 patient study then have information on natural history to develop a clinical trial Stuart Peltz, PhD

  • CEO, PTC Therapeutics

Rare disease, challenge for FDA approval and after market commercialization follow ups

Justification of cost for Rare disease – demonstration of Change is IP in value patients advocacy is helpful

  • Q&A 11:40 AM – 11:55 AM  

11:40 AM – 12:00 PM FIRESIDE

Partnering Across the GCT Spectrum

  Moderator: Erin Harris

  • Chief Editor, Cell & Gene

Perspective & professional tenure

Partnership in manufacturing what are the recommendations?

Hospital systems: Partnership Challenges  Speaker: Marc Casper

  • CEO, ThermoFisher

25 years in Diagnostics last 20 years at ThermoFisher 

products used in the Lab for CAR-T research and manufacture 

CGT Innovations: FDA will have a high level of approval each year

How move from research to clinical trials to manufacturing Quicker process

Best practices in Partnerships: the root cause if acceleration to market service providers to deliver highest standards

Building capacity by acquisition to avoid the waiting time

Accelerate new products been manufactured 

Collaborations with Academic Medical center i.e., UCSF in CGT joint funding to accelerate CGT to clinics’

Customers are extremely knowledgable, scale the capital investment made investment

150MIL a year to improve the Workflow 

  • Q&A 12:05 PM – 12:20 PM  

12:05 PM – 12:30 PM

  • 12:05 PM – 12:20 PM  

12:05 PM – 12:30 PM

CEO Panel | Anticipating Disruption | Planning for Widespread GCT

The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated. Moderator: Meg Tirrell

  • Senior Health and Science Reporter, CNBC

CGT becoming staple therapy what are the disruptors emerging Speakers: Lisa Dechamps

  • SVP & Chief Business Officer, Novartis Gene Therapies

Reimagine medicine with collaboration at MGH, MDM condition in children 

The Science is there, sustainable processes and systems impact is transformational

Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect

Collaboration with FDAKieran Murphy

  • CEO, GE Healthcare

Diagnosis of disease to be used in CGT

2021 investment in CAR-T platform 

Investment in several CGT frontier

Investment in AI, ML in system design new technologies 

GE: Scale and Global distributions, sponsor companies in software 

Waste in Industry – Healthcare % of GDP, work with MGH to smooth the workflow faster entry into hospital and out of Hospital

Telemedicine during is Pandemic: Radiologist needs to read remotely 

Supply chain disruptions slow down all ecosystem 

Production of ventilators by collaboration with GM – ingenuity 

Scan patients outside of hospital a scanner in a Box Christian Rommel, PhD

  • Head, Pharmaceuticals Research & Development, Bayer AG

CGT – 2016 and in 2020 new leadership and capability 

Disease Biology and therapeutics

Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular 

During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions 

  • Q&A 12:35 PM – 12:50 PM  

12:35 PM – 12:55 PM FIRESIDE

Building a GCT Portfolio

GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements? Moderator:

Shinichiro Fuse, PhD

  • Managing Partner, MPM Capital

Speaker: Wolfram Carius, PhD

  • EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG

CGT will bring treatment to cure, delivery of therapies 

Be a Leader repair, regenerate, cure

Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products

Bayer strategy: build platform for use by four domains  

Gener augmentation

Autologeneic therapy, analytics

Gene editing

Oncology Cell therapy tumor treatment: What kind of cells – the jury is out

Of 23 product launch at Bayer no prediction is possible some high some lows 

  • Q&A 1:00 PM – 1:15 PM  

12:55 PM – 1:35 PM

Lunch

  1:40 PM – 2:05 PM

GCT Delivery | Perfecting the Technology

Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities. Moderator: Natalie Artzi, PhD

  • Assistant Professor, BWH

Speakers: Geoff McDonough, MD

  • CEO, Generation Bio

Sonya Montgomery

  • CMO, Evox Therapeutics

Laura Sepp-Lorenzino, PhD

  • Chief Scientific Officer, Executive Vice President, Intellia Therapeutics

Doug Williams, PhD

  • CEO, Codiak BioSciences
  • Q&A 2:10 PM – 2:25 PM  

2:05 PM – 2:10 PM

Invention Discovery Grant Announcement

  2:10 PM – 2:20 PM FIRST LOOK

Enhancing vesicles for therapeutic delivery of bioproducts

Xandra Breakefield, PhD

  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS
  • Q&A 2:20 PM – 2:35 PM  

2:20 PM – 2:30 PM FIRST LOOK

Versatile polymer-based nanocarriers for targeted therapy and immunomodulation

Natalie Artzi, PhD

  • Assistant Professor, BWH
  • Q&A 2:30 PM – 2:45 PM  

2:55 PM – 3:20 PM HOT TOPICS

Gene Editing | Achieving Therapeutic Mainstream

Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.

Today’s panel is made up of pioneers who represent foundational aspects of gene editing.  They will discuss the movement of the technology into the therapeutic mainstream.

  • Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
  • When to use what editing tool – pros and cons of traditional gene-editing v. base editing.  Is prime editing the future? Specific use cases for epigenetic editing.
  • When we reach widespread clinical use – role of off-target editing – is the risk real?  How will we mitigate? How practical is patient-specific off-target evaluation?

Moderator: J. Keith Joung, MD, PhD

  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS

Speakers: John Evans

  • CEO, Beam Therapeutics

Lisa Michaels

  • EVP & CMO, Editas Medicine
  • Q&A 3:25 PM – 3:50 PM  

3:25 PM – 3:50 PM HOT TOPICS

Common Blood Disorders | Gene Therapy

There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and  Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:

  • What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
  • How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
  • How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
  • How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
  • Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
  • What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
  • Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?

Moderator: David Scadden, MD

  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS

Speakers: Samarth Kukarni, PhDNick Leschly

  • Chief Bluebird, Bluebird Bio

Mike McCune, MD, PhD

  • Head, HIV Frontiers, Global Health Innovative Technology Solutions, Bill & Melinda Gates Foundation
  • Q&A 3:55 PM – 4:15 PM  

3:50 PM – 4:00 PM FIRST LOOK

Gene Editing

J. Keith Joung, MD, PhD

  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS
  • Q&A 4:00 PM – 4:20 PM  

4:20 PM – 4:45 PM HOT TOPICS

Gene Expression | Modulating with Oligonucleotide-Based Therapies

Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:

How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?

  • Will oligonucleotides improve as a class that will make them even more effective?   Are further advancements in backbone chemistry anticipated, for example.
  • Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
  • Are small molecules a threat to oligonucleotide-based therapies?
  • Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides?  Is there a place for multiple mechanism oligonucleotide medicines?
  • Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?

Moderator: Jeannie Lee, MD, PhD

  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

Speakers: Bob Brown, PhD

  • CSO, EVP of R&D, Dicerna

Brett Monia, PhD

  • CEO, Ionis

Alfred Sandrock, MD, PhD

  • EVP, R&D and CMO, Biogen
  • Q&A 4:50 PM – 5:05 PM  

4:45 PM – 4:55 PM FIRST LOOK

RNA therapy for brain cancer

Pierpaolo Peruzzi, MD, PhD

  • Nuerosurgery, BWH
  • Assistant Professor of Neurosurgery, HMS
  • Q&A 4:55 PM – 5:15 PM  

Friday, May 21, 2021

8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly? Moderator: Meredith Fisher, PhD

  • Partner, Mass General Brigham Innovation Fund

Speakers: David Berry, MD, PhD

  • CEO, Valo Health
  • General Partner, Flagship Pioneering

Robert Nelsen

  • Managing Director, Co-founder, ARCH Venture Partners

Kush Parmar, MD, PhD

  • Managing Partner, 5AM Ventures
  • Q&A 9:00 AM – 9:15 AM  

9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product

Moderator: Ole Isacson, MD, PhD

  • Director, Neuroregeneration Research Institute, McLean
  • Professor, Neurology and Neuroscience, HMS

Speakers: Kapil Bharti, PhD

  • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH

Joe Burns, PhD

  • VP, Head of Biology, Decibel Therapeutics

Erin Kimbrel, PhD

  • Executive Director, Regenerative Medicine, Astellas

Nabiha Saklayen, PhD

  • CEO and Co-Founder, Cellino
  • Q&A 9:30 AM – 9:45 AM  

9:25 AM – 9:35 AM FIRST LOOK

Stem Cells

Bob Carter, MD, PhD

  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Q&A 9:35 AM – 9:55 AM  

9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated? Moderator: Roger Kitterman

  • VP, Venture, Mass General Brigham

Speakers: Ellen Hukkelhoven, PhD

  • Managing Director, Perceptive Advisors

Peter Kolchinsky, PhD

  • Founder and Managing Partner, RA Capital Management

Deep Nishar

  • Senior Managing Partner, SoftBank Investment Advisors

Oleg Nodelman

  • Founder & Managing Partner, EcoR1 Capital
  • Q&A 10:05 AM – 10:20 AM  

10:00 AM – 10:10 AM FIRST LOOK

New scientific and clinical developments for autologous stem cell therapy for Parkinson’s disease patients

Penelope Hallett, PhD

  • NRL, McLean
  • Assistant Professor Psychiatry, HMS
  • Q&A 10:10 AM – 10:30 AM  

10:10 AM – 10:35 AM HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT

Moderator: Bob Carter, MD, PhD

  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS

Speakers: Erwan Bezard, PhD

  • INSERM Research Director, Institute of Neurodegenerative Diseases

Nikola Kojic, PhD

  • CEO and Co-Founder, Oryon Cell Therapies

Geoff MacKay

  • President & CEO, AVROBIO

Viviane Tabar, MD

  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Q&A 10:40 AM – 10:55 AM  

10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care. 11:35 AM – 11:45 AM

Concluding Remarks

Friday, May 21, 2021

Computer connection to the iCloud of WordPress.com FROZE completely at 10:30AM EST and no file update was possible. COVERAGE OF MAY 21, 2021 IS RECORDED BELOW FOLLOWING THE AGENDA BY COPY AN DPASTE OF ALL THE TWEETS I PRODUCED ON MAY 21, 2021 8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly? Moderator: Meredith Fisher, PhD

  • Partner, Mass General Brigham Innovation Fund

Speakers: David Berry, MD, PhD

  • CEO, Valo Health
  • General Partner, Flagship Pioneering

Robert Nelsen

  • Managing Director, Co-founder, ARCH Venture Partners

Kush Parmar, MD, PhD

  • Managing Partner, 5AM Ventures
  • Q&A 9:00 AM – 9:15 AM  

9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product

Moderator: Ole Isacson, MD, PhD

  • Director, Neuroregeneration Research Institute, McLean
  • Professor, Neurology and Neuroscience, HMS

Speakers: Kapil Bharti, PhD

  • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH

Joe Burns, PhD

  • VP, Head of Biology, Decibel Therapeutics

Erin Kimbrel, PhD

  • Executive Director, Regenerative Medicine, Astellas

Nabiha Saklayen, PhD

  • CEO and Co-Founder, Cellino
  • Q&A 9:30 AM – 9:45 AM  

9:25 AM – 9:35 AM FIRST LOOK

Stem Cells

Bob Carter, MD, PhD

  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Q&A 9:35 AM – 9:55 AM  

9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated? Moderator: Roger Kitterman

  • VP, Venture, Mass General Brigham

Speakers: Ellen Hukkelhoven, PhD

  • Managing Director, Perceptive Advisors

Peter Kolchinsky, PhD

  • Founder and Managing Partner, RA Capital Management

Deep Nishar

  • Senior Managing Partner, SoftBank Investment Advisors

Oleg Nodelman

  • Founder & Managing Partner, EcoR1 Capital
  • Q&A 10:05 AM – 10:20 AM  

10:00 AM – 10:10 AM FIRST LOOK

New scientific and clinical developments for autologous stem cell therapy for Parkinson’s disease patients

Penelope Hallett, PhD

  • NRL, McLean
  • Assistant Professor Psychiatry, HMS
  • Q&A 10:10 AM – 10:30 AM  

10:10 AM – 10:35 AM HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT

Moderator: Bob Carter, MD, PhD

  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS

Speakers: Erwan Bezard, PhD

  • INSERM Research Director, Institute of Neurodegenerative Diseases

Nikola Kojic, PhD

  • CEO and Co-Founder, Oryon Cell Therapies

Geoff MacKay

  • President & CEO, AVROBIO

Viviane Tabar, MD

  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Q&A 10:40 AM – 10:55 AM  

10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care. 11:35 AM – 11:45 AM

Concluding Remarks

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.

 

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.Christine Seidman, MD

Hypertrophic and Dilated Cardiomyopaies ‘

10% receive heart transplant 12 years survival 

Mutation puterb function

TTN: contribute 20% of dilated cardiomyopaty

Silence gene 

pleuripotential cells deliver therapies 

  • Q&A 11:00 AM – 11:20 AM  

11:00 AM – 11:10 AM FIRST LOOK

Unlocking the secret lives of proteins in health and disease

Anna Greka, MD, PhD

  • Medicine, BWH
  • Associate Professor, Medicine, HMS

Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech 

Q&A

  • 11:10 AM – 11:30 AM  

11:10 AM – 11:35 AM

Rare and Ultra Rare Diseases | GCT Breaks Through

One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.

  • What is driving the interest in rare diseases?
  • What are the biggest barriers to making breakthroughs ‘routine and affordable?’
  • What is the role of retrospective and prospective natural history studies in rare disease?  When does the expected value of retrospective disease history studies justify the cost?
  • Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases?  How does this impact the collection of natural history data?

Moderator: Susan Slaugenhaupt, PhD

  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS

Speakers: Leah Bloom, PhD

  • SVP, External Innovation and Strategic Alliances, Novartis Gene Therapies

Ultra rare (less than 100) vs rare difficulty to recruit patients and to follow up after treatment Bobby Gaspar, MD, PhD

  • CEO, Orchard Therapeutics

Study of rare condition have transfer to other larger diseases – delivery of therapeutics genes, like immune disorders 

Patient testimonials just to hear what a treatment can make Emil Kakkis, MD, PhD

  • CEO, Ultragenyx

Do 100 patient study then have information on natural history to develop a clinical trial Stuart Peltz, PhD

  • CEO, PTC Therapeutics

Rare disease, challenge for FDA approval and after market commercialization follow ups

Justification of cost for Rare disease – demonstration of Change is IP in value patients advocacy is helpful

  • Q&A 11:40 AM – 11:55 AM  

11:40 AM – 12:00 PM FIRESIDE

Partnering Across the GCT Spectrum

  Moderator: Erin Harris

  • Chief Editor, Cell & Gene

Perspective & professional tenure

Partnership in manufacturing what are the recommendations?

Hospital systems: Partnership Challenges  Speaker: Marc Casper

  • CEO, ThermoFisher

25 years in Diagnostics last 20 years at ThermoFisher 

products used in the Lab for CAR-T research and manufacture 

CGT Innovations: FDA will have a high level of approval each year

How move from research to clinical trials to manufacturing Quicker process

Best practices in Partnerships: the root cause if acceleration to market service providers to deliver highest standards

Building capacity by acquisition to avoid the waiting time

Accelerate new products been manufactured 

Collaborations with Academic Medical center i.e., UCSF in CGT joint funding to accelerate CGT to clinics’

Customers are extremely knowledgable, scale the capital investment made investment

150MIL a year to improve the Workflow 

  • Q&A 12:05 PM – 12:20 PM  

12:05 PM – 12:30 PM

CEO Panel | Anticipating Disruption | Planning for Widespread GCT

The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated. Moderator: Meg Tirrell

  • Senior Health and Science Reporter, CNBC

CGT becoming staple therapy what are the disruptors emerging Speakers: Lisa Dechamps

  • SVP & Chief Business Officer, Novartis Gene Therapies

Reimagine medicine with collaboration at MGH, MDM condition in children 

The Science is there, sustainable processes and systems impact is transformational

Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect

Collaboration with FDAKieran Murphy

  • CEO, GE Healthcare

Diagnosis of disease to be used in CGT

2021 investment in CAR-T platform 

Investment in several CGT frontier

Investment in AI, ML in system design new technologies 

GE: Scale and Global distributions, sponsor companies in software 

Waste in Industry – Healthcare % of GDP, work with MGH to smooth the workflow faster entry into hospital and out of Hospital

Telemedicine during is Pandemic: Radiologist needs to read remotely 

Supply chain disruptions slow down all ecosystem 

Production of ventilators by collaboration with GM – ingenuity 

Scan patients outside of hospital a scanner in a Box Christian Rommel, PhD

  • Head, Pharmaceuticals Research & Development, Bayer AG

CGT – 2016 and in 2020 new leadership and capability 

Disease Biology and therapeutics

Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular 

During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions 

  • Q&A 12:35 PM – 12:50 PM  

12:35 PM – 12:55 PM FIRESIDE

Building a GCT Portfolio

GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements? Moderator:

Shinichiro Fuse, PhD

  • Managing Partner, MPM Capital

Speaker: Wolfram Carius, PhD

  • EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG

CGT will bring treatment to cure, delivery of therapies 

Be a Leader repair, regenerate, cure

Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products

Bayer strategy: build platform for use by four domains  

Gener augmentation

Autologeneic therapy, analytics

Gene editing

Oncology Cell therapy tumor treatment: What kind of cells – the jury is out

Of 23 product launch at Bayer no prediction is possible some high some lows 

  • Q&A 1:00 PM – 1:15 PM  

12:55 PM – 1:35 PM

Lunch

  1:40 PM – 2:05 PM

GCT Delivery | Perfecting the Technology

Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities. Moderator: Natalie Artzi, PhD

  • Assistant Professor, BWH

Speakers: Geoff McDonough, MD

  • CEO, Generation Bio

Sonya Montgomery

  • CMO, Evox Therapeutics

Laura Sepp-Lorenzino, PhD

  • Chief Scientific Officer, Executive Vice President, Intellia Therapeutics

Doug Williams, PhD

  • CEO, Codiak BioSciences
  • Q&A 2:10 PM – 2:25 PM  

2:05 PM – 2:10 PM

Invention Discovery Grant Announcement

  2:10 PM – 2:20 PM FIRST LOOK

Enhancing vesicles for therapeutic delivery of bioproducts

Xandra Breakefield, PhD

  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS
  • Q&A 2:20 PM – 2:35 PM  

2:20 PM – 2:30 PM FIRST LOOK

Versatile polymer-based nanocarriers for targeted therapy and immunomodulation

Natalie Artzi, PhD

  • Assistant Professor, BWH
  • Q&A 2:30 PM – 2:45 PM  

2:55 PM – 3:20 PM HOT TOPICS

Gene Editing | Achieving Therapeutic Mainstream

Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.

Today’s panel is made up of pioneers who represent foundational aspects of gene editing.  They will discuss the movement of the technology into the therapeutic mainstream.

  • Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
  • When to use what editing tool – pros and cons of traditional gene-editing v. base editing.  Is prime editing the future? Specific use cases for epigenetic editing.
  • When we reach widespread clinical use – role of off-target editing – is the risk real?  How will we mitigate? How practical is patient-specific off-target evaluation?

Moderator: J. Keith Joung, MD, PhD

  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS

Speakers: John Evans

  • CEO, Beam Therapeutics

Lisa Michaels

  • EVP & CMO, Editas Medicine
  • Q&A 3:25 PM – 3:50 PM  

3:25 PM – 3:50 PM HOT TOPICS

Common Blood Disorders | Gene Therapy

There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and  Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:

  • What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
  • How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
  • How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
  • How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
  • Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
  • What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
  • Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?

Moderator: David Scadden, MD

  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS

Speakers: Samarth Kukarni, PhDNick Leschly

  • Chief Bluebird, Bluebird Bio

Mike McCune, MD, PhD

  • Head, HIV Frontiers, Global Health Innovative Technology Solutions, Bill & Melinda Gates Foundation
  • Q&A 3:55 PM – 4:15 PM  

3:50 PM – 4:00 PM FIRST LOOK

Gene Editing

J. Keith Joung, MD, PhD

  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS
  • Q&A 4:00 PM – 4:20 PM  

4:20 PM – 4:45 PM HOT TOPICS

Gene Expression | Modulating with Oligonucleotide-Based Therapies

Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:

How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?

  • Will oligonucleotides improve as a class that will make them even more effective?   Are further advancements in backbone chemistry anticipated, for example.
  • Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
  • Are small molecules a threat to oligonucleotide-based therapies?
  • Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides?  Is there a place for multiple mechanism oligonucleotide medicines?
  • Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?

Moderator: Jeannie Lee, MD, PhD

  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

Speakers: Bob Brown, PhD

  • CSO, EVP of R&D, Dicerna

Brett Monia, PhD

  • CEO, Ionis

Alfred Sandrock, MD, PhD

  • EVP, R&D and CMO, Biogen
  • Q&A 4:50 PM – 5:05 PM  

4:45 PM – 4:55 PM FIRST LOOK

RNA therapy for brain cancer

Pierpaolo Peruzzi, MD, PhD

  • Nuerosurgery, BWH
  • Assistant Professor of Neurosurgery, HMS
  • Q&A 4:55 PM – 5:15 PM  

Friday, May 21, 2021

Computer connection to the iCloud of WordPress.com FROZE completely at 10:30AM EST and no file update was possible. COVERAGE OF MAY 21, 2021 IS RECORDED BELOW FOLLOWING THE AGENDA BY COPY AN DPASTE OF ALL THE TWEETS I PRODUCED ON MAY 21, 2021

8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly? Moderator:   Meredith Fisher, PhD

  • Partner, Mass General Brigham Innovation Fund

Strategies, success what changes are needed in the drug discovery process   Speakers:  

Bring disruptive frontier as a platform with reliable delivery CGT double knock out disease cure all change efficiency and scope human centric vs mice centered right scale of data converted into therapeutics acceleratetion 

Innovation in drugs 60% fails in trial because of Toxicology system of the future deal with big diseases

Moderna is an example in unlocking what is inside us Microbiome and beyond discover new drugs epigenetics  

  • Robert Nelsen
    • Managing Director, Co-founder, ARCH Venture Partners

Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization How to systematically scaling up systematize the discovery and the production regulatory innovations

Responsibility mismatch should be and what is “are”

Long term diseases Stack holders and modalities risk benefir for populations 

  • Q&A 9:00 AM – 9:15 AM  

9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product
  • Moderator:
    • Ole Isacson, MD, PhD
      • Director, Neuroregeneration Research Institute, McLean
      • Professor, Neurology and Neuroscience, MGH, HMS

Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all Translational medicine funding stem cells enormous opportunities 

  • Speakers:
  • Kapil Bharti, PhD
    • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH
    • first drug required to establish the process for that innovations design of animal studies not done before
    • Off-th-shelf one time treatment becoming cure 
    •  Intact tissue in a dish is fragile to maintain metabolism
    Joe Burns, PhD
    • VP, Head of Biology, Decibel Therapeutics
    • Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation
    • multiple cell types and tissue to follow
    Erin Kimbrel, PhD
    • Executive Director, Regenerative Medicine, Astellas
    • In the ocular space immunogenecity
    • regulatory communication
    • use gene editing for immunogenecity Cas1 and Cas2 autologous cells
    • gene editing and programming big opportunities 
    Nabiha Saklayen, PhD
    • CEO and Co-Founder, Cellino
    • scale production of autologous cells foundry using semiconductor process in building cassettes
    • solution for autologous cells
  • Q&A 9:30 AM – 9:45 AM  

9:25 AM – 9:35 AM FIRST LOOK

Stem Cells

Bob Carter, MD, PhD

  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamin
  • skin cell to become autologous cells reprograms to become cells producing dopamine
  • transplantation fibroblast cells metabolic driven process lower mutation burden 
  • Quercetin inhibition elimination undifferentiated cells graft survival oxygenation increased 
  • Q&A 9:35 AM – 9:55 AM  

9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated? Moderator: Roger Kitterman

  • VP, Venture, Mass General Brigham
  • Saturation reached or more investment is coming in CGT 

Speakers: Ellen Hukkelhoven, PhD

  • Managing Director, Perceptive Advisors
  • Cardiac area transduct cells
  • matching tools
  • 10% success of phase 1 in drug development next phase matters more 

Peter Kolchinsky, PhD

  • Founder and Managing Partner, RA Capital Management
  • Future proof for new comers disruptors 
  • Ex Vivo gene therapy to improve funding products what tool kit belongs to 
  • company insulation from next instability vs comapny stabilizing themselves along few years
  • Company interested in SPAC 
  • cross over investment vs SPAC
  • Multi Omics in cancer early screening metastatic diseas will be wiped out 

Deep Nishar

  • Senior Managing Partner, SoftBank Investment Advisors
  • Young field vs CGT started in the 80s 
  • high payloads is a challenge
  • cost effective fast delivery to large populations
  • Mission oriented by the team and management  
  • Multi Omics disease modality 

Oleg Nodelman

  • Founder & Managing Partner, EcoR1 Capital
  • Invest in company next round of investment will be IPO
  • Help company raise money cross over investment vs SPAC
  • Innovating ideas from academia in need for funding 
  • Q&A 10:05 AM – 10:20 AM  

10:00 AM – 10:10 AM FIRST LOOK

New scientific and clinical developments for autologous stem cell therapy for Parkinson’s disease patients

Penelope Hallett, PhD

  • NRL, McLean
  • Assistant Professor Psychiatry, HMS
  • Pharmacologic agent in existing cause another disorders locomo-movement related 
  • efficacy Autologous cell therapy transplantation approach program T cells into dopamine generating neurons greater than Allogeneic cell transplantation 
  • Q&A 10:10 AM – 10:30 AM  

10:10 AM – 10:35 AM HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT

Moderator: Bob Carter, MD, PhD

  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Neurogeneration REVERSAL or slowing down 

Speakers: Erwan Bezard, PhD

  • INSERM Research Director, Institute of Neurodegenerative Diseases
  • Cautious on reversal 
  • Early intervantion versus late

Nikola Kojic, PhD

  • CEO and Co-Founder, Oryon Cell Therapies
  • Autologus cell therapy placed focal replacing missing synapses reestablishment of neural circuitary

Geoff MacKay

  • President & CEO, AVROBIO
  • Prevent condition to be manifested in the first place 
  • clinical effect durable single infusion preventions of symptoms to manifest 
  • Cerebral edema – stabilization
  • Gene therapy know which is the abnormal gene grafting the corrected one 
  • More than biomarker as end point functional benefit not yet established  

Viviane Tabar, MD

  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Current market does not have delivery mechanism that a drug-delivery is the solution Trials would fail on DELIVERY
  • Immune suppressed patients during one year to avoid graft rejection Autologous approach of Parkinson patient genetically mutated reprogramed as dopamine generating neuron – unknowns are present
  • Circuitry restoration
  • Microenvironment disease ameliorate symptoms – education of patients on the treatment 
  • Q&A 10:40 AM – 10:55 AM  

10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care. 11:35 AM – 11:45 AM

Concluding Remarks

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.

