Feeds:
Posts
Comments

Posts Tagged ‘Biology’

Nitric Oxide Mitigates Sensitivity of Melanoma Cells to Cisplatin

Reporter/Curator: Stephen J. Williams, Ph.D.

Article ID #75: Nitric Oxide Mitigates Sensitivity of Melanoma Cells to Cisplatin. Published on 8/7/2013

WordCloud Image Produced by Adam Tubman

Screen Shot 2021-07-19 at 7.12.54 PM

Word Cloud By Danielle Smolyar

Picture of a human melanoma cell line growing in tissue culture

Cultured human melanocytes .

Nitric oxide (NO), a gas with many biological functions in healthy cells, has also been implicated in the development of pathologies such as cancer.  Nitric oxide may also play a role in chemotherapeutic reisitance. For example it had been known (in the 1996 Melanoma study by Joshi et al. curated below) that nitric oxide synthase activity (the enzyme system which produces NO) was significantly elevated in cultured melanoma cell lines versus normal melanocytes.   Although it is known that many protein and enzymes systems could be directly covalently-modified by nitric oxide, either by S-nitrosylation or NO-NAD+ modifications (one of my earlier postings described one such protein modified by nitric oxide, GAPDH, and the effect these NO-modifications of GAPDH has on the etiology of various pathologies.), the molecular mechanisms by which these modifications affect cellular processes, lead to disease etiology, the proteins which are affected, and mechanisms related to chemotherapeutic sensitivity need to be further characterized. A new study from MIT reveals how NO-induced modifications may reduce cisplatin sensitivity in melanoma cells.  This study focuses on how decreasing nitric oxide levels in melanoma cells increases their cisplatin sensitivity.  The study also describes a possible mechanism for this effect: NO-induced modifications of the proapoptotic enzyme caspace-3 and prolyl-hdroxylase-2 (responsible for targeting prosurvival HIF-1α for proteosomal degradation).  Also, for a description of other cancer-related targets of nitric oxide please see the posting by Dr. Saxena at Crucial role of Nitric Oxide in Cancer on this site.

To read more background on nitric oxide and its role in disease etiology please see our e-book Perspectives on Nitric Oxide in Disease Mechanisms (Biomed e-Books) available on Amazon at:

http://www.amazon.com/Perspectives-Nitric-Disease-Mechanisms-ebook/dp/B00DINFFYC

      It is important, however, to note that most of these relationships between NO-induced protein modification and its relationship to disease mechanisms are causal, meaning that, in general, one notices a nitric-induced modification of a protein/enzyme with concomitant alteration of protein/enzyme function occurring in a disease/phenotype.  However, unlike reversible modifications, which have a cadre of pharmacologic inhibitors, nitric oxide induced modifications are covalent and nonenzymatic, therefore hindering easy cause/effect relationships.

With that said, the following was adapted from the MIT site at http://web.mit.edu/newsoffice/2013/how-melanoma-evades-chemotherapy-0407.html.

  

 

The findings from Dr. Luiz Godoy’s PNAS paper ENDOGENOUSLY PRODUCED NITRIC OXIDE MITIGATES SENSITIVITY OF MELANOMA CELLS TO CISPLATIN,  were presented at the 2013 annual meeting of the American Association for Cancer Research. The prognosis is generally worse for patients whose tumors have high levels of NO, said Luiz Godoy, an MIT research associate and lead author of the study.

Godoy and his colleagues have unraveled the mechanism behind melanoma’s resistance to cisplatin, a commonly used chemotherapy drug, and, in ongoing studies, have found that cisplatin treatment also increases NO levels in breast and colon cancers.

“This could be a mechanism that is widely shared in different cancers, and if you use the drugs that are already used to treat cancer, along with other drugs that could scavenge or decrease the production of NO, you may have a synergistic effect,” said Godoy, who works in the lab of Gerald Wogan, an MIT professor emeritus of biological engineering and senior author of the study.

NO has many roles within living cells. At low concentrations, it helps regulate processes such as cell death and muscle contraction. NO, which is a free radical, is also important for immune-system function. Immune cells, such as macrophages, produce large amounts of NO during infection, helping to kill invading microbes by damaging their DNA or other cell components.

“It’s really a molecule that has a dual effect,” Godoy said. “At low concentrations it can act as a signaling molecule, while high concentrations will be toxic.”

Knocking out NO

In the new study, the researchers treated melanoma cells grown in the lab with drugs that capture NO before it can act. They then treated the cells with cisplatin and tracked cell-death rates. The NO-depleted cells became much more sensitive to the drug, confirming earlier findings.

The MIT team then went a step further, investigating how NO confers its survival benefits. It was already known that NO can alter protein function through a process known as S-nitrosation, which involves attaching NO to the target protein. S-nitrosation can affect many proteins, but in this study the researchers focused on two that are strongly linked with cell death and survival, known as caspase-3 and PHD2.

The role of caspase-3 is to stimulate cell suicide, under the appropriate conditions, but adding NO to the protein deactivates it. This prevents the cell from dying even when treated with cisplatin, a drug that produces massive DNA damage.

PHD2 is also involved in cell death; its role is to help break down another protein called HIF-1 alpha, which is a pro-survival protein. When NO inactivates PHD2, HIF-1 alpha stays intact and keeps the cell alive.

“Now we have a mechanistic link between nitric oxide and the increased aggressiveness of melanoma,” said Douglas Thomas, an assistant professor of medicinal chemistry and pharmacognosy at the University of Illinois at Chicago, who was not part of the research team. “It certainly would be worth exploring whether this mechanism is also present in different tumor types as well.”

The MIT researchers also found in some cancer cells, NO levels were five times higher than normal following cisplatin treatment. Godoy is now investigating how cisplatin stimulates that NO boost, and is also looking for other proteins that NO may be targeting.

Source: http://web.mit.edu/newsoffice/2013/how-melanoma-evades-chemotherapy-0407.html

Melanoma Res. 1996 Apr;6(2):121-6.

Nitric oxide synthase activity is up-regulated in melanoma cell lines: a potential mechanism for metastases formation.

Joshi M, Strandhoy J, White WL.

Source

Department of Dermatology, Bowman Gray School of Medicine, Wake Forest University, Winston-Salem, NC 27157, USA.

Abstract

Nitric oxide (NO) may be an important mediator of tumour angiogenesis and metastasis formation. Tumour cell derived NO may be important in the regulation of angiogenesis and vasodilatation of the blood vessels surrounding a tumour. The aims of the present study were, firstly, to determine whether malignant melanoma cells and normal melanocytes had nitric oxide synthase (NOS) activity (measured by the conversion of L-arginine to L-citrulline) and, secondly, to determine whether there was a difference in NOS activity between malignant and normal cell types. This paper assays NOS activity directly in lysates from normal human melanocyte and malignant melanoma cell lines. The enzyme activity was not inducible with bacterial lipopolysaccharide and could be heat denatured. The activity of NOS was demonstrated to be both NADPH- and calcium-dependent and it was inhibitable in a dose-dependent manner by the NOS inhibitor Nw-nitro-L-arginine methyl ester. We conclude that melanoma and melanocyte cells express a constitutive form of NOS. Finally, nitric oxide synthase activity in melanoma cell lines was found to be significantly greater than in normal melanocytes. These findings suggest that NO synthesis is elevated in malignant melanoma. An elevated NO concentration in melanoma is expected to promote metastases by maintaining a vasodilator tone in the blood vessels in and around the melanoma.

Proc Natl Acad Sci U S A. 2012 Dec 11;109(50):20373-8. doi: 10.1073/pnas.1218938109. Epub 2012 Nov 26.

Endogenously produced nitric oxide mitigates sensitivity of melanoma cells to cisplatin.

Godoy LC, Anderson CT, Chowdhury R, Trudel LJ, Wogan GN.

Source

Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA.

Abstract

Melanoma patients experience inferior survival after biochemotherapy when their tumors contain numerous cells expressing the inducible isoform of NO synthase (iNOS) and elevated levels of nitrotyrosine, a product derived from NO. Although several lines of evidence suggest that NO promotes tumor growth and increases resistance to chemotherapy, it is unclear how it shapes these outcomes. Here we demonstrate that modulation of NO-mediated S-nitrosation of cellular proteins is strongly associated with the pattern of response to the anticancer agent cisplatin in human melanoma cells in vitro. Cells were shown to express iNOS constitutively, and to generate sustained nanomolar levels of NO intracellularly. Inhibition of NO synthesis or scavenging of NO enhanced cisplatin-induced apoptotic cell death. Additionally, pharmacologic agents disrupting S-nitrosation markedly increased cisplatin toxicity, whereas treatments favoring stabilization of S-nitrosothiols (SNOs) decreased its cytotoxic potency. Activity of the proapoptotic enzyme caspase-3 was higher in cells treated with a combination of cisplatin and chemicals that decreased NO/SNOs, whereas lower activity resulted from cisplatin combined with stabilization of SNOs. Constitutive protein S-nitrosation in cells was detected by analysis with biotin switch and reduction/chemiluminescence techniques. Moreover, intracellular NO concentration increased significantly in cells that survived cisplatin treatment, resulting in augmented S-nitrosation of caspase-3 and prolyl-hydroxylase-2, the enzyme responsible for targeting the prosurvival transcription factor hypoxia-inducible factor-1α for proteasomal degradation. Because activities of these enzymes are inhibited by S-nitrosation, our data thus indicate that modulation of intrinsic intracellular NO levels substantially affects cisplatin toxicity in melanoma cells. The underlying mechanisms may thus represent potential targets for adjuvant strategies to improve the efficacy of chemotherapy.

Other posts on this site regarding Nitric Oxide and Cancer include:

Crucial role of Nitric Oxide in Cancer

Nitric Oxide Covalent Modifications: A Putative Therapeutic Target?

Nitric Oxide has a ubiquitous role in the regulation of glycolysis -with a concomitant influence on mitochondrial function

Nitric Oxide Signalling Pathways

In focus: Melanoma therapeutics

Combined anti-CTLA4 and anti-PD1 immunotherapy shows promising results against advanced melanoma

Whole exome somatic mutations analysis of malignant melanoma contributes to the development of personalized cancer therapy for this disease

In focus: Melanoma therapeutics

In focus: Melanoma Genetics

Read Full Post »

The Delicate Connection:  IDO (Indolamine 2, 3 dehydrogenase) and Cancer Immunology

Author and Curator: Demet Sag, PhD, CRA, GCP      

Table of Contents:

  1. Abstract
  2. Dual role for IDO
  3. Immune System and IDO
  4. Autoimmune disorders and IDO
  5. Cancer and Ido
  6. Clinical Interventions
  7. Clinical Trials
  8. Future Actions for Molecular Dx and Targeted Therapies:
  9. Conclusion
  10. References

TABLE 1- IDO Clinical Trials

TABLE 2- Kyn induced Genes

TABLE 3 Possible biomarkers and molecular diagnostics targets

TABLE 4: Current Interventions ______________________________________________________________________________________________________________

ABSTRACT:

Overall purpose is to find a method to manipulate IDO for clinical applications, mainly the focus of this review is is cancer prevention and treatment.  The first study proving the connection between IDO and immune response came from, a very natural event, a protection of pregnancy in human. This led to discover that high IDO expression is a common factor in cancer tumors. Thus, attention promoted investigations on IDO’s role in various disease states, immune disorders, transplantation, inflammation, women health, mood disorders.
Many approaches, vaccines and adjuvants are underway to find new immunotherapies by combining the power of DCs in immune response regulation and specific direction of siRNA.  As a result, with this unique qualities of IDO, DCs and siRNA, we orchestrated a novel intervention for immunomodulation of IDO by inhibiting with small interference RNA, called siRNA-IDO-DCvax.  Proven that our DCvax created a delay and regression of tumor growth without changing the natural structure and characterization of DCs in melanoma and breast cancers in vivo. (** The shRNA IDO- DCvax is developed by Regen BioPhrama, San Diego, CA ,  Thomas Ichim, Ph.D, CSO. and David Koos, CEO)

______________________________________________________________________________________________________________

Double-Edged Sword of IDO: The Good and The Bad for Clinical intervention and Developments

IDO almost has a dual role. There is a positive side of high expression of IDO during pregnancy (29; 28; 114), transplants (115; 116; 117; 118; 119), infectious diseases (96) and but this tolerance is negative during autoimmune-disorders (120; 121; 122), tumors of cancer (123; 124; 117; 121; 125; 126; 127) (127), and mood disorders (46). The increased IDO expression has a double-edged sword in human physiology provides a positive role during protection of fetus and grafts after transplantations but becomes a negative factor during autoimmune disorders, cancer, sepsis and mood disorders.

Prevention of allogeneic fetal rejection is possible by tryptophan metabolism (26) rejecting with lack of IDO but allocating if IDO present (29; 28; 114). These studies lead to find “the natural regulation mechanism” for protecting the transplants from graft versus host disease GVHD (128) and getting rid of tumors.

The plasticity of  mammary and uterus during reproduction may hold some more answers to prevent GVHD and tumors of cancer with good understanding of IDO and tryptophan mechanism (129; 130). After allogeneic bone marrow transplants the risk of solid tumor development increased about 80% among 19,229 patients even with a greater risk among patients under 18 years old (117).  The adaptation of tolerance against host mechanism is connected to the IDO expression (131). During implantation and early pregnancy IDO has a role by making CD4+CD25+Foxp3+ regulatory T cells (Tregs) and expressing in DCs and  MQs  (114; 132; 133).

Clonal deletion mechanism prevents mother to react with paternal products since female mice accepted the paternal MHC antigen-expressing tumor graft during pregnancy and rejected three weeks after delivery (134). CTLA-4Ig gene therapy alleviates abortion through regulation of apoptosis and inhibition of spleen lymphocytes (135).  

 Immune System and IDO DCs are the orchestrator of the immune response (56; 57; 58) with list of functions in uptake, processing, and presentation of antigens; activation of effector cells, such as T-cells and NK-cells; and secretion of cytokines and other immune-modulating molecules to direct the immune response. The differential regulation of IDO in distinct DC subsets is widely studied to delineate and correct immune homeostasis during autoimmunity, infection and cancer and the associated immunological outcomes. Genesis of antigen presenting cells (APCs), eventually the immune system, require migration of monocytes (MOs), which is originated in bone marrow. Then, these MOs move from bloodstream to other tissues to become macrophages and DCs (59; 60).

Initiation of immune response requires APCs to link resting helper T-cell with the matching antigen to protect body. DCs are superior to MQs and MOs in their immune action model. When DCs are first described (61) and classified, their role is determined as a highly potent antigen-presenting cell (APC) subset with 100 to 1000-times more effective than macrophages and B-cells in priming T-cells. Both MQs and monocytes phagocytize the pathogen, and their cell structure contains very large nucleus and many internal vesicles. However, there is a nuance between MQ and DCs, since DCs has a wider capacity of stimulation, because MQs activates only memory T cells, yet DCs can activate both naïve and memory T cells.

DCs are potent activators of T cells and they also have well controlled regulatory roles. DC properties determine the regulation regardless of their origin or the subset of the DCs. DCs reacts after identification of the signals or influencers for their inhibitory, stimulatory or regulatory roles, before they express a complex repertoire of positive and negative cytokines, transmembrane proteins and other molecules. Thus, “two signal theory” gains support with a defined rule.  The combination of two signals, their interaction with types of cells and time are critical.

In short, specificity and time are matter for a proper response. When IDO mRNA expression is activated with CTL40 ligand and IFNgamma, IDO results inhibition of T cell production (4).  However, if DCs are inhibited by 1MT, an inhibitor of IDO, the response stop but IgG has no affect (10).  In addition, if the stimulation is started by a tryptophan metabolite, which is downstream of IDO, such as 3-hydroxyantranilic or quinolinic acids, it only inhibits Th1 but not Th2 subset of T cells (62).

Furthermore, inclusion of signal molecules, such as Fas Ligand, cytochrome c, and pathways also differ in the T cell differentiation mechanisms due to combination, time and specificity of two-signals.  The co-culture experiments are great tool to identify specific stimuli in disease specific microenvironment (63; 12; 64) for discovering the mechanism and interactions between molecules in gene regulation, biochemical mechanism and physiological function during cell differentiation.

As a result, the simplest differential cell development from the early development of DCs impact the outcome of the data. For example, collection of MOs from peripheral blood mononuclear cells (PBMCs) with IL4 and GM-CSF leads to immature DCs (iDCs). On next step, treatment of iDCs with tumor necrosis factor (TNF) or other plausible cytokines (TGFb1, IFNgamma, IFNalpha,  IFNbeta, IL6 etc.) based on the desired outcome differentiate iDCs  into mature DCs (mDCs). DCs live only up to a week but MOs and generated MQs can live up to a month in the given tissue. B cells inhibit T cell dependent immune responses in tumors (65).

AutoImmune Disorders:

The Circadian Clock Circuitry and the AHR

The balance of IDO expression becomes necessary to prevent overactive immune response self-destruction, so modulation in tryptophan and NDA metabolisms maybe essential.  When splenic IDO-expressing CD11b (+) DCs from tolerized animals applied, they suppressed the development of arthritis, increased the Treg/Th17 cell ratio, and decreased the production of inflammatory cytokines in the spleen (136).

The role of Nicotinamide prevention on type 1 diabetes and ameliorates multiple sclerosis in animal model presented with activities of  NDAs stimulating GPCR109a to produce prostaglandins to induce IDO expression, then these PGEs and PGDs converted to the anti-inflammatory prostaglandin, 15d-PGJ(2) (137; 138; 139).  Thus, these events promotes endogenous signaling mechanisms involving the GPCRs EP2, EP4, and DP1 along with PPARgamma. (137).

Modulating the immune response at non-canonical at canonocal pathway while keeping the non-canonical Nf-KB intact may help to mend immune disorders. As a result, the targeted blocking in canonical at associated kinase IKKβ and leaving non-canonocal Nf-kB pathway intact, DCs tips the balance towards immune supression. Hence, noncanonical NF-κB pathway for regulatory functions in DCs required effective IDO induction, directly or indirectly by endogenous ligand Kyn and negative regulation of proinflammatory cytokine production. As a result, this may help to treat autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, inflammatory bowel disease, and multiple sclerosis, or allergy or transplant rejection.

While the opposite action needs to be taken during prevention of tumors, that is inhibition of non-canonical pathway.  Inflammation induces not only relaxation of veins and lowering blood pressure but also stimulate coagulopathies that worsen the microenvironment and decrease survival rate of patients after radio or chemotherapies.Cancer Generating tumor vaccines and using adjuvants underway (140).

Clinical correlation and genetic responses also compared in several studies to diagnose and target the system for cancer therapies (127; 141; 131).  The recent surveys on IDO expression and human cancers showed that IDO targeting is a candidate for cancer therapy since IDO expression recruiting Tregs, downregulates MHC class I and creating negative immune microenvironment for protection of development of tumors (125; 27; 142).  Inhibition of IDO expression can make advances in immunotherapy and chemotherapy fields (143; 125; 131; 144).

IDO has a great importance on prevention of cancer development (126). There are many approaches to create the homeostasis of immune response by Immunotherapy.  However, given the complexity of immune regulations, immunomodulation is a better approach to correct and relieve the system from the disease.  Some of the current IDO targeted immunotherapy or immmunomodulations with RNA technology for cancer prevention (145; 146; 147; 148; 149; 150) or applied on human or animals  (75; 151; 12; 115; 152; 9; 125) or chemical, (153; 154) or  radiological (155).  The targeted cell type in immune system generally DCs, monocytes (94)T cells (110; 156)and neutrophils (146; 157). On this paper, we will concentrate on DCvax on cancer treatments.

 T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

IDO and the downstream enzymes in tryptophan pathway produce a series of immunosuppressive tryptophan metabolites that may lead into Tregs proliferation or increase in T cell apoptosis (62; 16; 27; 158), and some can affect NK cell function (159).

The interesting part of the mechanism is even without presence of IDO itself, downstream enzymes of IDO in the kynurenine tryptophan degradation still show immunosuppressive outcome (160; 73) due to not only Kyn but also TGFbeta stimulated long term responses. DC vaccination with IDO plausible (161) due to its power in immune response changes and longevity in the bloodstream for reversing the system for Th17 production (162).

Clinical Interventions are taking advantage of the DC’s central role and combining with enhancing molecules for induction of immunity may overcome tolerogenic DCs in tumors of cancers (163; 164).

The first successful application of DC vaccine used against advanced melanoma after loading DCs with tumor peptides or autologous cell lysate in presence of adjuvants keyhole limpet hematocyanin (KLH) (165).  Previous animal and clinical studies show use of DCs against tumors created success (165; 166; 167) as well as some problems due to heterogeneity of DC populations in one study supporting tumor growth rather than diminishing (168).

DC vaccination applied onto over four thousand clinical trial but none of them used siRNA-IDO DC vaccination method. Clinical trials evaluating DCs loaded ex vivo with purified TAAs as an anticancer immunotherapeutic interventions also did not include IDO (Table from (169). This table presented the data from 30 clinical trials, 3 of which discontinued, evaluating DCs loaded ex vivo with TAAs as an anticancer immunotherapy for 12 types of cancer [(AML(1), Breast cancer (4), glioblastoma (1), glioma (2), hepatocellular carcinoma (1), hematological malignancies (1), melanoma (6), neuroblastoma sarcoma (2), NSCLC (1), ovarian cancer (3), pancreatic cancer (3), prostate cancer (10)] at phase I, II or I/II.

Tipping the balance between Treg and Th17 ratio has a therapeutic advantage for restoring the health that is also shown in ovarian cancer by DC vaccination with adjuvants (161).  This rebalancing of the immune system towards immunogenicity may restore Treg/Th17 ratio (162; 170) but it is complicated. The stimulation of IL10 and IL12 induce Treg produce less Th17 and inhibiting CTL activation and its function (76; 171; 172) while animals treated with anti-TGFb before vaccination increase the plasma levels of IL-15 for tumor specific T cell survival in vivo (173; 174) ovarian cancer studies after human papilloma virus infection present an increase of IL12 (175).

Opposing signal mechanism downregulates the TGFb to activate CTL and Th1 population with IL12 and IL15 expression (162; 173).  The effects of IL17 on antitumor properties observed by unique subset of CD4+ T cells (176) called also CD8+ T cells secrete even more IL17 (177).

Using cytokines as adjuvants during vaccination may improve the efficacy of vaccination since cancer vaccines unlike infections vaccines applied after the infection or disease started against the established adoptive immune response.  Adjuvants are used to improve the responses of the given therapies commonly in immunotherapy applications as a combination therapy (178).

Enhancing cancer vaccine efficacy via modulation of the microenvironment is a plausible solution if only know who are the players.  Several molecules can be used to initiate and lengthen the activity of intervention to stimulate IDO expression without compromising the mechanism (179).  The system is complicated so generally induction is completed ex-vivo stimulation of DCs in cell lysates, whole tumor lysates, to create the microenvironment and natural stimulatory agents. Introduction of molecules as an adjuvants on genetic regulation on modulation of DCs are critical, because order and time of the signals, specific location/ tissue, and heterogeneity of personal needs (174; 138; 180). These studies demonstrated that IL15 with low TGFb stimulates CTL and Th1, whereas elevated TGFb with IL10 increases Th17 and Tregs in cancer microenvironments.

IDO and signaling gene regulation

For example Ret-peptide antitumor vaccine contains an extracellular fragment of Ret protein and Th1 polarized immunoregulator CpG oligonucleotide (1826), with 1MT, a potent inhibitor of IDO, brought a powerful as well as specific cellular and humoral immune responses in mice (152).

The main idea of choosing Ret to produce vaccine in ret related carcinomas fall in two criterion, first choosing patients self-antigens for cancer therapy with a non-mutated gene, second, there is no evidence of genetic mutations in Ret amino acids 64-269. Demonstration of proliferating hemangiomas, benign endothelial tumors and often referred as hemangiomas of infancy appearing at head or neck, express IDO and slowly regressed as a result of immune mediated process.

After large scale of genomic analysis show insulin like growth factor 2 as the key regulator of hematoma growth (Ritter et al. 2003). We set out to develop new technology with our previous expertise in immunotherapy and immunomodulation (181; 182; 183; 184), correcting Th17/Th1 ratio (185), and siRNA technology (186; 187).  We developed siRNA-IDO-DCvax. Patented two technologies “Immunomodulation using Altered DCs (Patent No: US2006/0165665 A1) and Method of Cancer Treatments using siRNA Silencing (Patent No: US2009/0220582 A1).

In melanoma cancer DCs were preconditioned with whole tumor lysate but in breast cancer model pretreatment completed with tumor cell lysate before siRNA-IDO-DCvax applied. Both of these studies was a success without modifying the autanticity of DCs but decreasing the IDO expression to restore immunegenity by delaying tumor growth in breast cancer (147) and in melanoma (188).  Thus, our DCvax specifically interfere with Ido without disturbing natural structure and content of the DCs in vivo showed that it is possible to carry on this technology to clinical applications.

Furthermore, our method of intervention is more sophisticated since it has a direct interaction mechanism with ex-vivo DC modulation without creating long term metabolism imbalance in Trp/Kyn metabolite mechanisms since the action is corrective and non-invasive.

There were several reasons.

First, prevention of tumor development studies targeting non-enzymatic pathway initiated by pDCs conditioned with TGFbeta is specific to IDO1 (189).

Second, IDO upregulation in antigen presenting cells allowing metastasis show that most human tumors express IDO at high levels (123; 124).

Third, tolerogenic DCs secretes several molecules some of them are transforming growth factor beta (TGFb), interleukin IL10), human leukocyte antigen G (HLA-G), and leukemia inhibitory factor (LIF), and non-secreted program cell death ligand 1 (PD-1 L) and IDO, indolamine 2.3-dioxygenase, which promote tumor tolerance. Thus, we took advantage of DCs properties and Ido specificity to prevent the tolerogenicity with siRNA-IDO DC vaccine in both melanoma and breast cancer.

Fourth, IDO expression in DCs make them even more potent against tumor antigens and create more T cells against tumors. IDOs are expressed at different levels by both in broad range of tumor cells and many subtypes of DCs including monocyte-derived DCs (10), plasmacytoid DCs (142), CD8a+ DCs (190), IDO compotent DCs (17), IFNgamma-activated DCs used in DC vaccination.  These DCs suppress immune responses through several mechanisms for induction of apoptosis towards activated T cells (156) to mediate antigen-specific T cell anergy in vivo (142) and for enhancement of Treg cells production at sites of vaccination with IDO-positive DCs+ in human patients (142; 191; 192; 168; 193; 194). If DCs are preconditioned with tumor lysate with 1MT vaccination they increase DCvax effectiveness unlike DCs originated from “normal”, healthy lysate with 1MT in pancreatic cancer (195).  As a result, we concluded that the immunesupressive effect of IDO can be reversed by siRNA because Treg cells enhances DC vaccine-mediated anti-tumor-immunity in cancer patients.

Gene silencing is a promising technology regardless of advantages simplicity for finding gene interaction mechanisms in vitro and disadvantages of the technology is utilizing the system with specificity in vivo (186; 196).  siRNA technology is one of the newest solution for the treatment of diseases as human genomics is only producing about 25,000 genes by representing 1% of its genome. Thus, utilizing the RNA open the doors for more comprehensive and less invasive effects on interventions. Thus this technology is still improving and using adjuvants. Silencing of K-Ras inhibit the growth of tumors in human pancreatic cancers (197), silencing of beta-catenin in colon cancers causes tumor regression in mouse models (198), silencing of vascular endothelial growth factor (VGEF) decreased angiogenesis and inhibit tumor growth (199).

Combining siRNA IDO and DCvax from adult stem cell is a novel technology for regression of tumors in melanoma and breast cancers in vivo. Our data showed that IDO-siRNA reduced tumor derived T cell apoptosis and tumor derived inhibition of T cell proliferation.  In addition, silencing IDO made DCs more potent against tumors since treated or pretreated animals showed a delay or decreased the tumor growth (188; 147)

 

Clinical Trials:

First FDA approved DC-based cancer therapies for treatment of hormone-refractory prostate cancer as autologous cellular immunotherapy (163; 164).  However, there are many probabilities to iron out for a predictive outcome in patients.

Table 2 demonstrates the current summary of clinical trials report.  This table shows 38 total studies specifically Ido related function on cancer (16), eye (3), surgery (2), women health (4), obesity (1), Cardiovascular (2), brain (1), kidney (1), bladder (1), sepsis shock (1), transplant (1),  nervous system and behavioral studies (4), HIV (1) (Table 4).  Among these only 22 of which active, recruiting or not yet started to recruit, and 17 completed and one terminated.

Most of these studies concentrated on cancer by the industry, Teva GTC ( Phase I traumatic brain injury) Astra Zeneca (Phase IV on efficacy of CRESTOR 5mg for cardiovascular health concern), Incyte corporation (Phase II ovarian cancer) NewLink Genetics Corporation Phase I breast/lung/melanoma/pancreatic solid tumors that is terminated; Phase II malignant melanoma recruiting, Phase II active, not recruiting metastatic breast cancer, Phase I/II metastatic melanoma, Phase I advanced malignancies) , HIV (Phase IV enrolling by invitation supported by Salix Corp-UC, San Francisco and HIV/AIDS Research Programs).

Many studies based on chemotherapy but there are few that use biological methods completed study with  IDO vaccine peptide vaccination for Stage III-IV non-small-cell lung cancer patients (NCT01219348), observational study on effect of biological therapy on biomarkers in patients with untreated hepatitis C, metastasis melanoma, or Crohn disease by IFNalpha and chemical (ribavirin, ticilimumab (NCT00897312), polymorphisms of patients after 1MT drug application in treating patients with metastatic or unmovable refractory solid tumors by surgery (NCT00758537), IDO expression analysis on MSCs (NCT01668576), and not yet recruiting intervention with adenovirus-p53 transduced dendric cell vaccine , 1MT , radiation, Carbon C 11 aplha-methyltryptophan- (NCT01302821).

Among the registered clinical trials some of them are not interventional but  observational and evaluation studies on Trp/Kyn ratio (NCT01042847), Kyn/Trp ratio (NCT01219348), Kyn levels (NCT00897312, NCT00573300),  RT-PCR analysis for Kyn metabolism (NCT00573300, NCT00684736, NCT00758537), and intrinsic IDO expression of mesenchymal stem cells in lung transplant with percent inhibition of CD4+ and CD8+ T cell proliferation toward donor cells (NCT01668576), determining polymorphisms (NCT00426894). These clinical trials/studies are immensely valuable to understand the mechanism and route of intervention development with the data collected from human populations   

Future Actions for Molecular Dx and Targeted Therapies:

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors.  (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors. (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Current survival or response rate is around 40 to 50 % range.  By using specific cell type, selected inhibition/activation sequence based on patient’s genomic profile may improve the efficacy of clinical interventions on cancer treatments. Targeted therapies for specific gene regulation through signal transduction is necessary but there are few studies with genomics based approach.

On the other hand, there are surveys, observational or evaluations (listed in clinical trials section) registered with www.clinicaltrials.gov that will provide a valuable short-list of molecules.  Preventing stimulation of Ido1 as well as Tgfb-1gene expression by modulating receptor mediated phosphorylation between TGFb/SMAD either at Mad-Homology 1 (MH1) or Mad-Homology 1 (MH2) domains maybe possible (79; 82; 80). Within Smads are the conserved Mad-Homology 1 (MH1) domain, which is a DNA binding module contains tightly bound Zinc atom.

Smad MH2 domain is well conserved and one the most diverse protein-signal interacting molecule during signal transduction due to two important Serine residues located extreme distal C-termini at Ser-Val-Ser in Smad 2 or at pSer-X-PSer in RSmads (80). Kyn activated orphan G protein–coupled receptor, GPR35 with unknown function with a distinct expression pattern that collides with IDO sites since its expression at high levels of the immune system and the gut (63) (200; 63).  

The first study to connect IDO with cancer shows that group (75).  The directly targeting to regulate IDO expression is another method through modulating ISREs in its promoter with RNA-peptide combination technology. Indirectly, IDO can be regulated through Bin1 gene expression control over IDO since Bin1 is a negative regulator of IDO and prevents IDO expression.  IDO is under negative genetic control of Bin1, BAR adapter–encoding gene Bin1 (also known as Amphiphysin2). Bin1 functions in cancer suppression since attenuation of Bin1 observed in many human malignancies (141; 201; 202; 203; 204; 205; 206) .  Null Bin-/- mice showed that when there is lack of Bin1, upregulation of IDO through STAT1- and NF-kB-dependent expression of IDO makes tumor cells to escape from T cell–dependent antitumor immunity.

This pathway lies in non-enzymatic signal transducer function of IDO after stimulation of DCs by TGFb1.  The detail study on Bin1 gene by alternative spicing also provided that Bin1 is a tumor suppressor.  Its activities also depends on these spliced outcome, such as  Exon 10, in muscle, in turn Exon 13 in mice has importance in role for regulating growth when Bin1 is deleted or mutated C2C12 myoblasts interrupted due to its missing Myc, cyclinD1, or growth factor inhibiting genes like p21WAF1 (207; 208).

On the other hand alternative spliced Exon12A contributing brain cell differentiation (209; 210). Myc as a target at the junction between IDO gene interaction and Trp metabolism.  Bin1 interacts with Myc either early-dependent on Myc or late-independent on Myc, when Myc is not present. This gene regulation also interfered by the long term signaling mechanism related to Kynurenine (Kyn) acting as an endogenous ligand to AHR in Trp metabolite and TGFb1 and/or IFNalpha and IFNbeta up regulation of DCs to induce IDO in noncanonical pathway for NF-kB and myc gene activations (73; 74).  Hence, Trp/Kyn, Kyn/Trp, Th1/Th17 ratios are important to be observed in patients peripheral blood. These direct and indirect gene interactions place Bin1 to function in cell differentiation (211; 212; 205).

Regulatory T-cel generation via reverse and non-canonical signaliing to pDCs

Table 3 contains the microarray analysis for Kyn affect showed that there are 25 genes affected by Kyn, two of which are upregulated and 23 of them downregulated (100). This list of genes and additional knowledge based on studies creating the diagnostics panel with these genes as a biomarker may help to analyze the outcomes of given interventions and therapies. Some of these molecules are great candidate to seek as an adjuvant or co-stimulation agents.  These are myc, NfKB at IKKA, C2CD2, CREB3L2, GPR115, IL2, IL8, IL6, and IL1B, mir-376 RNA, NFKB3, TGFb, RelA, and SH3RF1. In addition, Lip, Fox3P, CTLA-4, Bin1, and IMPACT should be monitored.

In addition, Table 4 presents the other possible mechanisms. The highlights of possible target/biomarkers are specific TLRs, conserved sequences of IDO across its homologous structures, CCR6, CCR5, RORgammat, ISREs of IDO, Jak, STAT, IRFs, MH1 and MH2 domains of Smads. Endothelial cell coagulation activation mechanism and pDC maturation or immigration from lymph nodes to bloodstream should marry to control not only IDO expression but also genesis of preferred DC subsets. Stromal mesenchymal cells are also activated by these modulation at vascular system and interferes with metastasis of cancer. First, thrombin (human factor II) is a well regulated protein in coagulation hemostasis has a role in cell differentiation and angiogenesis.

Protein kinase activated receptors (PARs), type of GPCRs, moderate the actions. Second, during hematopoietic response endothelial cells produce hematopoietic growth factors (213; 214). Third, components of bone marrow stroma cells include monocytes, adipocytes, and mesenchymal stem cells (215). As a result, addressing this issue will prevent occurrence of coagulapathologies, namely DIC, bleeding, thrombosis, so that patients may also improve response rate towards therapies. Personal genomic profiles are powerful tool to improve efficacy in immunotherapies since there is an influence of age (young vs. adult), state of immune system (innate vs. adopted or acquired immunity). Table 5 includes some of the current studies directly with IDO and indirectly effecting its mechanisms via gene therapy, DNA vaccine, gene silencing and adjuvant applications as an intervention method to prevent various cancer types.

CONCLUSION

IDO has a confined function in immune system through complex interactions to maintain hemostasis of immune responses. The genesis of IDO stem from duplication of bacterial IDO-like genes.  Inhibition of microbial infection and invasion by depleting tryptophan limits and kills the invader but during starvation of trp the host may pass the twilight zone since trp required by host’s T cells.  Thus, the host cells in these small pockets adopt to new microenvironment with depleted trp and oxygen poor conditions. Hence, the cell metabolism differentiate to generate new cellular structure like nodules and tumors under the protection of constitutively expressed IDO in tumors, DCs and inhibited T cell proliferation.

On the other hand, having a dichotomy in IDO function can be a potential limiting factor that means is that IDOs impact on biological system could be variable based on several issues such as target cells, IDO’s capacity, pathologic state of the disease and conditions of the microenvironment. Thus, close monitoring is necessary to analyze the outcome to prevent conspiracies since previous studies generated paradoxical results.

Current therapies through chemotherapies, radiotherapies are costly and effectiveness shown that the clinical interventions require immunotherapies as well as coagulation and vascular biology manipulations for a higher efficacy and survival rate in cancer patients. Our siRNA and DC technologies based on stem cell modulation will provide at least prevention of cancer development and hopefully prevention in cancer.

11.       References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. Induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA.  Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (http://dx.doi.org:/10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197. 33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223, http://dx.doi.org:/10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp. http://dx.doi.org:/10.1038/nature10491.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878. 78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40.
http://dx.doi.org:/10.1016/S0092-8674(00)81696-7.  PMID 9865691.