ALL THE TWEETS PRODUCED ON MAY 21, 2021 INCLUDE THE FOLLOWING:

Aviva Lev-Ari

@AVIVA1950

  • @AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Erwan Bezard, PhD INSERM Research Director, Institute of Neurodegenerative Diseases Cautious on reversal

@pharma_BI

@AVIVA1950

Aviva Lev-Ari

@AVIVA1950

  • @AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Nikola Kojic, PhD CEO and Co-Founder, Oryon Cell Therapies Autologus cell therapy placed focal replacing missing synapses reestablishment of neural circutary

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

4h

#WMIF2021

@MGBInnovation

Bob Carter, MD, PhD Chairman, Department of Neurosurgery, MGH William and Elizabeth Sweet, Professor of Neurosurgery, HMS Neurogeneration REVERSAL or slowing down? 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

4h

#WMIF2021

@MGBInnovation

Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS efficacy Autologous cell therapy transplantation approach program T cells into dopamine genetating cells greater than Allogeneic cell transplantation 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

4h

#WMIF2021

@MGBInnovation

Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS Pharmacologic agent in existing cause another disorders locomo-movement related 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT Multi OMICS and academia originated innovations are the most attractive areas

@pharma_BI

@AVIVA1950

1

3

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT 

@pharma_BI

@AVIVA1950

1

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

4h

#WMIF2021

@MGBInnovation

Oleg Nodelman Founder & Managing Partner, EcoR1 Capital Invest in company next round of investment will be IPO 20% discount

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Peter Kolchinsky, PhD Founder and Managing Partner, RA Capital Management Future proof for new comers disruptors  Ex Vivo gene therapy to improve funding products what tool kit belongs to 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

4h

#WMIF2021

@MGBInnovation

Deep Nishar Senior Managing Partner, SoftBank Investment Advisors Young field vs CGT started in the 80s  high payloads is a challenge 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Bob Carter, MD, PhD MGH, HMS cells producing dopamine transplantation fibroblast cells metabolic driven process lower mutation burden  Quercetin inhibition elimination undifferentiated cells graft survival oxygenation increased 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Chairman, Department of Neurosurgery, MGH, Professor of Neurosurgery, HMS Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamine skin cell to become autologous cells reprogramed  

@pharma_BI

@AVIVA1950

#WMIF2021

@MGBInnovation

Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH Off-th-shelf one time treatment becoming cure  Intact tissue in a dish is fragile to maintain metabolism to become like semiconductors

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

5h

#WMIF2021

@MGBInnovation

Ole Isacson, MD, PhD Director, Neuroregeneration Research Institute, McLean Professor, Neurology and Neuroscience, MGH, HMS Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Erin Kimbrel, PhD Executive Director, Regenerative Medicine, Astellas In the ocular space immunogenecity regulatory communication use gene editing for immunogenecity Cas1 and Cas2 autologous cells

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Nabiha Saklayen, PhD CEO and Co-Founder, Cellino scale production of autologous cells foundry using semiconductor process in building cassettes by optic physicists

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Joe Burns, PhD VP, Head of Biology, Decibel Therapeutics Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation control by genomics

@pharma_BI

@AVIVA1950

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH first drug required to establish the process for that innovations design of animal studies not done before 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Meredith Fisher, PhD Partner, Mass General Brigham Innovation Fund Strategies, success what changes are needed in the drug discovery process@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization

@pharma_BI

@AVIVA1950

1

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

Kush Parmar, MD, PhD Managing Partner, 5AM Ventures Responsibility mismatch should be and what is “are”

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

5h

#WMIF2021

@MGBInnovation

David Berry, MD, PhD CEO, Valo Health GP, Flagship Pioneering Bring disruptive frontier platform reliable delivery CGT double knockout disease cure all change efficiency scope human centric vs mice centered right scale acceleration

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

6h

#WMIF2021

@MGBInnovation

Kush Parmar, MD, PhD Managing Partner, 5AM Ventures build it yourself, benefit for patients FIrst Look at MGB shows MEE innovation on inner ear worthy investment  

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

6h

#WMIF2021

@MGBInnovation

Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Frustration with supply chain during the Pandemic, GMC anticipation in advance CGT rapidly prototype rethink and invest proactive investor .edu and Pharma

@pharma_BI

@AVIVA1950

Read Full Post »


2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021

The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy.
Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.

About the World Medical Innovation Forum

Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation

Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next

https://worldmedicalinnovation.org/wp-content/uploads/2021/05/2021-WMIF-White-Paper-1.0.pdf

 

https://worldmedicalinnovation.org/agenda/

 

Virtual | May 19–21, 2021

#WMIF2021

@MGBInnovation

Leaders in Pharmaceutical Business Intelligence (LPBI) Group

will cover the event in Real Time

Aviva Lev-Ari, PhD, RN

Founder LPBI 1.0 & LPBI 2.0

member_60221522 copy

will be in virtual attendance producing the e-Proceedings

and the Tweet Collection of this Global event expecting +15,000 attendees

@pharma_BI

@AVIVA1950

LPBI’s Eighteen Books in Medicine

https://lnkd.in/ekWGNqA

 

Among them, books on Gene and Cell Therapy include the following:

Topics for May 19 – 21 include:

Impact on Patient Care – Therapeutic and Potentially Curative GCT Developments

GCT Delivery, Manufacturing – What’s Next

GCT Platform Development

Oncolytic Viruses – Cancer applications, start-ups

Regenerative Medicine/Stem Cells

Future of CAR-T

M&A Shaping GCT’s Future

Market Priorities

Venture Investing in GCT

China’s GCT Juggernaut

Disease and Patient Focus: Benign blood disorders, diabetes, neurodegenerative diseases

Click here for the current WMIF agenda  

 

Plus:

Fireside Chats: 1:1 interviews with industry CEOs/C-Suite leaders including Novartis Gene Therapies, ThermoFisher, Bayer AG, FDA

First Look: 18 briefings on emerging GCT research from Mass General Brigham scientists

Virtual Poster Session: 40 research posters and presenters on potential GCT discoveries from Mass General Brigham

Announcement of the Disruptive Dozen, 12 GCT technologies likely to break through in the next few years

AGENDA

8:00 AM – 8:10 AM

Opening Remarks

Welcome and the vision for Gene and Cell Therapy and why it is a top Mass General Brigham priority.

Introducer:
Scott Sperling
  • Co-President, Thomas H. Lee Partners
  • Chairman of the Board of Directors, PHS
Presenter:
Anne Klibanski, MD
  • CEO, Mass General Brigham

3,000 people joined 5/19 morning

30 sessions: Lab to Clinic,  academia, industry, investment community

May 22,23,24, 2022 – in Boston, in-person 2022 WMIF on CGT

 

8:10 AM – 8:30 AM

The Grand Challenge of Widespread GCT Patient Benefits

Co-Chairs identify the key themes of the Forum –  set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future.

Moderator:
Susan Hockfield, PhD
  • President Emerita and Professor of Neuroscience, MIT

GCT – poised to deliver therapies

Inflection point as Panel will present

Doctors and Patients – Promise for some patients 

Barriers for Cell & Gene

Access for patients to therapies like CGT

Speakers:
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic virus triple threat: Toxic, immunological, combine with anti cancer therapies

Polygenic therapy – multiple genes involved, plug-play, 

Susan Slaugenhaupt, PhD
  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS
Ravi Thadhani, MD
  • CAO, Mass General Brigham
  • Professor, Medicine and Faculty Dean, HMS

Role of academia special to spear head the Polygenic therapy – multiple genes involved, plug-play, 

Access critical, relations with Industry

Luk Vandenberghe, PhD
  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

Pharmacology Gene-Drug, Interface academic centers and industry

many CGT drugs emerged in Academic center

8:35 AM – 8:50 AM

 

FIRESIDE

Gene and Cell Therapy 2.0 – What’s Next as We Realize their Potential for Patients

Dave Lennon, PhD
  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

Moderator:
Julian Harris, MD
  • Partner, Deerfield

Promise of CGT realized, what part?

FDA role and interaction in CGT

Manufacturing aspects which is critical

Speaker:
Dave Lennon, PhD
  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

  • Q&A

    8:55 AM – 9:10 AM
     
8:55 AM – 9:20 AM

The Patient and GCT

GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates.

Moderator:
Patricia Musolino, MD, PhD
  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial

Speakers:
Jack Hogan
  • Patient, MEE
Jeanette Hogan
  • Parent of Patient, MEE
Jim Holland
  • CEO, Backcountry.com

Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical 

Barbara Lavery
  • Chief Program Officer, ACGT Foundation

Advocacy agency beginning of work Global Genes educational content and out reach to access the information 

Patient has the knowledge of the symptoms and recording all input needed for diagnosis by multiple clinicians Early application for CGT

Dan Tesler
  • Clinical Trial Patient, BWH/DFCC

Experimental Drug clinical trial patient participation in clinical trial is very important to advance the state of science

Sarah Beth Thomas, RN
  • Professional Development Manager, BWH

Outcome is unknown, hope for good, support with resources all advocacy groups, 

  • Q&A

    9:25 AM – 9:40 AM
     
9:25 AM – 9:45 AM

 

FIRESIDE

GCT Regulatory Framework | Why Different?

 
Moderator:
Vicki Sato, PhD
  • Chairman of the Board, Vir Biotechnology

Diversity of approaches

Process at FDA generalize from 1st entry to rules more generalizable 

Speaker:
Peter Marks, MD, PhD
  • Director, Center for Biologics Evaluation and Research, FDA

Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work

Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance  T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance

Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation 

  • Q&A

    9:50 AM – 10:05 AM
     
9:50 AM – 10:15 AM

Building a GCT Platform for Mainstream Success

This panel of GCT executives, innovators and investors explore how to best shape a successful GCT strategy. Among the questions to be addressed:

  • How are GCT approaches set around defining and building a platform?
  • Is AAV the leading modality and what are the remaining challenges?
  • What are the alternatives?
  • Is it just a matter of matching modalities to the right indications?
Moderator:
Jean-François Formela, MD
  • Partner, Atlas Venture

Established core components of the Platform

Speakers:
Katherine High, MD
  • President, Therapeutics, AskBio

Three drugs approved in Europe in the Gene therapy space

Regulatory Infrastructure exists for CGT drug approval – as new class of therapeutics

Participants investigators, regulators, patients i. e., MDM 

Hemophilia in male most challenging

Human are natural hosts for AV safety signals 

Dave Lennon, PhD
  • President, Novartis Gene Therapies

big pharma has portfolios of therapeutics not one drug across Tx areas: cell, gene iodine therapy 

collective learning infrastructure features manufacturing at scale early in development Acquisitions strategy for growth # applications for scaling 

 

Rick Modi
  • CEO, Affinia Therapeutics

Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP 

Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific 

Louise Rodino-Klapac, PhD
  • EVP, Chief Scientific Officer, Sarepta Therapeutics

AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years

Safety to clinic vs speed to clinic, difference of vectors to trust

  • Q&A

    10:20 AM – 10:35 AM
     
10:20 AM – 10:45 AM

AAV Success Studies | Retinal Dystrophy | Spinal Muscular Atrophy

Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.

The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.

  • Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
  • Lessons learned from these first-in-class approvals.
  • Challenges to broaden this modality to similar indications.
  • Reflections on safety signals in the clinical studies?
Moderator:
Joan Miller, MD
  • Chief, Ophthalmology, MEE
  • Cogan Professor & Chair of Ophthalmology, HMS

Retina specialist, Luxturna success FMA condition cell therapy as solution

Lessons learned

Safety

Speakers:
Ken Mills
  • CEO, RegenXBio

Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years 

Cell therapy vs transplant therapy no immunosuppression

 

Eric Pierce, MD, PhD
  • Director, Ocular Genomics Institute, MEE
  • Professor of Ophthalmology, HMS

Laxterna success to be replicated platform, paradigms measurement visual improved

More science is needed to continue develop vectors reduce toxicity,

AAV can deliver different cargos reduce adverse events improve vectors

Ron Philip
  • Chief Operating Officer, Spark Therapeutics

The first retinal gene therapy, voretigene neparvovec-rzyl (Luxturna, Spark Therapeutics), was approved by the FDA in 2017.

Meredith Schultz, MD
  • Executive Medical Director, Lead TME, Novartis Gene Therapies

Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise

Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information

  • Q&A

    10:50 AM – 11:05 AM
     
10:45 AM – 10:55 AM

Break

 
10:55 AM – 11:05 AM

 

FIRST LOOK

Control of AAV pharmacology by Rational Capsid Design

 
Luk Vandenberghe, PhD
  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,

Pathway for rational AAV rational design, curated smart variant libraries, AAV  sequence screen multiparametric , data enable liver (de-) targeting unlock therapeutics areas: cochlea 

  • Q&A

    11:05 AM – 11:25 AM
     
11:05 AM – 11:15 AM

 

FIRST LOOK

Enhanced gene delivery and immunoevasion of AAV vectors without capsid modification

 
Casey Maguire, PhD
  • Associate Professor of Neurology, MGH & HMS

Virus Biology: Enveloped (e) or not 

enveloped for gene therapy eAAV platform technology: tissue targets and Indications commercialization of eAAV 

  • Q&A

    11:15 AM – 11:35 AM
     
11:20 AM – 11:45 AM

 

HOT TOPICS

AAV Delivery

This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed?

Moderators:
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS

Florian Eichler, MD

  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS
Speakers:
Jennifer Farmer
  • CEO, Friedreich’s Ataxia Research Alliance

Ataxia requires therapy targeting multiple organ with one therapy, brain, spinal cord, heart several IND, clinical trials in 2022

Mathew Pletcher, PhD
  • SVP, Head of Gene Therapy Research and Technical Operations, Astellas

Work with diseases poorly understood, collaborations needs example of existing: DMD is a great example explain dystrophin share placedo data 

Continue to explore large animal guinea pig not the mice, not primates (ethical issues) for understanding immunogenicity and immune response 

Manny Simons, PhD
  • CEO, Akouos

AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model 

Biology across species nerve ending in the cochlea

engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones

  • Q&A

    11:50 AM – 12:05 PM
     
11:50 AM – 12:15 PM

M&A | Shaping GCT Innovation

The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up?

Moderator:
Adam Koppel, MD, PhD
  • Managing Director, Bain Capital Life Sciences

What acquirers are looking for??

What is the next generation vs what is real where is the industry going?

Speakers:

Debby Baron,

  • Worldwide Business Development, Pfizer 

CGT is an important area Pfizer is active looking for innovators, advancing forward programs of innovation with the experience Pfizer has internally 

Scalability and manufacturing  regulatory conversations, clinical programs safety in parallel to planning getting drug to patients

Kenneth Custer, PhD

  • Vice President, Business Development and Lilly New Ventures, Eli Lilly and Company

Marianne De Backer, PhD

Head of Strategy, Business Development & Licensing, and Member of the Executive Committee, Bayer

Absolute Leadership in Gene editing, gene therapy, via acquisition and strategic alliance 

Operating model of the acquired company discussed , company continue independence

Sean Nolan

  • Board Chairman, Encoded Therapeutics & Affinia

Executive Chairman, Jaguar Gene Therapy & Istari Oncology

As acquiree multiple M&A: How the acquirer looks at integration and cultures of the two companies 

Traditional integration vs jump start by external acquisition 

AAV – epilepsy, next generation of vectors 

  • Q&A

    12:20 PM – 12:35 PM
     
12:15 PM – 12:25 PM

 

FIRST LOOK

Gene Therapies for Neurological Disorders: Insights from Motor Neuron Disorders

 
Merit Cudkowicz, MD
  • Chief of Neurology, MGH

ALS – Man 1in 300, Women 1 in 400, next decade increase 7% 

10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters 

 

Q&A

  • 12:25 PM – 12:45 PM
     
12:25 PM – 12:35 PM

 

FIRST LOOK

Gene Therapy for Neurologic Diseases

 
Patricia Musolino, MD, PhD
  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

Cerebral Vascular disease – ACTA2 179H gene smooth muscle cell proliferation disorder

no surgery or drug exist –

Cell therapy for ACTA2 Vasculopathy  in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis 

  • Q&A

    12:35 PM – 12:55 PM
     
12:35 PM – 1:15 PM

Lunch

 
1:15 PM – 1:40 PM

Oncolytic Viruses in Cancer | Curing Melanoma and Beyond

Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story.  They will explore why and how Imlygic became approved and its path to commercialization.  Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers.  Why? Is there a limitation to what and which cancers can target?  Is the mode of administration a problem?

No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why?  Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?

The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses.  It will also assess the extent pre-clinical development challenges have slowed the development of OVs.

Moderator:
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Challenges of manufacturing at Amgen what are they?

Speakers:
Robert Coffin, PhD
  • Chief Research & Development Officer, Replimune

2002 in UK promise in oncolytic therapy GNCSF

Phase III melanoma 2015 M&A with Amgen

oncolytic therapy remains non effecting on immune response 

data is key for commercialization 

do not belief in systemic therapy achieve maximum immune response possible from a tumor by localized injection 

 

Roger Perlmutter, MD, PhD
  • Chairman, Merck & Co.

response rates systemic therapy like PD1, Keytruda, OPTIVA well tolerated combination of Oncolytic with systemic 

GMP critical for manufacturing 

 

David Reese, MD
  • Executive Vice President, Research and Development, Amgen

Inter lesion injection of agent vs systemic therapeutics 

cold tumors immune resistant render them immune susceptible 

Oncolytic virus is a Mono therapy

addressing the unknown 

Ann Silk, MD
  • Physician, Dana Farber-Brigham and Women’s Cancer Center
  • Assistant Professor of Medicine, HMS

Which person gets oncolytics virus if patient has immune suppression due to other indications

Safety of oncolytic virus greater than Systemic treatment

series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential 

  • Q&A

    1:45 PM – 2:00 PM
     
1:45 PM – 2:10 PM

Market Interest in Oncolytic Viruses | Calibrating

There are currently two oncolytic virus products on the market, one in the USA and one in China.  As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II.   Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:

What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?

  • Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
  • Why are these companies pursuing OVs while several others are taking a pass?
Moderators:
Martine Lamfers, PhD
  • Visiting Scientist, BWH

Challenged in development of strategies 

Demonstrate efficacy

Robert Martuza, MD
  • Consultant in Neurosurgery, MGH
  • William and Elizabeth Sweet Distinguished Professor of Neurosurgery, HMS

Modulation mechanism

Speakers:
Anlong Li, MD, PhD
  • Clinical Director, Oncology Clinical Development, Merck Research Laboratories

IV delivery preferred – delivery alternative are less aggereable

 

Jeffrey Infante, MD
  • Early development Oncolytic viruses, Oncology, Janssen Research & Development

oncologic virus if it will generate systemic effects the adoption will accelerate

What areas are the best efficacious 

Direct effect with intra-tumor single injection with right payload 

Platform approach  Prime with 1 and Boost with 2 – not yet experimented with 

Do not have the data at trial design for stratification of patients 

Turn off strategy not existing yet

Loic Vincent, PhD
  • Head of Oncology Drug Discovery Unit, Takeda

R&D in collaboration with Academic

Vaccine platform to explore different payload

IV administration may not bring sufficient concentration to the tumor is administer  in the blood stream

Classification of Patients by prospective response type id UNKNOWN yet, population of patients require stratification

  • Q&A

    2:15 PM – 2:30 PM
     
2:10 PM – 2:20 PM

 

FIRST LOOK

Oncolytic viruses: turning pathogens into anticancer agents

 
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic therapy DID NOT WORK Pancreatic Cancer and Glioblastoma 

Intra- tumoral heterogeniety hinders success 

Solution: Oncolytic VIRUSES – Immunological “coldness”

GADD-34 20,000 GBM 40,000 pancreatic cancer

  • Q&A

    2:25 PM – 2:40 PM
     
2:20 PM – 2:45 PM

Entrepreneurial Growth | Oncolytic Virus

In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:

  •  How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
  • Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
  • Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space?  Would they bring any real advantages?
Moderator:
Reid Huber, PhD
  • Partner, Third Rock Ventures

Critical milestones to observe

Speakers:
Caroline Breitbach, PhD
  • VP, R&D Programs and Strategy, Turnstone Biologics

Trying Intra-tumor delivery and IV infusion delivery oncolytic vaccine pushing dose 

translation biomarkers program 

transformation tumor microenvironment 

 

Brett Ewald, PhD
  • SVP, Development & Corporate Strategy, DNAtrix

Studies gets larger, kicking off Phase III multiple tumors 

 

Paul Hallenbeck, PhD
  • President and Chief Scientific Officer, Seneca Therapeutics

Translation: 

Stephen Russell, MD, PhD
  • CEO, Vyriad

Systemic delivery Oncolytic Virus IV delivery woman in remission

Collaboration with Regeneron

Data collection: Imageable reporter secretable reporter, gene expression

Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors 

  • Q&A

    2:50 PM – 3:05 PM
     
2:45 PM – 3:00 PM

Break

 
3:00 PM – 3:25 PM

CAR-T | Lessons Learned | What’s Next

Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:

  • Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
  • What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
  • Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
  • Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
  • Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
  • Moderator:
  • Marcela Maus, MD, PhD
    • Director, Cellular Immunotherapy Program, Cancer Center, MGH
    • Associate Professor, Medicine, HMS

    Is CAR-T Industry priority

  • Speakers:
  • Head of R&D, Atara BioTherapeutics
  • Phyno-type of the cells for hematologic cancers 
  • solid tumor 
  • inventory of Therapeutics for treating patients in the future 
  • Progressive MS program
  • EBBT platform B-Cells and T-Cells
    • Stefan Hendriks
      • Gobal Head, Cell & Gene, Novartis
      • yes, CGT is a strategy in the present and future
      • Journey started years ago 
      • Confirmation the effectiveness of CAR-T therapies, 1 year response prolonged to 5 years 26 months
      • Patient not responding – a lot to learn
      • Patient after 8 months of chemo can be helped by CAR-T
    • Christi Shaw
      • CEO, Kite
      • CAR-T is priority 120 companies in the space
      • Manufacturing consistency 
      • Patients respond with better quality of life
      • Blood cancer – more work to be done

Q&A

  • 3:30 PM – 3:45 PM
     
3:30 PM – 3:55 PM

 

HOT TOPICS

CAR-T | Solid Tumors Success | When?

The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:

  •  How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
  •  Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
  •  Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
  •  Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
Moderator:
Oladapo Yeku, MD, PhD
  • Clinical Assistant in Medicine, MGH

window of opportunities studies 

Speakers:
Jennifer Brogdon
  • Executive Director, Head of Cell Therapy Research, Exploratory Immuno-Oncology, NIBR

2017 CAR-T first approval

M&A and research collaborations

TCR tumor specific antigens avoid tissue toxicity 

Knut Niss, PhD
  • CTO, Mustang Bio

tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor 

Barbra Sasu, PhD
  • CSO, Allogene

T cell response at prostate cancer 

tumor specific 

cytokine tumor specific signals move from solid to metastatic cell type for easier infiltration

Where we might go: safety autologous and allogeneic 

Jay Short, PhD
  • Chairman, CEO, Cofounder, BioAlta, Inc.

Tumor type is not enough for development of therapeutics other organs are involved in the periphery

difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside 

Combination staggered key is try combination

  • Q&A

    4:00 PM – 4:15 PM
     
4:00 PM – 4:25 PM

GCT Manufacturing | Vector Production | Autologous and Allogeneic | Stem Cells | Supply Chain | Scalability & Management

The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027,  groups of products are emerging.  Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:

  • Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
  • For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
  • Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
  • How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Moderator:
Michael Paglia
  • VP, ElevateBio
Speakers:
  • Dannielle Appelhans
    • SVP TechOps and Chief Technical Officer, Novartis Gene Therapies
  • Thomas Page, PhD
    • VP, Engineering and Asset Development, FUJIFILM Diosynth Biotechnologies
  • Rahul Singhvi, ScD
    • CEO and Co-Founder, National Resilience, Inc.
  • Thomas VanCott, PhD
    • Global Head of Product Development, Gene & Cell Therapy, Catalent
    • 2/3 autologous 1/3 allogeneic  CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized  allogeneic are health donors innovations in cell types in use improvements in manufacturing

Ropa Pike, Director,  Enterprise Science & Partnerships, Thermo Fisher Scientific 

Centralized biopharma industry is moving  to decentralized models site specific license 

  • Q&A

    4:30 PM – 4:45 PM
     
4:30 PM – 4:40 PM

 

FIRST LOOK

CAR-T

 
Marcela Maus, MD, PhD
  • Director, Cellular Immunotherapy Program, Cancer Center, MGH
  • Assistant Professor, Medicine, HMS 

Fit-to-purpose CAR-T cells: 3 lead programs

Tr-fill 

CAR-T induce response myeloma and multiple myeloma GBM

27 patents on CAR-T

+400 patients treaded 40 Clinical Trials 

  • Q&A

    4:40 PM – 5:00 PM
     
4:40 PM – 4:50 PM

 

FIRST LOOK

Repurposed Tumor Cells as Killers and Immunomodulators for Cancer Therapy

 
Khalid Shah, PhD
  • Vice Chair, Neurosurgery Research, BWH
  • Director, Center for Stem Cell Therapeutics and Imaging, HMS

Solid tumors are the hardest to treat because: immunosuppressive, hypoxic, Acidic Use of autologous tumor cells self homing ThTC self targeting therapeutic cells Therapeutic tumor cells efficacy pre-clinical models GBM 95% metastesis ThTC translation to patient settings

  • Q&A

    4:50 PM – 5:10 PM
     
4:50 PM – 5:00 PM

 

FIRST LOOK

Other Cell Therapies for Cancer

 
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS

T-cell are made in bone marrow create cryogel  can be an off-the-shelf product repertoire on T Receptor CCL19+ mesenchymal cells mimic Tymus cells –

inter-tymic injection. Non human primate validation

Q&A

 

5:00 PM – 5:20 PM
 
5:00 PM – 5:20 PM

 

FIRESIDE

Fireside with Mikael Dolsten, MD, PhD

 
Introducer:
Jonathan Kraft
Moderator:
Daniel Haber, MD, PhD
  • Chair, Cancer Center, MGH
  • Isselbacher Professor of Oncology, HMS

Vaccine Status 

Mikael Dolsten, MD, PhD
  • Chief Scientific Officer and President, Worldwide Research, Development and Medical, Pfizer

Deliver vaccine around the Globe, Israel, US, Europe.