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810.
http://dx.doi.org:/10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.   http://dx.doi.org:/10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132–     http://dx.doi.org:/10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271,  http://dx.doi.org:/10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31.

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. http://dx.doi.org:/10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606.  http://dx.doi.org:/10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11.  http://dx.doi.org:/10.1126/scisignal.2002963.

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii: S0006-291X(13)00779-1. http://dx.doi.org:/10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

114. What is the role of regulatory T cells in the success of implantation and early pregnancy? Saito, S., Shima, T., Nakashima, A., Shiozaki, A., Ito, M., Sasaki, Y. 2007, J Assist Reprod Genet, pp. 24: 379-386.

115. Sleeping Beauty-based gene therapy with indoleamine 2,3-dioxygenase inhibits lung allograft fibrosis. Liu H, Liu L, Fletcher BS, Visner GA. 2006, FASEB J, pp. 20:2384-2386.

116. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

117. Solid Cancers after Bone Marrow Transplantatioin. Curtis, R.E., Rowlings, P.A., Deeg, J., Schirer, D.A. et al. 1997, The New England Journal of Medicine., pp. 336, No: 13: 897-904.

118. More ADO about IDO; GVHD (commentary). Curti, A., Trabanelli, S., Lemoli, M. 2008, Blood, p. 2950.

119. Jasperson, et al, . 2008, Blood, p. 3257.

120. Tolerance, DCs and tryptophan: much ado about IDO. Grohmann U, Fallarino F, Puccetti P. 2003, Trends Immunol, pp. 24:242-248.

121. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med , pp. 9:1269–74.

122. Indoleamine 2,3-dioxygenase is a critical regulator of acute graft-versus-host disease lethality. Lisa K. Jasperson, Christoph Bucher, Angela Panoskaltsis-Mortari, Patricia A. Taylor, Andrew L. Mellor, David H. Munn, and Bruce R. Blazar. 2008., Blood., pp. 111:3257-3265.

123. The metabolism of tryptophan. 2. The metabolism of tryptophan in patients suffering from cancer of the bladder. . Boyland, E. & Willliams, D.C. 1956, Biochem. J., pp. 64, 578−582 .

124. Tryptophan metabolism in carcinoma of the breast. . Rose, D. 1967, Lancet , pp. 1, 239−241. 

125. Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees? . Löb S, Königsrainer A, Rammensee HG, Opelz G, Terness P. 2009;, Nat Rev Cancer , pp. 9:445–52.  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

126. The hallmarks of cancer. . Hanahan, D. & Weinberg, R.A. 2000., Cell., pp. 100, 57−70.

127. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Godin-Ethier, J., Hanafi,L.A., Piccirillo,C.A. and Lapointe, R. 2011, Clin Cancer Res, pp. 17; 6985,  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

128. Dendritic cell modification as a route to inhibiting corneal graft rejection by the indirect pathway of allorecognition. Khan A, Fu H, Tan LA, Harper JE, Beutelspacher SC, Larkin DF, Lombardi G, McClure MO, George AJ. 2013, Eur J Immunol., pp. 43(3):734-46. http://dx.doi.org:/10.1002/eji.201242914. Epub 2013 Jan 18.

129. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. . Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int., pp. 37(2):105-8.  http://dx.doi.org:/10.1002/cbin.10023. Epub 2013 Jan 2.

130. Implication of indolamine 2,3 dioxygenase in the tolerance toward fetuses, tumors, and allografts. . Dürr S, Kindler V. 2013, J Leukoc Biol. , pp. 93(5):681-7.
http://dx.doi.org:/10.1189/jlb.0712347. Epub 2013 Jan 16.

131. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med, pp. 9:1269–74.

132. NAturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Sagaguchi, S. 2004, Annu. Rev. of Immunol., pp. 22: 531-562.

133. Regulatory T cells in transplantation tolerance. Wood, K.J., zZSakaguchi, S.,. 2003, Nat. Rev. Immunol., pp. 3; 199-210.

134. The cell awareness of paternal alloantigens during pregnancy. Tafuri, A., Alferink, J., Hammerling, G.J., Arnold, B. 1995, Science, pp. 270; 630-3.

135. Adenovirus mediated CTLA4Ig transgene therapy alleviates abortion by inhibiting spleen lymphocyte proliferation and regulating apoptosis in the feto-placental unit. Li W, Li B, Li S. 2013, J Reprod Immunol. , pp. 97(2):167-74.

136. A distinct tolerogenic subset of splenic IDO(+)CD11b(+) dendritic cells from orally tolerized mice is responsible for induction of systemic immune tolerance and suppression of collagen-induced arthritis. Park MJ, Park KS, Park HS, Cho ML, Hwang SY, Min SY, Park MK, Park SH, Kim HY. 2012, Cell Immunol. , pp. 278(1-2):45-54. http://dx.doi.org:/10.1016/j.cellimm.2012.06.009. Epub 2012 Jul 10.

137. Pharmacological targeting of IDO-mediated tolerance for treating autoimmune disease. Penberthy, W.T. 2007, Curr. Drug Metab., pp. 8:(3):245-266.

138. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

139. Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. . Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS. 2001., NeuroReport. , pp. 12(9):1841–1845.

140. Tumor vaccines in 2010: need for integration. Koos, D., Josephs, SF, Alexandrescu, DT et al. 2010, Cell Immunol, pp. 263: 138-147.

141. BIN1 is a novel MYC-interacting protein with features of a tumor suppressor. . Sakamuro, D., Elliott, K., Wechsler-Reya, R. & Prendergast, G.C. 1996, Nat. Genet. , pp. 14, 69−77.

142. Expression of Indolamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor draining nodes. Munn, S.H., Sharma, M.D., Hou, D., Baban, B. et al. 2004, J. Clin. Invest. , pp. 114: 280-290.

143. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Jessica Godin-Ethier, Laïla-Aïcha Hanafi, Ciriaco A. Piccirillo, and Réjean Lapointe. 2011 , Clin Cancer Res, pp. 17; 6985, http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

144. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. . Munn, D.H. et al. 2002, Science 297, 1867−1870, pp. 297, 1867−1870 .

145. An HDAC inhibitor enhances cancer therapeutic efficiency of RNA polymerase III promoter-driven IDO shRNA. Yen MC, Weng TY, Chen YL, Lin CC, Chen CY, Wang CY, Chao HL, Chen CS, Lai MD. 2013, Cancer Gene Ther. , p. http://dx.doi.org:/10.1038/cgt.2013.27. [Epub ahead of print].

146. Systemic delivery of Salmonella typhimurium transformed with IDO shRNA enhances intratumoral vector colonization and suppresses tumor growth. Blache CA, Manuel ER, Kaltcheva TI, Wong AN, Ellenhorn JD, Blazar BR, Diamond DJ. 2012, Cancer Res. , pp. 72(24):6447-56.
http://dx.doi.org:/ZZ1158/0008-5472.CAN-12-0193. Epub 2012 Oct 22.

147. Silencing IDO in dendritic cells: a novel approach to enhance cancer immunotherapy in a murine breast cancer model. Zheng X, Koropatnick J, Chen D, Velenosi T, Ling H, Zhang X, Jiang N, Navarro B, Ichim TE, Urquhart B, Min W. 2013, Int J Cancer., pp.132(4):967-77. http://dx.doi.org:/10.1002/ijc.27710. Epub 2012 Jul 20.

148. Immunosuppressive CD14+HLA-DRlow/neg IDO+ myeloid cells in patients following allogeneic hematopoietic stem cell transplantation. Mougiakakos D, Jitschin R, von Bahr L, Poschke I, Gary R, Sundberg B, Gerbitz A, Ljungman P, Le Blanc K. 2013, Leukemia. , pp. 27(2):377-88.
http://dx.doi.org:/10.1038/leu.2012.215. Epub 2012 Jul 25.

149. Upregulated expression of indoleamine 2, 3-dioxygenase in primary breast cancer correlates with increase of infiltrated regulatory T cells in situ and lymph node metastasis. Yu J, Sun J, Wang SE, Li H, Cao S, Cong Y, Liu J, Ren X. 2011, Clin Dev Immunol. , p. 11:469135.
http://dx.doi.org:/10.1155/2011/469135. Epub 2011 Oct 24.

150. Skin delivery of short hairpin RNA of indoleamine 2,3 dioxygenase induces antitumor immunity against orthotopic and metastatic liver cancer. Huang TT, Yen MC, Lin CC, Weng TY, Chen YL, Lin CM, Lai MD. 2011, Cancer Sci. , pp. 102(12):2214-20. http://dx.doi.org:/10.1111/j.1349-7006.2011.02094.x.

151. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. . Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

152. Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan. Zeng, J., Cai, S., Yi, Y., et al. 2009, Cancer Res., pp. 69: 3963-3970,  http://dx.doi.org:/10.1158/0008-5472.CAN-08-2476.

153. Medicinal electronomics bricolage design of hypoxia-targeting antineoplastic drugs and invention of boron tracedrugs as innovative future-architectural drugs. Hori H, Uto Y, Nakata E. 2010, Anticancer Res. , pp. 30(9):3233-42.

154. Synthesis of 4-cyano and 4-nitrophenyl 1,6-dithio-D-manno-, L-ido- and D-glucoseptanosides possessing antithrombotic activity. Bozó E, Gáti T, Demeter A, Kuszmann J. 2002, Carbohydr Res. , pp. 3;337(15):1351-65.

155. Radiopharmaceuticals XXVII. 18F-labeled 2-deoxy-2-fluoro-d-glucose as a radiopharmaceutical for measuring regional myocardial glucose metabolism in vivo: tissue distribution and imaging studies in animals. Gallagher BM, Ansari A, Atkins H, Casella V, Christman DR, Fowler JS, Ido T, MacGregor RR, Som P, Wan CN, Wolf AP, Kuhl DE, Reivich M. 1977, J Nucl Med. , pp. 18(10):990-6.

156. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology, pp. 107:452–460.

157. Induction of indoleamine 2,3-dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial infection. Loughman JA, Hunstad DA. 2012 , J Infect Dis. , pp. 205(12):1830-9.  http://dx.doi.org:/10.1093/infdis/jis280.

158. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. . Terness, P., et al. 2002, J. Exp. Med.196:447–457., pp. 196:447–457.

159. The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46- and NKG2D-activating receptors and regulates NK-cell function. . Chiesa, M.D., et al. 2006, Blood. , pp. 108:4118–4125.38.

160. Differential effects of the tryptophan metabolite 3-hydroxyanthranilic acid on the proliferation of human CD8+ T cells induced by TCR triggering or homeostatic cytokines. Weber, W.P., et al. 2006, Eur. J. Immunol. , pp. 36:296-304.

161. Dendritic cell vaccination against ovarian cancer–tipping the Treg/TH17 balance to therapeutic advantage? Cannon MJ, Goyne H, Stone PJ, Chiriva-Internati M. 2011, Expert Opin Biol Ther. , pp. 11(4):441-5. http://dx.doi.org:/10.1517/14712598.2011.554812.

162. Phenotype, distribution, generation, and functional and clinical relevance of Th17 cells in the human tumor environments. . Kryczek I, Banerjee M, Cheng P, et al. 2009, Blood., pp. 114:1141–1149.

163. The use of dendritic cells in cancer immunitherapy. Schuler, G., Schuker-Turner, B., Steinman, RM, 2003, Curr. Opin. Immunol., pp. 15: 138-147.

164. Clinical applications of dentritic cell vaccines. Morse, MA, Lyerly, HK. 2000, Curr. Opin. Mol Ther., pp. 2:20-28.

165. Vaccination of melanoma patients with peptide or tumor lysate-pulsed dendritic cells. Nestle, FO, Alijagic, S., Gillet, M. et al. 1998, Nat. Med., pp. 4: 328-332.

166. Dentritic cell based tumor vaccination in prostate and renal cell cancer: a systamatic review. Draube, A., Klein-Gonzales, Matheus, S et al. 2011, Plos One, p. 6:e1881.

167. [Online] http://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapy-Products/ApprovedProducts/ucm210215.htm.

168. Dendritic cell based antitumor vaccination: impact of functional indolamine 2,3-dioxygenase expression. Wobster, m., Voigt, H., Houben, R. et al. 2007, Cancer Immunol Immunother, pp. 56:1017-1024. 169. [Online] oncoimmunology.2012 October1; 1(17):1111-1134,  http://dx.doi.org:/10.4161/onci.21494.

170. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. 2007 , Nat Immunol. , pp. 8(9):942-9.

171. IFNgamma promotes generationof Il-10 secreting CD4+ T cells that suppress generationof CD8responses in an antigen-experienced host. Liu, X.S., Leerberg, J., MacDonald, K., Leggatt, G.R., Frazer, I.H. 2009, J. Immunol., pp. 183: 51-58.

172. Antigen, in the presence of TGF-beta, induces up-regulationof FoxP3gfp+ in CD4+ TCR transgenic T cells that mediate linked supressionof CD8+ T cell responses. . Kapp, J.A., Honjo, K., Kapp, L.M., Goldsmith, K., Bucy, R.P. 2007, J. Immunol., pp. 179: 2105-2114.

173. Opposing effects of TGF-beta and IL-15 cytokines control the number of short lived effecctor CD8+ T cells. Sanjabi, S, Mosaheb, M.M., Flavell, R.A. 2009, Immunity., pp. 31; 131-144.

174. Synergestic enhancement of CD8+ T cell mediated tumor vaccines efficacy by an anti-tumor forming growth factor-beta monoclonal antibody. . Terabe, M., Ambrosino, E., Takaku, S. et al. 2009, Clin. Cancer Res., pp. 15; 6560-9.

175. IL-12 enhances CTL synapse formationand induces self-reactivity. Markinewicz, MA, Wise, EL, Buchwald, ZS et al. 2009, J. Immunol., pp. 182: 1351-1362.

176. Tumor specific Th17-polarized cells eradicate large established melanoma. Muranski, P., Boni, A., Antony, PA, et al. 2008, Blood, pp. 112; 362-373.

177. Type17 CD8+ T cells dispplay enhanced antitumor immunity. Hinrichs, C.S., Kaiser, A., Paulos, C.M., et al. 2008, Blood., pp. 112:362-373.

178. Marying Immunotherapy with Chemotherapy: Why Say IDO? Muller, AJ, and Prendergrast, GC. 2005, Cancer Research, pp. 65: 8065-8068.

179. Enhancing Cancer Vaccine efficacy via Modulationof the Tumor Environment. Disis, ML. 2009, Clin Cancer Res, pp. 15: 6476-6478.

180. Systemic inhibition of transforming growth factor beta 1 in glioma bearing mice improves the therapeutic efficacy of glioma-associated antigen peptide vaccines. Ueda, R., Fujita, M., Zhu, X., et al. 2009, Clin. Cancer res., pp. 15: 6551-9.

181. Immune modulation by silencing IL-12 productionin dendritic cells using smal interfering RNA. Hill, JA, Ichim, TE, Kusznieruk, KP, et al. 2003, J. Immunol, pp. 171:809-813.

182. Immune modulation and tolerance induction by RelB-silenced dentritic cells through RNA interference. Li, M. Zang, X, Zheng, X, et al. 2007, J. Immunol, pp. 178: 5480-7.

183. RNAi mediated CD40-CD54 interruption promotes tolerance in autoimmune arthritis. . Zheng, X., Suzuki, M., Zhang, X., et al. 2010, Arthritis Res. Ther., p. 12:R13.

184. Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival. Min, WP. Gorczynki, R., huang, XY et al. 2000, J. Immunol., pp. 164:161-167.

185. LF15-0195 generates tolerogenic dendritic cells by supressionof NF-kappaB signaling through inhibitionof IKK activity. . Yang, J., Bernier, SM, Ichim, TE, et al. 2003, J Leukoc. Biol., pp. 74: 438-447.

186. RNA interfrence: A potent tool for gene specific therapeutics. . Ichim, TE, Li, M., Qian, H., Popov, HI, Rycerz, K., Zheng, X., White, D., Zhong, R., and Min, WP. 2004, Am. J. Transplant, pp. 4:1227-1236.

187. A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Zheng, X., Vladau, C., Zhang, X. et al. 2009, Blood, pp. 113:2646-2654.

188. Reinstalling Antitumor Immunity by Inhibiting Tumor derived ImmunoSupressive Molecule IDO through RNA interference. Zheng, X et al. 2006, Int. Journal of Immunology., pp. 177:5639-5646.

189. Roles of TGFbeta in metastasis. Padua, D., Massague, J. 2009, Cell Res., pp. 19;89-102.

190. Functional expression of indolamine2,3-dioxygenase by murine CDalpha+dendritic cells. Fallarino, F., Vacca, C, Orabona, C et al. 2002, Int Immunol., pp. 14:65-8.

191. Indolamine2,3-dioxygenase controls conversion of Fox3+ Tregs to TH17-like cells in tumor draining lymph nodes. Sharma, MD, Hou, DY, Liu, Y et al. 2009, Blood, pp.113: 6102-11.

192. IDO upregulates regulatory T cells via tryptoophan catabolite and supresses encephalitogenic T cell responses in experimental autoimmune encephalomyelitis. Yan, Y, Zhang, GX, Gran, B et al. 2010, J Immunol, pp. 185; 5953-61.

193. IDO activates regulatory T cells and blocks their conversion into Th-17-like T cells. Baban, B, Chandler, PR, Sharma, MD et al. 2009, J Immunol, pp. 183; 2475-83.

194. Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletionof regulatory T cells. Dannull, J., Farrand, KJ, Mathews, SA, et al. 2005, J Clin Invest, pp. 115: 3623-33.

195. 1-MT enhances potency of tumor cell lysate pulled dentritic cells against pancreatic adenocarcinoma by downregulating percentage of Tregs. Li, Y, Xu, J, Zhou, H. et al. 2010, J Huazhong Univ Sci Technol Med Sci , pp. 30: 344-8.

196. siRNA mediated antitumorigenesis for drug target validation and therapeutics. Lu, PY, Xie, FY and Woodle, MC. 2003, Curr Opin Mol. Ther., pp. 5:225-234.

197. Stable supression of tumorigenicity by virus-mediated RNA interference. Brumellkamp, TR, Bernards, R, Agami, R. 2002, Cancer Cell, pp. 2; 243-247.

198. Small interferring RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells. Verma, UN, Surabhi, RM, Schmaltieg, A., Becerra, C., Gaynor, RB. 2003, Clin. Cancer. Res., pp. 9:1291-1300.

199. siRNA mediated inhibition of vascular endothelial growth factor severely limits tumor resistance to antiangiogeneic thromboposdin-1 and slows tumor vascularization and growth. Filleur, S., Courtin, A, Ait-Si-Ali, S., Guglielmi, J., Merel, C., Harel-Bellan, A., CLezardin, P., and Cabon, F. 2003, Cancer Res, pp. 63; 3919-3922.

200. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. . Wang, J., et al. 2006, J. Biol.Chem. , pp. 281:22021–22028. 201. Bin1 functionally interacts with Myc in cells and inhibits cell proliferation by multiple mechanisms. Elliott, K. et al. 1999, Oncogene , pp. 18, 3564−3573 .

202. Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. . Ge, K. et al. 1999, Proc. Natl. Acad. Sci. USA, pp. 96, 9689−9694. 

203. Losses of the tumor suppressor Bin1 in breast carcinoma are frequent and reflect deficits in a programmed cell death capacity. Ge, K. et al. 2000, Int. J. Cancer , pp. 85, 376−383.

204. Loss of heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Ge, K. et al. 2000, Int. J. Cancer , pp. 86, 155−161.

205. Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. . Tajiri, T. et al. 2003, Clin. Cancer Res., pp. 9, 3345−3355.

206. Targeted deletion of the suppressor gene Bin1/Amphiphysin2 enhances the malignant character of transformed cells. Muller, A.J., DuHadaway, J.B., Donover, P.S., Sutanto-Ward, E. & Prendergast, G.C. 2004, Cancer Biol. Ther. , p. 3.

207. Interactions of myogenic factors and the retinoblastoma protein mediates muscle commitment and cell differentiation. Gu, WJ., Scheniider,W., Condrolli,G., Kaushal,, S, Mahdavi,V., Nadal-Gnard, B. 1993, Cell, pp. 72; 309-324.

208. Structural analysis of the human BIN1 gene: evidence of tissue-specific transcriptional regualtion and alternate splicing. Wechsler-Reya, R, Sakamuro, J., Zhang, J., DuHadaway, J., and Predengast. 1998, J of Biol Chem.

209. A role for th ePutative Tuimor Supressor Bin1 in Muscle Differentiation. Wechsler-Reya, R., Elliott, KJ, Prendergast, GC. 1998, Molecular and Cellular Biology, p. 18 (1) :566.

210. The putative tumor repressor BIN1 is a short lived nuclear phosphoprotein whose localization is altered in malignant cells. Wechsler-Reya, R., Elliot, K., Herlyn, M., Prendergast, GC. 1997, Cancer Res, pp. 57: 3258-3263.

211. Transformation selective apoptosis by farnesyltransferase inhibitors requires Bin1. DuHadaway, J.B. et al. 2003, Oncogene, pp. 22, 3578−3588 (2003).

212. The c-Myc-interacting adapter protein Bin1 activates a caspase-independent cell death program. Elliott, K., Ge, K., Du, W. & Prendergast, G.C. 2000., Oncogene , pp. 19, 4669−4684.

213. Growth stimulation of human bone marrow cells in agar culture by vascular cells. Knudtzon, S., and Mortensen, BT. 1975, Blood, pp. 46 (6) 937-943.

214. Exogenous endothelial cells as accelerators of hematopoietic reconstitution. Mizer, C., Ichim, TE, Alexandrescu, DT, DAsanu, CA, Ramos, F., Turner, A., Woods, EJ, Bogon, V., Murphy, MP, Koos, D., and Patel, A. 2013, J. Translational Medicine, p. 10: 231.

215. Dissecting the bone marrow microenvironment . Torok-Storb, B. et al. 1999, Annals of New York Academy of Science, pp. 872: 164-170. 217. Yuasa, XX and Ball YY. 2011.

218. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int. , pp. 37(2):105-8. http://dx.doi.org:/10.1002/cbin.10023.

219. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

220. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

Read Full Post »

 

Abstract:

The immune response mechanism is the holy grail of the human defense system for health.   IDO, indolamine 2, 3-dioxygenase, is a key gene for homeostasis of immune responses and producing an enzyme catabolizing the first rate-limiting step in tryptophan degradation metabolism. The hemostasis of immune system is complicated.  In this review, the  properties of IDO such as basic molecular genetics, biochemistry and genesis will be discussed.

IDO belongs to globin gene family to carry oxygen and heme.  The main function and genesis of IDO comes from the immune responses during host-microbial invasion and choice between tolerance and immunegenity.  In human there are three kinds of IDOs, which are IDO1, IDO2, and TDO, with distinguished mechanisms and expression profiles. , IDO mechanism includes three distinguished pathways: enzymatic acts through IFNgamma, non-enzymatic acts through TGFbeta-IFNalpha/IFNbeta and moonlighting acts through AhR/Kyn.

The well understood functional genomics and mechanisms is important to translate basic science for clinical interventions of human health needs. In conclusion, overall purpose is to find a method to manipulate IDO to correct/fix/modulate immune responses for clinical applications.

The first part of the review concerns the basic science information gained overall several years that lay the foundation where translational research scientist should familiar to develop a new technology for clinic. The first connection of IDO and human health came from a very natural event that is protection of pregnancy in human. The focus of the translational medicine is treatment of cancer or prevention/delay cancer by stem cell based Dendritic Cell Vaccine (DCvax) development.

Table of Contents:

  • Abstract

1         Introduction: IDO gene encodes a heme enzyme

2        Location, location, location

3        Molecular genetics

4        Types of IDO:

4.1       IDO1,

4.2       IDO2,

4.3       IDO-like proteins

5        Working mechanisms of IDO

6        Infection Diseases and IDO

7. Conclusion

  1. 1.     Indoleamine 2, 3-dioxygenase (IDO) gene encodes a heme enzyme

IDO is a key homeostatic regulator and confined in immune system mechanism for the balance between tolerance and immunity.  This gene encodes indoleamine 2, 3-dioxygenase (IDO) – a heme enzyme (EC=1.13.11.52) that catalyzes the first rate-limiting step in tryptophan catabolism to N-formyl-kynurenine and acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin.

The basic genetic information describes indoleamine 2, 3-dioxygenase 1 (IDO1, IDO, INDO) as an enzyme located at Chromosome 8p12-p11 (5; 6) that active at the first step of the Tryptophan catabolism.    The cloned gene structure showed that IDO contains 10 exons ad 9 introns (7; 8) producing 9 transcripts.

After alternative splicing only five of the transcripts encode a protein but the other four does not make protein products, three of transcripts retain intron and one of them create a nonsense code (7).  Based on IDO related studies 15 phenotypes of IDO is identified, of which, twelve in cancer tumor models of lung, kidney, endometrium, intestine, two in nervous system, and one HGMD- deletion.

  1. 2.     Location, Location and Location

The specific cellular location of IDO is in cytosol, smooth muscle contractile fibers and stereocilium bundle. The expression specificity shows that IDO is present very widely in all cell types but there is an elevation of expression in placenta, pancreas, pancreas islets, including dendritic cells (DCs) according to gene atlas of transcriptome (9).  Expression of IDO is common in antigen presenting cells (APCs), monocytes (MO), macrophages (MQs), DCs, T-cells, and some B-cells. IDO present in APCs (10; 11), due to magnitude of role play hierarchy and level of expression DCs are the better choice but including MOs during establishment of three DC cell subset, CD14+CD25+, CD14++CD25+ and CD14+CD25++ may increase the longevity and efficacy of the interventions.

IDO is strictly regulated and confined to immune system with diverse functions based on either positive or negative stimulations. The positive stimulations are T cell tolerance induction, apoptotic process, and chronic inflammatory response, type 2 immune response, interleukin-12 production (12).  The negative stimulations are interleukin-10 production, activated T cell proliferation, T cell apoptotic process.  Furthermore, there are more functions allocating fetus during female pregnancy; changing behavior, responding to lipopolysaccharide or multicellular organismal response to stress possible due to degradation of tryptophan, kynurenic acid biosynthetic process, cellular nitrogen compound metabolic process, small molecule metabolic process, producing kynurenine process (13; 14; 15).

IDO plays a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity (16; 17; 18; 19).

 

 3.     Molecular Genetics of IDO:

A: Structure of human IDO2 gene and transcripts. Complete coding region is 1260 bps encoding a 420 aa polypeptide. Alternate splice isoforms lacking the exons indicated are noted. Hatch boxes represent a frameshift in the coding region to an alternate reading frame leading to termination. Black boxes represent 3' untranslated regions. Nucleotide numbers, intron sizes, and positioning are based on IDO sequence files NW_923907.1 and GI:89028628 in the Genbank database. (reference: http://atlasgeneticsoncology.org/Genes/IDO2ID44387ch8p11.html)

A: Structure of human IDO2 gene and transcripts. Complete coding region is 1260 bps encoding a 420 aa polypeptide. Alternate splice isoforms lacking the exons indicated are noted. Hatch boxes represent a frameshift in the coding region to an alternate reading frame leading to termination. Black boxes represent 3′ untranslated regions. Nucleotide numbers, intron sizes, and positioning are based on IDO sequence files NW_923907.1 and GI:89028628 in the Genbank database.
(reference: http://atlasgeneticsoncology.org/Genes/IDO2ID44387ch8p11.html)

Molecular genetics data from earlier findings based on reporter assay results showed that IDO promoter is regulated by ISRE-like elements and GAS-sequence at -1126 and -1083 region (20).  Two cis-acting elements are ISRE1 (interferon sequence response element 1) and interferon sequence response element 2 (ISRE2).

Analyses of site directed and deletion mutation with transfected cells demonstrated that introduction of point mutations at these elements decreases the IDO expression. Removing ISRE1 decreases the effects of IFNgamma induction 50 fold and deleting ISRE1 at -1126 reduced by 25 fold (3). Introducing point mutations in conserved t residues at -1124 and -1122 (from T to C or G) in ISRE consensus sequence NAGtttCA/tntttNCC of IFNa/b inducible gene ISG4 eliminates the promoter activity by 24 fold (21).

ISRE2 have two boxes, X box (-114/1104) and Y Box 9-144/-135), which are essential part of the IFNgamma response region of major histocompatibility complex class II promoters (22; 23).  When these were removed from ISRE2 or introducing point mutations at two A residues of ISRE2 at -111 showed a sharp decrease after IFNgamma treatment by 4 fold (3).

The lack of responses related to truncated or deleted IRF-1 interactions whereas IRF-2, Jak2 and STAT91 levels were similar in the cells, HEPg2 and ME180 (3). Furthermore, 748 bp deleted between these elements did not affect the IDO expression, thus the distance between ISRE1 and ISRE2 elements have no function or influence on IDO (3; 24)

B: Amino acid alignment of IDO and IDO2. Amino acids determined by mutagenesis and the crystal structure of IDO that are critical for catalytic activity are positioned below the human IDO sequence. Two commonly occurring SNPs identified in the coding region of human IDO2 are shown above the sequence which alter a critical amino acid (R248W) or introduce a premature termination codon (Y359stop).

B: Amino acid alignment of IDO and IDO2. Amino acids determined by mutagenesis and the crystal structure of IDO that are critical for catalytic activity are positioned below the human IDO sequence. Two commonly occurring SNPs identified in the coding region of human IDO2 are shown above the sequence which alter a critical amino acid (R248W) or introduce a premature termination codon (Y359stop).

4.     There are three types of IDO in human genome:

IDO was originally discovered in 1967 in rabbit intestine (25). Later, in 1990 the human IDO gene is cloned and sequenced (7).  However, its importance and relevance in immunology was not created until prevention of allocation of fetal rejection and founding expression in wide range of human cancers (26; 27).

There are three types of IDO, pro-IDO like, IDO1, and IDO2.  In addition, another enzyme called TDO, tryptophan 2, 3, dehydrogenase solely degrade L-Trp at first-rate limiting mechanism in liver and brain.

4.1.  IDO1:

IDO1 mechanism is the target for immunotherapy applications. The initial discovery of IDO in human physiology is protection of pregnancy (1) since lack of IDO results in premature recurrent abortion (28; 26; 29).   The initial rate-limiting step of tryptophan metabolism is catalyzed by either IDO or tryptophan 2, 3-dioxygenase (TDO).

Structural studies of IDO versus TDO presenting active site environments, conserved Arg 117 and Tyr113, found both in TDO and IDO for the Tyr-Glu motif, but His55 in TDO replaced by Ser167b in IDO (30; 2). As a result, they are regulated with different mechanisms (1; 2) (30).  The short-lived TDO, about 2h, responds to level of tryptophan and its expression regulated by glucorticoids (31; 32).  Thus, it is a useful target for regulation and induced by tryptophan so that increasing tryptophan induces NAD biosynthesis. Whereas, IDO is not activated by the level of Trp presence but inflammatory agents with its interferon stimulated response elements (ISRE1 and ISRE2) in its (33; 34; 35; 36; 3; 10) promoter.

TDO promoter contains glucorticoid response elements (37; 38) and regulated by glucocorticoids and other available amino acids for gluconeogenesis. This is how IDO binds to only immune response cells and TDO relates to NAD biosynthesis mechanisms. Furthermore, TDO is express solely in liver and brain (36).  NAD synthesis (39) showed increased IDO ubiquitous and TDO in liver and causing NAD level increase in rat with neuronal degeneration (40; 41).  NAM has protective function in beta-cells could be used to cure Type1 diabetes (40; 42; 43). In addition, knowledge on NADH/NAD, Kyn/Trp or Trp/Kyn ratios as well as Th1/Th2, CD4/CD8 or Th17/Threg are equally important (44; 40).

Active site of IDO–PI complex. (A) Stereoview of the residues around the heme of IDO viewed from the side of heme plane. The proximal ligand H346 is H-bonded to wa1. The 6-propionate of the heme contacts with wa2 and R343 Nε. The wa2 is H-bonded to wa1, L388 O, and 6-propionate. Mutations of F226, F227, and R231 do not lose the substrate affinity but produce the inactive enzyme. Two CHES molecules are bound in the distal pocket. The cyclohexan ring of CHES-1 (green) contacts with F226 and R231. The 7-propionate of the heme interacts with the amino group of CHES-1 and side chain of Ser-263. The mutational analyses for these distal residues are shown in Table 1. (B) Top view of A by a rotation of 90°. The proximal residues are omitted. (http://www.pnas.org/content/103/8/2611/F3.expansion.html)

Active site of IDO–PI complex. (A) Stereoview of the residues around the heme of IDO viewed from the side of heme plane. The proximal ligand H346 is H-bonded to wa1. The 6-propionate of the heme contacts with wa2 and R343 Nε. The wa2 is H-bonded to wa1, L388 O, and 6-propionate. Mutations of F226, F227, and R231 do not lose the substrate affinity but produce the inactive enzyme. Two CHES molecules are bound in the distal pocket. The cyclohexan ring of CHES-1 (green) contacts with F226 and R231. The 7-propionate of the heme interacts with the amino group of CHES-1 and side chain of Ser-263. The mutational analyses for these distal residues are shown in Table 1. (B) Top view of A by a rotation of 90°. The proximal residues are omitted. (http://www.pnas.org/content/103/8/2611/F3.expansion.html)

4.2. IDO2:

The third type of IDO, called IDO2 exists in lower vertebrates like chicken, fish and frogs (45) and in human with differential expression properties. The expression of IDO2 is only in DCs, unlike IDO1 expresses on both tumors and DCs in human tissues.  Yet, in lower invertebrates IDO2 is not inhibited by general inhibitor of IDO, D-1-methyl-tryptophan (1MT) (46).   Recently, two structurally unusual natural inhibitors of IDO molecules, EXIGUAMINES A and B, are synthesized (47).  LIP mechanism cannot be switch back to activation after its induction in IDO2 (46).

Crucial cancer progression can continue with production of IL6, IL10 and TGF-beta1 to help invasion and metastasis.  Inclusion of two common SNPs affects the function of IDO2 in certain populations.  SNP1 reduces 90% of IDO2 catalytic activity in 50% of European and Asian descent and SNP2 produce premature protein through inclusion of stop-codon in 25% of African descent lack functional IDO2 (Uniport).

4.3. IDO-like proteins: The Origin of IDO:

Knowing the evolutionary steps will helps us to identify how we can manage the regulator function to protect human health in cancer, immune disorders, diabetes, and infectious diseases.

Bacterial IDO has two types of IDOs that are group I and group II IDO (48).  These are the earliest version of the IDO, pro-IDO like, proteins with a quite complicated function.  Each microorganism recognized by a specific set of receptors, called Toll-Like Receptors (TLR), to activate the IDO-like protein expression based on the origin of the bacteria or virus (49; 35).   Thus, the genesis of human IDO originates from gene duplication of these early bacterial versions of IDO-like proteins after their invasion interactions with human host.  IDO1 only exists in mammals and fungi.

Fungi also has three types of IDO; IDOa, IDO beta, and IDO gamma (50) with different properties than human IDOs, perhaps multiple IDO is necessary for the world’s decomposers.

All globins, haemoglobins and myoglobins are destined to evolve from a common ancestor, which  is only 14-16kDa (51) length. Binding of a heme and being oxygen carrier are central to the enzyme mechanism of this family.  Globins are classified under three distinct origins; a universal globin, a compact globin, and IDO-like globin (52).  IDO like globin widely distributed among gastropodic mollusks (53; 51).  The indoleamine 2, 3-dioxygenase 1–like “myoglobin” (Myb) was discovered in 1989 in the buccal mass of the abalone Sulculus diversicolor (54).

The conserved region between Myb and IDO-like Myb existed for at least 600 million years (53).  Even though the splice junction of seven introns was kept intact, the overall homolog region between Myb and IDO is only about 35%.

No significant evolutionary relationship is found between them after their amino acid sequence of each exon is compared to usual globin sequences. This led the hint that molluscan IDO-like protein must have other functions besides carrying oxygen, like myoglobin.   Alignment of S. cerevisiae cDNA, mollusk and vertebrate IDO–like globins show the key regions for controlling IDO or myoglobin function (55). These data suggest that there is an alternative pathways of myoglobin evolution.  In addition, understanding the diversity of globin may help to design better protocols for interventions of diseases.

Mechanisms of IDO:

The dichotomy of IDO mechanism lead the discovery that IDO is more than an enzyme as a versatile regulator of innate and adaptive immune responses in DCs (66; 67; 68). Meantime IDO also involve with Th2 response and B cell mediated autoimmunity showing that it has three paths, short term (acute) based on enzymatic actions, long term (chronic) based on non-enzymatic role, and moonlighting relies of downstream metabolites of tryptophan metabolism (69; 70).

IFNgamma produced by DC, MQ, NK, NKT, CD4+ T cells and CD8+ T cells, after stimulation with IL12 and IL8.  Inflammatory cytokine(s) expressed by DCs produce IFNgamma to stimulate IDO’s enzymatic reactions in acute response.  Then, TDO in liver and tryptophan catabolites act through Aryl hydrocarbon receptor induction for prevention of T cell proliferation. This mechanism is common among IDO, IDO2 (expresses in brain and liver) and TDO expresses in liver) provide an acute response for an innate immunity (30). When the pDCs are stimulated with IFNgamma, activation of IDO is go through Jak, STAT signaling pathway to degrade Trp to Kyn causing Trp depletion. The starvation of tryptophan in microenvironment inhibits generation of T cells by un-read t-RNAs and induce apoptosis through myc pathway.  In sum, lack of tryptophan halts T cell proliferation and put the T cells in apoptosis at S1 phase of cell division (71; 62).