3BIL vaccine in 2022 for all Global vaccination 

Bio Ntech in Germany

Experience with Biologics immuneoncology & allogeneic antibody cells – new field for drug discovery 

mRNA curative effort and cancer vaccine 

Access to drugs developed by Pfizer to underdeveloped countries 

  • Q&A

    5:25 PM – 5:40 AM
     
5:20 PM – 5:30 PM
8:00 AM – 8:25 AM

GCT | The China Juggernaut

China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer.  Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents.  It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.

In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment.  In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.

The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.

This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market.

Moderator:
Min Wu, PhD
  • Managing Director, Fosun Health Fund

What are the area of CGT in China, regulatory similar to the US

 

Speakers:
Alvin Luk, PhD
  • CEO, Neuropath Therapeutics

Monogenic rare disease with clear genomic target

Increase of 30% in patient enrollment 

Regulatory reform approval is 60 days no delay

 

Pin Wang, PhD
  • CSO, Jiangsu Simcere Pharmaceutical Co., Ltd.

Similar starting point in CGT as the rest of the World unlike a later starting point in other biological

 

Richard Wang, PhD
  • CEO, Fosun Kite Biotechnology Co., Ltd

Possibilities to be creative and capitalize the new technologies for innovating drug

Support of the ecosystem by funding new companie allowing the industry to be developed in China

Autologous in patients differences cost challenge

Tian Xu, PhD
  • Vice President, Westlake University

ICH committee and Chinese FDA -r regulation similar to the US

Difference is the population recruitment, in China patients are active participants in skin disease 

Active in development of transposome 

Development of non-viral methods, CRISPR still in D and transposome

In China price of drugs regulatory are sensitive 

Shunfei Yan, PhD
  • Investment Manager, InnoStar Capital

Indication driven: Hymophilia, 

Allogogenic efficiency therapies

Licensing opportunities 

 

  • Q&A

    8:30 AM – 8:45 AM
     
8:30 AM – 8:55 AM

Impact of mRNA Vaccines | Global Success Lessons

The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?

  • How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
  • How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
  • Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
  • Will cost-of-goods be reduced as the industry matures?
  • How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Moderator:
Lindsey Baden, MD
  • Director, Clinical Research, Division of Infectious Diseases, BWH
  • Associate Professor, HMS

In vivo delivery process regulatory cooperation new opportunities for same platform for new indication

Speakers:

Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna

How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy 

45 days for Personalized cancer vaccine one per patient

1.6 Billion doses produced rare disease monogenic correct mRNA like CF multiple mutation infection disease and oncology applications

Platform allowing to swap cargo reusing same nanoparticles address disease beyond Big Pharma options for biotech

WHat strain of Flu vaccine will come back in the future when people do not use masks 

  • Kate Bingham, UK Vaccine Taskforce

July 2020, AAV vs mRNA delivery across UK local centers administered both types supply and delivery uplift 

 

  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

 

HOT TOPICS

Benign Blood Disorders

Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market?

Moderator:
Nancy Berliner, MD
  • Chief, Division of Hematology, BWH
  • H. Franklin Bunn Professor of Medicine, HMS
Speakers:
Theresa Heggie
  • CEO, Freeline Therapeutics

Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered 

Potency and quality less quantity drug and greater potency

risk of delivery unwanted DNA, capsules are critical 

analytics is critical regulator involvement in potency definition

Close of collaboration is exciting

Gallia Levy, MD, PhD
  • Chief Medical Officer, Spark Therapeutics

Hemophilia CGT is the highest potential for Global access logistics in underdeveloped countries working with NGOs practicality of the Tx

Roche reached 120 Counties great to be part of the Roche Group

Amir Nashat, PhD
  • Managing Partner, Polaris Ventures
Suneet Varma
  • Global President of Rare Disease, Pfizer

Gene therapy at Pfizer small molecule, large molecule and CGT – spectrum of choice allowing Hemophilia patients to marry 

1/3 internal 1/3 partnership 1/3 acquisitions 

Learning from COVID-19 is applied for other vaccine development

review of protocols and CGT for Hemophelia

You can’t buy Time

With MIT Pfizer is developing a model for Hemopilia CGT treatment

  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Treating Rett Syndrome through X-reactivation

 
Jeannie Lee, MD, PhD
  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

200 disease X chromosome unlock for neurological genetic diseases: Rett Syndromeand other autism spectrum disorders female model vs male mice model

deliver protein to the brain 

restore own missing or dysfunctional protein

Epigenetic not CGT – no exogent intervention Xist ASO drug

Female model

  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 9:45 AM

 

FIRST LOOK

Rare but mighty: scaling up success in single gene disorders

 
Florian Eichler, MD
  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS

Single gene disorder NGS enable diagnosis, DIagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology 

crosswalk from bone marrow matter 

New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers 

  • Q&A

    9:45 AM – 10:05 AM
     
9:50 AM – 10:15 AM

 

HOT TOPICS

Diabetes | Grand Challenge

The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.

  •  Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
  • How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Moderator:
Marie McDonnell, MD
  • Chief, Diabetes Section and Director, Diabetes Program, BWH
  • Lecturer on Medicine, HMS

Type 1 Diabetes cost of insulin for continuous delivery of drug

alternative treatments: 

The Future: neuropotent stem cells 

What keeps you up at night 

Speakers:
Tom Bollenbach, PhD
  • Chief Technology Officer, Advanced Regenerative Manufacturing Institute

Data managment sterility sensors, cell survival after implantation, stem cells manufacturing, process development in manufacturing of complex cells

Data and instrumentation the Process is the Product

Manufacturing tight schedules 

 

Manasi Jaiman, MD
  • Vice President, Clinical Development, ViaCyte
  • Pediatric Endocrinologist

continous glucose monitoring 

 

Bastiano Sanna, PhD
  • EVP, Chief of Cell & Gene Therapies and VCGT Site Head, Vertex Pharmaceuticals

100 years from discovering Insulin, Insulin is not a cure in 2021 – asking patients to partner more 

Produce large quantities of the Islet cells encapsulation technology been developed 

Scaling up is a challenge

Rogerio Vivaldi, MD
  • CEO, Sigilon Therapeutics

Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression 

Volume to have of-the-shelf inventory oxegenation in location lymphatic and vascularization conrol the whole process modular platform learning from others

  • Q&A

    10:20 AM – 10:35 AM
     
10:20 AM – 10:40 AM

 

FIRESIDE

Building A Unified GCT Strategy

 
Introducer:
John Fish
  • CEO, Suffolk
  • Chairman of Board Trustees, Brigham Health
Moderator:
Meg Tirrell
  • Senior Health and Science Reporter, CNBC

Last year, what was it at Novartis

Speaker:
Jay Bradner, MD
  • President, NIBR

Keep eyes open, waiting the Pandemic to end and enable working back on all the indications 

Portfolio of MET, Mimi Emerging Therapies 

Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis

Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy 

Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic

Protein degradation organization constraint valuation by parties in a partnership 

Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate

Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter

  • Q&A

    10:45 AM – 11:00 AM
     
10:40 AM – 10:50 AM

Break

 
10:50 AM – 11:00 AM

 

FIRST LOOK

Getting to the Heart of the Matter: Curing Genetic Cardiomyopathy

 
Christine Seidman, MD
  • Director, Cardiovascular Genetics Center, BWH
  • Smith Professor of Medicine & Genetics, HMS

2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021

The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy.
Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.

About the World Medical Innovation Forum

Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation

Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next

https://worldmedicalinnovation.org/wp-content/uploads/2021/05/2021-WMIF-White-Paper-1.0.pdf

 

https://worldmedicalinnovation.org/agenda/

 

Virtual | May 19–21, 2021

#WMIF2021

@MGBInnovation

Leaders in Pharmaceutical Business Intelligence (LPBI) Group

will cover the event in Real Time

Aviva Lev-Ari, PhD, RN

Founder LPBI 1.0 & LPBI 2.0

member_60221522 copy

will be in virtual attendance producing the e-Proceedings

and the Tweet Collection of this Global event expecting +15,000 attendees

@pharma_BI

@AVIVA1950

LPBI’s Eighteen Books in Medicine

https://lnkd.in/ekWGNqA

 

Among them, books on Gene and Cell Therapy include the following:

Topics for May 19 – 21 include:

Impact on Patient Care – Therapeutic and Potentially Curative GCT Developments

GCT Delivery, Manufacturing – What’s Next

GCT Platform Development

Oncolytic Viruses – Cancer applications, start-ups

Regenerative Medicine/Stem Cells

Future of CAR-T

M&A Shaping GCT’s Future

Market Priorities

Venture Investing in GCT

China’s GCT Juggernaut

Disease and Patient Focus: Benign blood disorders, diabetes, neurodegenerative diseases

Click here for the current WMIF agenda

Plus:

Fireside Chats: 1:1 interviews with industry CEOs/C-Suite leaders including Novartis Gene Therapies, ThermoFisher, Bayer AG, FDA

First Look: 18 briefings on emerging GCT research from Mass General Brigham scientists

Virtual Poster Session: 40 research posters and presenters on potential GCT discoveries from Mass General Brigham

Announcement of the Disruptive Dozen, 12 GCT technologies likely to break through in the next few years

AGENDA

8:00 AM – 8:10 AM

Opening Remarks

Welcome and the vision for Gene and Cell Therapy and why it is a top Mass General Brigham priority.

Introducer:
Scott Sperling
  • Co-President, Thomas H. Lee Partners
  • Chairman of the Board of Directors, PHS
Presenter:
Anne Klibanski, MD
  • CEO, Mass General Brigham

3,000 people joined 5/19 morning

30 sessions: Lab to Clinic,  academia, industry, investment community

May 22,23,24, 2022 – in Boston, in-person 2022 WMIF on CGT

 

8:10 AM – 8:30 AM

The Grand Challenge of Widespread GCT Patient Benefits

Co-Chairs identify the key themes of the Forum –  set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future.

Moderator:
Susan Hockfield, PhD
  • President Emerita and Professor of Neuroscience, MIT

GCT – poised to deliver therapies

Inflection point as Panel will present

Doctors and Patients – Promise for some patients 

Barriers for Cell & Gene

Access for patients to therapies like CGT

Speakers:
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic virus triple threat: Toxic, immunological, combine with anti cancer therapies

Polygenic therapy – multiple genes involved, plug-play, 

Susan Slaugenhaupt, PhD
  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS
Ravi Thadhani, MD
  • CAO, Mass General Brigham
  • Professor, Medicine and Faculty Dean, HMS

Role of academia special to spear head the Polygenic therapy – multiple genes involved, plug-play, 

Access critical, relations with Industry

Luk Vandenberghe, PhD
  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

Pharmacology Gene-Drug, Interface academic centers and industry

many CGT drugs emerged in Academic center

8:35 AM – 8:50 AM

 

FIRESIDE

Gene and Cell Therapy 2.0 – What’s Next as We Realize their Potential for Patients

Dave Lennon, PhD
  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

Moderator:
Julian Harris, MD
  • Partner, Deerfield

Promise of CGT realized, what part?

FDA role and interaction in CGT

Manufacturing aspects which is critical

Speaker:
Dave Lennon, PhD
  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

  • Q&A

    8:55 AM – 9:10 AM
     
8:55 AM – 9:20 AM

The Patient and GCT

GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates.

Moderator:
Patricia Musolino, MD, PhD
  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial

Speakers:
Jack Hogan
  • Patient, MEE
Jeanette Hogan
  • Parent of Patient, MEE
Jim Holland
  • CEO, Backcountry.com

Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical 

Barbara Lavery
  • Chief Program Officer, ACGT Foundation

Advocacy agency beginning of work Global Genes educational content and out reach to access the information 

Patient has the knowledge of the symptoms and recording all input needed for diagnosis by multiple clinicians Early application for CGT

Dan Tesler
  • Clinical Trial Patient, BWH/DFCC

Experimental Drug clinical trial patient participation in clinical trial is very important to advance the state of science

Sarah Beth Thomas, RN
  • Professional Development Manager, BWH

Outcome is unknown, hope for good, support with resources all advocacy groups, 

  • Q&A

    9:25 AM – 9:40 AM
     
9:25 AM – 9:45 AM

 

FIRESIDE

GCT Regulatory Framework | Why Different?

 
Moderator:
Vicki Sato, PhD
  • Chairman of the Board, Vir Biotechnology

Diversity of approaches

Process at FDA generalize from 1st entry to rules more generalizable 

Speaker:
Peter Marks, MD, PhD
  • Director, Center for Biologics Evaluation and Research, FDA

Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work

Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance  T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance

Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation 

  • Q&A

    9:50 AM – 10:05 AM
     
9:50 AM – 10:15 AM

Building a GCT Platform for Mainstream Success

This panel of GCT executives, innovators and investors explore how to best shape a successful GCT strategy. Among the questions to be addressed:

  • How are GCT approaches set around defining and building a platform?
  • Is AAV the leading modality and what are the remaining challenges?
  • What are the alternatives?
  • Is it just a matter of matching modalities to the right indications?
Moderator:
Jean-François Formela, MD
  • Partner, Atlas Venture

Established core components of the Platform

Speakers:
Katherine High, MD
  • President, Therapeutics, AskBio

Three drugs approved in Europe in the Gene therapy space

Regulatory Infrastructure exists for CGT drug approval – as new class of therapeutics

Participants investigators, regulators, patients i. e., MDM 

Hemophilia in male most challenging

Human are natural hosts for AV safety signals 

Dave Lennon, PhD
  • President, Novartis Gene Therapies

big pharma has portfolios of therapeutics not one drug across Tx areas: cell, gene iodine therapy 

collective learning infrastructure features manufacturing at scale early in development Acquisitions strategy for growth # applications for scaling 

 

Rick Modi
  • CEO, Affinia Therapeutics

Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP 

Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific 

Louise Rodino-Klapac, PhD
  • EVP, Chief Scientific Officer, Sarepta Therapeutics

AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years

Safety to clinic vs speed to clinic, difference of vectors to trust

  • Q&A

    10:20 AM – 10:35 AM
     
10:20 AM – 10:45 AM

AAV Success Studies | Retinal Dystrophy | Spinal Muscular Atrophy

Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.

The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.

  • Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
  • Lessons learned from these first-in-class approvals.
  • Challenges to broaden this modality to similar indications.
  • Reflections on safety signals in the clinical studies?
Moderator:
Joan Miller, MD
  • Chief, Ophthalmology, MEE
  • Cogan Professor & Chair of Ophthalmology, HMS

Retina specialist, Luxturna success FMA condition cell therapy as solution

Lessons learned

Safety

Speakers:
Ken Mills
  • CEO, RegenXBio

Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years 

Cell therapy vs transplant therapy no immunosuppression

 

Eric Pierce, MD, PhD
  • Director, Ocular Genomics Institute, MEE
  • Professor of Ophthalmology, HMS

Laxterna success to be replicated platform, paradigms measurement visual improved

More science is needed to continue develop vectors reduce toxicity,

AAV can deliver different cargos reduce adverse events improve vectors

Ron Philip
  • Chief Operating Officer, Spark Therapeutics

The first retinal gene therapy, voretigene neparvovec-rzyl (Luxturna, Spark Therapeutics), was approved by the FDA in 2017.

Meredith Schultz, MD
  • Executive Medical Director, Lead TME, Novartis Gene Therapies

Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise

Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information

  • Q&A

    10:50 AM – 11:05 AM
     
10:45 AM – 10:55 AM

Break

 
10:55 AM – 11:05 AM

 

FIRST LOOK

Control of AAV pharmacology by Rational Capsid Design

 
Luk Vandenberghe, PhD
  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,

Pathway for rational AAV rational design, curated smart variant libraries, AAV  sequence screen multiparametric , data enable liver (de-) targeting unlock therapeutics areas: cochlea 

  • Q&A

    11:05 AM – 11:25 AM
     
11:05 AM – 11:15 AM

 

FIRST LOOK

Enhanced gene delivery and immunoevasion of AAV vectors without capsid modification

 
Casey Maguire, PhD
  • Associate Professor of Neurology, MGH & HMS

Virus Biology: Enveloped (e) or not 

enveloped for gene therapy eAAV platform technology: tissue targets and Indications commercialization of eAAV 

  • Q&A

    11:15 AM – 11:35 AM
     
11:20 AM – 11:45 AM

 

HOT TOPICS

AAV Delivery

This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed?

Moderators:
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS

Florian Eichler, MD

  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS
Speakers:
Jennifer Farmer
  • CEO, Friedreich’s Ataxia Research Alliance

Ataxia requires therapy targeting multiple organ with one therapy, brain, spinal cord, heart several IND, clinical trials in 2022

Mathew Pletcher, PhD
  • SVP, Head of Gene Therapy Research and Technical Operations, Astellas

Work with diseases poorly understood, collaborations needs example of existing: DMD is a great example explain dystrophin share placedo data 

Continue to explore large animal guinea pig not the mice, not primates (ethical issues) for understanding immunogenicity and immune response 

Manny Simons, PhD
  • CEO, Akouos

AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model 

Biology across species nerve ending in the cochlea

engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones

  • Q&A

    11:50 AM – 12:05 PM
     
11:50 AM – 12:15 PM

M&A | Shaping GCT Innovation

The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up?

Moderator:
Adam Koppel, MD, PhD
  • Managing Director, Bain Capital Life Sciences

What acquirers are looking for??

What is the next generation vs what is real where is the industry going?

Speakers:

Debby Baron,

  • Worldwide Business Development, Pfizer 

CGT is an important area Pfizer is active looking for innovators, advancing forward programs of innovation with the experience Pfizer has internally 

Scalability and manufacturing  regulatory conversations, clinical programs safety in parallel to planning getting drug to patients

Kenneth Custer, PhD

  • Vice President, Business Development and Lilly New Ventures, Eli Lilly and Company

Marianne De Backer, PhD

Head of Strategy, Business Development & Licensing, and Member of the Executive Committee, Bayer

Absolute Leadership in Gene editing, gene therapy, via acquisition and strategic alliance 

Operating model of the acquired company discussed , company continue independence

Sean Nolan

  • Board Chairman, Encoded Therapeutics & Affinia

Executive Chairman, Jaguar Gene Therapy & Istari Oncology

As acquiree multiple M&A: How the acquirer looks at integration and cultures of the two companies 

Traditional integration vs jump start by external acquisition 

AAV – epilepsy, next generation of vectors 

  • Q&A

    12:20 PM – 12:35 PM
     
12:15 PM – 12:25 PM

 

FIRST LOOK

Gene Therapies for Neurological Disorders: Insights from Motor Neuron Disorders

 
Merit Cudkowicz, MD
  • Chief of Neurology, MGH

ALS – Man 1in 300, Women 1 in 400, next decade increase 7% 

10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters 

 

Q&A

  • 12:25 PM – 12:45 PM
     
12:25 PM – 12:35 PM

 

FIRST LOOK

Gene Therapy for Neurologic Diseases

 
Patricia Musolino, MD, PhD
  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

Cerebral Vascular disease – ACTA2 179H gene smooth muscle cell proliferation disorder

no surgery or drug exist –

Cell therapy for ACTA2 Vasculopathy  in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis 

  • Q&A

    12:35 PM – 12:55 PM
     
12:35 PM – 1:15 PM

Lunch

 
1:15 PM – 1:40 PM

Oncolytic Viruses in Cancer | Curing Melanoma and Beyond

Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story.  They will explore why and how Imlygic became approved and its path to commercialization.  Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers.  Why? Is there a limitation to what and which cancers can target?  Is the mode of administration a problem?

No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why?  Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?

The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses.  It will also assess the extent pre-clinical development challenges have slowed the development of OVs.

Moderator:
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Challenges of manufacturing at Amgen what are they?

Speakers:
Robert Coffin, PhD
  • Chief Research & Development Officer, Replimune

2002 in UK promise in oncolytic therapy GNCSF

Phase III melanoma 2015 M&A with Amgen

oncolytic therapy remains non effecting on immune response 

data is key for commercialization 

do not belief in systemic therapy achieve maximum immune response possible from a tumor by localized injection 

 

Roger Perlmutter, MD, PhD
  • Chairman, Merck & Co.

response rates systemic therapy like PD1, Keytruda, OPTIVA well tolerated combination of Oncolytic with systemic 

GMP critical for manufacturing 

 

David Reese, MD
  • Executive Vice President, Research and Development, Amgen

Inter lesion injection of agent vs systemic therapeutics 

cold tumors immune resistant render them immune susceptible 

Oncolytic virus is a Mono therapy

addressing the unknown 

Ann Silk, MD
  • Physician, Dana Farber-Brigham and Women’s Cancer Center
  • Assistant Professor of Medicine, HMS

Which person gets oncolytics virus if patient has immune suppression due to other indications

Safety of oncolytic virus greater than Systemic treatment

series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential 

  • Q&A

    1:45 PM – 2:00 PM
     
1:45 PM – 2:10 PM

Market Interest in Oncolytic Viruses | Calibrating

There are currently two oncolytic virus products on the market, one in the USA and one in China.  As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II.   Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:

What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?

  • Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
  • Why are these companies pursuing OVs while several others are taking a pass?
Moderators:
Martine Lamfers, PhD
  • Visiting Scientist, BWH

Challenged in development of strategies 

Demonstrate efficacy

Robert Martuza, MD
  • Consultant in Neurosurgery, MGH
  • William and Elizabeth Sweet Distinguished Professor of Neurosurgery, HMS

Modulation mechanism

Speakers:
Anlong Li, MD, PhD
  • Clinical Director, Oncology Clinical Development, Merck Research Laboratories

IV delivery preferred – delivery alternative are less aggereable

 

Jeffrey Infante, MD
  • Early development Oncolytic viruses, Oncology, Janssen Research & Development

oncologic virus if it will generate systemic effects the adoption will accelerate

What areas are the best efficacious 

Direct effect with intra-tumor single injection with right payload 

Platform approach  Prime with 1 and Boost with 2 – not yet experimented with 

Do not have the data at trial design for stratification of patients 

Turn off strategy not existing yet

Loic Vincent, PhD
  • Head of Oncology Drug Discovery Unit, Takeda

R&D in collaboration with Academic

Vaccine platform to explore different payload

IV administration may not bring sufficient concentration to the tumor is administer  in the blood stream

Classification of Patients by prospective response type id UNKNOWN yet, population of patients require stratification

  • Q&A

    2:15 PM – 2:30 PM
     
2:10 PM – 2:20 PM

 

FIRST LOOK

Oncolytic viruses: turning pathogens into anticancer agents

 
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic therapy DID NOT WORK Pancreatic Cancer and Glioblastoma 

Intra- tumoral heterogeniety hinders success 

Solution: Oncolytic VIRUSES – Immunological “coldness”

GADD-34 20,000 GBM 40,000 pancreatic cancer

  • Q&A

    2:25 PM – 2:40 PM
     
2:20 PM – 2:45 PM

Entrepreneurial Growth | Oncolytic Virus

In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:

  •  How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
  • Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
  • Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space?  Would they bring any real advantages?
Moderator:
Reid Huber, PhD
  • Partner, Third Rock Ventures

Critical milestones to observe

Speakers:
Caroline Breitbach, PhD
  • VP, R&D Programs and Strategy, Turnstone Biologics

Trying Intra-tumor delivery and IV infusion delivery oncolytic vaccine pushing dose 

translation biomarkers program 

transformation tumor microenvironment 

 

Brett Ewald, PhD
  • SVP, Development & Corporate Strategy, DNAtrix

Studies gets larger, kicking off Phase III multiple tumors 

 

Paul Hallenbeck, PhD
  • President and Chief Scientific Officer, Seneca Therapeutics

Translation: 

Stephen Russell, MD, PhD
  • CEO, Vyriad

Systemic delivery Oncolytic Virus IV delivery woman in remission

Collaboration with Regeneron

Data collection: Imageable reporter secretable reporter, gene expression

Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors 

  • Q&A

    2:50 PM – 3:05 PM
     
2:45 PM – 3:00 PM

Break

 
3:00 PM – 3:25 PM

CAR-T | Lessons Learned | What’s Next

Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:

  • Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
  • What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
  • Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
  • Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
  • Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
  • Moderator:
  • Marcela Maus, MD, PhD
    • Director, Cellular Immunotherapy Program, Cancer Center, MGH
    • Associate Professor, Medicine, HMS

    Is CAR-T Industry priority

  • Speakers:
  • Head of R&D, Atara BioTherapeutics
  • Phyno-type of the cells for hematologic cancers 
  • solid tumor 
  • inventory of Therapeutics for treating patients in the future 
  • Progressive MS program
  • EBBT platform B-Cells and T-Cells
    • Stefan Hendriks
      • Gobal Head, Cell & Gene, Novartis
      • yes, CGT is a strategy in the present and future
      • Journey started years ago 
      • Confirmation the effectiveness of CAR-T therapies, 1 year response prolonged to 5 years 26 months
      • Patient not responding – a lot to learn
      • Patient after 8 months of chemo can be helped by CAR-T
    • Christi Shaw
      • CEO, Kite
      • CAR-T is priority 120 companies in the space
      • Manufacturing consistency 
      • Patients respond with better quality of life
      • Blood cancer – more work to be done

Q&A

  • 3:30 PM – 3:45 PM
     
3:30 PM – 3:55 PM

 

HOT TOPICS

CAR-T | Solid Tumors Success | When?

The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:

  •  How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
  •  Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
  •  Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
  •  Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
Moderator:
Oladapo Yeku, MD, PhD
  • Clinical Assistant in Medicine, MGH

window of opportunities studies 

Speakers:
Jennifer Brogdon
  • Executive Director, Head of Cell Therapy Research, Exploratory Immuno-Oncology, NIBR

2017 CAR-T first approval

M&A and research collaborations

TCR tumor specific antigens avoid tissue toxicity 

Knut Niss, PhD
  • CTO, Mustang Bio

tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor 

Barbra Sasu, PhD
  • CSO, Allogene

T cell response at prostate cancer 

tumor specific 

cytokine tumor specific signals move from solid to metastatic cell type for easier infiltration

Where we might go: safety autologous and allogeneic 

Jay Short, PhD
  • Chairman, CEO, Cofounder, BioAlta, Inc.