The intermediary enzymes, functioning during Tryptophan degradation in Kynurenine (Kyn) pathway like kynurenine 3-hydroxylase and kynureninase, are also induced after stimulation with liposaccaride and proinflammatory cytokines (72). They exhibit their function in homeostasis through aryl-hydrocarbon receptor (AhR) induction by kynurenine as an endogenous signal (73; 74).  The endogenous tumor-promoting ligand of AhR are usually activated by environmental stress or xenobiotic toxic chemicals in several cellular processes like tumorigenesis, inflammation, transformation, and embryogenesis (Opitz ET. Al, 2011).

Human tumor cells constitutively produce TDO also contributes to production of Kyn as an endogenous ligand of the AhR (75; 27).  Degradation of tryptophan by IDO1/2 in tumors and tumor-draining lymph nodes occur. As a result, there are animal studies and Phase I/II clinical trials to inhibit the IDO1/2 to prevent cancer and poor prognosis (NewLink Genetics Corp. NCT00739609, 2007).

 IDO mechanism for immune response

Systemic inflammation (like in sepsis, cerebral malaria and brain tumor) creates hypotension and IDO expression has the central role on vascular tone control (63).  Moreover, inflammation activates the endothelial coagulation activation system causing coagulopathies on patients.  This reaction is namely endothelial cell activation of IDO by IFNgamma inducing Trp to Kyn conversion. After infection with malaria the blood vessel tone has decreases, inflammation induce IDO expression in endothelial cells producing Kyn causing decreased trp, lower arterial relaxation, and develop hypotension (Wang, Y. et. al 2010).  Furthermore, existing hypotension in knock out Ido mice point out a secondary mechanism driven by Kyn as an endogenous ligand to activate non-canonical NfKB pathway (63).

Another study also hints this “back –up” mechanism by a significant outcome with a differential response in pDCs against IMT treatment.  Unlike IFN gamma conditioned pDC blocks T cell proliferation and apoptosis, methyl tryptophan fails to inhibit IDO activity for activating naïve T cells to make Tregs at TGF-b1 conditioned pDCs (77; 78).

 Indoleamine-Pyrrole 2,3,-Dioxygenase; IDO dioxygenase; Indeolamine-2,3

The second role of the IDO relies on non-enzymatic action as being a signal molecule. Yet, IDO2 and TDO are devoid of this function. This role mainly for maintenance of microenvironment condition. DCs response to TGFbeta-1 exposure starts the kinase Fyn induce phosphorylation of IDO-associated immunoreceptor tyrosine–based inhibitory motifs (ITIMs) for propagation of the downstream signals involving non-canonical (anti-inflammatory) NF-kB pathway for a long term response. When the pDCs are conditioned with TGF-beta1 the signaling (68; 77; 78) Phospho Inositol Kinase3 (PIK-3)-dependent and Smad independent pathways (79; 80; 81; 82; 83) induce Fyn-dependent phosphorylation of IDO ITIMs.  A prototypic ITIM has the I/V/L/SxYxxL/V/F sequence (84), where x in place of an amino acid and Y is phosphorylation sites of tyrosines (85; 86).

Smad independent pathway stimulates SHP and PIK3 induce both SHP and IDO phosphorylation. Then, formed SHP-IDO complex can induce non-canonical (non-inflammatory) NF-kB pathway (64; 79; 80; 82) by phosphorylation of kinase IKKa to induce nuclear translocation of p52-Relb towards their targets.  Furthermore, the SHP-IDO complex also may inhibit IRAK1 (68). SHP-IDO complex activates genes through Nf-KB for production of Ido1 and Tgfb1 genes and secretion of IFNalpha/IFNbeta.  IFNa/IFNb establishes a second short positive feedback loop towards p52-RelB for continuous gene expression of IDO, TGFb1, IFNa and IFNb (87; 68).  However, SHP-IDO inhibited IRAK1 also activates p52-RelB.  Nf-KB induction at three path, one main and two positive feedback loops, is also critical.  Finally, based on TGF-beta1 induction (76) cellular differentiation occurs to stimulate naïve CD4+ T cell differentiation to regulatory T cells (Tregs).  In sum, TGF-b1 and IFNalpha/IFNbeta stimulate pDCs to keep inducing naïve T cells for generation of Treg cells at various stages, initiate, maintain, differentiate, infect, amplify, during long-term immune responses (67; 66).

Moonlighting function of Kyn/AhR is an adaptation mechanism after the catalytic (enzymatic) role of IDO depletes tryptophan and produce high concentration of Kyn induce Treg and Tr1 cell expansion leading Tregs to use TGFbeta for maintaining this environment (67; 76). In this role, Kyn pathway has positive-feedback-loop function to induce IDO expression.

In T cells, tryptophan starvation induces Gcn2-dependent stress signaling pathway, which initiates uncharged Trp-tRNA binding onto ribosomes. Elevated GCN2 expression stimulates elF2alfa phosphorylation to stop translation initiation (88). Therefore, most genes downregulated and LIP, an alternatively initiated isoform of the b/ZIP transcription factor NF-IL6/CEBP-beta (89).

This mechanism happens in tumor cells based on Prendergast group observations. As a result, not only IDO1 propagates itself while producing IFNalpha/IFNbeta, but also demonstrates homeostasis choosing between immunegenity by production of TH17or tolerance by Tregs. This mechanism acts like a see-saw. Yet, tolerance also can be broken by IL6 induction so reversal mechanism by SOC-3 dependent proteosomal degradation of the enzyme (90).  All proper responses require functional peripheral DCs to generate mature DCs for T cells to avoid autoimmunity (91).

Niacin (vitamin B3) is the final product of tryptophan catabolism and first molecule at Nicotinomic acid (NDA) Biosynthesis.  The function of IDO in tryptophan and NDA metabolism has a great importance to develop new clinical applications (40; 42; 41).  NAD+, biosynthesis and tryptophan metabolisms regulate several steps that can be utilize pharmacologically for reformation of healthy physiology (40).

IDO for protection in Microbial Infection with Toll-like Receptors

The mechanism of microbial response and infectious tolerance are complex and the origination of IDO based on duplication of microbial IDO (49).  During microbial responses, Toll-like receptors (TLRs) play a role to differentiate and determine the microbial structures as a ligand to initiate production of cytokines and pro-inflammatory agents to activate specific T helper cells (92; 93; 94; 95). Uniqueness of TLR comes from four major characteristics of each individual TLR by ligand specificity, signal transduction pathways, expression profiles and cellular localization (96). Thus, TLRs are important part of the immune response signaling mechanism to initiate and design adoptive responses from innate (naïve) immune system to defend the host.

TLRs are expressed cell type specific patterns and present themselves on APCs (DCs, MQs, monocytes) with a rich expression levels (96; 97; 98; 99; 93; 100; 101; 102; 87). Induction signals originate from microbial stimuli for the genesis of mature immune response cells.  Co-stimulation mechanisms stimulate immature DCs to travel from lymphoid organs to blood stream for proliferation of specific T cells (96).  After the induction of iDCs by microbial stimuli, they produce proinflammatory cytokines such as TNF and IL-12, which can activate differentiation of T cells into T helper cell, type one (Th1) cells. (103).

Utilizing specific TLR stimulation to link between innate and acquired responses can be possible through simple recognition of pathogen-associated molecular patterns (PAMPs) or co-stimulation of PAMPs with other TLR or non-TLR receptors, or even better with proinflammatory cytokines.   Some examples of ligand- TLR specificity shown in Table1, which are bacterial lipopeptides, Pam3Cys through TLR2 (92; 104; 105).  Double stranded (ds) RNAs through TLR3 (106; 107), Lipopolysaccharide (LPS) through TLR4, bacterial flagellin through TLR5 (108; 109), single stranded RNAs through TLR7/8 (97; 98), synthetic anti-viral compounds imiquinod through TLR 7 and resiquimod through TLR8, unmethylated CpG DNA motifs through TLR9 (Krieg, 2000).

IDO action

Then, the specificity is established by correct pairing of a TLR with its proinflammatory cytokines, so that these permutations influence creation and maintenance of cell differentiation. For example, leading the T cell response toward a preferred Th1 or Th2 response possible if the cytokines TLR-2 mediated signals induce a Th2 profile when combined with IL-2 but TLR4 mediated signals lean towards Th1 if it is combined with IL-10 or Il-12, (110; 111)  (112).

TLR ligand TLR Reference
Lipopolysaccharide, LPS TLR4 (96).  (112).
Lipopeptides, Pam3Cys TLR2 (92; 104; 105)
Double stranded (ds) RNAs TLR3 (106; 107)
Bacterial flagellin TLR5 (108; 109)
Single stranded RNAs TLR7/8 (97; 98)
Unmethylated CpG DNA motifs TLR9 (Krieg, 2000)
Synthetic anti-viral compounds imiquinod and resiquimod TLR7 and TLR8 (Lee J, 2003)

Furthermore, if the DCs are stimulated with IL-6, DCs relieve the suppression of effector T cells by regulatory T cells (113).

The modification of IDO+ monocytes manage towards specific subset of T cell activation with specific TLRs are significantly important (94).

The type of cell with correct TLR and stimuli improves or decreases the effectiveness of stimuli. Induction of IDO in monocytes by synthetic viral RNAs (isRNA) and CMV was possible, but not in monocyte derived DCs or TLR2 ligand lipopeptide Pam3Cys since single- stranded RNA ligands target TLR7/8 in monocytes derive DCs only (Lee J, 2003).  These data show that TLRs has ligand specificity, signal transduction pathways, expression profiles and cellular localization so design of experiments should follow these rules.

Conclusion:

Overall our purpose of this information is to find a method to manipulate IDO to correct/fix/modulate immune responses for clinical applications.  This first part of the review concerns the basic science information gained overall several years that lay the foundation that translational research scientist should familiar to develop a new technology for clinic. The first connection of IDO and human health came from a very natural event that is protection of pregnancy in human. The focus of the translational medicine is treatment of cancer or prevention/delay cancer by stem cell based Dendritic Cell Vaccine (DCvax) development.

References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8. . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA. . Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C.Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9,, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197.

33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH 1998Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. . Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223, doi: 10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp. doi: 10.1038/nature10491,.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878.

78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40. doi:10.1016/S0092-8674(00)81696-7.PMID 9865691. .

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810. doi:10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.doi:10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132– doi:10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271, doi: 10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31. .

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. doi: 10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606. doi: 10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11. doi: 10.1126/scisignal.2002963. .

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii: S0006-291X(13)00779-1. 10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D.Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

 

  

Read Full Post »

The immune response

The immune response (Photo credit: Wikipedia)

Confined Indolamine 2, 3 dioxygenase (IDO) Controls the Hemeostasis of Immune Responses for Good and Bad

Curator: Demet Sag, PhD, CRA, GCP

ABSTRACT:

The immune response mechanism is the holy grail of the human defense system for health.   IDO, indolamine 2, 3-dioxygenase, is a key gene for homeostasis of immune responses and producing an enzyme catabolizing the first rate-limiting step in tryptophan degradation metabolism. The hemostasis of immune system is complicated.  In this review we will discuss properties of IDO such as basic molecular genetics, biochemistry and genesis. IDO belongs to globin gene family to carry oxygen and heme.

The main function and genesis of IDO comes from the immune responses during host-microbial invasion and choice between tolerance and immunegenity. In addition IDO has a role in vascular tone as well.  In human there are three kinds of IDOs, which are IDO1, IDO2, and TDO, with distinguished mechanisms and expression profiles. , IDO mechanism includes three distinguished pathways: enzymatic acts through IFNgamma, non-enzymatic acts through TGFbeta-IFNalpha/IFNbeta and moonlighting acts through AhR/Kyn. These mechanisms and their relation with various health and disease will be presented. Overall our purpose is to find a method to manipulate IDO to correct/fix/modulate immune responses for clinical applications.

Our focus is on cancer prevention with DCvax.  The first study proving the connection between IDO and immune response came from, a very natural event, a protection of pregnancy in human. This led to discover that high IDO expression is a common factor in cancer tumors. Thus, attention promoted investigations on IDO’s role in various disease states, immune disorders, transplantation, inflammation, women health, mood disorders.  Many approaches, vaccines and adjuvants are underway to find new immunotherapies by combining the power of DCs in immune response regulation and specific direction of siRNA.  As a result, with this unique qualities of IDO, DCs and siRNA, we orchestrated a novel intervention for immunomodulation of IDO by inhibiting with small interference RNA, called siRNA-IDO-DCvax.  Proven that our DCvax created a delay and regression of tumor growth without changing the natural structure and characterization of DCs in melanoma and breast cancers in vivo.

_____________________________________________________________________________

IDO is a key homeostatic regulator and confined in immune system mechanism for the balance between tolerance and immunity.  This gene encodes indoleamine 2, 3-dioxygenase (IDO) – a heme enzyme (EC=1.13.11.52) that catalyzes the first rate-limiting step in tryptophan catabolism to N-formyl-kynurenine and acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin (1; 2; 3; 4).

The basic genetic information describes indoleamine 2, 3-dioxygenase 1 (IDO1, IDO, INDO) as an enzyme located at Chromosome 8p12-p11 (5; 6) that active at the first step of the Tryptophan catabolism.    The cloned gene structure showed that IDO contains 10 exons ad 9 introns (7; 8) producing 9 transcripts.  After alternative splicing only five of the transcripts encode a protein but the other four does not make protein products, three of transcripts retain intron and one of them create a nonsense code (7).  Based on IDO related studies 15 phenotypes of IDO is identified, of which, twelve in cancer tumor models of lung, kidney, endometrium, intestine, two in nervous system, and one HGMD- deletion.

The specific cellular location of IDO is in cytosol, smooth muscle contractile fibers and stereocilium bundle. The expression specificity shows that IDO is present very widely in all cell types but there is an elevation of expression in placenta, pancreas, pancreas islets, including dendritic cells (DCs) according to gene atlas of transcriptome (9).  Expression of IDO is common in antigen presenting cells (APCs), monocytes (MO), macrophages (MQs), DCs, T-cells, and some B-cells. IDO present in APCs (10; 11), due to magnitude of role play hierarchy and level of expression DCs are the better choice but including MOs during establishment of three DC cell subset, CD14+CD25+, CD14++CD25+ and CD14+CD25++ may increase the longevity and efficacy of the interventions.

IDO is strictly regulated and confined to immune system with diverse functions based on either positive or negative stimulations. The positive stimulations are T cell tolerance induction, apoptotic process, and chronic inflammatory response, type 2 immune response, interleukin-12 production (12).  The negative stimulations are interleukin-10 production, activated T cell proliferation, T cell apoptotic process.  Furthermore, there are more functions allocating fetus during female pregnancy; changing behavior, responding to lipopolysaccharide or multicellular organismal response to stress possible due to degradation of tryptophan, kynurenic acid biosynthetic process, cellular nitrogen compound metabolic process, small molecule metabolic process, producing kynurenine process (13; 14; 15).   IDO plays a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity (16; 17; 18; 19).

Active site of IDO–PI complex. (A) Stereoview of the residues around the heme of IDO viewed from the side of heme plane. The proximal ligand H346 is H-bonded to wa1. The 6-propionate of the heme contacts with wa2 and R343 Nε. The wa2 is H-bonded to wa1, L388 O, and 6-propionate. Mutations of F226, F227, and R231 do not lose the substrate affinity but produce the inactive enzyme. Two CHES molecules are bound in the distal pocket. The cyclohexan ring of CHES-1 (green) contacts with F226 and R231. The 7-propionate of the heme interacts with the amino group of CHES-1 and side chain of Ser-263. The mutational analyses for these distal residues are shown in Table 1. (B) Top view of A by a rotation of 90°. The proximal residues are omitted. (http://www.pnas.org/content/103/8/2611/F3.expansion.html)

Active site of IDO–PI complex. (A) Stereoview of the residues around the heme of IDO viewed from the side of heme plane. The proximal ligand H346 is H-bonded to wa1. The 6-propionate of the heme contacts with wa2 and R343 Nε. The wa2 is H-bonded to wa1, L388 O, and 6-propionate. Mutations of F226, F227, and R231 do not lose the substrate affinity but produce the inactive enzyme. Two CHES molecules are bound in the distal pocket. The cyclohexan ring of CHES-1 (green) contacts with F226 and R231. The 7-propionate of the heme interacts with the amino group of CHES-1 and side chain of Ser-263. The mutational analyses for these distal residues are shown in Table 1. (B) Top view of A by a rotation of 90°. The proximal residues are omitted. (http://www.pnas.org/content/103/8/2611/F3.expansion.html)

Molecular genetics data from earlier findings based on reporter assay results showed that IDO promoter is regulated by ISRE-like elements and GAS-sequence at -1126 and -1083 region (20).

Two cis-acting elements are ISRE1 (interferon sequence response element 1) and interferon sequence response element 2 (ISRE2).    Analyses of site directed and deletion mutation with transfected cells demonstrated that introduction of point mutations at these elements decreases the IDO expression. Removing ISRE1 decreases the effects of IFNgamma induction 50 fold and deleting ISRE1 at -1126 reduced by 25 fold (3). Introducing point mutations in conserved t residues at -1124 and -1122 (from T to C or G) in ISRE consensus sequence NAGtttCA/tntttNCC of IFNa/b inducible gene ISG4 eliminates the promoter activity by 24 fold (21).

ISRE2 have two boxes, X box (-114/1104) and Y Box 9-144/-135), which are essential part of the IFNgamma response region of major histocompatibility complex class II promoters (22; 23).  When these were removed from ISRE2 or introducing point mutations at two A residues of ISRE2 at -111 showed a sharp decrease after IFNgamma treatment by 4 fold (3).  The lack of responses related to truncated or deleted IRF-1 interactions whereas IRF-2, Jak2 and STAT91 levels were similar in the cells, HEPg2 and ME180 (3). Furthermore, 748 bp deleted between these elements did not affect the IDO expression, thus the distance between ISRE1 and ISRE2 elements have no function or influence on IDO (3; 24)

There are three types of IDO in human genome:

IDO was originally discovered in 1967 in rabbit intestine (25). Later, in 1990 the human IDO gene is cloned and sequenced (7).  However, its importance and relevance in immunology was not created until prevention of allocation of fetal rejection and founding expression in wide range of human cancers (26; 27).  There are three types of IDO, pro-IDO like, IDO1, and IDO2.  In addition, another enzyme called TDO, tryptophan 2, 3, dehydrogenase solely degrade L-Trp at first-rate limiting mechanism in liver and brain.

 

IDO1 mechanism is the target for immunotherapy applications. The initial discovery of IDO in human physiology is protection of pregnancy (1) since lack of IDO results in premature recurrent abortion (28; 26; 29).   The initial rate-limiting step of tryptophan metabolism is catalyzed by either IDO or tryptophan 2, 3-dioxygenase (TDO).