Tumor type is not enough for development of therapeutics other organs are involved in the periphery

difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside 

Combination staggered key is try combination

  • Q&A

    4:00 PM – 4:15 PM
     
4:00 PM – 4:25 PM

GCT Manufacturing | Vector Production | Autologous and Allogeneic | Stem Cells | Supply Chain | Scalability & Management

The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027,  groups of products are emerging.  Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:

  • Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
  • For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
  • Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
  • How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Moderator:
Michael Paglia
  • VP, ElevateBio
Speakers:
  • Dannielle Appelhans
    • SVP TechOps and Chief Technical Officer, Novartis Gene Therapies
  • Thomas Page, PhD
    • VP, Engineering and Asset Development, FUJIFILM Diosynth Biotechnologies
  • Rahul Singhvi, ScD
    • CEO and Co-Founder, National Resilience, Inc.
  • Thomas VanCott, PhD
    • Global Head of Product Development, Gene & Cell Therapy, Catalent
    • 2/3 autologous 1/3 allogeneic  CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized  allogeneic are health donors innovations in cell types in use improvements in manufacturing

Ropa Pike, Director,  Enterprise Science & Partnerships, Thermo Fisher Scientific 

Centralized biopharma industry is moving  to decentralized models site specific license 

  • Q&A

    4:30 PM – 4:45 PM
     
4:30 PM – 4:40 PM

 

FIRST LOOK

CAR-T

 
Marcela Maus, MD, PhD
  • Director, Cellular Immunotherapy Program, Cancer Center, MGH
  • Assistant Professor, Medicine, HMS 

Fit-to-purpose CAR-T cells: 3 lead programs

Tr-fill 

CAR-T induce response myeloma and multiple myeloma GBM

27 patents on CAR-T

+400 patients treaded 40 Clinical Trials 

  • Q&A

    4:40 PM – 5:00 PM
     
4:40 PM – 4:50 PM

 

FIRST LOOK

Repurposed Tumor Cells as Killers and Immunomodulators for Cancer Therapy

 
Khalid Shah, PhD
  • Vice Chair, Neurosurgery Research, BWH
  • Director, Center for Stem Cell Therapeutics and Imaging, HMS

Solid tumors are the hardest to treat because: immunosuppressive, hypoxic, Acidic Use of autologous tumor cells self homing ThTC self targeting therapeutic cells Therapeutic tumor cells efficacy pre-clinical models GBM 95% metastesis ThTC translation to patient settings

  • Q&A

    4:50 PM – 5:10 PM
     
4:50 PM – 5:00 PM

 

FIRST LOOK

Other Cell Therapies for Cancer

 
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS

T-cell are made in bone marrow create cryogel  can be an off-the-shelf product repertoire on T Receptor CCL19+ mesenchymal cells mimic Tymus cells –

inter-tymic injection. Non human primate validation

Q&A

 

5:00 PM – 5:20 PM
 
5:00 PM – 5:20 PM

 

FIRESIDE

Fireside with Mikael Dolsten, MD, PhD

 
Introducer:
Jonathan Kraft
Moderator:
Daniel Haber, MD, PhD
  • Chair, Cancer Center, MGH
  • Isselbacher Professor of Oncology, HMS

Vaccine Status 

Mikael Dolsten, MD, PhD
  • Chief Scientific Officer and President, Worldwide Research, Development and Medical, Pfizer

Deliver vaccine around the Globe, Israel, US, Europe.

3BIL vaccine in 2022 for all Global vaccination 

Bio Ntech in Germany

Experience with Biologics immuneoncology & allogeneic antibody cells – new field for drug discovery 

mRNA curative effort and cancer vaccine 

Access to drugs developed by Pfizer to underdeveloped countries 

  • Q&A

    5:25 PM – 5:40 AM
     
5:20 PM – 5:30 PM
8:00 AM – 8:25 AM

GCT | The China Juggernaut

China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer.  Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents.  It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.

In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment.  In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.

The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.

This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market.

Moderator:
Min Wu, PhD
  • Managing Director, Fosun Health Fund

What are the area of CGT in China, regulatory similar to the US

 

Speakers:
Alvin Luk, PhD
  • CEO, Neuropath Therapeutics

Monogenic rare disease with clear genomic target

Increase of 30% in patient enrollment 

Regulatory reform approval is 60 days no delay

 

Pin Wang, PhD
  • CSO, Jiangsu Simcere Pharmaceutical Co., Ltd.

Similar starting point in CGT as the rest of the World unlike a later starting point in other biological

 

Richard Wang, PhD
  • CEO, Fosun Kite Biotechnology Co., Ltd

Possibilities to be creative and capitalize the new technologies for innovating drug

Support of the ecosystem by funding new companie allowing the industry to be developed in China

Autologous in patients differences cost challenge

Tian Xu, PhD
  • Vice President, Westlake University

ICH committee and Chinese FDA -r regulation similar to the US

Difference is the population recruitment, in China patients are active participants in skin disease 

Active in development of transposome 

Development of non-viral methods, CRISPR still in D and transposome

In China price of drugs regulatory are sensitive 

Shunfei Yan, PhD
  • Investment Manager, InnoStar Capital

Indication driven: Hymophilia, 

Allogogenic efficiency therapies

Licensing opportunities 

 

  • Q&A

    8:30 AM – 8:45 AM
     
8:30 AM – 8:55 AM

Impact of mRNA Vaccines | Global Success Lessons

The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?

  • How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
  • How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
  • Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
  • Will cost-of-goods be reduced as the industry matures?
  • How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Moderator:
Lindsey Baden, MD
  • Director, Clinical Research, Division of Infectious Diseases, BWH
  • Associate Professor, HMS

In vivo delivery process regulatory cooperation new opportunities for same platform for new indication

Speakers:

Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna

How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy 

45 days for Personalized cancer vaccine one per patient

1.6 Billion doses produced rare disease monogenic correct mRNA like CF multiple mutation infection disease and oncology applications

Platform allowing to swap cargo reusing same nanoparticles address disease beyond Big Pharma options for biotech

WHat strain of Flu vaccine will come back in the future when people do not use masks 

  • Kate Bingham, UK Vaccine Taskforce

July 2020, AAV vs mRNA delivery across UK local centers administered both types supply and delivery uplift 

 

  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

 

HOT TOPICS

Benign Blood Disorders

Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market?

Moderator:
Nancy Berliner, MD
  • Chief, Division of Hematology, BWH
  • H. Franklin Bunn Professor of Medicine, HMS
Speakers:
Theresa Heggie
  • CEO, Freeline Therapeutics

Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered 

Potency and quality less quantity drug and greater potency

risk of delivery unwanted DNA, capsules are critical 

analytics is critical regulator involvement in potency definition

Close of collaboration is exciting

Gallia Levy, MD, PhD
  • Chief Medical Officer, Spark Therapeutics

Hemophilia CGT is the highest potential for Global access logistics in underdeveloped countries working with NGOs practicality of the Tx

Roche reached 120 Counties great to be part of the Roche Group

Amir Nashat, PhD
  • Managing Partner, Polaris Ventures
Suneet Varma
  • Global President of Rare Disease, Pfizer

Gene therapy at Pfizer small molecule, large molecule and CGT – spectrum of choice allowing Hemophilia patients to marry 

1/3 internal 1/3 partnership 1/3 acquisitions 

Learning from COVID-19 is applied for other vaccine development

review of protocols and CGT for Hemophelia

You can’t buy Time

With MIT Pfizer is developing a model for Hemopilia CGT treatment

  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Treating Rett Syndrome through X-reactivation

 
Jeannie Lee, MD, PhD
  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

200 disease X chromosome unlock for neurological genetic diseases: Rett Syndromeand other autism spectrum disorders female model vs male mice model

deliver protein to the brain 

restore own missing or dysfunctional protein

Epigenetic not CGT – no exogent intervention Xist ASO drug

Female model

  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 9:45 AM

 

FIRST LOOK

Rare but mighty: scaling up success in single gene disorders

 
Florian Eichler, MD
  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS

Single gene disorder NGS enable diagnosis, DIagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology 

crosswalk from bone marrow matter 

New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers 

  • Q&A

    9:45 AM – 10:05 AM
     
9:50 AM – 10:15 AM

 

HOT TOPICS

Diabetes | Grand Challenge

The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.

  •  Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
  • How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Moderator:
Marie McDonnell, MD
  • Chief, Diabetes Section and Director, Diabetes Program, BWH
  • Lecturer on Medicine, HMS

Type 1 Diabetes cost of insulin for continuous delivery of drug

alternative treatments: 

The Future: neuropotent stem cells 

What keeps you up at night 

Speakers:
Tom Bollenbach, PhD
  • Chief Technology Officer, Advanced Regenerative Manufacturing Institute

Data managment sterility sensors, cell survival after implantation, stem cells manufacturing, process development in manufacturing of complex cells

Data and instrumentation the Process is the Product

Manufacturing tight schedules 

 

Manasi Jaiman, MD
  • Vice President, Clinical Development, ViaCyte
  • Pediatric Endocrinologist

continous glucose monitoring 

 

Bastiano Sanna, PhD
  • EVP, Chief of Cell & Gene Therapies and VCGT Site Head, Vertex Pharmaceuticals

100 years from discovering Insulin, Insulin is not a cure in 2021 – asking patients to partner more 

Produce large quantities of the Islet cells encapsulation technology been developed 

Scaling up is a challenge

Rogerio Vivaldi, MD
  • CEO, Sigilon Therapeutics

Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression 

Volume to have of-the-shelf inventory oxegenation in location lymphatic and vascularization conrol the whole process modular platform learning from others

  • Q&A

    10:20 AM – 10:35 AM
     
10:20 AM – 10:40 AM

 

FIRESIDE

Building A Unified GCT Strategy

 
Introducer:
John Fish
  • CEO, Suffolk
  • Chairman of Board Trustees, Brigham Health
Moderator:
Meg Tirrell
  • Senior Health and Science Reporter, CNBC

Last year, what was it at Novartis

Speaker:
Jay Bradner, MD
  • President, NIBR

Keep eyes open, waiting the Pandemic to end and enable working back on all the indications 

Portfolio of MET, Mimi Emerging Therapies 

Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis

Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy 

Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic

Protein degradation organization constraint valuation by parties in a partnership 

Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate

Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter

  • Q&A

    10:45 AM – 11:00 AM
     
10:40 AM – 10:50 AM

Break

 
10:50 AM – 11:00 AM

 

FIRST LOOK

Getting to the Heart of the Matter: Curing Genetic Cardiomyopathy

 
Christine Seidman, MD
  • Director, Cardiovascular Genetics Center, BWH
  • Smith Professor of Medicine & Genetics, HMS

@@@@@

Hypertrophic and Dilated Cardiomyopaies ‘

10% receive heart transplant 12 years survival 

Mutation puterb function

TTN: contribute 20% of dilated cardiomyopaty

Silence gene 

pleuripotential cells deliver therapies 

  • Q&A

    11:00 AM – 11:20 AM
     
11:00 AM – 11:10 AM

 

FIRST LOOK

Unlocking the secret lives of proteins in health and disease

 
Anna Greka, MD, PhD
  • Medicine, BWH
  • Associate Professor, Medicine, HMS

Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech 

 

Q&A

  • 11:10 AM – 11:30 AM
     
11:10 AM – 11:35 AM

Rare and Ultra Rare Diseases | GCT Breaks Through

One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.

  • What is driving the interest in rare diseases?
  • What are the biggest barriers to making breakthroughs ‘routine and affordable?’
  • What is the role of retrospective and prospective natural history studies in rare disease?  When does the expected value of retrospective disease history studies justify the cost?
  • Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases?  How does this impact the collection of natural history data?
Moderator:
Susan Slaugenhaupt, PhD
  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS
Speakers:
Leah Bloom, PhD
  • SVP, External Innovation and Strategic Alliances, Novartis Gene Therapies

Ultra rare (less than 100) vs rare difficulty to recruit patients and to follow up after treatment 

 

Bobby Gaspar, MD, PhD
  • CEO, Orchard Therapeutics

Study of rare condition have transfer to other larger diseases – delivery of therapeutics genes, like immune disorders 

Patient testimonials just to hear what a treatment can make 

Emil Kakkis, MD, PhD
  • CEO, Ultragenyx

Do 100 patient study then have information on natural history to develop a clinical trial 

Stuart Peltz, PhD
  • CEO, PTC Therapeutics

Rare disease, challenge for FDA approval and after market commercialization follow ups

Justification of cost for Rare disease – demonstration of Change is IP in value patients advocacy is helpful

  • Q&A

    11:40 AM – 11:55 AM
     
11:40 AM – 12:00 PM

 

FIRESIDE

Partnering Across the GCT Spectrum

 
Moderator:
Erin Harris
  • Chief Editor, Cell & Gene

Perspective & professional tenure

Partnership in manufacturing what are the recommendations?

Hospital systems: Partnership Challenges 

Speaker:
Marc Casper
  • CEO, ThermoFisher

25 years in Diagnostics last 20 years at ThermoFisher 

products used in the Lab for CAR-T research and manufacture 

CGT Innovations: FDA will have a high level of approval each year

How move from research to clinical trials to manufacturing Quicker process

Best practices in Partnerships: the root cause if acceleration to market service providers to deliver highest standards

Building capacity by acquisition to avoid the waiting time

Accelerate new products been manufactured 

Collaborations with Academic Medical center i.e., UCSF in CGT joint funding to accelerate CGT to clinics’

Customers are extremely knowledgable, scale the capital investment made investment

150MIL a year to improve the Workflow 

 

  • Q&A

    12:05 PM – 12:20 PM
     
12:05 PM – 12:30 PM

CEO Panel | Anticipating Disruption | Planning for Widespread GCT

The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated.

Moderator:
Meg Tirrell
  • Senior Health and Science Reporter, CNBC

CGT becoming staple therapy what are the disruptors emerging

Speakers:
Lisa Dechamps
  • SVP & Chief Business Officer, Novartis Gene Therapies

Reimagine medicine with collaboration at MGH, MDM condition in children 

The Science is there, sustainable processes and systems impact is transformational

Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect

Collaboration with FDA

 

Kieran Murphy
  • CEO, GE Healthcare

Diagnosis of disease to be used in CGT

2021 investment in CAR-T platform 

Investment in several CGT frontier

Investment in AI, ML in system design new technologies 

GE: Scale and Global distributions, sponsor companies in software 

Waste in Industry – Healthcare % of GDP, work with MGH to smooth the workflow faster entry into hospital and out of Hospital

Telemedicine during is Pandemic: Radiologist needs to read remotely 

Supply chain disruptions slow down all ecosystem 

Production of ventilators by collaboration with GM – ingenuity 

Scan patients outside of hospital a scanner in a Box 

Christian Rommel, PhD
  • Head, Pharmaceuticals Research & Development, Bayer AG

CGT – 2016 and in 2020 new leadership and capability 

Disease Biology and therapeutics

Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular 

During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions 

 

  • Q&A

    12:35 PM – 12:50 PM
     
12:35 PM – 12:55 PM

 

FIRESIDE

Building a GCT Portfolio

GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements?

Moderator:

Shinichiro Fuse, PhD

  • Managing Partner, MPM Capital
Speaker:
Wolfram Carius, PhD
  • EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG

CGT will bring treatment to cure, delivery of therapies 

Be a Leader repair, regenerate, cure

Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products

Bayer strategy: build platform for use by four domains  

Gener augmentation

Autologeneic therapy, analytics

Gene editing

Oncology Cell therapy tumor treatment: What kind of cells – the jury is out

Of 23 product launch at Bayer no prediction is possible some high some lows 

 

  • Q&A

    1:00 PM – 1:15 PM
     
12:55 PM – 1:35 PM

Lunch

 
1:40 PM – 2:05 PM

GCT Delivery | Perfecting the Technology

Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities.

Moderator:
Natalie Artzi, PhD
  • Assistant Professor, BWH

Targeting ligands, 

Speakers:
Matthew Stanton, PhD
  • CSO, Generation Bio

Hepatocytes 

 

Sonya Montgomery
  • CMO, Evox Therapeutics

Exosomes and proteins and mRNA

Accessing CNS by different administration modes

 

Laura Sepp-Lorenzino, PhD
  • Chief Scientific Officer, Executive Vice President, Intellia Therapeutics

CRISPR  – program cell ex Vivo  bacteria editing 

CRISPS Cas9 delivery mechanism in VIVO

Gene cassettes delivered to Liver 

 

Doug Williams, PhD
  • CEO, Codiak BioSciences

Exosomes Platform and Kit delivery into the lumen of the exosomes 

Two candidates in Oncology  drug molecule on the surface of the lumen of exosomes 

Enhance a nature process 

Multiple ligands simultaneously, multiple distinct cells using combinatorial in a system developed 

  • Q&A

    2:10 PM – 2:25 PM
     
2:05 PM – 2:10 PM

Invention Discovery Grant Announcement

IDG Announcement

Tool for translation research at MGB

Commercialization of Lab to Clinic

$70MM was invested by VC minority equity investments in early stage for 1.2MM internal funding by MGB – Academia and Industry – Bayer as Investor 

Six Winners

Lydia Lynche, PhD
Peter Page, PhD 
Pietr from MEE
 
2:10 PM – 2:20 PM

 

FIRST LOOK

Enhancing vesicles for therapeutic delivery of bioproducts

 
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS

DNA, RNA, exosomes avoid random transgene integration 

EVs – Extracellular Vesicles 

  • Q&A

    2:20 PM – 2:35 PM
     
2:20 PM – 2:30 PM

 

FIRST LOOK

Versatile polymer-based nanocarriers for targeted therapy and immunomodulation

 
Natalie Artzi, PhD
  • Assistant Professor, BWH

Epigenome

Nonviral (nucleic acid) delivery 

Nanoparticle Toolbox : Cyclical Dinucleotides (CDN) 

Nanoparticles for delivery of medicines Delivery route affect on therapeutic efficacy

Polymeric based nanocarriers for targeted therapy and immunomodulation

  • Q&A

    2:30 PM – 2:45 PM
     
2:55 PM – 3:20 PM

 

HOT TOPICS

Gene Editing | Achieving Therapeutic Mainstream

Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.

Today’s panel is made up of pioneers who represent foundational aspects of gene editing.  They will discuss the movement of the technology into the therapeutic mainstream.

  • Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
  • When to use what editing tool – pros and cons of traditional gene-editing v. base editing.  Is prime editing the future? Specific use cases for epigenetic editing.
  • When we reach widespread clinical use – role of off-target editing – is the risk real?  How will we mitigate? How practical is patient-specific off-target evaluation?
Moderator:
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS

target alteration of genes for research and novele therapeutics for indications without alternative Tx

Chardonay Platform Specificity and safety 

 

Speakers:
John Evans
  • CEO, Beam Therapeutics

CRISPR targets the Genome reaching the site open DNA single base change in the Genome sicle cell anemia, letter misspelled correction

turn off or activate or program the protein function genome modification tool immunology CAR-T nanoparticles to deliver locally

Delivery is the challenge ex Vivo, In Vivo innovations in nanoparticles to blood system, muscle 

Lisa Michaels
  • EVP & CMO, Editas Medicine

Gene editing allows correction of genetic abnormalities 

CRISPR editing the Genome in Vivo 

Delivery specificity edit DNA of cells for Tx objective

 

Rachel Haurwitz, PhD

Caribou BioSciences, Off UC, Berkeley, CA

Innovation to delivery large quantities of DNA 

  • Q&A

    3:25 PM – 3:50 PM
     
3:25 PM – 3:50 PM

 

HOT TOPICS

Common Blood Disorders | Gene Therapy

There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and  Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:

  • What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
  • How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
  • How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
  • How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
  • Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
  • What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
  • Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Moderator:
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS
Speakers:
Samarth Kukarni, PhD
Nick Leschly
  • Chief Bluebird, Bluebird Bio
Mike McCune, MD, PhD
  • Head, HIV Frontiers, Global Health Innovative Technology Solutions, Bill & Melinda Gates Foundation
  • Q&A

    3:55 PM – 4:15 PM
     
3:50 PM – 4:00 PM

 

FIRST LOOK

Gene Editing

 
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS

ONE-seq enriched in specific populations for genetic variation

seq IP and commercialization

 

 

FIRST LOOK

RNA Therapy for Brain Cancer

Pierpaolo Peruzzi, MD, PhD

Neurosurgery, BWH; Assistant Professor of Neurosurgery, HMS

Targeting with RNA clusters enhances chemotheraphy in GBM

AAV delivery micro RNA – viral mediated and by exosomes (non viral)

Therapeutic impact in Brain Tumors 2-3 readiness

 

  • Q&A

    4:00 PM – 4:20 PM
     
4:20 PM – 4:45 PM

 

HOT TOPICS

Gene Expression | Modulating with Oligonucleotide-Based Therapies

Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:

How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?

  • Will oligonucleotides improve as a class that will make them even more effective?   Are further advancements in backbone chemistry anticipated, for example.
  • Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
  • Are small molecules a threat to oligonucleotide-based therapies?
  • Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides?  Is there a place for multiple mechanism oligonucleotide medicines?
  • Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
Moderator:
Jeannie Lee, MD, PhD
  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021

The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy.
Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.

About the World Medical Innovation Forum

Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation

Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next

https://worldmedicalinnovation.org/wp-content/uploads/2021/05/2021-WMIF-White-Paper-1.0.pdf

 

https://worldmedicalinnovation.org/agenda/

 

Virtual | May 19–21, 2021

#WMIF2021

@MGBInnovation

Leaders in Pharmaceutical Business Intelligence (LPBI) Group

will cover the event in Real Time

Aviva Lev-Ari, PhD, RN

Founder LPBI 1.0 & LPBI 2.0

member_60221522 copy

will be in virtual attendance producing the e-Proceedings

and the Tweet Collection of this Global event expecting +15,000 attendees

@pharma_BI

@AVIVA1950

LPBI’s Eighteen Books in Medicine

https://lnkd.in/ekWGNqA

 

Among them, books on Gene and Cell Therapy include the following:

Topics for May 19 – 21 include:

Impact on Patient Care – Therapeutic and Potentially Curative GCT Developments

GCT Delivery, Manufacturing – What’s Next

GCT Platform Development

Oncolytic Viruses – Cancer applications, start-ups

Regenerative Medicine/Stem Cells

Future of CAR-T

M&A Shaping GCT’s Future

Market Priorities

Venture Investing in GCT

China’s GCT Juggernaut

Disease and Patient Focus: Benign blood disorders, diabetes, neurodegenerative diseases

Click here for the current WMIF agenda  

 

Plus:

Fireside Chats: 1:1 interviews with industry CEOs/C-Suite leaders including Novartis Gene Therapies, ThermoFisher, Bayer AG, FDA

First Look: 18 briefings on emerging GCT research from Mass General Brigham scientists

Virtual Poster Session: 40 research posters and presenters on potential GCT discoveries from Mass General Brigham

Announcement of the Disruptive Dozen, 12 GCT technologies likely to break through in the next few years

AGENDA

8:00 AM – 8:10 AM

Opening Remarks

Welcome and the vision for Gene and Cell Therapy and why it is a top Mass General Brigham priority.

Introducer:
Scott Sperling
  • Co-President, Thomas H. Lee Partners
  • Chairman of the Board of Directors, PHS
Presenter:
Anne Klibanski, MD
  • CEO, Mass General Brigham

3,000 people joined 5/19 morning

30 sessions: Lab to Clinic,  academia, industry, investment community

May 22,23,24, 2022 – in Boston, in-person 2022 WMIF on CGT

 

8:10 AM – 8:30 AM

The Grand Challenge of Widespread GCT Patient Benefits

Co-Chairs identify the key themes of the Forum –  set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future.

Moderator:
Susan Hockfield, PhD
  • President Emerita and Professor of Neuroscience, MIT

GCT – poised to deliver therapies

Inflection point as Panel will present

Doctors and Patients – Promise for some patients 

Barriers for Cell & Gene

Access for patients to therapies like CGT

Speakers:
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic virus triple threat: Toxic, immunological, combine with anti cancer therapies

Polygenic therapy – multiple genes involved, plug-play, 

Susan Slaugenhaupt, PhD
  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS
Ravi Thadhani, MD
  • CAO, Mass General Brigham
  • Professor, Medicine and Faculty Dean, HMS

Role of academia special to spear head the Polygenic therapy – multiple genes involved, plug-play, 

Access critical, relations with Industry

Luk Vandenberghe, PhD
  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

Pharmacology Gene-Drug, Interface academic centers and industry

many CGT drugs emerged in Academic center

8:35 AM – 8:50 AM

 

FIRESIDE

Gene and Cell Therapy 2.0 – What’s Next as We Realize their Potential for Patients

Dave Lennon, PhD
  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

Moderator:
Julian Harris, MD
  • Partner, Deerfield

Promise of CGT realized, what part?

FDA role and interaction in CGT

Manufacturing aspects which is critical

Speaker:
Dave Lennon, PhD
  • President, Novartis Gene Therapies

Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT

FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products 

payments over time payers and Innovators relations

  • Q&A

    8:55 AM – 9:10 AM
     
8:55 AM – 9:20 AM

The Patient and GCT

GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates.

Moderator:
Patricia Musolino, MD, PhD
  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial

Speakers:
Jack Hogan
  • Patient, MEE
Jeanette Hogan
  • Parent of Patient, MEE
Jim Holland
  • CEO, Backcountry.com

Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical 

Barbara Lavery
  • Chief Program Officer, ACGT Foundation

Advocacy agency beginning of work Global Genes educational content and out reach to access the information 

Patient has the knowledge of the symptoms and recording all input needed for diagnosis by multiple clinicians Early application for CGT

Dan Tesler
  • Clinical Trial Patient, BWH/DFCC

Experimental Drug clinical trial patient participation in clinical trial is very important to advance the state of science

Sarah Beth Thomas, RN
  • Professional Development Manager, BWH

Outcome is unknown, hope for good, support with resources all advocacy groups, 

  • Q&A

    9:25 AM – 9:40 AM
     
9:25 AM – 9:45 AM

 

FIRESIDE

GCT Regulatory Framework | Why Different?