Structural studies of IDO versus TDO presenting active site environments, conserved Arg 117 and Tyr113, found both in TDO and IDO for the Tyr-Glu motif, but His55 in TDO replaced by Ser167b in IDO (30; 2). As a result, they are regulated with different mechanisms (1; 2) (30).

 The short-lived TDO, about 2h, responds to level of tryptophan and its expression regulated by glucorticoids (31; 32).  Thus, it is a useful target for regulation and induced by tryptophan so that increasing tryptophan induces NAD biosynthesis. Whereas, IDO is not activated by the level of Trp presence but inflammatory agents with its interferon stimulated response elements (ISRE1 and ISRE2) in its (33; 34; 35; 36; 3; 10) promoter.

TDO promoter contains glucorticoid response elements (37; 38) and regulated by glucocorticoids and other available amino acids for gluconeogenesis. This is how IDO binds to only immune response cells and TDO relates to NAD biosynthesis mechanisms.

Furthermore, TDO is express solely in liver and brain (36).  NAD synthesis (39) showed increased IDO ubiquitous and TDO in liver and causing NAD level increase in rat with neuronal degeneration (40; 41).  NAM has protective function in beta-cells could be used to cure Type1 diabetes (40; 42; 43). In addition, knowledge on NADH/NAD, Kyn/Trp or Trp/Kyn ratios as well as Th1/Th2, CD4/CD8 or Th17/Threg are equally important (44; 40).

The third type of IDO, called IDO2 exists in lower vertebrates like chicken, fish and frogs (45) and in human with differential expression properties. The expression of IDO2 is only in DCs, unlike IDO1 expresses on both tumors and DCs in human tissues.  Yet, in lower invertebrates IDO2 is not inhibited by general inhibitor of IDO, D-1-methyl-tryptophan (1MT) (46).

Recently, two structurally unusual natural inhibitors of IDO molecules, EXIGUAMINES A and B, are synthesized (47).  LIP mechanism cannot be switch back to activation after its induction in IDO2 (46). Crucial cancer progression can continue with production of IL6, IL10 and TGF-beta1 to help invasion and metastasis.  Inclusion of two common SNPs affects the function of IDO2 in certain populations.  SNP1 reduces 90% of IDO2 catalytic activity in 50% of European and Asian descent and SNP2 produce premature protein through inclusion of stop-codon in 25% of African descent lack functional IDO2 (Uniport).

The Origin of IDO:

A: Structure of human IDO2 gene and transcripts. Complete coding region is 1260 bps encoding a 420 aa polypeptide. Alternate splice isoforms lacking the exons indicated are noted. Hatch boxes represent a frameshift in the coding region to an alternate reading frame leading to termination. Black boxes represent 3' untranslated regions. Nucleotide numbers, intron sizes, and positioning are based on IDO sequence files NW_923907.1 and GI:89028628 in the Genbank database. (reference: http://atlasgeneticsoncology.org/Genes/IDO2ID44387ch8p11.html)

A: Structure of human IDO2 gene and transcripts. Complete coding region is 1260 bps encoding a 420 aa polypeptide. Alternate splice isoforms lacking the exons indicated are noted. Hatch boxes represent a frameshift in the coding region to an alternate reading frame leading to termination. Black boxes represent 3′ untranslated regions. Nucleotide numbers, intron sizes, and positioning are based on IDO sequence files NW_923907.1 and GI:89028628 in the Genbank database.
(reference: http://atlasgeneticsoncology.org/Genes/IDO2ID44387ch8p11.html)

Knowing the evolutionary steps will helps us to identify how we can manage the regulator function to protect human health in cancer, immune disorders, diabetes, and infectious diseases.   Bacterial IDO has two types of IDOs that are group I and group II IDO (48).  These are the earliest version of the IDO, pro-IDO like, proteins with a quite complicated function.  Each microorganism recognized by a specific set of receptors, called Toll-Like Receptors (TLR), to activate the IDO-like protein expression based on the origin of the bacteria or virus (49; 35).  

Thus, the genesis of human IDO originates from gene duplication of these early bacterial versions of IDO-like proteins after their invasion interactions with human host.  IDO1 only exists in mammals and fungi.  Fungi also has three types of IDO; IDOa, IDO beta, and IDO gamma (50) with different properties than human IDOs, perhaps multiple IDO is necessary for the world’s decomposers.

All globins, haemoglobins and myoglobins, destined to evolve from a common ancestor that is only 14-16kDa (51) length. Binding of a heme and being oxygen carrier are central to the enzyme mechanism of this family.  Globins are classified under three distinct origins; a universal globin, a compact globin, and IDO-like globin (52).  IDO like globin widely distributed among gastropodic mollusks (53; 51).

The indoleamine 2, 3-dioxygenase 1–like “myoglobin” (Myb) was discovered in 1989 in the buccal mass of the abalone Sulculus diversicolor (54).  The conserved region between Myb and IDO-like Myb existed for at least 600 million years (53).  Even though the splice junction of seven introns was kept intact, the overall homolog region between Myb and IDO is only about 35%.  No significant evolutionary relationship is found between them after their amino acid sequence of each exon is compared to usual globin sequences. This led the hint that molluscan IDO-like protein must have other functions besides carrying oxygen, like myoglobin.   Alignment of S. cerevisiae cDNA, mollusk and vertebrate IDO–like globins show the key regions for controlling IDO or myoglobin function (55). These data suggest that there is an alternative pathways of myoglobin evolution.  In addition, understanding the diversity of globin may help to design better protocols for interventions of diseases.

B: Amino acid alignment of IDO and IDO2. Amino acids determined by mutagenesis and the crystal structure of IDO that are critical for catalytic activity are positioned below the human IDO sequence. Two commonly occurring SNPs identified in the coding region of human IDO2 are shown above the sequence which alter a critical amino acid (R248W) or introduce a premature termination codon (Y359stop).

B: Amino acid alignment of IDO and IDO2. Amino acids determined by mutagenesis and the crystal structure of IDO that are critical for catalytic activity are positioned below the human IDO sequence. Two commonly occurring SNPs identified in the coding region of human IDO2 are shown above the sequence which alter a critical amino acid (R248W) or introduce a premature termination codon (Y359stop).

The Immune Cells and IDO in DCs:

DCs are the orchestrator of the immune response (56; 57; 58) with list of functions in uptake, processing, and presentation of antigens; activation of effector cells, such as T-cells and NK-cells; and secretion of cytokines and other immune-modulating molecules to direct the immune response. The differential regulation of IDO in distinct DC subsets is widely studied to delineate and correct immune homeostasis during autoimmunity, infection and cancer and the associated immunological outcomes.

Genesis of antigen presenting cells (APCs), eventually the immune system, require migration of monocytes (MOs), which is originated in bone marrow. Then, these MOs move from bloodstream to other tissues to become macrophages and DCs (59; 60). Initiation of immune response requires APCs to link resting helper T-cell with the matching antigen to protect body. DCs are superior to MQs and MOs in their immune action model. When DCs are first described (61) and classified, their role is determined as a highly potent antigen-presenting cell (APC) subset with 100 to 1000-times more effective than macrophages and B-cells in priming T-cells. Both MQs and monocytes phagocytize the pathogen, and their cell structure contains very large nucleus and many internal vesicles. However, there is a nuance between MQ and DCs, since DCs has a wider capacity of stimulation, because MQs activates only memory T cells, yet DCs can activate both naïve and memory T cells.

DCs are potent activators of T cells and they also have well controlled regulatory roles. DC properties determine the regulation regardless of their origin or the subset of the DCs.  DCs react after identification of the signals or influencers for their inhibitory, stimulatory or regulatory roles, before they express a complex repertoire of positive and negative cytokines, transmembrane proteins and other molecules. Thus, “two signal theory” gains support with a defined rule.

The combination of two signals, their interaction with types of cells and time are critical. In short, specificity and time are matter for a proper response.  When IDO mRNA expression is activated with CTL40 ligand and IFNgamma, IDO results inhibition of T cell production (4).  However, if DCs are inhibited by 1MT, an inhibitor of IDO, the response stop but IgG has no affect (10).  In addition, if the stimulation is started by a tryptophan metabolite, which is downstream of IDO, such as 3-hydroxyantranilic or quinolinic acids, it only inhibits Th1 but not Th2 subset of T cells (62). Furthermore, inclusion of signal molecules, such as Fas Ligand, cytochrome c, and pathways also differ in the T cell differentiation mechanisms due to combination, time and specificity of two-signals.  The co-culture experiments are great tool to identify specific stimuli in disease specific microenvironment (63; 12; 64) for discovering the mechanism and interactions between molecules in gene regulation, biochemical mechanism and physiological function during cell differentiation.

As a result, the simplest differential cell development from the early development of DCs impact the outcome of the data. For example, collection of MOs from peripheral blood mononuclear cells (PBMCs) with IL4 and GM-CSF leads to immature DCs (iDCs). On next step, treatment of iDCs with tumor necrosis factor (TNF) or other plausible cytokines (TGFb1, IFNgamma, IFNalpha,  IFNbeta, IL6 etc.) based on the desired outcome differentiate iDCs  into mature DCs (mDCs). DCs live only up to a week but MOs and generated MQs can live up to a month in the given tissue. B cells inhibit T cell dependent immune responses in tumors (65).

Mechanisms of IDO:

IDO mechanism for immune response

The dichotomy of IDO mechanism lead the discovery that IDO is more than an enzyme as a versatile regulator of innate and adaptive immune responses in DCs (66; 67; 68). Meantime IDO also involve with Th2 response and B cell mediated autoimmunity showing that it has three paths, short term (acute) based on enzymatic actions, long term (chronic) based on non-enzymatic role, and moonlighting relies of downstream metabolites of tryptophan metabolism (69; 70).

IFNgamma produced by DC, MQ, NK, NKT, CD4+ T cells and CD8+ T cells, after stimulation with IL12 and IL8.  Inflammatory cytokine(s) expressed by DCs produce IFNgamma to stimulate IDO’s enzymatic reactions in acute response.  Then, TDO in liver and tryptophan catabolites act through Aryl hydrocarbon receptor induction for prevention of T cell proliferation. This mechanism is common among IDO, IDO2 (expresses in brain and liver) and TDO (expresses in liver) provide an acute response for an innate immunity (30). When the pDCs are stimulated with IFNgamma, activation of IDO is go through Jak, STAT signaling pathway to degrade Trp to Kyn causing Trp depletion. The starvation of tryptophan in microenvironment inhibits generation of T cells by un-read t-RNAs and induce apoptosis through myc pathway.  In sum, lack of tryptophan halts T cell proliferation and put the T cells in apoptosis at S1 phase of cell division (71; 62).

 T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

The intermediary enzymes, functioning during Tryptophan degradation in Kynurenine (Kyn) pathway like kynurenine 3-hydroxylase and kynureninase, are also induced after stimulation with liposaccaride and proinflammatory cytokines (72). They exhibit their function in homeostasis through aryl-hydrocarbon receptor (AhR) induction by kynurenine as an endogenous signal (73; 74).  The endogenous tumor-promoting ligand of AhR are usually activated by environmental stress or xenobiotic toxic chemicals in several cellular processes like tumorigenesis, inflammation, transformation, and embryogenesis (Opitz ET. Al, 2011).

Human tumor cells constitutively produce TDO also contributes to production of Kyn as an endogenous ligand of the AhR (75; 27).  Degradation of tryptophan by IDO1/2 in tumors and tumor-draining lymph nodes occur. As a result, there are animal studies and Phase I/II clinical trials to inhibit the IDO1/2 to prevent cancer and poor prognosis (NewLink Genetics Corp. NCT00739609, 2007).

Systemic inflammation (like in sepsis, cerebral malaria and brain tumor) creates hypotension and IDO expression has the central role on vascular tone control (63).  Moreover, inflammation activates the endothelial coagulation activation system causing coagulopathies on patients.  This reaction is namely endothelial cell activation of IDO by IFNgamma inducing Trp to Kyn conversion. After infection with malaria the blood vessel tone has decreases, inflammation induce IDO expression in endothelial cells producing Kyn causing decreased trp, lower arterial relaxation, and develop hypotension (Wang, Y. et. al 2010).  Furthermore, existing hypotension in knock out Ido mice point out a secondary mechanism driven by Kyn as an endogenous ligand to activate non-canonical NfKB pathway (63). Another study also hints this “back –up” mechanism by a significant outcome with a differential response in pDCs against IMT treatment.  Unlike IFN gamma conditioned pDC blocks T cell proliferation and apoptosis, methyl tryptophan fails to inhibit IDO activity for activating naïve T cells to make Tregs at TGF-b1 conditioned pDCs (77; 78).

The second role of the IDO relies on non-enzymatic action as being a signal molecule. Yet, IDO2 and TDO are devoid of this function. This role mainly for maintenance of microenvironment condition. DCs response to TGFbeta-1 exposure starts the kinase Fyn induce phosphorylation of IDO-associated immunoreceptor tyrosine–based inhibitory motifs (ITIMs) for propagation of the downstream signals involving non-canonical (anti-inflammatory) NF-kB pathway for a long term response.

When the pDCs are conditioned with TGF-beta1 the signaling (68; 77; 78) Phospho Inositol Kinase3 (PIK-3)-dependent and Smad independent pathways (79; 80; 81; 82; 83) induce Fyn-dependent phosphorylation of IDO ITIMs.  A prototypic ITIM has the I/V/L/SxYxxL/V/F sequence (84), where x in place of an amino acid and Y is phosphorylation sites of tyrosines (85; 86).  Smad independent pathway stimulates SHP and PIK3 induce both SHP and IDO phosphorylation. Then, formed SHP-IDO complex can induce non-canonical (non-inflammatory) NF-kB pathway (64; 79; 80; 82) by phosphorylation of kinase IKKa to induce nuclear translocation of p52-Relb towards their targets.  Furthermore, the SHP-IDO complex also may inhibit IRAK1 (68).  SHP-IDO complex activates genes through Nf-KB for production of Ido1 and Tgfb1 genes and secretion of IFNalpha/IFNbeta.  IFNa/IFNb establishes a second short positive feedback loop towards p52-RelB for continuous gene expression of IDO, TGFb1, IFNa and IFNb (87; 68).  However, SHP-IDO inhibited IRAK1 also activates p52-RelB.  Nf-KB induction at three path, one main and two positive feedback loops, is also critical.  Finally, based on TGF-beta1 induction (76) cellular differentiation occurs to stimulate naïve CD4+ T cell differentiation to regulatory T cells (Tregs).  In sum, TGF-b1 and IFNalpha/IFNbeta stimulate pDCs to keep inducing naïve T cells for generation of Treg cells at various stages, initiate, maintain, differentiate, infect, amplify, during long-term immune responses (67; 66).

Moonlighting function of Kyn/AhR is an adaptation mechanism after the catalytic (enzymatic) role of IDO depletes tryptophan and produce high concentration of Kyn induce Treg and Tr1 cell expansion leading Tregs to use TGFbeta for maintaining this environment (67; 76). In this role, Kyn pathway has positive-feedback-loop function to induce IDO expression.

TABLE 3- Kyn induced Genes

Table 2: Kyn induced genes based on the only microarray analysis (based on Opitz et. al 2011 data)
  Upregulators Phenotype Location
 Upregulators MYC Oncogene myc
avian myelocytomatosis viral oncogene homolog
protooncogene homologous to myelocytomatosis virus
INDIRECTLY MANIPULATED TARGET
NfKB complex Inappropriate activation of NF-kappa-B has been linked to inflammatory events associated with autoimmune arthritis, asthma, septic shock, lung fibrosis, glomerulonephritis, atherosclerosis, and AIDS. In contrast, complete and persistent inhibition of NF-kappa-B has been linked directly to apoptosis, inappropriate immune cell development, and delayed cell growth. 10q24.32POSSIBLE INDIRECTLY MANIPULATEDTARGET   4q24 
  Downregulators
       

 

ALDH1A3(ALDEHYDE DEHYDROGENASE 1 FAMILY, MEMBER A3) An unique ALDH isozyme in human saliva 15q26.3
ARNT2,ARYL HYDROCARBON RECEPTOR NUCLEAR TRANSLOCATOR 2 Member of a novel transcription factor family consisting of a conserved basic helix-loop-helix (bhlh) structural motif contiguous with a PAS domain. Members of this family include PER, the aryl hydrocarbon receptor,SIM1,and HIF1A. 15q25.1
C2CD2 Myogenesis in C2C12 mouse myoblasts by DUX4 and inhibited zebrafish development past gastrulation or caused severe developmental abnormalities in the surviving embryos. 4q35.2
CDC42EP2,CDC42 EFFECTOR PROTEIN 2 A small RHO gtpase, regulates the formation of F-actin-containing structures through its interaction with several downstream effector proteins.  11q13.1
 CDH1,CADHERIN 1;  Uvomorulin, a specific calcium ion-dependent cell adhesion molecule, expresses its adhesive function during the preimplantation stage of development and in epithelial cells,Endometrial carcinoma, somatic, Ovarian carcinoma, somatic, Gastric cancer, familial diffuse, with or without cleft lip and/or palate, Breast cancer, lobular, Prostate cancer, susceptibility to. 16q22.1
CENPACENTROMERIC PROTEIN A;  Centromeric proteins, see CENPB 2p23.3
CREB3L2cAMP RESPONSE ELEMENT-BINDING PROTEIN 3-LIKE 2; Member of the old astrocyte specifically induced substance (OASIS) DNA binding and basic leucine zipper dimerization (bzip) family of transcription factors, which includes CREB3 and CREB4. 7q33
CYP1B1,CYTOCHROME P450, SUBFAMILY I, POLYPEPTIDE 1
Glaucoma 3A, primary open angle, congenital, juvenile,Or adult onset, Peters anomaly 231300
2p22.2
EGR; Discovered first as a putative G0/G1 switch regulatory gene in human blood lymphocyte cultures and named G0S30 (Forsdyke, 1985). Sequence analysis of the murine gene predicted a protein with 3 DNA-binding zinc fingers POSSIBLE TARGET
EGR1;EARLY GROWTH RESPONSE 1 Displays FOS-like induction kinetics in fibroblasts, epithelial cells, and lymphocyte. EGR1 is also known as KROX24. Or nerve growth factor-induced clone A (NGFIA). 5q31.2(Sukhatme et al., 1988).
EREG;EPIREGULIN Functions as a tumor growth-inhibitory factor inducing morphologic changes and exhibits low affinity for the EGF receptor. Found on hela,on human epidermoid carcinoma A431 cells. Toyoda et al. (1995), Toyoda et al. (1997)
GPR115; G PROTEIN-COUPLED RECEPTOR 115 Expression in pregnant uterus, breast, and genitourinary tract. 6p12.3fredriksson et al. (2002) POSSIBLE target
HK2; HEXOKINASE 2 Hexokinase (EC 2.7.1.1) catalyzes the first step in glucose metabolism, using ATP for the phosphorylation of glucose to glucose-6-phosphate. Four different types of hexokinase, designated HK1, HK2, HK3, and HK4 (encoded by different genes, are present in mammalian tissues. 2p12
HTT; HUNTINGTON DISEASE  Huntington disease (HD) is caused by an expanded trinucleotide repeat (CAG)n, encoding glutamine, in the gene encoding Huntington. An autosomal dominant progressive neurodegenerative disorder with a distinct phenotype characterized by chorea, dystonia, incoordination, cognitive decline, and behavioral difficulties. 4p16.3
IGFBP4; INSULIN-LIKE GROWTH FACTOR-BINDING PROTEIN 4 Insulin-like growth factor binding proteins (igfbps), such as IGFBP4, are involved in the systemic and local regulation of IGF activity. Igfbps contain 3 structurally distinct domains each comprising approximately one-third of the molecule.). 17q21.2(Kiefer et al., 1992
IL1A; INTERLEUKIN 1-ALPHA IL1A is 1 of 2 structurally distinct forms of IL1, the other being IL1B (147720). The IL1A and IL1B proteins are synthesized by a variety of cell types, including activated macrophages, keratinocytes, stimulated B lymphocytes, and fibroblasts, and are potent mediators of inflammation and immunity 2q13(Lord et al., 1991).
IL1B; INTERLEUKIN 1-BETA {Gastric cancer risk after H. Pylori infection} 2q13
IL6INTERFERON, BETA-2; IFNB2
B-
CELL DIFFERENTIATION FACTOR, B-CELL STIMULATORY FACTOR 2; BSF2,  HEPATOCYTE STIMULATORY FACTOR; HSF,HYBRIDOMA GROWTH FACTOR; HGF 
Crohn disease-associated growth, failure}, {Diabetes, susceptibility to}, {Kaposi sarcoma, susceptibility to}, {Intracranial hemorrhage in brain, Cerebrovascular malformations, susceptibility to}, {Rheumatoid arthritis, systemic juvenile}. 7p15.3 POSSIBLE COSTIMULATION TARGET
IL8SMALL INDUCIBLE CYTOKINE SUBFAMILY B, MEMBER 8; SCYB8, MONOCYTE-DERIVED NEUTROPHIL CHEMOTACTIC FACTOR,
NEUTROPHIL-ACTIVATING PEPTIDE 1;
NAP1
GRANULOCYTE CHEMOTACTIC PROTEIN 1; GCP1
CHEMOKINE, CXC MOTIF, LIGAND 8; CXCL8
 