 
Moderator:
Vicki Sato, PhD
  • Chairman of the Board, Vir Biotechnology

Diversity of approaches

Process at FDA generalize from 1st entry to rules more generalizable 

Speaker:
Peter Marks, MD, PhD
  • Director, Center for Biologics Evaluation and Research, FDA

Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work

Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance  T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance

Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation 

  • Q&A

    9:50 AM – 10:05 AM
     
9:50 AM – 10:15 AM

Building a GCT Platform for Mainstream Success

This panel of GCT executives, innovators and investors explore how to best shape a successful GCT strategy. Among the questions to be addressed:

  • How are GCT approaches set around defining and building a platform?
  • Is AAV the leading modality and what are the remaining challenges?
  • What are the alternatives?
  • Is it just a matter of matching modalities to the right indications?
Moderator:
Jean-François Formela, MD
  • Partner, Atlas Venture

Established core components of the Platform

Speakers:
Katherine High, MD
  • President, Therapeutics, AskBio

Three drugs approved in Europe in the Gene therapy space

Regulatory Infrastructure exists for CGT drug approval – as new class of therapeutics

Participants investigators, regulators, patients i. e., MDM 

Hemophilia in male most challenging

Human are natural hosts for AV safety signals 

Dave Lennon, PhD
  • President, Novartis Gene Therapies

big pharma has portfolios of therapeutics not one drug across Tx areas: cell, gene iodine therapy 

collective learning infrastructure features manufacturing at scale early in development Acquisitions strategy for growth # applications for scaling 

 

Rick Modi
  • CEO, Affinia Therapeutics

Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP 

Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific 

Louise Rodino-Klapac, PhD
  • EVP, Chief Scientific Officer, Sarepta Therapeutics

AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years

Safety to clinic vs speed to clinic, difference of vectors to trust

  • Q&A

    10:20 AM – 10:35 AM
     
10:20 AM – 10:45 AM

AAV Success Studies | Retinal Dystrophy | Spinal Muscular Atrophy

Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.

The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.

  • Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
  • Lessons learned from these first-in-class approvals.
  • Challenges to broaden this modality to similar indications.
  • Reflections on safety signals in the clinical studies?
Moderator:
Joan Miller, MD
  • Chief, Ophthalmology, MEE
  • Cogan Professor & Chair of Ophthalmology, HMS

Retina specialist, Luxturna success FMA condition cell therapy as solution

Lessons learned

Safety

Speakers:
Ken Mills
  • CEO, RegenXBio

Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years 

Cell therapy vs transplant therapy no immunosuppression

 

Eric Pierce, MD, PhD
  • Director, Ocular Genomics Institute, MEE
  • Professor of Ophthalmology, HMS

Laxterna success to be replicated platform, paradigms measurement visual improved

More science is needed to continue develop vectors reduce toxicity,

AAV can deliver different cargos reduce adverse events improve vectors

Ron Philip
  • Chief Operating Officer, Spark Therapeutics

The first retinal gene therapy, voretigene neparvovec-rzyl (Luxturna, Spark Therapeutics), was approved by the FDA in 2017.

Meredith Schultz, MD
  • Executive Medical Director, Lead TME, Novartis Gene Therapies

Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise

Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information

  • Q&A

    10:50 AM – 11:05 AM
     
10:45 AM – 10:55 AM

Break

 
10:55 AM – 11:05 AM

 

FIRST LOOK

Control of AAV pharmacology by Rational Capsid Design

 
Luk Vandenberghe, PhD
  • Grousbeck Family Chair, Gene Therapy, MEE
  • Associate Professor, Ophthalmology, HMS

AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,

Pathway for rational AAV rational design, curated smart variant libraries, AAV  sequence screen multiparametric , data enable liver (de-) targeting unlock therapeutics areas: cochlea 

  • Q&A

    11:05 AM – 11:25 AM
     
11:05 AM – 11:15 AM

 

FIRST LOOK

Enhanced gene delivery and immunoevasion of AAV vectors without capsid modification

 
Casey Maguire, PhD
  • Associate Professor of Neurology, MGH & HMS

Virus Biology: Enveloped (e) or not 

enveloped for gene therapy eAAV platform technology: tissue targets and Indications commercialization of eAAV 

  • Q&A

    11:15 AM – 11:35 AM
     
11:20 AM – 11:45 AM

 

HOT TOPICS

AAV Delivery

This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed?

Moderators:
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS

Florian Eichler, MD

  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS
Speakers:
Jennifer Farmer
  • CEO, Friedreich’s Ataxia Research Alliance

Ataxia requires therapy targeting multiple organ with one therapy, brain, spinal cord, heart several IND, clinical trials in 2022

Mathew Pletcher, PhD
  • SVP, Head of Gene Therapy Research and Technical Operations, Astellas

Work with diseases poorly understood, collaborations needs example of existing: DMD is a great example explain dystrophin share placedo data 

Continue to explore large animal guinea pig not the mice, not primates (ethical issues) for understanding immunogenicity and immune response 

Manny Simons, PhD
  • CEO, Akouos

AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model 

Biology across species nerve ending in the cochlea

engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones

  • Q&A

    11:50 AM – 12:05 PM
     
11:50 AM – 12:15 PM

M&A | Shaping GCT Innovation

The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up?

Moderator:
Adam Koppel, MD, PhD
  • Managing Director, Bain Capital Life Sciences

What acquirers are looking for??

What is the next generation vs what is real where is the industry going?

Speakers:

Debby Baron,

  • Worldwide Business Development, Pfizer 

CGT is an important area Pfizer is active looking for innovators, advancing forward programs of innovation with the experience Pfizer has internally 

Scalability and manufacturing  regulatory conversations, clinical programs safety in parallel to planning getting drug to patients

Kenneth Custer, PhD

  • Vice President, Business Development and Lilly New Ventures, Eli Lilly and Company

Marianne De Backer, PhD

Head of Strategy, Business Development & Licensing, and Member of the Executive Committee, Bayer

Absolute Leadership in Gene editing, gene therapy, via acquisition and strategic alliance 

Operating model of the acquired company discussed , company continue independence

Sean Nolan

  • Board Chairman, Encoded Therapeutics & Affinia

Executive Chairman, Jaguar Gene Therapy & Istari Oncology

As acquiree multiple M&A: How the acquirer looks at integration and cultures of the two companies 

Traditional integration vs jump start by external acquisition 

AAV – epilepsy, next generation of vectors 

  • Q&A

    12:20 PM – 12:35 PM
     
12:15 PM – 12:25 PM

 

FIRST LOOK

Gene Therapies for Neurological Disorders: Insights from Motor Neuron Disorders

 
Merit Cudkowicz, MD
  • Chief of Neurology, MGH

ALS – Man 1in 300, Women 1 in 400, next decade increase 7% 

10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters 

 

Q&A

  • 12:25 PM – 12:45 PM
     
12:25 PM – 12:35 PM

 

FIRST LOOK

Gene Therapy for Neurologic Diseases

 
Patricia Musolino, MD, PhD
  • Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
  • Assistant Professor of Neurology, HMS

Cerebral Vascular disease – ACTA2 179H gene smooth muscle cell proliferation disorder

no surgery or drug exist –

Cell therapy for ACTA2 Vasculopathy  in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis 

  • Q&A

    12:35 PM – 12:55 PM
     
12:35 PM – 1:15 PM

Lunch

 
1:15 PM – 1:40 PM

Oncolytic Viruses in Cancer | Curing Melanoma and Beyond

Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story.  They will explore why and how Imlygic became approved and its path to commercialization.  Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers.  Why? Is there a limitation to what and which cancers can target?  Is the mode of administration a problem?

No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why?  Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?

The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses.  It will also assess the extent pre-clinical development challenges have slowed the development of OVs.

Moderator:
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Challenges of manufacturing at Amgen what are they?

Speakers:
Robert Coffin, PhD
  • Chief Research & Development Officer, Replimune

2002 in UK promise in oncolytic therapy GNCSF

Phase III melanoma 2015 M&A with Amgen

oncolytic therapy remains non effecting on immune response 

data is key for commercialization 

do not belief in systemic therapy achieve maximum immune response possible from a tumor by localized injection 

 

Roger Perlmutter, MD, PhD
  • Chairman, Merck & Co.

response rates systemic therapy like PD1, Keytruda, OPTIVA well tolerated combination of Oncolytic with systemic 

GMP critical for manufacturing 

 

David Reese, MD
  • Executive Vice President, Research and Development, Amgen

Inter lesion injection of agent vs systemic therapeutics 

cold tumors immune resistant render them immune susceptible 

Oncolytic virus is a Mono therapy

addressing the unknown 

Ann Silk, MD
  • Physician, Dana Farber-Brigham and Women’s Cancer Center
  • Assistant Professor of Medicine, HMS

Which person gets oncolytics virus if patient has immune suppression due to other indications

Safety of oncolytic virus greater than Systemic treatment

series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential 

  • Q&A

    1:45 PM – 2:00 PM
     
1:45 PM – 2:10 PM

Market Interest in Oncolytic Viruses | Calibrating

There are currently two oncolytic virus products on the market, one in the USA and one in China.  As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II.   Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:

What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?

  • Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
  • Why are these companies pursuing OVs while several others are taking a pass?
Moderators:
Martine Lamfers, PhD
  • Visiting Scientist, BWH

Challenged in development of strategies 

Demonstrate efficacy

Robert Martuza, MD
  • Consultant in Neurosurgery, MGH
  • William and Elizabeth Sweet Distinguished Professor of Neurosurgery, HMS

Modulation mechanism

Speakers:
Anlong Li, MD, PhD
  • Clinical Director, Oncology Clinical Development, Merck Research Laboratories

IV delivery preferred – delivery alternative are less aggereable

 

Jeffrey Infante, MD
  • Early development Oncolytic viruses, Oncology, Janssen Research & Development

oncologic virus if it will generate systemic effects the adoption will accelerate

What areas are the best efficacious 

Direct effect with intra-tumor single injection with right payload 

Platform approach  Prime with 1 and Boost with 2 – not yet experimented with 

Do not have the data at trial design for stratification of patients 

Turn off strategy not existing yet

Loic Vincent, PhD
  • Head of Oncology Drug Discovery Unit, Takeda

R&D in collaboration with Academic

Vaccine platform to explore different payload

IV administration may not bring sufficient concentration to the tumor is administer  in the blood stream

Classification of Patients by prospective response type id UNKNOWN yet, population of patients require stratification

  • Q&A

    2:15 PM – 2:30 PM
     
2:10 PM – 2:20 PM

 

FIRST LOOK

Oncolytic viruses: turning pathogens into anticancer agents

 
Nino Chiocca, MD, PhD
  • Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
  • Harvey W. Cushing Professor of Neurosurgery, HMS

Oncolytic therapy DID NOT WORK Pancreatic Cancer and Glioblastoma 

Intra- tumoral heterogeniety hinders success 

Solution: Oncolytic VIRUSES – Immunological “coldness”

GADD-34 20,000 GBM 40,000 pancreatic cancer

  • Q&A

    2:25 PM – 2:40 PM
     
2:20 PM – 2:45 PM

Entrepreneurial Growth | Oncolytic Virus

In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:

  •  How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
  • Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
  • Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space?  Would they bring any real advantages?
Moderator:
Reid Huber, PhD
  • Partner, Third Rock Ventures

Critical milestones to observe

Speakers:
Caroline Breitbach, PhD
  • VP, R&D Programs and Strategy, Turnstone Biologics

Trying Intra-tumor delivery and IV infusion delivery oncolytic vaccine pushing dose 

translation biomarkers program 

transformation tumor microenvironment 

 

Brett Ewald, PhD
  • SVP, Development & Corporate Strategy, DNAtrix

Studies gets larger, kicking off Phase III multiple tumors 

 

Paul Hallenbeck, PhD
  • President and Chief Scientific Officer, Seneca Therapeutics

Translation: 

Stephen Russell, MD, PhD
  • CEO, Vyriad

Systemic delivery Oncolytic Virus IV delivery woman in remission

Collaboration with Regeneron

Data collection: Imageable reporter secretable reporter, gene expression

Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors 

  • Q&A

    2:50 PM – 3:05 PM
     
2:45 PM – 3:00 PM

Break

 
3:00 PM – 3:25 PM

CAR-T | Lessons Learned | What’s Next

Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:

  • Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
  • What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
  • Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
  • Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
  • Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
  • Moderator:
  • Marcela Maus, MD, PhD
    • Director, Cellular Immunotherapy Program, Cancer Center, MGH
    • Associate Professor, Medicine, HMS

    Is CAR-T Industry priority

  • Speakers:
  • Head of R&D, Atara BioTherapeutics
  • Phyno-type of the cells for hematologic cancers 
  • solid tumor 
  • inventory of Therapeutics for treating patients in the future 
  • Progressive MS program
  • EBBT platform B-Cells and T-Cells
    • Stefan Hendriks
      • Gobal Head, Cell & Gene, Novartis
      • yes, CGT is a strategy in the present and future
      • Journey started years ago 
      • Confirmation the effectiveness of CAR-T therapies, 1 year response prolonged to 5 years 26 months
      • Patient not responding – a lot to learn
      • Patient after 8 months of chemo can be helped by CAR-T
    • Christi Shaw
      • CEO, Kite
      • CAR-T is priority 120 companies in the space
      • Manufacturing consistency 
      • Patients respond with better quality of life
      • Blood cancer – more work to be done

Q&A

  • 3:30 PM – 3:45 PM
     
3:30 PM – 3:55 PM

 

HOT TOPICS

CAR-T | Solid Tumors Success | When?

The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:

  •  How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
  •  Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
  •  Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
  •  Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
Moderator:
Oladapo Yeku, MD, PhD
  • Clinical Assistant in Medicine, MGH

window of opportunities studies 

Speakers:
Jennifer Brogdon
  • Executive Director, Head of Cell Therapy Research, Exploratory Immuno-Oncology, NIBR

2017 CAR-T first approval

M&A and research collaborations

TCR tumor specific antigens avoid tissue toxicity 

Knut Niss, PhD
  • CTO, Mustang Bio

tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor 

Barbra Sasu, PhD
  • CSO, Allogene

T cell response at prostate cancer 

tumor specific 

cytokine tumor specific signals move from solid to metastatic cell type for easier infiltration

Where we might go: safety autologous and allogeneic 

Jay Short, PhD
  • Chairman, CEO, Cofounder, BioAlta, Inc.

Tumor type is not enough for development of therapeutics other organs are involved in the periphery

difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside 

Combination staggered key is try combination

  • Q&A

    4:00 PM – 4:15 PM
     
4:00 PM – 4:25 PM

GCT Manufacturing | Vector Production | Autologous and Allogeneic | Stem Cells | Supply Chain | Scalability & Management

The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027,  groups of products are emerging.  Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:

  • Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
  • For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
  • Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
  • How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Moderator:
Michael Paglia
  • VP, ElevateBio
Speakers:
  • Dannielle Appelhans
    • SVP TechOps and Chief Technical Officer, Novartis Gene Therapies
  • Thomas Page, PhD
    • VP, Engineering and Asset Development, FUJIFILM Diosynth Biotechnologies
  • Rahul Singhvi, ScD
    • CEO and Co-Founder, National Resilience, Inc.
  • Thomas VanCott, PhD
    • Global Head of Product Development, Gene & Cell Therapy, Catalent
    • 2/3 autologous 1/3 allogeneic  CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized  allogeneic are health donors innovations in cell types in use improvements in manufacturing

Ropa Pike, Director,  Enterprise Science & Partnerships, Thermo Fisher Scientific 

Centralized biopharma industry is moving  to decentralized models site specific license 

  • Q&A

    4:30 PM – 4:45 PM
     
4:30 PM – 4:40 PM

 

FIRST LOOK

CAR-T

 
Marcela Maus, MD, PhD
  • Director, Cellular Immunotherapy Program, Cancer Center, MGH
  • Assistant Professor, Medicine, HMS 

Fit-to-purpose CAR-T cells: 3 lead programs

Tr-fill 

CAR-T induce response myeloma and multiple myeloma GBM

27 patents on CAR-T

+400 patients treaded 40 Clinical Trials 

  • Q&A

    4:40 PM – 5:00 PM
     
4:40 PM – 4:50 PM

 

FIRST LOOK

Repurposed Tumor Cells as Killers and Immunomodulators for Cancer Therapy

 
Khalid Shah, PhD
  • Vice Chair, Neurosurgery Research, BWH
  • Director, Center for Stem Cell Therapeutics and Imaging, HMS

Solid tumors are the hardest to treat because: immunosuppressive, hypoxic, Acidic Use of autologous tumor cells self homing ThTC self targeting therapeutic cells Therapeutic tumor cells efficacy pre-clinical models GBM 95% metastesis ThTC translation to patient settings

  • Q&A

    4:50 PM – 5:10 PM
     
4:50 PM – 5:00 PM

 

FIRST LOOK

Other Cell Therapies for Cancer

 
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS

T-cell are made in bone marrow create cryogel  can be an off-the-shelf product repertoire on T Receptor CCL19+ mesenchymal cells mimic Tymus cells –

inter-tymic injection. Non human primate validation

Q&A

 

5:00 PM – 5:20 PM
 
5:00 PM – 5:20 PM

 

FIRESIDE

Fireside with Mikael Dolsten, MD, PhD

 
Introducer:
Jonathan Kraft
Moderator:
Daniel Haber, MD, PhD
  • Chair, Cancer Center, MGH
  • Isselbacher Professor of Oncology, HMS

Vaccine Status 

Mikael Dolsten, MD, PhD
  • Chief Scientific Officer and President, Worldwide Research, Development and Medical, Pfizer

Deliver vaccine around the Globe, Israel, US, Europe.

3BIL vaccine in 2022 for all Global vaccination 

Bio Ntech in Germany

Experience with Biologics immuneoncology & allogeneic antibody cells – new field for drug discovery 

mRNA curative effort and cancer vaccine 

Access to drugs developed by Pfizer to underdeveloped countries 

  • Q&A

    5:25 PM – 5:40 AM
     
5:20 PM – 5:30 PM
8:00 AM – 8:25 AM

GCT | The China Juggernaut

China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer.  Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents.  It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.

In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment.  In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.

The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.

This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market.

Moderator:
Min Wu, PhD
  • Managing Director, Fosun Health Fund

What are the area of CGT in China, regulatory similar to the US

 

Speakers:
Alvin Luk, PhD
  • CEO, Neuropath Therapeutics

Monogenic rare disease with clear genomic target

Increase of 30% in patient enrollment 

Regulatory reform approval is 60 days no delay

 

Pin Wang, PhD
  • CSO, Jiangsu Simcere Pharmaceutical Co., Ltd.

Similar starting point in CGT as the rest of the World unlike a later starting point in other biological

 

Richard Wang, PhD
  • CEO, Fosun Kite Biotechnology Co., Ltd

Possibilities to be creative and capitalize the new technologies for innovating drug

Support of the ecosystem by funding new companie allowing the industry to be developed in China

Autologous in patients differences cost challenge

Tian Xu, PhD
  • Vice President, Westlake University

ICH committee and Chinese FDA -r regulation similar to the US

Difference is the population recruitment, in China patients are active participants in skin disease 

Active in development of transposome 

Development of non-viral methods, CRISPR still in D and transposome

In China price of drugs regulatory are sensitive 

Shunfei Yan, PhD
  • Investment Manager, InnoStar Capital

Indication driven: Hemophilia, 

Allogogenic efficiency therapies

Licensing opportunities 

 

  • Q&A

    8:30 AM – 8:45 AM
     
8:30 AM – 8:55 AM

Impact of mRNA Vaccines | Global Success Lessons

The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?

  • How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
  • How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
  • Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
  • Will cost-of-goods be reduced as the industry matures?
  • How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Moderator:
Lindsey Baden, MD
  • Director, Clinical Research, Division of Infectious Diseases, BWH
  • Associate Professor, HMS

In vivo delivery process regulatory cooperation new opportunities for same platform for new indication

Speakers:

Many years of mRNA pivoting for new diseases, DARPA, Nucleic Acids global deployment of a manufacturing unit on site where the need arise. Elan Musk funds new directions at Moderna

How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy 

45 days for Personalized cancer vaccine one per patient

1.6 Billion doses produced rare disease monogenic correct mRNA like CF multiple mutation infection disease and oncology applications

Platform allowing to swap cargo reusing same nanoparticles address disease beyond Big Pharma options for biotech

WHat strain of Flu vaccine will come back in the future when people do not use masks 

  • Kate Bingham, UK Vaccine Taskforce

July 2020, AAV vs mRNA delivery across UK local centers administered both types supply and delivery uplift 

 

  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

 

HOT TOPICS

Benign Blood Disorders

Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market?

Moderator:
Nancy Berliner, MD
  • Chief, Division of Hematology, BWH
  • H. Franklin Bunn Professor of Medicine, HMS
Speakers:
Theresa Heggie
  • CEO, Freeline Therapeutics

Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered 

Potency and quality less quantity drug and greater potency

risk of delivery unwanted DNA, capsules are critical 

analytics is critical regulator involvement in potency definition

Close of collaboration is exciting

Gallia Levy, MD, PhD
  • Chief Medical Officer, Spark Therapeutics

Hemophilia CGT is the highest potential for Global access logistics in underdeveloped countries working with NGOs practicality of the Tx

Roche reached 120 Counties great to be part of the Roche Group

Amir Nashat, PhD
  • Managing Partner, Polaris Ventures
Suneet Varma
  • Global President of Rare Disease, Pfizer

Gene therapy at Pfizer small molecule, large molecule and CGT – spectrum of choice allowing Hemophilia patients to marry 

1/3 internal 1/3 partnership 1/3 acquisitions 

Learning from COVID-19 is applied for other vaccine development

review of protocols and CGT for Hemophelia

You can’t buy Time

With MIT Pfizer is developing a model for Hemopilia CGT treatment

  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Treating Rett Syndrome through X-reactivation

 
Jeannie Lee, MD, PhD
  • Molecular Biologist, MGH
  • Professor of Genetics, HMS

200 disease X chromosome unlock for neurological genetic diseases: Rett Syndrome and other autism spectrum disorders female model vs male mice model

deliver protein to the brain 

restore own missing or dysfunctional protein

Epigenetic not CGT – no exogenous intervention Xist ASO drug

Female model

  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 9:45 AM

 

FIRST LOOK

Rare but mighty: scaling up success in single gene disorders

 
Florian Eichler, MD
  • Director, Center for Rare Neurological Diseases, MGH
  • Associate Professor, Neurology, HMS

Single gene disorder NGS enable diagnosis, Diagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology 

crosswalk from bone marrow matter 

New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers 

  • Q&A

    9:45 AM – 10:05 AM
     
9:50 AM – 10:15 AM

 

HOT TOPICS

Diabetes | Grand Challenge

The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.

  •  Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
  • How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Moderator:
Marie McDonnell, MD
  • Chief, Diabetes Section and Director, Diabetes Program, BWH
  • Lecturer on Medicine, HMS

Type 1 Diabetes cost of insulin for continuous delivery of drug

alternative treatments: 

The Future: neuropotent stem cells 

What keeps you up at night 

Speakers:
Tom Bollenbach, PhD
  • Chief Technology Officer, Advanced Regenerative Manufacturing Institute

Data managment sterility sensors, cell survival after implantation, stem cells manufacturing, process development in manufacturing of complex cells

Data and instrumentation the Process is the Product

Manufacturing tight schedules 

 

Manasi Jaiman, MD
  • Vice President, Clinical Development, ViaCyte
  • Pediatric Endocrinologist

continous glucose monitoring 

 

Bastiano Sanna, PhD
  • EVP, Chief of Cell & Gene Therapies and VCGT Site Head, Vertex Pharmaceuticals

100 years from discovering Insulin, Insulin is not a cure in 2021 – asking patients to partner more 

Produce large quantities of the Islet cells encapsulation technology been developed 

Scaling up is a challenge

Rogerio Vivaldi, MD
  • CEO, Sigilon Therapeutics

Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression 

Volume to have of-the-shelf inventory oxygenation in location lymphatic and vascularization control the whole process modular platform learning from others

  • Q&A

    10:20 AM – 10:35 AM
     
10:20 AM – 10:40 AM

 

FIRESIDE

Building A Unified GCT Strategy

 
Introducer:
John Fish
  • CEO, Suffolk
  • Chairman of Board Trustees, Brigham Health
Moderator:
Meg Tirrell
  • Senior Health and Science Reporter, CNBC

Last year, what was it at Novartis

Speaker:
Jay Bradner, MD
  • President, NIBR

Keep eyes open, waiting the Pandemic to end and enable working back on all the indications 

Portfolio of MET, Mimi Emerging Therapies 

Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis

Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy 

Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic

Protein degradation organization constraint valuation by parties in a partnership 

Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate

Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter

  • Q&A

    10:45 AM – 11:00 AM
     
10:40 AM – 10:50 AM

Break

 
10:50 AM – 11:00 AM

 

FIRST LOOK

Getting to the Heart of the Matter: Curing Genetic Cardiomyopathy

 
  • Christine Seidman, MD
    • Director, Cardiovascular Genetics Center, BWH
    • Smith Professor of Medicine & Genetics, HMS

The Voice of Dr. Seidman – Her abstract is cited below

The ultimate opportunity presented by discovering the genetic basis of human disease is accurate prediction and disease prevention. To enable this achievement, genetic insights must enable the identification of at-risk

individuals prior to end-stage disease manifestations and strategies that delay or prevent clinical expression. Genetic cardiomyopathies provide a paradigm for fulfilling these opportunities. Hypertrophic cardiomyopathy (HCM) is characterized by left ventricular hypertrophy, diastolic dysfunction with normal or enhanced systolic performance and a unique histopathology: myocyte hypertrophy, disarray and fibrosis. Dilated cardiomyopathy (DCM) exhibits enlarged ventricular volumes with depressed systolic performance and nonspecific histopathology. Both HCM and DCM are prevalent clinical conditions that increase risk for arrhythmias, sudden death, and heart failure. Today treatments for HCM and DCM focus on symptoms, but none prevent disease progression. Human molecular genetic studies demonstrated that these pathologies often result from dominant mutations in genes that encode protein components of the sarcomere, the contractile unit in striated muscles. These data combined with the emergence of molecular strategies to specifically modulate gene expression provide unparalleled opportunities to silence or correct mutant genes and to boost healthy gene expression in patients with genetic HCM and DCM. Many challenges remain, but the active and vital efforts of physicians, researchers, and patients are poised to ensure success.

 
2:10 PM – 2:20 PM

 

FIRST LOOK

Enhancing vesicles for therapeutic delivery of bioproducts

 
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS

DNA, RNA, exosomes avoid random transgene integration 

EVs – Extracellular Vesicles 

  • Q&A

    2:20 PM – 2:35 PM
     
2:20 PM – 2:30 PM

 

FIRST LOOK

Versatile polymer-based nanocarriers for targeted therapy and immunomodulation

 
Natalie Artzi, PhD
  • Assistant Professor, BWH

Epigenome

Nonviral (nucleic acid) delivery 

Nanoparticle Toolbox : Cyclical Dinucleotides (CDN) 

Nanoparticles for delivery of medicines Delivery route affect on therapeutic efficacy

Polymeric based nanocarriers for targeted therapy and immunomodulation

  • Q&A

    2:30 PM – 2:45 PM
     
2:55 PM – 3:20 PM

 

HOT TOPICS

Gene Editing | Achieving Therapeutic Mainstream

Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.