A member of the CXC chemokine family. These small basic heparin-binding proteins are proinflammatory and primarily mediate the activation and migration of neutrophils into tissue from peripheral blood. 4q13.3 (Hull et al., 2001). POSSIBLE  COSTIMULATION TARGET
ITGAE;INTEGRIN, ALPHA-ECD103 ANTIGEN
HUMAN MUCOSAL LYMPHOCYTE ANTIGEN 1, ALPHA SUBUNIT
Integrins are a family of cell surface adhesion molecules that play a major role in diverse cellular and developmental processes including morphogenesis, hemostasis, leukocyte activation, cellular adhesion, and homing.Immune responses at mucosal sites are mediated by lymphocytes associated with mammary glands and the gastrointestinal, genitourinary, and respiratory tracts. Cerf-Bensussan et al. (1987),Parker et al. (1992)
JUN
kiaa1644;TRIL;  TLR4 INTERACTOR WITH LEUCINE-RICH REPEATS TRIL is a component of the TLR4 complex and is induced in a number of cell types by lipopolysaccharide (LPS) 7p14.3(Carpenter et al., 2009).
LDO C1LLEUCINE ZIPPER, DOWNREGULATED IN CANCER 1; LDOC1 Contains a leucine zipper-like motif in its N-terminal region and a proline-rich region that shares marked similarity to an SH3-binding domain.  Northern blot analysis detected ubiquitous expression of LDOC1 in normal tissues, with high expression in brain and thyroid and low expression in placenta, liver, and leukocytes.  LDOC1 was expressed in 6 of 7 human breast cancer cell lines examined, but, with only 1 exception, was not expressed in any pancreatic or gastric cancer cell lines examined.  Fluorescence microscopy analysis demonstrated that the LDOC1 protein is located predominantly in the nucleus. Xq27.1 Nagasaki et al. (1999) COSTIMULATION TARGET
MID1; MIDLINE 1 Midline 1 ring finger gene
midin
finger on x and y, mouse, homolog of; fxyOpitz gbbb syndrome, type I
 xp22.2
mir-124; MICRO RNA 124-1 Lagos-Quintana et al. (2002) cloned mouse mir124a.Northern blot analysis showed that mir124a was highly expressed in mouse brain, but not in any other mouse tissues examined.Suh et al. (2004) cloned human mirna124a from embryonic stem cells. The mature mirna124a sequence is UUAAGGCACGCGGUGAAUGCCA.Sempere et al. (2004) found that mirna124 was preferentially expressed in brain. Chromosome 8
mir-290 Both of the major editing sites in pri-mir-376 rnas (+4 and +44) are located within the functionally critical 5-prime-proximal ‘seed’ sequences, critical for the hybridization of mirnas to targets, of mir-376, suggesting that edited mature mir-376 rnas may target genes different from those targeted by the unedited mir-376 rnas. Their results suggested that a single A-I base change is sufficient to redirect silencing mirnas to a new set of targets.Editing of mir-376 appears to be one of the mechanisms that ensure tight regulation of uric acid levels in select tissues such as the brain cortex. MICRO RNA 376-B; MIRN376B Kawahara et al. (2007)POSSIBLE COSTIMULATION TARGET
mir548
RB1;RB1 GENE Bladder cancer, somatic, Osteosarcoma, somatic, Retinoblastoma, Retinoblastoma, trilateral, Small cell cancer of the lung, somatic. 13q14.2Dryja et al. (1984)
RELA; V-REL AVIAN RETICULOENDOTHELIOSIS VIRAL ONCOGENE HOMOLOG A NUCLEAR FACTOR KAPPA-B, SUBUNIT 3; NFKB3
TRANSCRIPTION FACTOR NFKB3
NFKB, p65 SUBUNIT
NUCLEAR FACTOR OF KAPPA LIGHT CHAIN
GENE ENHANCER IN B CELLS 3Activated NFKB complex translocates into the nucleus and binds DNA at kappa-B-binding motifs such as 5-prime GGGRNNYYCC 3-prime or 5-prime HGGARNYYCC 3-prime (where H is A, C, or T; R is an A or G purine; and Y is a C or T pyrimidine). 
11q13.1   POSSIBLE CO-TIMULATION TARGET
SERPINB2;SERPIN PEPTIDASE INHIBITOR,Clade B (Ovalbumin), Member 2Plasminogen Activator Inhibitor, Type 2; Pai2
Planh2
Monocyte Arginine-Serpin
Monocyte-Derived Plasminogen Activator Inhibitor
Urokinase Inhibitor
The specific inhibitors of plasminogen activators have been classified into 4 immunologically distinct groups: PAI1 type PA inhibitor from endothelial cells; PAI2 type PA inhibitor from placenta, monocytes, and macrophages; urinary inhibitor; and protease-nexin-I.Plasminogen activator inhibitor-2 is also known as monocyte arg-serpin because it belongs to the superfamily of serine proteases in which the target specificity of each is determined by the amino acid residue located at its reactive center; i.e., met or val for elastase, leu for kinase, and arg for thrombin. 18q21.33
SH3RF1; SH3 DOMAIN-CONTAINING RING FINGER PROTEIN 2 Chen et al. (2010) cloned SH3RF2, which they called HEPP1. The deduced 186-amino acid protein contains a PP1-binding motif (KTVRFQ). Northern blot analysis detected 1.24- and 0.68-kb HEPP1 transcripts in heart and testis only. 5q32
STC2;STANNIOCALCIN-RELATED PROTEIN Northern blot analysis revealed that STC2 is expressed as multiple transcripts in several human tissues, with the strongest expression in skeletal muscle and heart. No entry??
TAF9; TAF9 RNA POLYMERASE II, TATA BOX-BINDING PROTEIN-ASSOCIATED FACTOR, 32-KD The tafs are required for activated rather than basal transcription and serve to mediate signals between various activators and the basal transcriptional machinery. 5q13.2
TGFB1; TRANSFORMING GROWTH FACTOR, BETA-1
Camurati-Engelmann disease 131300
{Cystic fibrosis lung disease, modifier of}TGFB is a multifunctional peptide that controls proliferation, differentiation, and other functions in many cell types. TGFB acts synergistically with TGFA (190170) in inducing transformation. It also acts as a negative autocrine growth factor. Dysregulation of TGFB activation and signaling may result in apoptosis. Many cells synthesize TGFB and almost all of them have specific receptors for this peptide. TGFB1, TGFB2 (190220), and TGFB3 (190230) all function through the same receptor signaling systems.
19q13.2
  TIPARP; TCDD-INDUCIBLE POLY(ADP-RIBOSE) POLYMERASE Amplified and upregulated in head and neck squamous cell carcinoma (HNSCC). The N-terminal part of the TPH domain contains a CCCH-type zinc finger. 3q25.31Katoh and Katoh (2003)  Redon et al. (2001)
TOP2A DNA topoisomerase II, resistance to inhibition of, by amsacrine.  DNA topoisomerases (EC 5.99.1.3) are enzymes that control and alter the topologic states of DNA in both prokaryotes and eukaryotes.There are about 100,000 molecules of topoisomerase II per hela cell nucleus, constituting about 0.1% of the nuclear extract. In a human leukemia cell line, HL-60/AMSA, Hinds et al. (1991) found that resistance to inhibition of topoisomerase II by amsacrine and other intercalating agents was dueTo a single base change, AGA (arginine) to AAA (lysine). 17q21.2
TP53; P53
TRANSFORMATION-RELATED PROTEIN 53;
TRP53Osteosarcoma, Choroid plexus papilloma, Breast cancer,Adrenal cortical carcinoma, Colorectal cancer, Hepatocellular carcinoma, Li-Fraumeni syndrome, Nasop haryngeal carcinoma, Pancreatic cancer, {Glioma susceptibility 1}, {Basal cell carcinoma 7} 
The transcription factor p53 responds to diverse cellular stresses to regulate target genes that induce cell cycle arrest, apoptosis, senescence, DNA repair, or changes in metabolism. In addition, p53 appears to induce apoptosis through nontranscriptional cytoplasmic processes.Activity of p53 is ubiquitously lost in human cancer either by mutation of the p53 gene itself or by loss of cell signaling upstream or downstream 17p13.1 POSSIBLE TARGET FOR CO-STIMULATION
TP73; p53-RELATED PROTEIN p73; p73
TRP73, MOUSE, HOMOLOG OF
The p53 gene (TP53; 191170) is the most frequently mutated tumor suppressor in human cancers. The ability of p53 to inhibit cell growth is due, at least in part, to its ability to bind to specific DNA sequences and activate transcription of target genes, such as that encoding cell cycle inhibitor p21(Waf1/Cip1) 1p36.32
ZIC2; ZIC FAMILY MEMBER 2  Brown et al. (1998) reported that the human ZIC2 gene, a homolog of the Drosophila ‘odd-paired’ (opa) gene, maps to the region of chromosome 13 associated with holoprosencephaly (HPE5; 609637). Have zinc finger domain.Holoprosencephaly-5Holoprosencephaly is the most common structural anomaly of the human brain and is one of the anomalies seen in patients with deletions and duplications of chromosome 13 13q32.3

In T cells, tryptophan starvation induces Gcn2-dependent stress signaling pathway, which  initiates uncharged Trp-tRNA binding onto ribosomes. Elevated GCN2 expression stimulates elF2alfa phosphorylation to stop translation initiation (88). Therefore, most genes downregulated and LIP, an alternatively initiated isoform of the b/ZIP transcription factor NF-IL6/CEBP-beta (89).  This mechanism happens in tumor cells based on Prendergast group observations. As a result, not only IDO1 propagates itself while producing IFNalpha/IFNbeta, but also demonstrates homeostasis choosing between immunegenity by production of TH17or tolerance by Tregs. This mechanism acts like a see-saw. Yet, tolerance also can be broken by IL6 induction so reversal mechanism by SOC-3 dependent proteosomal degradation of the enzyme (90).  All proper responses require functional peripheral DCs to generate mature DCs for T cells to avoid autoimmunity (91)

Niacin (vitamin B3) is the final product of tryptophan catabolism and first molecule at Nicotinomic acid (NDA) Biosynthesis.  The function of IDO in tryptophan and NDA metabolism has a great importance to develop new clinical applications (40; 42; 41).  NAD+, biosynthesis and tryptophan metabolisms regulate several steps that can be utilize pharmacologically for reformation of healthy physiology (40).

IDO for protection in Microbial Infection with Toll-like Receptors

The mechanism of microbial response and infectious tolerance are complex and the origination of IDO based on duplication of microbial IDO (49).  During microbial responses, Toll-like receptors (TLRs) play a role to differentiate and determine the microbial structures as a ligand to initiate production of cytokines and pro-inflammatory agents to activate specific T helper cells (92; 93; 94; 95). Uniqueness of TLR comes from four major characteristics of each individual TLR by ligand specificity, signal transduction pathways, expression profiles and cellular localization (96). Thus, TLRs are important part of the immune response signaling mechanism to initiate and design adoptive responses from innate (naïve) immune system to defend the host.

TLRs are expressed cell type specific patterns and present themselves on APCs (DCs, MQs, monocytes) with a rich expression levels (96; 97; 98; 99; 93; 100; 101; 102; 87). Induction signals originate from microbial stimuli for the genesis of mature immune response cells.  Co-stimulation mechanisms stimulate immature DCs to travel from lymphoid organs to blood stream for proliferation of specific T cells (96).  After the induction of iDCs by microbial stimuli, they produce proinflammatory cytokines such as TNF and IL-12, which can activate differentiation of T cells into T helper cell, type one (Th1) cells. (103). Specific TLR stimulation links innate and acquired responses through simple recognition of pathogen-associated molecular patterns (PAMPs) or co-stimulation of PAMPs with other TLR or non-TLR receptors, or even better with proinflammatory cytokines.   Some examples of ligand- TLR specificity shown in Table1, which are bacterial lipopeptides, Pam3Cys through TLR2 (92; 104; 105), double stranded (ds) RNAs through TLR3 (106; 107), lipopolysaccharide (LPS) through TLR4, bacterial flagellin through TLR5 (108; 109), single stranded RNAs through TLR7/8 (97; 98), synthetic anti-viral compounds imiquinod through TLR 7 and resiquimod through TLR8, unmethylated CpG DNA motifs through TLR9 (Krieg, 2000).

The specificity is established by correct pairing of a TLR with its proinflammatory cytokine(s), so that these permutations influence creation and maintenance of cell differentiation. For example, leading the T cell response toward a preferred Th1 or Th2 response possible if the cytokines TLR-2 mediated signals induce a Th2 profile when combined with IL-2 but TLR4 mediated signals lean towards Th1 if it is combined with IL-10 or Il-12, (110; 111)  (112).

TLR ligand TLR Reference
Lipopolysaccharide, LPS TLR4 (96).  (112).
Lipopeptides, Pam3Cys TLR2 (92; 104; 105)
Double stranded (ds) RNAs TLR3 (106; 107)
Bacterial flagellin TLR5 (108; 109)
Single stranded RNAs TLR7/8 (97; 98)
Unmethylated CpG DNA motifs TLR9 (Krieg, 2000)
Synthetic anti-viral compounds imiquinod and resiquimod TLR7 and TLR8 (Lee J, 2003)

Furthermore, IL6 stimulated DCs relieve the suppression of effector T cells by regulatory T cells (113).  The modification of IDO+ monocytes towards specific subset of T cell activation with specific TLRs are significantly important (94).  The type of cell with correct TLR and stimuli improves or decreases the effectiveness of stimuli. Induction of IDO in monocytes by synthetic viral RNAs (isRNA) or CMV was possible but not in monocyte derived DCs or TLR2 ligand lipopeptide Pam3Cys.  Single- stranded RNA ligands target TLR7/8 in monocytes derive DCs only (Lee J, 2003).  These futures of TLRs important during design of experiments to target and improve the efficacy.

Double-Edged Sword of IDO: The Good and The Bad for Clinical intervention and Developments

High expression level of IDO has a positive impact during pregnancy (29; 28; 114), transplants (115; 116; 117; 118; 119), infectious diseases (96). On the other hand, high IDO expression leads the system to a tolerance state is negative during autoimmune-disorders (120; 121; 122), tumors of cancer (123; 124; 117; 121; 125; 126; 127) (127), and mood disorders (46).

Prevention of allogeneic fetal rejection is possible by tryptophan metabolism (26) by rejecting at lack of IDO but allocating with abundant IDO  (29; 28; 114). The plasticity of  mammary and uterus during reproduction may hold some more answers to prevent GVHD and tumors of cancer with good understanding of IDO and tryptophan mechanism (129; 130). These studies lead to find “the natural regulation mechanism” for protecting the transplants from graft versus host disease GVHD (128) and getting rid of tumors. After allogeneic bone marrow transplants the risk of solid tumor development increased about 80% among 19,229 patients,  even with a greater risk if patients are under 18 years old (117).  The adaptation of tolerance against host mechanism is connected to the IDO expression (131).   During implantation and early pregnancy IDO has a role by making CD4+CD25+Foxp3+ regulatory T cells (Tregs) and expressing in DCs and  MQs  (114; 132; 133).  Clonal deletion mechanism prevents mother to react with paternal products since female mice accepted the paternal MHC antigen-expressing tumor graft during pregnancy and rejected three weeks after delivery (134). CTLA-4Ig gene therapy alleviates abortion through regulation of apoptosis and inhibition of spleen lymphocytes (135).

AutoImmune Disorders:

The balance of IDO expression becomes necessary to prevent overactive immune response self-destruction, so modulation in tryptophan and NDA metabolisms maybe essential.  When splenic IDO-expressing CD11b (+) DCs from tolerized animals applied, they suppressed the development of arthritis, increased the Treg/Th17 cell ratio, and decreased the production of inflammatory cytokines in the spleen (136).   The role of Nicotinamide prevention on type 1 diabetes and ameliorates multiple sclerosis in animal model presented with activities of  NDAs stimulating GPCR109a to produce prostaglandins to induce IDO expression, then these PGEs and PGDs converted to the anti-inflammatory prostaglandin, 15d-PGJ(2) (137; 138; 139).  Thus, these events promote endogenous signaling mechanisms involving the GPCRs EP2, EP4, and DP1 along with PPARgamma. (137).