Today’s panel is made up of pioneers who represent foundational aspects of gene editing.  They will discuss the movement of the technology into the therapeutic mainstream.

  • Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
  • When to use what editing tool – pros and cons of traditional gene-editing v. base editing.  Is prime editing the future? Specific use cases for epigenetic editing.
  • When we reach widespread clinical use – role of off-target editing – is the risk real?  How will we mitigate? How practical is patient-specific off-target evaluation?
Moderator:
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS

target alteration of genes for research and novele therapeutics for indications without alternative Tx

Chardonay Platform Specificity and safety 

 

Speakers:
John Evans
  • CEO, Beam Therapeutics

CRISPR targets the Genome reaching the site open DNA single base change in the Genome sicle cell anemia, letter misspelled correction

turn off or activate or program the protein function genome modification tool immunology CAR-T nanoparticles to deliver locally

Delivery is the challenge ex Vivo, In Vivo innovations in nanoparticles to blood system, muscle 

Lisa Michaels
  • EVP & CMO, Editas Medicine

Gene editing allows correction of genetic abnormalities 

CRISPR editing the Genome in Vivo 

Delivery specificity edit DNA of cells for Tx objective

 

Rachel Haurwitz, PhD

Caribou BioSciences, Off UC, Berkeley, CA

Innovation to delivery large quantities of DNA 

  • Q&A

    3:25 PM – 3:50 PM
     
3:25 PM – 3:50 PM

 

HOT TOPICS

Common Blood Disorders | Gene Therapy

There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and  Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:

  • What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
  • How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
  • How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
  • How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
  • Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
  • What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
  • Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Moderator:
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS
Speakers:
Samarth Kukarni, PhD
Nick Leschly
  • Chief Bluebird, Bluebird Bio
Mike McCune, MD, PhD
  • Head, HIV Frontiers, Global Health Innovative Technology Solutions, Bill & Melinda Gates Foundation
  • Q&A

    3:55 PM – 4:15 PM
     
3:50 PM – 4:00 PM

 

FIRST LOOK

Gene Editing

 
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS

ONE-seq enriched in specific populations for genetic variation

seq IP and commercialization

 
FIRST LOOK
Pierpaolo Peruzzi, MD, PhD
  • Nuerosurgery, BWH
  • Assistant Professor of Neurosurgery, HMS
 

Targeting with RNA clusters enhances chemotheraphy in GBM

AAV delivery micro RNA – viral mediated and by exosomes (non viral)

Therapeutic impact in Brain Tumors 2-3 readiness

 

 

 
  •  
  • Q&A

    4:00 PM – 4:20 PM
     
4:20 PM – 4:45 PM

 

HOT TOPICS

Gene Expression | Modulating with Oligonucleotide-Based Therapies

Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:

How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?

  • Will oligonucleotides improve as a class that will make them even more effective?   Are further advancements in backbone chemistry anticipated, for example.
  • Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
  • Are small molecules a threat to oligonucleotide-based therapies?
  • Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides?  Is there a place for multiple mechanism oligonucleotide medicines?
  • Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?

small molecule vs capacity of nanoparticles to deliver therapeutics quantity for more molecule is much larger

  • Alfred Sandrock, MD, PhD

    EVP, R&D and CMO, Biogen
  •  
 
  •  
  • Q&A

    4:55 PM – 5:15 PM
     
8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?

Moderator:
Meredith Fisher, PhD
  • Partner, Mass General Brigham Innovation Fund
Speakers:
David Berry, MD, PhD
  • CEO, Valo Health
  • General Partner, Flagship Pioneering
Robert Nelsen
  • Managing Director, Co-founder, ARCH Venture Partners
Kush Parmar, MD, PhD
  • Managing Partner, 5AM Ventures
  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product
Moderator:
Ole Isacson, MD, PhD
  • Director, Neuroregeneration Research Institute, McLean
  • Professor, Neurology and Neuroscience, HMS
Speakers:
Kapil Bharti, PhD
  • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH
Joe Burns, PhD
  • VP, Head of Biology, Decibel Therapeutics
Erin Kimbrel, PhD
  • Executive Director, Regenerative Medicine, Astellas
Nabiha Saklayen, PhD
  • CEO and Co-Founder, Cellino
  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Stem Cells

 
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?

Moderator:
Roger Kitterman
  • VP, Venture, Mass General Brigham
Speakers:
Ellen Hukkelhoven, PhD
  • Managing Director, Perceptive Advisors
Peter Kolchinsky, PhD
  • Founder and Managing Partner, RA Capital Management
Deep Nishar
  • Senior Managing Partner, SoftBank Investment Advisors
Oleg Nodelman
  • Founder & Managing Partner, EcoR1 Capital
  • Q&A

    10:05 AM – 10:20 AM
     
10:00 AM – 10:10 AM

 

FIRST LOOK
10:10 AM – 10:35 AM

 

HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT
Moderator:
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
Speakers:
Erwan Bezard, PhD
  • INSERM Research Director, Institute of Neurodegenerative Diseases
Nikola Kojic, PhD
  • CEO and Co-Founder, Oryon Cell Therapies
Geoff MacKay
  • President & CEO, AVROBIO
Viviane Tabar, MD
  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Q&A

    10:40 AM – 10:55 AM
     
10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.

11:35 AM – 11:45 AM

Concluding Remarks

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.

Christine Seidman, MD
  •  

Hypertrophic and Dilated Cardiomyopaies ‘

10% receive heart transplant 12 years survival 

Mutation puterb function

TTN: contribute 20% of dilated cardiomyopaty

Silence gene 

pleuripotential cells deliver therapies 

  • Q&A

    11:00 AM – 11:20 AM
     
11:00 AM – 11:10 AM

 

FIRST LOOK

Unlocking the secret lives of proteins in health and disease

 
Anna Greka, MD, PhD
  • Medicine, BWH
  • Associate Professor, Medicine, HMS

Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech 

 

Q&A

  • 11:10 AM – 11:30 AM
     
11:10 AM – 11:35 AM

Rare and Ultra Rare Diseases | GCT Breaks Through

One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.

  • What is driving the interest in rare diseases?
  • What are the biggest barriers to making breakthroughs ‘routine and affordable?’
  • What is the role of retrospective and prospective natural history studies in rare disease?  When does the expected value of retrospective disease history studies justify the cost?
  • Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases?  How does this impact the collection of natural history data?
Moderator:
Susan Slaugenhaupt, PhD
  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS
Speakers:
Leah Bloom, PhD
  • SVP, External Innovation and Strategic Alliances, Novartis Gene Therapies

Ultra rare (less than 100) vs rare difficulty to recruit patients and to follow up after treatment 

 

Bobby Gaspar, MD, PhD
  • CEO, Orchard Therapeutics

Study of rare condition have transfer to other larger diseases – delivery of therapeutics genes, like immune disorders 

Patient testimonials just to hear what a treatment can make 

Emil Kakkis, MD, PhD
  • CEO, Ultragenyx

Do 100 patient study then have information on natural history to develop a clinical trial 

Stuart Peltz, PhD
  • CEO, PTC Therapeutics

Rare disease, challenge for FDA approval and after market commercialization follow ups

Justification of cost for Rare disease – demonstration of Change is IP in value patients advocacy is helpful

  • Q&A

    11:40 AM – 11:55 AM
     
11:40 AM – 12:00 PM

 

FIRESIDE

Partnering Across the GCT Spectrum

 
Moderator:
Erin Harris
  • Chief Editor, Cell & Gene

Perspective & professional tenure

Partnership in manufacturing what are the recommendations?

Hospital systems: Partnership Challenges 

Speaker:
Marc Casper
  • CEO, ThermoFisher

25 years in Diagnostics last 20 years at ThermoFisher 

products used in the Lab for CAR-T research and manufacture 

CGT Innovations: FDA will have a high level of approval each year

How move from research to clinical trials to manufacturing Quicker process

Best practices in Partnerships: the root cause if acceleration to market service providers to deliver highest standards

Building capacity by acquisition to avoid the waiting time

Accelerate new products been manufactured 

Collaborations with Academic Medical center i.e., UCSF in CGT joint funding to accelerate CGT to clinics’

Customers are extremely knowledgable, scale the capital investment made investment

150MIL a year to improve the Workflow 

 

  • Q&A

    12:05 PM – 12:20 PM
     
12:05 PM – 12:30 PM

CEO Panel | Anticipating Disruption | Planning for Widespread GCT

The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated.

Moderator:
Meg Tirrell
  • Senior Health and Science Reporter, CNBC

CGT becoming staple therapy what are the disruptors emerging

Speakers:
Lisa Dechamps
  • SVP & Chief Business Officer, Novartis Gene Therapies

Reimagine medicine with collaboration at MGH, MDM condition in children 

The Science is there, sustainable processes and systems impact is transformational

Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect

Collaboration with FDA

 

Kieran Murphy
  • CEO, GE Healthcare

Diagnosis of disease to be used in CGT

2021 investment in CAR-T platform 

Investment in several CGT frontier

Investment in AI, ML in system design new technologies 

GE: Scale and Global distributions, sponsor companies in software 

Waste in Industry – Healthcare % of GDP, work with MGH to smooth the workflow faster entry into hospital and out of Hospital

Telemedicine during is Pandemic: Radiologist needs to read remotely 

Supply chain disruptions slow down all ecosystem 

Production of ventilators by collaboration with GM – ingenuity 

Scan patients outside of hospital a scanner in a Box 

Christian Rommel, PhD
  • Head, Pharmaceuticals Research & Development, Bayer AG

CGT – 2016 and in 2020 new leadership and capability 

Disease Biology and therapeutics

Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular 

During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions 

 

  • Q&A

    12:35 PM – 12:50 PM
     
12:35 PM – 12:55 PM

 

FIRESIDE

Building a GCT Portfolio

GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements?

Moderator:

Shinichiro Fuse, PhD

  • Managing Partner, MPM Capital
Speaker:
Wolfram Carius, PhD
  • EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG

CGT will bring treatment to cure, delivery of therapies 

Be a Leader repair, regenerate, cure

Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products

Bayer strategy: build platform for use by four domains  

Gener augmentation

Autologeneic therapy, analytics

Gene editing

Oncology Cell therapy tumor treatment: What kind of cells – the jury is out

Of 23 product launch at Bayer no prediction is possible some high some lows 

 

  • Q&A

    1:00 PM – 1:15 PM
     
12:55 PM – 1:35 PM

Lunch

 
1:40 PM – 2:05 PM

GCT Delivery | Perfecting the Technology

Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities.

Moderator:
Natalie Artzi, PhD
  • Assistant Professor, BWH
Speakers:
Geoff McDonough, MD
  • CEO, Generation Bio
Sonya Montgomery
  • CMO, Evox Therapeutics
Laura Sepp-Lorenzino, PhD
  • Chief Scientific Officer, Executive Vice President, Intellia Therapeutics
Doug Williams, PhD
  • CEO, Codiak BioSciences
  • Q&A

    2:10 PM – 2:25 PM
     
2:10 PM – 2:20 PM

 

FIRST LOOK

Enhancing vesicles for therapeutic delivery of bioproducts

 
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS
  • Q&A

    2:20 PM – 2:35 PM
     
2:20 PM – 2:30 PM

 

FIRST LOOK
2:55 PM – 3:20 PM

 

HOT TOPICS

Gene Editing | Achieving Therapeutic Mainstream

Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.

Today’s panel is made up of pioneers who represent foundational aspects of gene editing.  They will discuss the movement of the technology into the therapeutic mainstream.

  • Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
  • When to use what editing tool – pros and cons of traditional gene-editing v. base editing.  Is prime editing the future? Specific use cases for epigenetic editing.
  • When we reach widespread clinical use – role of off-target editing – is the risk real?  How will we mitigate? How practical is patient-specific off-target evaluation?
Moderator:
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS
Speakers:
John Evans
  • CEO, Beam Therapeutics
Lisa Michaels
  • EVP & CMO, Editas Medicine
  • Q&A

    3:25 PM – 3:50 PM
     
3:25 PM – 3:50 PM

 

HOT TOPICS

Common Blood Disorders | Gene Therapy

There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and  Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:

  • What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
  • How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
  • How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
  • How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
  • Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
  • What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
  • Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Moderator:
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS
Speakers:
Samarth Kukarni, PhD
Nick Leschly
  • Chief Bluebird, Bluebird Bio
Mike McCune, MD, PhD
  • Head, HIV Frontiers, Global Health Innovative Technology Solutions, Bill & Melinda Gates Foundation
  • Q&A

    3:55 PM – 4:15 PM
     
3:50 PM – 4:00 PM

 

FIRST LOOK

Gene Editing

 
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS
  • Q&A

    4:00 PM – 4:20 PM
     
4:20 PM – 4:45 PM

 

HOT TOPICS

Gene Expression | Modulating with Oligonucleotide-Based Therapies

Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:

How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?

  • Will oligonucleotides improve as a class that will make them even more effective?   Are further advancements in backbone chemistry anticipated, for example.
  • Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
  • Are small molecules a threat to oligonucleotide-based therapies?
  • Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides?  Is there a place for multiple mechanism oligonucleotide medicines?
  • Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
Moderator:
Jeannie Lee, MD, PhD
  • Molecular Biologist, MGH
  • Professor of Genetics, HMS
Speakers:
Bob Brown, PhD
  • CSO, EVP of R&D, Dicerna
Brett Monia, PhD
  • CEO, Ionis
Alfred Sandrock, MD, PhD
  • EVP, R&D and CMO, Biogen
  • Q&A

    4:50 PM – 5:05 PM
     
4:45 PM – 4:55 PM

 

FIRST LOOK

RNA therapy for brain cancer

 
Pierpaolo Peruzzi, MD, PhD
  • Nuerosurgery, BWH
  • Assistant Professor of Neurosurgery, HMS
  • Q&A

    4:55 PM – 5:15 PM
     
8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?

Moderator:
 
Meredith Fisher, PhD
  • Partner, Mass General Brigham Innovation Fund

Strategies, success what changes are needed in the drug discovery process

 
Speakers:
 

Bring disruptive frontier as a platform with reliable delivery CGT double knock out disease cure all change efficiency and scope human centric vs mice centered right scale of data converted into therapeutics acceleratetion 

Innovation in drugs 60% fails in trial because of Toxicology system of the future deal with big diseases

Moderna is an example in unlocking what is inside us Microbiome and beyond discover new drugs epigenetics  

  • Robert Nelsen
    • Managing Director, Co-founder, ARCH Venture Partners

Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization How to systematically scaling up systematize the discovery and the production regulatory innovations

Responsibility mismatch should be and what is “are”

Long term diseases Stack holders and modalities risk benefir for populations 

  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product
  • Moderator:
    • Ole Isacson, MD, PhD
      • Director, Neuroregeneration Research Institute, McLean
      • Professor, Neurology and Neuroscience, MGH, HMS

Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all Translational medicine funding stem cells enormous opportunities 

  • Speakers:
  • Kapil Bharti, PhD
    • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH
    • first drug required to establish the process for that innovations design of animal studies not done before
    • Off-th-shelf one time treatment becoming cure 
    •  Intact tissue in a dish is fragile to maintain metabolism
    Joe Burns, PhD
    • VP, Head of Biology, Decibel Therapeutics
    • Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation
    • multiple cell types and tissue to follow
    Erin Kimbrel, PhD
    • Executive Director, Regenerative Medicine, Astellas
    • In the ocular space immunogenecity
    • regulatory communication
    • use gene editing for immunogenecity Cas1 and Cas2 autologous cells
    • gene editing and programming big opportunities 
    Nabiha Saklayen, PhD
    • CEO and Co-Founder, Cellino
    • scale production of autologous cells foundry using semiconductor process in building cassettes
    • solution for autologous cells
  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Stem Cells

 
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamin
  • skin cell to become autologous cells reprograms to become cells producing dopamine
  • transplantation fibroblast cells metabolic driven process lower mutation burden 
  • Quercetin inhibition elimination undifferentiated cells graft survival oxygenation increased 
  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?

Moderator:
Roger Kitterman
  • VP, Venture, Mass General Brigham
  • Saturation reached or more investment is coming in CGT 
Speakers:
Ellen Hukkelhoven, PhD
  • Managing Director, Perceptive Advisors
  • Cardiac area transduct cells
  • matching tools
  • 10% success of phase 1 in drug development next phase matters more 
  •  
Peter Kolchinsky, PhD
  • Founder and Managing Partner, RA Capital Management
  • Future proof for new comers disruptors 
  • Ex Vivo gene therapy to improve funding products what tool kit belongs to 
  • company insulation from next instability vs comapny stabilizing themselves along few years
  • Company interested in SPAC 
  • cross over investment vs SPAC
  • Multi Omics in cancer early screening metastatic diseas will be wiped out 
Deep Nishar
  • Senior Managing Partner, SoftBank Investment Advisors
  • Young field vs CGT started in the 80s 
  • high payloads is a challenge
  • cost effective fast delivery to large populations
  • Mission oriented by the team and management  
  • Multi Omics disease modality 
Oleg Nodelman
  • Founder & Managing Partner, EcoR1 Capital
  • Invest in company next round of investment will be IPO
  • Help company raise money cross over investment vs SPAC
  • Innovating ideas from academia in need for funding 
  • Q&A

    10:05 AM – 10:20 AM
     
10:00 AM – 10:10 AM

 

FIRST LOOK

New scientific and clinical developments for autologous stem cell therapy for Parkinson’s disease patients

 
Penelope Hallett, PhD
  • NRL, McLean
  • Assistant Professor Psychiatry, HMS
  • Pharmacologic agent in existing cause another disorders locomo-movement related 
  • efficacy Autologous cell therapy transplantation approach program T cells into dopamine generating neurons greater than Allogeneic cell transplantation 
  • Q&A

    10:10 AM – 10:30 AM
     
10:10 AM – 10:35 AM

 

HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT
Moderator:
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Neurogeneration REVERSAL or slowing down 
Speakers:
Erwan Bezard, PhD
  • INSERM Research Director, Institute of Neurodegenerative Diseases
  • Cautious on reversal 
  • Early intervantion versus late
Nikola Kojic, PhD
  • CEO and Co-Founder, Oryon Cell Therapies
  • Autologus cell therapy placed focal replacing missing synapses reestablishment of neural circuitary
Geoff MacKay
  • President & CEO, AVROBIO
  • Prevent condition to be manifested in the first place 
  • clinical effect durable single infusion preventions of symptoms to manifest 
  • Cerebral edema – stabilization
  • Gene therapy know which is the abnormal gene grafting the corrected one 
  • More than biomarker as end point functional benefit not yet established  
Viviane Tabar, MD
  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Current market does not have delivery mechanism that a drug-delivery is the solution Trials would fail on DELIVERY
  • Immune suppressed patients during one year to avoid graft rejection Autologous approach of Parkinson patient genetically mutated reprogramed as dopamine generating neuron – unknowns are present
  • Circuitry restoration
  • Microenvironment disease ameliorate symptoms – education of patients on the treatment 
  • Q&A

    10:40 AM – 10:55 AM
     
10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.

11:35 AM – 11:45 AM

Concluding Remarks

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.

Speakers:
Bob Brown, PhD
  • CSO, EVP of R&D, Dicerna
Brett Monia, PhD
  • CEO, Ionis
Alfred Sandrock, MD, PhD
  • EVP, R&D and CMO, Biogen
  • Q&A

    4:50 PM – 5:05 PM
     
4:45 PM – 4:55 PM

 

FIRST LOOK

RNA therapy for brain cancer

 
Pierpaolo Peruzzi, MD, PhD
  • Nuerosurgery, BWH
  • Assistant Professor of Neurosurgery, HMS
  • Q&A

    4:55 PM – 5:15 PM
     
8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?

Moderator:
Meredith Fisher, PhD
  • Partner, Mass General Brigham Innovation Fund
Speakers:
David Berry, MD, PhD
  • CEO, Valo Health
  • General Partner, Flagship Pioneering
Robert Nelsen
  • Managing Director, Co-founder, ARCH Venture Partners
Kush Parmar, MD, PhD
  • Managing Partner, 5AM Ventures
  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product
Moderator:
Ole Isacson, MD, PhD
  • Director, Neuroregeneration Research Institute, McLean
  • Professor, Neurology and Neuroscience, HMS
Speakers:
Kapil Bharti, PhD
  • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH
Joe Burns, PhD
  • VP, Head of Biology, Decibel Therapeutics
Erin Kimbrel, PhD
  • Executive Director, Regenerative Medicine, Astellas
Nabiha Saklayen, PhD
  • CEO and Co-Founder, Cellino
  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Stem Cells

 
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?

Moderator:
Roger Kitterman
  • VP, Venture, Mass General Brigham
Speakers:
Ellen Hukkelhoven, PhD
  • Managing Director, Perceptive Advisors
Peter Kolchinsky, PhD
  • Founder and Managing Partner, RA Capital Management
Deep Nishar
  • Senior Managing Partner, SoftBank Investment Advisors
Oleg Nodelman
  • Founder & Managing Partner, EcoR1 Capital
  • Q&A

    10:05 AM – 10:20 AM
     
10:00 AM – 10:10 AM

 

FIRST LOOK
10:10 AM – 10:35 AM

 

HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT
Moderator:
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
Speakers:
Erwan Bezard, PhD
  • INSERM Research Director, Institute of Neurodegenerative Diseases
Nikola Kojic, PhD
  • CEO and Co-Founder, Oryon Cell Therapies
Geoff MacKay
  • President & CEO, AVROBIO
Viviane Tabar, MD
  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Q&A

    10:40 AM – 10:55 AM
     
10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.

11:35 AM – 11:45 AM

Concluding Remarks

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.

Christine Seidman, MD
  •  

Hypertrophic and Dilated Cardiomyopaies ‘

10% receive heart transplant 12 years survival 

Mutation puterb function

TTN: contribute 20% of dilated cardiomyopaty

Silence gene 

pleuripotential cells deliver therapies 

  • Q&A

    11:00 AM – 11:20 AM
     
11:00 AM – 11:10 AM

 

FIRST LOOK

Unlocking the secret lives of proteins in health and disease

 
Anna Greka, MD, PhD
  • Medicine, BWH
  • Associate Professor, Medicine, HMS

Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech 

 

Q&A

  • 11:10 AM – 11:30 AM
     
11:10 AM – 11:35 AM

Rare and Ultra Rare Diseases | GCT Breaks Through

One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.

  • What is driving the interest in rare diseases?
  • What are the biggest barriers to making breakthroughs ‘routine and affordable?’
  • What is the role of retrospective and prospective natural history studies in rare disease?  When does the expected value of retrospective disease history studies justify the cost?
  • Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases?  How does this impact the collection of natural history data?
Moderator:
Susan Slaugenhaupt, PhD
  • Scientific Director and Elizabeth G. Riley and Daniel E. Smith Jr., Endowed Chair, Mass General Research Institute
  • Professor, Neurology, HMS
Speakers:
Leah Bloom, PhD
  • SVP, External Innovation and Strategic Alliances, Novartis Gene Therapies

Ultra rare (less than 100) vs rare difficulty to recruit patients and to follow up after treatment 

 

Bobby Gaspar, MD, PhD
  • CEO, Orchard Therapeutics

Study of rare condition have transfer to other larger diseases – delivery of therapeutics genes, like immune disorders 

Patient testimonials just to hear what a treatment can make 

Emil Kakkis, MD, PhD
  • CEO, Ultragenyx

Do 100 patient study then have information on natural history to develop a clinical trial 

Stuart Peltz, PhD
  • CEO, PTC Therapeutics

Rare disease, challenge for FDA approval and after market commercialization follow ups

Justification of cost for Rare disease – demonstration of Change is IP in value patients advocacy is helpful

  • Q&A

    11:40 AM – 11:55 AM
     
11:40 AM – 12:00 PM

 

FIRESIDE

Partnering Across the GCT Spectrum

 
Moderator:
Erin Harris
  • Chief Editor, Cell & Gene

Perspective & professional tenure

Partnership in manufacturing what are the recommendations?

Hospital systems: Partnership Challenges 

Speaker:
Marc Casper
  • CEO, ThermoFisher

25 years in Diagnostics last 20 years at ThermoFisher 

products used in the Lab for CAR-T research and manufacture 

CGT Innovations: FDA will have a high level of approval each year

How move from research to clinical trials to manufacturing Quicker process

Best practices in Partnerships: the root cause if acceleration to market service providers to deliver highest standards

Building capacity by acquisition to avoid the waiting time

Accelerate new products been manufactured 

Collaborations with Academic Medical center i.e., UCSF in CGT joint funding to accelerate CGT to clinics’

Customers are extremely knowledgable, scale the capital investment made investment

150MIL a year to improve the Workflow 

 

  • Q&A

    12:05 PM – 12:20 PM
     
12:05 PM – 12:30 PM

CEO Panel | Anticipating Disruption | Planning for Widespread GCT

The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated.

Moderator:
Meg Tirrell
  • Senior Health and Science Reporter, CNBC

CGT becoming staple therapy what are the disruptors emerging

Speakers:
Lisa Dechamps
  • SVP & Chief Business Officer, Novartis Gene Therapies

Reimagine medicine with collaboration at MGH, MDM condition in children 

The Science is there, sustainable processes and systems impact is transformational

Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect

Collaboration with FDA

 

Kieran Murphy
  • CEO, GE Healthcare

Diagnosis of disease to be used in CGT

2021 investment in CAR-T platform 

Investment in several CGT frontier

Investment in AI, ML in system design new technologies 

GE: Scale and Global distributions, sponsor companies in software 

Waste in Industry – Healthcare % of GDP, work with MGH to smooth the workflow faster entry into hospital and out of Hospital

Telemedicine during is Pandemic: Radiologist needs to read remotely 

Supply chain disruptions slow down all ecosystem 

Production of ventilators by collaboration with GM – ingenuity 

Scan patients outside of hospital a scanner in a Box 

Christian Rommel, PhD
  • Head, Pharmaceuticals Research & Development, Bayer AG

CGT – 2016 and in 2020 new leadership and capability 

Disease Biology and therapeutics

Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular 

During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions 

 

  • Q&A

    12:35 PM – 12:50 PM
     
12:35 PM – 12:55 PM

 

FIRESIDE

Building a GCT Portfolio

GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements?

Moderator:

Shinichiro Fuse, PhD

  • Managing Partner, MPM Capital
Speaker:
Wolfram Carius, PhD
  • EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG

CGT will bring treatment to cure, delivery of therapies 

Be a Leader repair, regenerate, cure

Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products

Bayer strategy: build platform for use by four domains  

Gener augmentation

Autologeneic therapy, analytics

Gene editing

Oncology Cell therapy tumor treatment: What kind of cells – the jury is out

Of 23 product launch at Bayer no prediction is possible some high some lows 

 

  • Q&A

    1:00 PM – 1:15 PM
     
12:55 PM – 1:35 PM

Lunch

 
1:40 PM – 2:05 PM

GCT Delivery | Perfecting the Technology

Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities.

Moderator:
Natalie Artzi, PhD
  • Assistant Professor, BWH
Speakers:
Geoff McDonough, MD
  • CEO, Generation Bio
Sonya Montgomery
  • CMO, Evox Therapeutics
Laura Sepp-Lorenzino, PhD
  • Chief Scientific Officer, Executive Vice President, Intellia Therapeutics
Doug Williams, PhD
  • CEO, Codiak BioSciences
  • Q&A

    2:10 PM – 2:25 PM
     
2:10 PM – 2:20 PM

 

FIRST LOOK

Enhancing vesicles for therapeutic delivery of bioproducts

 
Xandra Breakefield, PhD
  • Geneticist, MGH, MGH
  • Professor, Neurology, HMS
  • Q&A

    2:20 PM – 2:35 PM
     
2:20 PM – 2:30 PM

 

FIRST LOOK
2:55 PM – 3:20 PM

 

HOT TOPICS

Gene Editing | Achieving Therapeutic Mainstream

Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.

Today’s panel is made up of pioneers who represent foundational aspects of gene editing.  They will discuss the movement of the technology into the therapeutic mainstream.

  • Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
  • When to use what editing tool – pros and cons of traditional gene-editing v. base editing.  Is prime editing the future? Specific use cases for epigenetic editing.
  • When we reach widespread clinical use – role of off-target editing – is the risk real?  How will we mitigate? How practical is patient-specific off-target evaluation?
Moderator:
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS
Speakers:
John Evans
  • CEO, Beam Therapeutics
Lisa Michaels
  • EVP & CMO, Editas Medicine
  • Q&A

    3:25 PM – 3:50 PM
     
3:25 PM – 3:50 PM

 

HOT TOPICS

Common Blood Disorders | Gene Therapy

There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and  Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:

  • What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
  • How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
  • How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
  • How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
  • Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
  • What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
  • Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Moderator:
David Scadden, MD
  • Director, Center for Regenerative Medicine; Co-Director, Harvard Stem Cell Institute, Director, Hematologic Malignancies & Experimental Hematology, MGH
  • Jordan Professor of Medicine, HMS
Speakers:
Samarth Kukarni, PhD
Nick Leschly
  • Chief Bluebird, Bluebird Bio
Mike McCune, MD, PhD
  • Head, HIV Frontiers, Global Health Innovative Technology Solutions, Bill & Melinda Gates Foundation
  • Q&A

    3:55 PM – 4:15 PM
     
3:50 PM – 4:00 PM

 

FIRST LOOK

Gene Editing

 
J. Keith Joung, MD, PhD
  • Robert B. Colvin, M.D. Endowed Chair in Pathology & Pathologist, MGH
  • Professor of Pathology, HMS
  • Q&A

    4:00 PM – 4:20 PM
     
4:20 PM – 4:45 PM

 

HOT TOPICS

Gene Expression | Modulating with Oligonucleotide-Based Therapies

Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:

How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?

  • Will oligonucleotides improve as a class that will make them even more effective?   Are further advancements in backbone chemistry anticipated, for example.
  • Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
  • Are small molecules a threat to oligonucleotide-based therapies?
  • Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides?  Is there a place for multiple mechanism oligonucleotide medicines?
  • Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
Moderator:
Jeannie Lee, MD, PhD
  • Molecular Biologist, MGH
  • Professor of Genetics, HMS
Speakers:
Bob Brown, PhD
  • CSO, EVP of R&D, Dicerna
Brett Monia, PhD
  • CEO, Ionis
Alfred Sandrock, MD, PhD
  • EVP, R&D and CMO, Biogen
  • Q&A

    4:50 PM – 5:05 PM
     
4:45 PM – 4:55 PM

 

FIRST LOOK

RNA therapy for brain cancer

 
Pierpaolo Peruzzi, MD, PhD
  • Nuerosurgery, BWH
  • Assistant Professor of Neurosurgery, HMS
  • Q&A

    4:55 PM – 5:15 PM
     

Computer connection to the iCloud of WordPress.com FROZE completely at 10:30AM EST and no file update was possible. COVERAGE OF MAY 21, 2021 IS RECORDED BELOW FOLLOWING THE AGENDA BY COPY AN DPASTE OF ALL THE TWEETS I PRODUCED ON MAY 21, 2021

8:30 AM – 8:55 AM

Venture Investing | Shaping GCT Translation

What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?

Moderator:
Meredith Fisher, PhD
  • Partner, Mass General Brigham Innovation Fund
Speakers:
David Berry, MD, PhD
  • CEO, Valo Health
  • General Partner, Flagship Pioneering
Robert Nelsen
  • Managing Director, Co-founder, ARCH Venture Partners
Kush Parmar, MD, PhD
  • Managing Partner, 5AM Ventures
  • Q&A

    9:00 AM – 9:15 AM
     
9:00 AM – 9:25 AM

Regenerative Medicine | Stem Cells

The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:

  • Stem cell sourcing
  • Therapeutic indication growth
  • Genetic and other modification in cell production
  • Cell production to final product optimization and challenges
  • How to optimize the final product
Moderator:
Ole Isacson, MD, PhD
  • Director, Neuroregeneration Research Institute, McLean
  • Professor, Neurology and Neuroscience, HMS
Speakers:
Kapil Bharti, PhD
  • Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH
Joe Burns, PhD
  • VP, Head of Biology, Decibel Therapeutics
Erin Kimbrel, PhD
  • Executive Director, Regenerative Medicine, Astellas
Nabiha Saklayen, PhD
  • CEO and Co-Founder, Cellino
  • Q&A

    9:30 AM – 9:45 AM
     
9:25 AM – 9:35 AM

 

FIRST LOOK

Stem Cells

 
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
  • Q&A

    9:35 AM – 9:55 AM
     
9:35 AM – 10:00 AM

Capital Formation ’21-30 | Investing Modes Driving GCT Technology and Timing

The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players?  Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged?  Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?

Moderator:
Roger Kitterman
  • VP, Venture, Mass General Brigham
Speakers:
Ellen Hukkelhoven, PhD
  • Managing Director, Perceptive Advisors
Peter Kolchinsky, PhD
  • Founder and Managing Partner, RA Capital Management
Deep Nishar
  • Senior Managing Partner, SoftBank Investment Advisors
Oleg Nodelman
  • Founder & Managing Partner, EcoR1 Capital
  • Q&A

    10:05 AM – 10:20 AM
     
10:00 AM – 10:10 AM

 

FIRST LOOK
10:10 AM – 10:35 AM

 

HOT TOPICS

Neurodegenerative Clinical Outcomes | Achieving GCT Success

Can stem cell-based platforms become successful treatments for neurodegenerative diseases?

  •  What are the commonalities driving GCT success in neurodegenerative disease and non-neurologic disease, what are the key differences?
  • Overcoming treatment administration challenges
  • GCT impact on degenerative stage of disease
  • How difficult will it be to titrate the size of the cell therapy effect in different neurological disorders and for different patients?
  • Demonstrating clinical value to patients and payers
  • Revised clinical trial models to address issues and concerns specific to GCT
Moderator:
Bob Carter, MD, PhD
  • Chairman, Department of Neurosurgery, MGH
  • William and Elizabeth Sweet, Professor of Neurosurgery, HMS
Speakers:
Erwan Bezard, PhD
  • INSERM Research Director, Institute of Neurodegenerative Diseases
Nikola Kojic, PhD
  • CEO and Co-Founder, Oryon Cell Therapies
Geoff MacKay
  • President & CEO, AVROBIO
Viviane Tabar, MD
  • Founding Investigator, BlueRock Therapeutics
  • Chair of Neurosurgery, Memorial Sloan Kettering
  • Q&A

    10:40 AM – 10:55 AM
     
10:35 AM – 11:35 AM

Disruptive Dozen: 12 Technologies that Will Reinvent GCT

Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.

11:35 AM – 11:45 AM

Concluding Remarks

The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.

ALL THE TWEETS PRODUCED ON MAY 21, 2021 INCLUDE THE FOLLOWING:

 

Aviva Lev-Ari

@AVIVA1950

 

  • @AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Erwan Bezard, PhD INSERM Research Director, Institute of Neurodegenerative Diseases Cautious on reversal

@pharma_BI

@AVIVA1950

 

Aviva Lev-Ari

@AVIVA1950

 

  • @AVIVA1950_PIcs

4h

#WMIF2021

@MGBInnovation

Nikola Kojic, PhD CEO and Co-Founder, Oryon Cell Therapies Autologus cell therapy placed focal replacing missing synapses reestablishment of neural circutary

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

4h

#WMIF2021

@MGBInnovation

Bob Carter, MD, PhD Chairman, Department of Neurosurgery, MGH William and Elizabeth Sweet, Professor of Neurosurgery, HMS Neurogeneration REVERSAL or slowing down? 

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

4h

#WMIF2021

@MGBInnovation

Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS efficacy Autologous cell therapy transplantation approach program T cells into dopamine genetating cells greater than Allogeneic cell transplantation 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

 

Aviva Lev-Ari

@AVIVA1950

 

  •  

4h

#WMIF2021

@MGBInnovation

Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS Pharmacologic agent in existing cause another disorders locomo-movement related 

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

  •  

4h

#WMIF2021

@MGBInnovation

Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT Multi OMICS and academia originated innovations are the most attractive areas

@pharma_BI

@AVIVA1950

1

3

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

  •  

4h

#WMIF2021

@MGBInnovation

Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT 

@pharma_BI

@AVIVA1950

1

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

4h

#WMIF2021

@MGBInnovation

Oleg Nodelman Founder & Managing Partner, EcoR1 Capital Invest in company next round of investment will be IPO 20% discount

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

  •  

4h

#WMIF2021

@MGBInnovation

Peter Kolchinsky, PhD Founder and Managing Partner, RA Capital Management Future proof for new comers disruptors  Ex Vivo gene therapy to improve funding products what tool kit belongs to 

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

4h

#WMIF2021

@MGBInnovation

Deep Nishar Senior Managing Partner, SoftBank Investment Advisors Young field vs CGT started in the 80s  high payloads is a challenge 

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

 

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Bob Carter, MD, PhD MGH, HMS cells producing dopamine transplantation fibroblast cells metabolic driven process lower mutation burden  Quercetin inhibition elimination undifferentiated cells graft survival oxygenation increased 

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Chairman, Department of Neurosurgery, MGH, Professor of Neurosurgery, HMS Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamine skin cell to become autologous cells reprogramed  

@pharma_BI

@AVIVA1950

 

#WMIF2021

@MGBInnovation

Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH Off-th-shelf one time treatment becoming cure  Intact tissue in a dish is fragile to maintain metabolism to become like semiconductors

@pharma_BI

@AVIVA1950

@AVIVA1950_PIcs

 

Aviva Lev-Ari

@AVIVA1950

@AVIVA1950_PIcs

  •  

5h

#WMIF2021

@MGBInnovation

Ole Isacson, MD, PhD Director, Neuroregeneration Research Institute, McLean Professor, Neurology and Neuroscience, MGH, HMS Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Erin Kimbrel, PhD Executive Director, Regenerative Medicine, Astellas In the ocular space immunogenecity regulatory communication use gene editing for immunogenecity Cas1 and Cas2 autologous cells

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Nabiha Saklayen, PhD CEO and Co-Founder, Cellino scale production of autologous cells foundry using semiconductor process in building cassettes by optic physicists

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Joe Burns, PhD VP, Head of Biology, Decibel Therapeutics Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation control by genomics

@pharma_BI

@AVIVA1950

 

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH first drug required to establish the process for that innovations design of animal studies not done before 

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Meredith Fisher, PhD Partner, Mass General Brigham Innovation Fund Strategies, success what changes are needed in the drug discovery process@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization

@pharma_BI

@AVIVA1950

1

@AVIVA1950_PIcs

 

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

Kush Parmar, MD, PhD Managing Partner, 5AM Ventures Responsibility mismatch should be and what is “are”

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

5h

#WMIF2021

@MGBInnovation

David Berry, MD, PhD CEO, Valo Health GP, Flagship Pioneering Bring disruptive frontier platform reliable delivery CGT double knockout disease cure all change efficiency scope human centric vs mice centered right scale acceleration

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

6h

#WMIF2021

@MGBInnovation

Kush Parmar, MD, PhD Managing Partner, 5AM Ventures build it yourself, benefit for patients FIrst Look at MGB shows MEE innovation on inner ear worthy investment  

@pharma_BI

@AVIVA1950

 

@AVIVA1950_PIcs

Aviva Lev-Ari

@AVIVA1950

 

  •  

6h

#WMIF2021

@MGBInnovation

Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Frustration with supply chain during the Pandemic, GMC anticipation in advance CGT rapidly prototype rethink and invest proactive investor .edu and Pharma

@pharma_BI

@AVIVA1950

 

 

Read Full Post »


Inhibitory CD161 receptor recognized as a potential immunotherapy target in glioma-infiltrating T cells by single-cell analysis

Reporter: Dr. Premalata Pati, Ph.D., Postdoc

 

Brain tumors, especially the diffused Gliomas are of the most devastating forms of cancer and have so-far been resistant to immunotherapy. It is comprehended that T cells can penetrate the glioma cells, but it still remains unknown why infiltrating cells miscarry to mount a resistant reaction or stop the tumor development.

Gliomas are brain tumors that begin from neuroglial begetter cells. The conventional therapeutic methods including, surgery, chemotherapy, and radiotherapy, have accomplished restricted changes inside glioma patients. Immunotherapy, a compliance in cancer treatment, has introduced a promising strategy with the capacity to penetrate the blood-brain barrier. This has been recognized since the spearheading revelation of lymphatics within the central nervous system. Glioma is not generally carcinogenic. As observed in a number of cases, the tumor cells viably reproduce and assault the adjoining tissues, by and large, gliomas are malignant in nature and tend to metastasize. There are four grades in glioma, and each grade has distinctive cell features and different treatment strategies. Glioblastoma is a grade IV glioma, which is the crucial aggravated form. This infers that all glioblastomas are gliomas, however, not all gliomas are glioblastomas.

Decades of investigations on infiltrating gliomas still take off vital questions with respect to the etiology, cellular lineage, and function of various cell types inside glial malignancies. In spite of the available treatment options such as surgical resection, radiotherapy, and chemotherapy, the average survival rate for high-grade glioma patients remains 1–3 years (1).

A recent in vitro study performed by the researchers of Dana-Farber Cancer Institute, Massachusetts General Hospital, and the Broad Institute of MIT and Harvard, USA, has recognized that CD161 is identified as a potential new target for immunotherapy of malignant brain tumors. The scientific team depicted their work in the Cell Journal, in a paper entitled, “Inhibitory CD161 receptor recognized in glioma-infiltrating T cells by single-cell analysis.” on 15th February 2021.

To further expand their research and findings, Dr. Kai Wucherpfennig, MD, PhD, Chief of the Center for Cancer Immunotherapy, at Dana-Farber stated that their research is additionally important in a number of other major human cancer types such as 

  • melanoma,
  • lung,
  • colon, and
  • liver cancer.

Dr. Wucherpfennig has praised the other authors of the report Mario Suva, MD, PhD, of Massachusetts Common Clinic; Aviv Regev, PhD, of the Klarman Cell Observatory at Broad Institute of MIT and Harvard, and David Reardon, MD, clinical executive of the Center for Neuro-Oncology at Dana-Farber.

Hence, this new study elaborates the effectiveness of the potential effectors of anti-tumor immunity in subsets of T cells that co-express cytotoxic programs and several natural killer (NK) cell genes.

The Study-

IMAGE SOURCE: Experimental Strategy (Mathewson et al., 2021)

 

The group utilized single-cell RNA sequencing (RNA-seq) to mull over gene expression and the clonal picture of tumor-infiltrating T cells. It involved the participation of 31 patients suffering from diffused gliomas and glioblastoma. Their work illustrated that the ligand molecule CLEC2D activates CD161, which is an immune cell surface receptor that restrains the development of cancer combating activity of immune T cells and tumor cells in the brain. The study reveals that the activation of CD161 weakens the T cell response against tumor cells.

Based on the study, the facts suggest that the analysis of clonally expanded tumor-infiltrating T cells further identifies the NK gene KLRB1 that codes for CD161 as a candidate inhibitory receptor. This was followed by the use of 

  • CRISPR/Cas9 gene-editing technology to inactivate the KLRB1 gene in T cells and showed that CD161 inhibits the tumor cell-killing function of T cells. Accordingly,
  • genetic inactivation of KLRB1 or
  • antibody-mediated CD161 blockade

enhances T cell-mediated killing of glioma cells in vitro and their anti-tumor function in vivo. KLRB1 and its associated transcriptional program are also expressed by substantial T cell populations in other forms of human cancers. The work provides an atlas of T cells in gliomas and highlights CD161 and other NK cell receptors as immune checkpoint targets.

Further, it has been identified that many cancer patients are being treated with immunotherapy drugs that disable their “immune checkpoints” and their molecular brakes are exploited by the cancer cells to suppress the body’s defensive response induced by T cells against tumors. Disabling these checkpoints lead the immune system to attack the cancer cells. One of the most frequently targeted checkpoints is PD-1. However, recent trials of drugs that target PD-1 in glioblastomas have failed to benefit the patients.

In the current study, the researchers found that fewer T cells from gliomas contained PD-1 than CD161. As a result, they said, “CD161 may represent an attractive target, as it is a cell surface molecule expressed by both CD8 and CD4 T cell subsets [the two types of T cells engaged in response against tumor cells] and a larger fraction of T cells express CD161 than the PD-1 protein.”

However, potential side effects of antibody-mediated blockade of the CLEC2D-CD161 pathway remain unknown and will need to be examined in a non-human primate model. The group hopes to use this finding in their future work by

utilizing their outline by expression of KLRB1 gene in tumor-infiltrating T cells in diffuse gliomas to make a remarkable contribution in therapeutics related to immunosuppression in brain tumors along with four other common human cancers ( Viz. melanoma, non-small cell lung cancer (NSCLC), hepatocellular carcinoma, and colorectal cancer) and how this may be manipulated for prevalent survival of the patients.

References

(1) Anders I. Persson, QiWen Fan, Joanna J. Phillips, William A. Weiss, 39 – Glioma, Editor(s): Sid Gilman, Neurobiology of Disease, Academic Press, 2007, Pages 433-444, ISBN 9780120885923, https://doi.org/10.1016/B978-012088592-3/50041-4.

Main Source

Mathewson ND, Ashenberg O, Tirosh I, Gritsch S, Perez EM, Marx S, et al. 2021. Inhibitory CD161 receptor identified in glioma-infiltrating T cells by single-cell analysis. Cell.https://www.cell.com/cell/fulltext/S0092-8674(21)00065-9?elqTrackId=c3dd8ff1d51f4aea87edd0153b4f2dc7

Related Articles

VIDEOS on Cancer Biology, Cancer Genetics, Cancer Immunotherapy

19th Annual Koch Institute Summer Symposium on Cancer Immunotherapy, June 12, 2020 at MIT’s Kresge Auditorium

 

Other related articles published in this Open Access Online Scientific Journal include the following:

 

Single Cell Sequencing:

Part 4.1 in Genomics Volume 2

Latest in Genomics Methodologies for Therapeutics: Gene Editing, NGS & BioInformatics, Simulations and the Genome Ontology 

On Amazon.com since 12/28/2019

https://www.amazon.com/dp/B08385KF87

 

4.1.3   Single-cell Genomics: Directions in Computational and Systems Biology – Contributions of Prof. Aviv Regev @Broad Institute of MIT and Harvard, Cochair, the Human Cell Atlas Organizing Committee with Sarah Teichmann of the Wellcome Trust Sanger Institute

Curator: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2018/09/03/single-cell-genomics-directions-in-computational-and-systems-biology-contributions-of-ms-aviv-regev-phd-broad-institute-of-mit-and-harvard-cochair-the-human-cell-atlas-organizing-committee-wit/

 

4.1.4   Cellular Genetics

https://www.sanger.ac.uk/science/programmes/cellular-genetics

 

4.1.5   Cellular Genomics

https://www.garvan.org.au/research/cellular-genomics

 

4.1.6   SINGLE CELL GENOMICS 2019 – sometimes the sum of the parts is greater than the whole, September 24-26, 2019, Djurönäset, Stockholm, Sweden http://www.weizmann.ac.il/conferences/SCG2019/single-cell-genomics-2019

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2019/05/29/single-cell-genomics-2019-september-24-26-2019-djuronaset-stockholm-sweden/

 

4.1.7   Norwich Single-Cell Symposium 2019, Earlham Institute, single-cell genomics technologies and their application in microbial, plant, animal and human health and disease, October 16-17, 2019, 10AM-5PM

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2019/06/04/norwich-single-cell-symposium-2019-earlham-institute-single-cell-genomics-technologies-and-their-application-in-microbial-plant-animal-and-human-health-and-disease-october-16-17-2019-10am-5pm/

 

4.1.8   Newly Found Functions of B Cell

Reporter and Curator: Dr. Sudipta Saha, Ph.D.

https://pharmaceuticalintelligence.com/2019/05/23/newly-found-functions-of-b-cell/

 

4.1.9 RESEARCH HIGHLIGHTS: HUMAN CELL ATLAS

https://www.broadinstitute.org/research-highlights-human-cell-atlas

 

CRISPR – 200 articles in the Journal

 

Chapter 21 in Genomics Volume 1

Genomics Orientations for Personalized Medicine. On Amazon.com since 11/23/2015

http://www.amazon.com/dp/B018DHBUO6

 

Glioblastoma – 150 articles in the Journal

Most recent

 

Immunotherapy may help in glioblastoma survival

Reporter and Curator: Dr. Sudipta Saha, Ph.D.

https://pharmaceuticalintelligence.com/2019/03/16/immunotherapy-may-help-in-glioblastoma-survival/

 

New Treatment in Development for Glioblastoma: Hopes for Sen. John McCain

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2017/07/25/new-treatment-in-development-for-glioblastoma-hopes-for-sen-john-mccain/

 

Funding Oncorus’s Immunotherapy Platform: Next-generation Oncolytic Herpes Simplex Virus (oHSV) for Brain Cancer, Glioblastoma Multiforme (GBM)

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2016/12/28/funding-oncoruss-immunotherapy-platform-next-generation-oncolytic-herpes-simplex-virus-ohsv-for-brain-cancer-glioblastoma-multiforme-gbm/

 

Glioma, Glioblastoma and Neurooncology

Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2015/10/19/glioma-glioblastoma-and-neurooncology/

 

Positron Emission Tomography (PET) and Near-Infrared Fluorescence Imaging:  Noninvasive Imaging of Cancer Stem Cells (CSCs)  monitoring of AC133+ glioblastoma in subcutaneous and intracerebral xenograft tumors

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2014/01/29/positron-emission-tomography-pet-and-near-infrared-fluorescence-imaging-noninvasive-imaging-of-cancer-stem-cells-cscs-monitoring-of-ac133-glioblastoma-in-subcutaneous-and-intracerebral-xenogra/

 

Gamma Linolenic Acid (GLA) as a Therapeutic tool in the Management of Glioblastoma

Eric Fine* (1), Mike Briggs* (1,2), Raphael Nir# (1,2,3)

https://pharmaceuticalintelligence.com/2013/07/15/gamma-linolenic-acid-gla-as-a-therapeutic-tool-in-the-management-of-glioblastoma/

 

 

Read Full Post »


Dysregulation of ncRNAs in association with Neurodegenerative Disorders

Curator: Amandeep Kaur

Research over the years has added evidences to the hypothesis of “RNA world” which explains the evolution of DNA and protein from a simple RNA molecule. Our understanding of RNA biology has dramatically changed over the last 50 years and rendered the scientists with the conclusion that apart from coding for protein synthesis, RNA also plays an important role in regulation of gene expression.

Figure: Overall Taxonomy of ncRNAs
Figure: Overall Taxonomy of ncRNAs
https://www.nature.com/articles/s42256-019-0051-2

The universe of non-coding RNAs (ncRNAs) is transcending the margins of preconception and altered the traditional thought that the coding RNAs or messenger RNAs (mRNAs) are more prevalent in our cells. Research on the potential use of ncRNAs in therapeutic relevance increased greatly after the discovery of RNA interference (RNAi) and provided important insights into our further understanding of etiology of complex disorders.

Figure: Atomic Structure of Non-coding RNA
https://en.wikipedia.org/wiki/Non-coding_RNA

Latest research on neurodegenerative disorders has shown the perturbed expression of ncRNAs which provides the functional association between neurodegeneration and ncRNAs dysfunction. Due to the diversity of functions and abundance of ncRNAs, they are classified into Housekeeping RNAs and Regulatory ncRNAs.

The best known classes of ncRNAs are the microRNAs (miRNAs) which are extensively studied and are of research focus. miRNAs are present in both intronic and exonic regions of matured RNA (mRNA) and are crucial for development of CNS. The reduction of Dicer-1, a miRNA biogenesis-related protein affects neural development and the elimination of Dicer in specifically dopaminergic neurons causes progressive degeneration of these neuronal cells in striatum of mice.

A new class of regulatory ncRNAs, tRNAs-derived fragments (tRFs) is superabundantly present in brain cells. tRFs are considered as risk factors in conditions of neural degeneration because of accumulation with aging. tRFs have heterogenous functions with regulation of gene expression at multiple layers including regulation of mRNA processing and translation, inducing the activity of silencing of target genes, controlling cell growth and differentiation processes.

The existence of long non-coding RNAs (lncRNAs) was comfirmed by the ENCODE project. Numerous studies reported that approximately 40% of lncRNAs are involved in gene expression, imprinting and pluripotency regulation in the CNS. lncRNA H19 is of paramount significance in neural viability and contribute in epilepsy condition by activating glial cells. Other lncRNAs are highly bountiful in neurons including Evf2 and MALAT1 which play important function in regulating neural differentiation and synapse formation and development of dendritic cells respectively.

Recently, a review article in Nature mentioned about the complex mechanisms of ncRNAs contributing to neurodegenerative conditions. The ncRNA-mediated mechanisms of regulation are as follows:

  • Epigenetic regulation: Various lncRNAs such as BDNF-AS, TUG1, MEG3, NEAT1 and TUNA are differentially expressed in brain tissue and act as epigenetic regulators.
  • RNAi: RNA interference includes post-transcriptional repression by small-interfering RNAs (siRNAs) and binding of miRNAs to target genes. In a wide spectrum of neurodegenerative diseases such as Alzheimer’s disease, Parkinson disease, Huntington’s disease, Amyotrophic lateral sclerosis, Fragile X syndrome, Frontotemporal dementia, and Spinocerebellar ataxia, have shown perturbed expression of miRNA.
  • Alternative splicing: Variation in splicing of transcripts of ncRNAs has shown adverse affects in neuropathology of degenerative diseases.
  • mRNA stability: The stability of mRNA may be affected by RNA-RNA duplex formation which leads to the degradation of sense mRNA or blocking the access to proteins involved in RNA turnover and modify the progression of neurodegenerative disorders.
  • Translational regulation: Numerous ncRNAs including BC200 directly control the translational process of transcripts of mRNAs and effect human brain of Alzheimer’s disease.
  • Molecular decoys: Non-coding RNAs (ncRNAs) dilute the expression of other RNAs by molecular trapping, also known as competing endogenous RNAs (ceRNAs) which hinder the normal functioning of RNAs. The ceRNAs proportion must be equivalent to the number of target miRNAs that can be sequestered by each ncRNAs in order to induce consequential de-repression of the target molecules.
Table: ncRNAs and related processes involved in neurodegenerative disorders
https://www.nature.com/articles/nrn.2017.90

The unknown functions of numerous annotated ncRNAs may explain the underlying complexity in neurodegenerative disorders. The profiling of ncRNAs of patients suffering from neurodevelopmental and neurodegenerative conditions are required to outline the changes in ncRNAs and their role in specific regions of brain and cells. Analysis of Large-scale gene expression and functional studies of ncRNAs may contribute to our understanding of these diseases and their remarkable connections. Therefore, targeting ncRNAs may provide effective therapeutic perspective for the treatment of neurodegenerative diseases.

References https://www.nature.com/scitable/topicpage/rna-functions-352/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6035743/ https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7695195/ https://link.springer.com/article/10.1007/s13670-012-0023-4 https://www.nature.com/articles/nrn.2017.90

 

Other related articles were published in this Open Access Online Scientific Journal, including the following:

RNA in synthetic biology

Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2016/03/26/rna-in-synthetic-biology/

mRNA Data Survival Analysis

Curators: Larry H. Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2016/06/18/mrna-data-survival-analysis/

Recent progress in neurodegenerative diseases and gliomas

Curator: Larry H. Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2016/05/28/recent-progress-in-neurodegenerative-diseases-and-gliomas/

Genomic Promise for Neurodegenerative Diseases, Dementias, Autism Spectrum, Schizophrenia, and Serious Depression

Reporter and writer: Larry H Bernstein, MD, FCAP

https://pharmaceuticalintelligence.com/2013/02/19/genomic-promise-for-neurodegenerative-diseases-dementias-autism-spectrum-schizophrenia-and-serious-depression/

Read Full Post »


 

Nanoparticles can turn off genes in bone marrow cells

Reporter : Irina Robu, PhD

MIT engineers developed an alternative to turn off specific genes which play a vital role in producing blood cells of the bone marrow using specialized nanoparticles. These nanoparticles can be made-to-order to treat heart disease or increase the yield of stem cells in patience who need stem cell transplants. The particles are coated with lipids that help stabilize them, and they can target organs such as the lungs, heart, and spleen, depending on the particles’ composition and molecular weight. This genetic therapy, also known as RNA interference is difficult to target organs other than the liver, where most of the nanoparticles tend to collect.

RNA interference is an approach that could theoretically be used to treat a variety of diseases by delivering short strands of RNA that block specific genes from being turned on in a cell. Yet, the main obstacle to this kind of therapy has been  delivering it to the right part of the body. When injected into the bloodstream, nanoparticles carrying RNA tend to accrue in the liver, which various biotech companies have taken advantage of to develop new experimental treatments for liver disease.

In their recent study, scientists set out to adapt the nanoparticles so that they could reach the bone marrow which contains stem cells that produce different types of blood cells. Stimulating the process , they could enhance the yield of hematopoietic stem cells for stem cell transplantation and they created variants that have different arrangements of surface coating, polyethylene glycol. They were able to test 15 particles and determined one that was able to avoid being caught in the liver or the lungs, and that could effectively accumulate in endothelial cells of the bone marrow. They also showed that RNA carried by this particle could reduce the expression of a target gene by up to 80 percent.

The scientists then tested this approach with two genes. The first gene, SDF1 is a molecule that normally prevents hematopoietic stem cells from leaving the bone marrow. They realized that turning off the SDF1 gene could have the same effect as the drugs that are being used to induce hematopoietic stem cell release in patients who need undergo radiation treatments for blood cancers. These stem cells are later transplanted to repopulate the patient’s blood cells. By knocking down SDF1, they could boost the release of hematopoietic cells fivefold which is comparable to the levels achieved by the drugs that are now used to enhance stem cell release.

The second gene researchers use is MCP1, a molecule that plays a key role in heart disease.  They realized that when MCP1 is released by bone marrow cells after a heart attack, it stimulates a flood of immune cells to leave the bone marrow and travel to the heart. Researchers realize that by delivering RNA that targets MCP1 reduced the number of immune cells that went to the heart after a heart attack.

Using these new particles, researchers hypothesized that they could further develop treatments for heart disease and other conditions.

SOURCE

https://news.mit.edu/2020/nanoparticles-bone-marrow-rnai-1005

Read Full Post »


RNA from the SARS-CoV-2 virus taking over the cells it infects: Virulence – Pathogen’s ability to infect a Resistant Host: The Imbalance between Controlling Virus Replication versus Activation of the Adaptive Immune Response

Curator: Aviva Lev-Ari, PhD, RN – I added colors and bold face

 

UPDATED on 9/8/2020

What bats can teach us about developing immunity to Covid-19 | Free to read

Clive Cookson, Anna Gross and Ian Bott, London

https://www.ft.com/content/743ce7a0-60eb-482d-b1f4-d4de11182fa9?utm_source=Nature+Briefing&utm_campaign=af64422080-briefing-dy-20200908&utm_medium=email&utm_term=0_c9dfd39373-af64422080-43323101

 

UPDATED on 6/29/2020

Another duality and paradox in the Treatment of COVID-19 Patients in ICUs was expressed by Mike Yoffe, MD, PhD, David H. Koch Professor of Biology and Biological Engineering, Massachusetts Institute of Technology. Dr. Yaffe has a joint appointment in Acute Care Surgery, Trauma, and Surgical Critical Care, and in Surgical Oncology @BIDMC

on 6/29 at SOLUTIONS with/in/sight at Koch Institute @MIT

How Are Cancer Researchers Fighting COVID-19? (Part II)” Jun 29, 2020 11:30 AM EST

Mike Yoffe, MD, PhD 

In COVID-19 patients: two life threatening conditions are seen in ICUs:

  • Blood Clotting – Hypercoagulability or Thrombophilia
  • Cytokine Storm – immuno-inflammatory response
  • The coexistence of 1 and 2 – HINDERS the ability to use effectively tPA as an anti-clotting agent while the cytokine storm is present.

Mike Yoffe’s related domain of expertise:

Signaling pathways and networks that control cytokine responses and inflammation

Misregulation of cytokine feedback loops, along with inappropriate activation of the blood clotting cascade causes dysregulation of cell signaling pathways in innate immune cells (neutrophils and macrophages), resulting in tissue damage and multiple organ failure following trauma or sepsis. Our research is focused on understanding the role of the p38-MK2 pathway in cytokine control and innate immune function, and on cross-talk between cytokines, clotting factors, and neutrophil NADPH oxidase-derived ROS in tissue damage, coagulopathy, and inflammation, using biochemistry, cell biology, and mouse knock-out/knock-in models.  We recently discovered a particularly important link between abnormal blood clotting and the complement pathway cytokine C5a which causes excessive production of extracellular ROS and organ damage by neutrophils after traumatic injury.

SOURCE

https://www.bidmc.org/research/research-by-department/surgery/acute-care-surgery-trauma-and-surgical-critical-care/michael-b-yaffe

 

See

The Genome Structure of CORONAVIRUS, SARS-CoV-2

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2020/05/04/the-genome-structure-of-coronavirus-sars-cov-2-i-awaited-for-this-article-for-60-days/

 

Imbalanced Host Response to SARS-CoV-2 Drives Development of COVID-19

Open Access Published:May 15, 2020DOI:https://doi.org/10.1016/j.cell.2020.04.026

Highlights

  • SARS-CoV-2 infection induces low IFN-I and -III levels with a moderate ISG response
  • Strong chemokine expression is consistent across in vitroex vivo, and in vivo models
  • Low innate antiviral defenses and high pro-inflammatory cues contribute to COVID-19

Summary

Viral pandemics, such as the one caused by SARS-CoV-2, pose an imminent threat to humanity. Because of its recent emergence, there is a paucity of information regarding viral behavior and host response following SARS-CoV-2 infection. Here we offer an in-depth analysis of the transcriptional response to SARS-CoV-2 compared with other respiratory viruses. Cell and animal models of SARS-CoV-2 infection, in addition to transcriptional and serum profiling of COVID-19 patients, consistently revealed a unique and inappropriate inflammatory response. This response is defined by low levels of type I and III interferons juxtaposed to elevated chemokines and high expression of IL-6. We propose that reduced innate antiviral defenses coupled with exuberant inflammatory cytokine production are the defining and driving features of COVID-19.

Graphical Abstract

Keywords

Results

Defining the Transcriptional Response to SARS-CoV-2 Relative to Other Respiratory Viruses

To compare the transcriptional response of SARS-CoV-2 with other respiratory viruses, including MERS-CoV, SARS-CoV-1, human parainfluenza virus 3 (HPIV3), respiratory syncytial virus (RSV), and IAV, we first chose to focus on infection in a variety of respiratory cell lines (Figure 1). To this end, we collected poly(A) RNA from infected cells and performed RNA sequencing (RNA-seq) to estimate viral load. These data show that virus infection levels ranged from 0.1% to more than 50% of total RNA reads (Figure 1A).

Discussion

In the present study, we focus on defining the host response to SARS-CoV-2 and other human respiratory viruses in cell lines, primary cell cultures, ferrets, and COVID-19 patients. In general, our data show that the overall transcriptional footprint of SARS-CoV-2 infection was distinct in comparison with other highly pathogenic coronaviruses and common respiratory viruses such as IAV, HPIV3, and RSV. It is noteworthy that, despite a reduced IFN-I and -III response to SARS-CoV-2, we observed a consistent chemokine signature. One exception to this observation is the response to high-MOI infection in A549-ACE2 and Calu-3 cells, where replication was robust and an IFN-I and -III signature could be observed. In both of these examples, cells were infected at a rate to theoretically deliver two functional virions per cell in addition to any defective interfering particles within the virus stock that were not accounted for by plaque assays. Under these conditions, the threshold for PAMP may be achieved prior to the ability of the virus to evade detection through production of a viral antagonist. Alternatively, addition of multiple genomes to a single cell may disrupt the stoichiometry of viral components, which, in turn, may itself generate PAMPs that would not form otherwise. These ideas are supported by the fact that, at a low-MOI infection in A549-ACE2 cells, high levels of replication could also be achieved, but in the absence of IFN-I and -III induction. Taken together, these data suggest that, at low MOIs, the virus is not a strong inducer of the IFN-I and -III system, as opposed to conditions where the MOI is high.
Taken together, the data presented here suggest that the response to SARS-CoV-2 is imbalanced with regard to controlling virus replication versus activation of the adaptive immune response. Given this dynamic, treatments for COVID-19 have less to do with the IFN response and more to do with controlling inflammation. Because our data suggest that numerous chemokines and ILs are elevated in COVID-19 patients, future efforts should focus on U.S. Food and Drug Administration (FDA)-approved drugs that can be rapidly deployed and have immunomodulating properties.

SOURCE

https://www.cell.com/cell/fulltext/S0092-8674(20)30489-X

SARS-CoV-2 ORF3b is a potent interferon antagonist whose activity is further increased by a naturally occurring elongation variant

Yoriyuki KonnoIzumi KimuraKeiya UriuMasaya FukushiTakashi IrieYoshio KoyanagiSo NakagawaKei Sato

Abstract

One of the features distinguishing SARS-CoV-2 from its more pathogenic counterpart SARS-CoV is the presence of premature stop codons in its ORF3b gene. Here, we show that SARS-CoV-2 ORF3b is a potent interferon antagonist, suppressing the induction of type I interferon more efficiently than its SARS-CoV ortholog. Phylogenetic analyses and functional assays revealed that SARS-CoV-2-related viruses from bats and pangolins also encode truncated ORF3b gene products with strong anti-interferon activity. Furthermore, analyses of more than 15,000 SARS-CoV-2 sequences identified a natural variant, in which a longer ORF3b reading frame was reconstituted. This variant was isolated from two patients with severe disease and further increased the ability of ORF3b to suppress interferon induction. Thus, our findings not only help to explain the poor interferon response in COVID-19 patients, but also describe a possibility of the emergence of natural SARS-CoV-2 quasi-species with extended ORF3b that may exacerbate COVID-19 symptoms.

Highlights

  • ORF3b of SARS-CoV-2 and related bat and pangolin viruses is a potent IFN antagonist

  • SARS-CoV-2 ORF3b suppresses IFN induction more efficiently than SARS-CoV ortholog

  • The anti-IFN activity of ORF3b depends on the length of its C-terminus

  • An ORF3b with increased IFN antagonism was isolated from two severe COVID-19 cases

Competing Interest Statement

The authors have declared no competing interest.

Paper in collection COVID-19 SARS-CoV-2 preprints from medRxiv and bioRxiv

 

SOURCE

https://www.biorxiv.org/content/10.1101/2020.05.11.088179v1

 

 

A deep dive into how the new coronavirus infects cells has found that it orchestrates a hostile takeover of their genes unlike any other known viruses do, producing what one leading scientist calls “unique” and “aberrant” changes.Recent studies show that in seizing control of genes in the human cells it invades, the virus changes how segments of DNA are read, doing so in a way that might explain why the elderly are more likely to die of Covid-19 and why antiviral drugs might not only save sick patients’ lives but also prevent severe disease if taken before infection.“It’s something I have never seen in my 20 years of” studying viruses, said virologist Benjamin tenOever of the Icahn School of Medicine at Mount Sinai, referring to how SARS-CoV-2, the virus that causes Covid-19, hijacks cells’ genomes.The “something” he and his colleagues saw is how SARS-CoV-2 blocks one virus-fighting set of genes but allows another set to launch, a pattern never seen with other viruses. Influenza and the original SARS virus (in the early 2000s), for instance, interfere with both arms of the body’s immune response — what tenOever dubs “call to arms” genes and “call for reinforcement” genes.The first group of genes produces interferons. These proteins, which infected cells release, are biological semaphores, signaling to neighboring cells to activate some 500 of their own genes that will slow down the virus’ ability to make millions of copies of itself if it invades them. This lasts seven to 10 days, tenOever said, controlling virus replication and thereby buying time for the second group of genes to act.This second set of genes produce their own secreted proteins, called chemokines, that emit a biochemical “come here!” alarm. When far-flung antibody-making B cells and virus-killing T cells sense the alarm, they race to its source. If all goes well, the first set of genes holds the virus at bay long enough for the lethal professional killers to arrive and start eradicating viruses.

“Most other viruses interfere with some aspect of both the call to arms and the call for reinforcements,” tenOever said. “If they didn’t, no one would ever get a viral illness”: The one-two punch would pummel any incipient infection into submission.

SARS-CoV-2, however, uniquely blocks one cellular defense but activates the other, he and his colleagues reported in a study published last week in Cell. They studied healthy human lung cells growing in lab dishes, ferrets (which the virus infects easily), and lung cells from Covid-19 patients. In all three, they found that within three days of infection, the virus induces cells’ call-for-reinforcement genes to produce cytokines. But it blocks their call-to-arms genes — the interferons that dampen the virus’ replication.

The result is essentially no brakes on the virus’s replication, but a storm of inflammatory molecules in the lungs, which is what tenOever calls an “unique” and “aberrant” consequence of how SARS-CoV-2 manipulates the genome of its target.

In another new study, scientists in Japan last week identified how SARS-CoV-2 accomplishes that genetic manipulation. Its ORF3b gene produces a protein called a transcription factor that has “strong anti-interferon activity,” Kei Sato of the University of Tokyo and colleagues found — stronger than the original SARS virus or influenza viruses. The protein basically blocks the cell from recognizing that a virus is present, in a way that prevents interferon genes from being expressed.

In fact, the Icahn School team found no interferons in the lung cells of Covid-19 patients. Without interferons, tenOever said, “there is nothing to stop the virus from replicating and festering in the lungs forever.”

That causes lung cells to emit even more “call-for-reinforcement” genes, summoning more and more immune cells. Now the lungs have macrophages and neutrophils and other immune cells “everywhere,” tenOever said, causing such runaway inflammation “that you start having inflammation that induces more inflammation.”

At the same time, unchecked viral replication kills lung cells involved in oxygen exchange. “And suddenly you’re in the hospital in severe respiratory distress,” he said.

In elderly people, as well as those with diabetes, heart disease, and other underlying conditions, the call-to-arms part of the immune system is weaker than in younger, healthier people, even before the coronavirus arrives. That reduces even further the cells’ ability to knock down virus replication with interferons, and imbalances the immune system toward the dangerous inflammatory response.

The discovery that SARS-CoV-2 strongly suppresses infected cells’ production of interferons has raised an intriguing possibility: that taking interferons might prevent severe Covid-19 or even prevent it in the first place, said Vineet Menachery of the University of Texas Medical Branch.

In a study of human cells growing in lab dishes, described in a preprint (not peer-reviewed or published in a journal yet), he and his colleagues also found that SARS-CoV-2 “prevents the vast amount” of interferon genes from turning on. But when cells growing in lab dishes received the interferon IFN-1 before exposure to the coronavirus, “the virus has a difficult time replicating.”

After a few days, the amount of virus in infected but interferon-treated cells was 1,000- to 10,000-fold lower than in infected cells not pre-treated with interferon. (The original SARS virus, in contrast, is insensitive to interferon.)

Ending the pandemic and preventing its return is assumed to require an effective vaccine to prevent infectionand antiviral drugs such as remdesivir to treat the very sick, but the genetic studies suggest a third strategy: preventive drugs.

It’s possible that treatment with so-called type-1 interferon “could stop the virus before it could get established,” Menachery said.

Giving drugs to healthy people is always a dicey proposition, since all drugs have side effects — something considered less acceptable than when a drug is used to treat an illness. “Interferon treatment is rife with complications,” Menachery warned. The various interferons, which are prescribed for hepatitis, cancers, and many other diseases, can cause flu-like symptoms.

But the risk-benefit equation might shift, both for individuals and for society, if interferons or antivirals or other medications are shown to reduce the risk of developing serious Covid-19 or even make any infection nearly asymptomatic.

Interferon “would be warning the cells the virus is coming,” Menachery said, so such pretreatment might “allow treated cells to fend off the virus better and limit its spread.” Determining that will of course require clinical trials, which are underway.

Read Full Post »


The Genome Structure of CORONAVIRUS, SARS-CoV-2

“I awaited for this article for 60 days”

Aviva Lev-Ari, PhD, RN

Reporter: Aviva Lev-Ari, PhD, RN

 

UPDATED on 8/9/2020

 

The Genome Structure of CORONAVIRUS, SARS-CoV-2

Note:

  • The four letters of DNA are A, C, G and T.
  • In RNA molecules like the coronavirus genome, the T (thymine) is replaced with U (uracil).

Sources:

  • Fan Wu et al., Nature;
  • National Center for Biotechnology Information;
  • Dr. David Gordon, University of California, San Francisco;
  • Dr. Matthew B.   and Dr. Stuart Weston, University of Maryland School of Medicine;
  • Dr. Pleuni Pennings, San Francisco State University;
  • David Haussler and Jason Fernandes, U.C. Santa Cruz Genomics Institute; Journal of Virology;
  • Annual Review of Virology.

Model sources:

  • Coronavirus by Maria Voigt, RCSB Protein Data Bank headquartered at Rutgers University–New Brunswick;
  • Ribosome from Heena Khatter et al., Nature;
  • Proteins from Yang Zhang’s Research Group, University of Michigan.

Bad News Wrapped in Protein: Inside the Coronavirus Genome

A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.

In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.

Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.

A String of RNA

Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

The first sequence of RNA letters reads:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

This sequence recruits machinery inside the infected cell to read the RNA letters — acg and u — and translate them into coronavirus proteins.

The full coronavirus genome and the proteins it encodes are shown below.

A Chain of Proteins · ORF1ab

The first viral protein created inside the infected cell is actually a chain of 16 proteins joined together. Two of these proteins act like scissors, snipping the links between the different proteins and freeing them to do their jobs.

See graph at https://www.nytimes.com/interactive/2020/04/03/science/coronavirus-genome-bad-news-wrapped-in-protein.html

Research on other coronaviruses has given scientists a good understanding of what some of the SARS-CoV-2 proteins do. But other proteins are far more mysterious, and some might do nothing at all.

Cellular Saboteur · NSP1

This protein slows down the infected cell’s production of its own proteins. This sabotage forces the cell to make more virus proteins and prevents it from assembling antiviral proteins that could stop the virus.

auggagagccuugucccugguuucaacgagaaaacacacguccaacucaguuugccuguuuuacagguucgcgacgugcucguacguggcuuuggagacuccguggaggaggucuuaucagaggcacgucaacaucuuaaagauggcacuuguggcuuaguagaaguugaaaaaggcguuuugccucaacuugaacagcccuauguguucaucaaacguucggaugcucgaacugcaccucauggucauguuaugguugagcugguagcagaacucgaaggcauucaguacggucguaguggugagacacuugguguccuugucccucaugugggcgaaauaccaguggcuuaccgcaagguucuucuucguaagaacgguaauaaaggagcugguggccauaguuacggcgccgaucuaaagucauuugacuuaggcgacgagcuuggcacugauccuuaugaagauuuucaagaaaacuggaacacuaaacauagcagugguguuacccgugaacucaugcgugagcuuaacggaggg

Mystery Protein · NSP2

Scientists aren’t sure what NSP2 does. The other proteins it attaches to may offer some clues. Two of them help move molecule-filled bubbles called endosomes around the cell.

gcauacacucgcuaugucgauaacaacuucuguggcccugauggcuacccucuugagugcauuaaagaccuucuagcacgugcugguaaagcuucaugcacuuuguccgaacaacuggacuuuauugacacuaagagggguguauacugcugccgugaacaugagcaugaaauugcuugguacacggaacguucugaaaagagcuaugaauugcagacaccuuuugaaauuaaauuggcaaagaaauuugacaccuucaauggggaauguccaaauuuuguauuucccuuaaauuccauaaucaagacuauucaaccaaggguugaaaagaaaaagcuugauggcuuuauggguagaauucgaucugucuauccaguugcgucaccaaaugaaugcaaccaaaugugccuuucaacucucaugaagugugaucauuguggugaaacuucauggcagacgggcgauuuuguuaaagccacuugcgaauuuuguggcacugagaauuugacuaaagaaggugccacuacuugugguuacuuaccccaaaaugcuguuguuaaaauuuauuguccagcaugucacaauucagaaguaggaccugagcauagucuugccgaauaccauaaugaaucuggcuugaaaaccauucuucguaaggguggucgcacuauugccuuuggaggcuguguguucucuuauguugguugccauaacaagugugccuauuggguuccacgugcuagcgcuaacauagguuguaaccauacagguguuguuggagaagguuccgaaggucuuaaugacaaccuucuugaaauacuccaaaaagagaaagucaacaucaauauuguuggugacuuuaaacuuaaugaagagaucgccauuauuuuggcaucuuuuucugcuuccacaagugcuuuuguggaaacugugaaagguuuggauuauaaagcauucaaacaaauuguugaauccugugguaauuuuaaaguuacaaaaggaaaagcuaaaaaaggugccuggaauauuggugaacagaaaucaauacugaguccucuuuaugcauuugcaucagaggcugcucguguuguacgaucaauuuucucccgcacucuugaaacugcucaaaauucugugcguguuuuacagaaggccgcuauaacaauacuagauggaauuucacaguauucacugagacucauugaugcuaugauguucacaucugauuuggcuacuaacaaucuaguuguaauggccuacauuacaggugguguuguucaguugacuucgcaguggcuaacuaacaucuuuggcacuguuuaugaaaaacucaaacccguccuugauuggcuugaagagaaguuuaaggaagguguagaguuucuuagagacgguugggaaauuguuaaauuuaucucaaccugugcuugugaaauugucgguggacaaauugucaccugugcaaaggaaauuaaggagaguguucagacauucuuuaagcuuguaaauaaauuuuuggcuuugugugcugacucuaucauuauugguggagcuaaacuuaaagccuugaauuuaggugaaacauuugucacgcacucaaagggauuguacagaaaguguguuaaauccagagaagaaacuggccuacucaugccucuaaaagccccaaaagaaauuaucuucuuagagggagaaacacuucccacagaaguguuaacagaggaaguugucuugaaaacuggugauuuacaaccauuagaacaaccuacuagugaagcuguugaagcuccauugguugguacaccaguuuguauuaacgggcuuauguugcucgaaaucaaagacacagaaaaguacugugcccuugcaccuaauaugaugguaacaaacaauaccuucacacucaaaggcggu

Untagging and Cutting · NSP3

NSP3 is a large protein that has two important jobs. One is cutting loose other viral proteins so they can do their own tasks. It also alters many of the infected cell’s proteins.

Normally, a healthy cell tags old proteins for destruction. But the coronavirus can remove those tags, changing the balance of proteins and possibly reducing the cell’s ability to fight the virus.

gcaccaacaaagguuacuuuuggugaugacacugugauagaagugcaagguuacaagagugugaauaucacuuuugaacuugaugaaaggauugauaaaguacuuaaugagaagugcucugccuauacaguugaacucgguacagaaguaaaugaguucg