IDO (indoleamine 2,3-dioxygenase) and IDO2 control a tryptophan catabolism signaling pathway. (a) From tryptophan starvation to LIP activation. By catabolizing the essential amino acid tryptophan, IDO and IDO2 generate kynurenines and other reaction products that can modulate T-cell immunity as well as a local microenvironment that is starved for tryptophan. Little is known as yet of the precise mechanistic effects of the tryptophan catabolites generated. Elaboration of the starvation condition triggers a stress response in local T cells through Gcn2, which responds to amino-acid deprivation by phosphorylating the translation initiation factor eIF2alpha, leading to a blockade of most translation initiation with the exception of certain factors such as LIP involved in mediating responses to the stress. (b) LIP is a dominant negative isoform of the immune regulatory b/ZIP transcription factor NF-IL6, also known as CEBPbeta. LIP is an alternately translated isoform of the transcription factor NF-IL6/CEBPbeta implicated in regulating proliferation and immune response. Starvation responses switch NF-IL6/CEBPbeta expression from LAP isoforms to the LIP isoform through the use of a downstream translation start site in the mRNA. Encoding only a b/ZIP dimerization domain, LIP functions as a 'natural' dominant negative molecule that disrupts NF-IL6/CEBPbeta function by competing with LAP isoforms for binding to target gene promoters. Both IDO and IDO2 can switch on LIP, but subsequent restoration of tryptophan levels will only switch it off in the case of IDO, offering a possible mechanism for distal propagation of immune suppression away from the local tumor microenvironment (Figure 5). NF-IL6/CEBPbeta target genes with relevance to the function of IDO include the immune suppressive cytokines IL-6, IL-10 and TGF-beta, which may be upregulated as a result of LIP induction. (http://www.nature.com/onc/journal/v27/n28/fig_tab/onc200835f3.html)

IDO (indoleamine 2,3-dioxygenase) and IDO2 control a tryptophan catabolism signaling pathway. (a) From tryptophan starvation to LIP activation. By catabolizing the essential amino acid tryptophan, IDO and IDO2 generate kynurenines and other reaction products that can modulate T-cell immunity as well as a local microenvironment that is starved for tryptophan. Little is known as yet of the precise mechanistic effects of the tryptophan catabolites generated. Elaboration of the starvation condition triggers a stress response in local T cells through Gcn2, which responds to amino-acid deprivation by phosphorylating the translation initiation factor eIF2alpha, leading to a blockade of most translation initiation with the exception of certain factors such as LIP involved in mediating responses to the stress. (b) LIP is a dominant negative isoform of the immune regulatory b/ZIP transcription factor NF-IL6, also known as CEBPbeta. LIP is an alternately translated isoform of the transcription factor NF-IL6/CEBPbeta implicated in regulating proliferation and immune response. Starvation responses switch NF-IL6/CEBPbeta expression from LAP isoforms to the LIP isoform through the use of a downstream translation start site in the mRNA. Encoding only a b/ZIP dimerization domain, LIP functions as a ‘natural’ dominant negative molecule that disrupts NF-IL6/CEBPbeta function by competing with LAP isoforms for binding to target gene promoters. Both IDO and IDO2 can switch on LIP, but subsequent restoration of tryptophan levels will only switch it off in the case of IDO, offering a possible mechanism for distal propagation of immune suppression away from the local tumor microenvironment (Figure 5). NF-IL6/CEBPbeta target genes with relevance to the function of IDO include the immune suppressive cytokines IL-6, IL-10 and TGF-beta, which may be upregulated as a result of LIP induction. (http://www.nature.com/onc/journal/v27/n28/fig_tab/onc200835f3.html)

Modulating the immune response at non-canonical at canonocal pathway while keeping the non-canonical Nf-  KB intact may help to mend immune disorders. As a result, the targeted blocking in canonical at associated  kinase IKKβ and leaving non-canonocal Nf-kB pathway intact, DCs tips the balance towards immune supression.  Hence, noncanonical NF-κB pathway for regulatory functions in DCs required effective IDO induction, directly or  indirectly by endogenous ligand Kyn and negative regulation of proinflammatory cytokine production.

As a result, this may help to treat autoimmune diseases such as rheumatoid arthritis, type 1 diabetes,        inflammatory bowel disease, and multiple sclerosis, or allergy or transplant rejection. While the opposite action  needs to be taken during prevention of tumors, that is inhibition of non-canonical pathway.  Inflammation    induces not only relaxation of veins and lowering blood pressure but also stimulate coagulopathies that worsen  the microenvironment and decrease survival rate of patients after radio or chemotherapies .

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors.  (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors. (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Cancer:

Generating tumor vaccines and using adjuvants underway (140).   Comparison of clinical correlation and genetic responses in several studies hopes to diagnose and target the system for cancer therapies (127; 141; 131).  The recent surveys on IDO expression and human cancers show that IDO targeting is a candidate for cancer therapy since IDO expression recruiting Tregs, downregulating MHC class I and creating negative immune microenvironment for protection of development of tumors (125; 27; 142).  Inhibition of IDO expression can make advances in immunotherapy and chemotherapy fields (143; 125; 131; 144).  IDO has a great importance on prevention of cancer development (126).    There are many approaches to create the homeostasis of immune response by Immunotherapy.  However, given the complexity of immune regulations, immunomodulation is a better approach to correct and relieve the system from the disease.  Some of the current IDO targeted immunotherapy or immmunomodulations are with RNA technology for cancer prevention (145; 146; 147; 148; 149; 150) or applied on human or animals  (75; 151; 12; 115; 152; 9; 125) or chemical, (153; 154) or  radiological (155).  The targeted cell type in immune system generally DCs, monocytes (94), T cells (110; 156) and neutrophils (146; 157). On this paper, we will concentrate on DCvax on cancer treatments.

IDO and the downstream enzymes in tryptophan pathway produce a series of immunosuppressive tryptophan     metabolites that may lead into Tregs proliferation or increase in T cell apoptosis (62; 16; 27; 158), and some can   affect NK cell function (159).  The interesting part of the mechanism is, even without presence of IDO itself,    downstream enzymes of IDO in the kynurenine tryptophan degradation still show immunosuppressive outcome   (160; 73) due to not only Kyn but also TGFbeta stimulated long term responses. DC vaccination with IDO is    plausible (161) due to its power in immune response changes and longevity in the bloodstream for reversing  the system for Th17 production (162).

Taking advantage of the DC’s central role and combining with enhancing molecules for induction of immunity may overcome tolerogenic DCs in tumors of cancers (163; 164). The first successful application of DC vaccine used against advanced melanoma after loading DCs with tumor peptides or autologous cell lysate in presence of adjuvants keyhole limpet hematocyanin (KLH) (165).  Previous animal and clinical studies show use of DCs against tumors created success (165; 166; 167) as well as some problems due to heterogeneity of DC populations in one study supporting tumor growth rather than diminishing (168).

DC vaccination applied onto over four thousand clinical trial but none of them used siRNA-IDO DC vaccination method. Clinical trials evaluating DCs, loaded ex vivo with purified TAAs as anticancer immunotherapeutic interventions, also did not include IDO (Table from (169). This data is coming from 30 clinical trials, 3 of which discontinued, evaluating DCs loaded ex vivo with TAAs as an anticancer immunotherapy for 12 types of cancer [(AML(1), Breast cancer (4), glioblastoma (1), glioma (2), hepatocellular carcinoma (1), hematological malignancies (1), melanoma (6), neuroblastoma sarcoma (2), NSCLC (1), ovarian cancer (3), pancreatic cancer (3), prostate cancer (10)] at phase I, II or I/II.

Tipping the balance between Treg and Th17 ratio has a therapeutic advantage for restoring the health.  This is shown in ovarian cancer by DC vaccination with adjuvants (161).  Rebalancing of the immune system towards immunogenicity may restore Treg/Th17 ratio (162; 170) but it is complicated. The stimulation of IL10 and IL12 induce Tregs produce less Th17 while inhibiting CTL activation and its function (76; 171; 172).  When animals were pre-treated with anti-TGFbeta before vaccination, elevation in the plasma levels of IL-15 for tumor specific T cell survival in (173; 174) ovarian cancer studies was observed.   After human papilloma virus infection, the system present an increase of IL12 (175).  Opposing signal mechanism downregulates the TGFbeta to activate CTL and Th1 population with IL12 and IL15 expression (162; 173).  The effects of IL17 on antitumor properties observed by unique subset of CD4+ T cells (176) called also CD8+ T cells secrete even more IL17 (177).

Use of cytokines as adjuvants during vaccination may improve the efficacy of vaccination, since cancer vaccines, unlike infections vaccines, applied after the infection or disease started against the established adoptive immune response.  It is an almost common practice to use adjuvants to improve efficacy in immunotherapy as a combination therapy (178). Enhancing cancer vaccine efficacy via modulation of the microenvironment is another solution, if only know who are the players.  For example, changing intercellular Ca signaling in T cells is necessary to convert them to Tregs.    Several molecules can be used to initiate and lengthen the activity of intervention to stimulate IDO expression without compromising the mechanism (179) because of the positive feedback loops.  The system is complicated so generally induction is completed ex-vivo stimulation of DCs in cell lysates, or in whole tumor lysates, to create the microenvironment and natural stimulatory agents. Introduction of molecules as an adjuvants on genetic regulation on modulation of DCs are critical, because order and time of the signals, specific location/ tissue, and heterogeneity of personal needs (174; 138; 180). These studies demonstrated that IL15 with low TGFb stimulates CTL and Th1, whereas elevated TGFb with IL10 increases Th17 and Tregs in cancer microenvironments.

For example Ret-peptide antitumor vaccine contains an extracellular fragment of Ret protein and Th1 polarized immunoregulator CpG oligonucleotide (1826), with 1MT, a potent inhibitor of IDO, brought a powerful as well as specific cellular and humoral immune responses in mice (152).  The main idea of choosing Ret is to produce vaccine in ret related carcinomas because ret fulfilled two requirements, first choosing patients self-antigens for cancer therapy with a non-mutated gene, and second, there is no evidence of genetic mutations in Ret amino acids 64-269.

Table 2- IDO Clinical Trials

1

Clinical Trials From Clinicaltrials.Gov

Title And Details Of The Study

NCT Number Recruitment Condition Primary Completion Date Sponsor/Collaborator Phase orObservation. Intervention Type
2 IDO Inhibitor Study For Relapsed Or Refractory Solid Tumors NCT00739609

Terminated

Breast Cancer|Lung Cancer|Melanoma|Pancreatic Cancer|Solid Tumors October 2012 NewlLink enetics Corp. 1 CHEM
3  IDO2 Genetic Status Informs The Neoadjuvant Efficacy Of Chloroquine (CQ) In Brain Metastasis Radiotherapy NCT01727531

Recruiting

Brain Metastasis Dec. 2020 Main Line Health NA CHEM
4 Peptide Vaccine And Temozolomide For Metastatic Melanoma Patients NCT01543464

Recruiting

Malignant Melanoma September 2014 Newlink Genetics Corporation 2 CHEM
5 A Phase 1/2 Randomized, Blinded, Placebo Controlled Study Of Ipilimumab In Combination With INCB024360 Or Placebo In Subjects With Unresectable Or Metastatic Melanoma NCT01604889

Recruiting

Metastatic Melanoma August 2014 Incyte Corporation 1/2 BIOLINH+CHEM
6 A Phase 2 Study Of The IDO Inhibitor INCB024360 Versus Tamoxifen For Subjects With Biochemical-Recurrent-Only EOC, PPC Or FTC Following Complete Remission With First-Line Chemotherapy NCT01685255

Recruiting

April 2014 Incyte Corporation 2 CHEM
7   Different Injection Number Of The Same Dose Of Botulinum Toxin A On Overactive Bladder Syndrome NCT01657409

Recruiting

Overactive Bladder March 2014 Buddhist Tzu Chi General Hospital 2 CHEM
8  Study On The Effect Of Intravenous Ascorbic Acid On Intraoperative Blood Loss In Women With Uterine MyomaInterventions: Drug: Ascorbic Acid NCT01715597

Recruiting

Uterine Leiomyoma January 2014 Seoul National University Hospital 3 CHEM
9 1-Methyl-D-Tryptophan In Treating Patients With Metastatic Or Refractory Solid Tumors That Cannot Be Removed By Surgery NCT00567931

Recruiting

Unspecified Adult Solid Tumor, Protocol Specific September 2013 National Cancer Institute (NCI) 1 CHEM
10  Properties Of Mesenchymal Stem Cells In Lung Transplant NCT01668576

Recruiting

Lung Transplantation August 2013 Emory University OBS BIOL
11  The Effects Of Medical Clowns In Children Undergoing Blood Tests NCT01396876

Recruiting

Pain And Anxiety Reduction July 2012 Tel-Aviv Sourasky Medical Center NA BIOL
12   Saline Injection – Assisted Anesthesia In Eyelid Surgery NCT01239498

Recruiting

Blepharoptosis October 2011 Sheba Medical Center 4 CHEMBIOL
13   Effects Of The Consumption Of California Walnuts On Cardiovascular HealthInterventions:            Dietary Supplement: Walnuts NCT01235390

Recruiting

Cardiovascular Disease|Immune Health October 2011 University Of California, Davis|California Walnut Commission 1 FOODALERGY-WALNUT
14  Pomegranate To Reduce Maternal And Fetal Oxidative Stress And Improve Outcome In Pregnancies Complicated With Preterm Premature Rupture Of The Membranes NCT01584323

Recruiting

Preterm Premature Rupture Of Membranes|Pregnant State 2013 Rambam Health Care Campus NA FOODSUP
1 Phase II INCB024360 Study For Patients With Myelodysplastic Syndromes (MDS) NCT01822691

Not Yet Recruiting

Myelodysplastic Syndromes September 2015 H. Lee Moffitt Cancer Center And Research Institute|Incyte Corporation 2 CHEM-BIOL?
2   Title:  Schizophrenia Imaging NCT01655472

Not Yet Recruiting

Foetal Differences Between Healthy And Schizophernic Parents July 2014 Tel-Aviv Sourasky Medical Center IMAGEN
3  C11 AMT Positron Emission Tomography (PET) Imaging In Patients With Metastatic Invasive Breast Cancer NCT01302821

Not Yet Recruiting

Breast Cancer April 2014     H. Lee Moffitt Cancer Center And Research Institute|National Cancer Institute (NCI) NA BIOLDCAV-P53MTRADIA
4   Sonographic Evaluation Of Visceral Fat After Bariatric Surgery NCT01285791

Not Yet Recruiting

Morbid Obesity April 2012 Hadassah Medical Organization OBS BIOL CELL
5 How Our Immune System Can Help Fight Cancer NCT01042847

Not Yet Recruiting

Ovarian Cancer January 2011 Winthrop UniversityHospita EVALNA POLY.BIOL
6  Title: Study Of The Long-Term Effect Of Frequent Anti-VEGF Dosing On Retinal Function In Patients With Neovascular AMD NCT00533689

Not Yet Recruiting

Electrophysiology 2013 NA  Tel-Aviv Sourasky Medical Center NAEYE BIOL
7  Microbial Surveillance In Children Hospitalized For Cardiovascular Surgery NCT00426894

Not Yet Recruiting

Cardiac Surgery|Perioperative Prophylaxis 2013 NA Hadassah Medical Organization OBS
8 Study Of Chemotherapy In Combination With IDO Inhibitor In Metastatic Breast Cancer NCT01792050

Not Recruitinbut  Active  G

Metastatic Breast Cancer January 2015 Newlink Genetics Corporation 2 CHEM
9 A Dose-Escalation Study In Subjects With Advanced Malignancies NCT01195311

Not BUT  Active Recruiting

Advanced Malignancies November 2012 Incyte Corporation 1 CHEM DOSE
SP  Title:   Mesalamine To Reduce T Cell Activation In HIV Infection NCT01090102

Enrolling By Invitation

HIV Infections|Sexually Transmitted Diseases|Immune System Diseases|Lentivirus Infections|Acquired Immunodeficiency Syndrome January 2013 UC, San Francisco|California HIV/AIDS Research Program|Salix Pharmaceuticals 4 CHEM
1 Study Of Indoleamine 2,3-Dioxygenase Activity, Serum Levels Of Cytokines, BDNF, BH4 And NCT00919295

Completed

Fibromyalgia Syndrome October 2011 Mahidol University|University Of Texas|University Of Wuerzburg 2 CHEM.
2 Diagnosis Of Posttraumatic Stress Disorder Following Primary Rhegmatogenous Retinal Detachment NCT01233908

Completed

Stress Disorders, Post-Traumatic|Retinal Detachment September 2010 Sheba Medical Center OBSEYE BIOL
3 Comparison Of DCT, ORA And GAT In Eyes After Penetrating Keratoplasty NCT00834782

Completed

Corneal Transplantation December 2009 Sheba Medical Center 4
4 Disturbances Of Kynurenine Pathway Of Trytophan Metabolism In Schizophrenia: A Quantitative Reverse Transcription Polymerase Chain Reaction (RT-PCR) Study NCT00573300

Completed

Schizophrenia May 2009 North Suffolk Mental Health Association OBSV. BIOL
5 Effect Of Biological Therapy On Biomarkers In Patients With Untreated Hepatitis C, Metastatic Melanoma, Or Crohn Disease NCT00897312

Completed

Melanoma August 2008 Vanderbilt-Ingram Cancer Center|National Cancer Institute (NCI) OBSV.  BIOL-CHEM
6 A Prospective Comparative Study Of Induction Of Labor With A Cervical Ripening Double Balloon Vs Foley Catheter NCT00501033

Completed

Induction Of Labor|Cesarean|Endometritis February 2008 Western Galilee Hospital-Nahariya NA DEVICE
7 Tryptophan, Serotonin And Kynurenine In Septic Shock NCT00684736

Completed

Shock, Septic April 2007 Central Hospital, Versailles OBS KYN
8 Imatinib Mesylate In Treating Patients With Metastatic Breast Cancer NCT00045188

Completed

Male Breast Cancer|Recurrent Breast Cancer|Stage IV Breast Cancer July 2004 National Cancer Institute (NCI) 2 CHEM
9 IDO Peptid Vaccination For Stage III-IV Non Small-Cell Lung Cancer Patients. NCT01219348

Completed

NSCLC|Lung Cancer NA IDO Peptide Vaccinantio 1
10  Indoleamine 2,3-Dioxygenase (IDO) Activity In Patients With Chronic Lymphocytic Leukemia (CLL) NCT01397916

Completed

CLL NA Tampere University Hospital NA
11   Tryptophan Metabolism In Kidney Disease NCT00758537

Completed

Chronic Kidney Disease NA Charite University, Berlin, Germany OBS BIOLTRP LEVELS
12 Observational To Investigate The Efficacy Of CRESTOR 5mg In Reaching LDL-C Target Goals In Patients Who Are At High Risk For A Cardiovascular Event NCT00347217

Completed

HypercholesteremiaCardiovascular NA Astrazeneca 4 CHEM
13 The Association Between Delivery Method And Maternal Rehospitalization NCT00501501

Completed

Hospitalization NA Western Galilee Hospital-Nahariya OBS BIOL
14 Uterine Flora During Elective And Urgent Cesarean Sections NCT00500019

Completed

Endometritis NA Western Galilee Hospital-Nahariya OBS BIOL
15   Title: Pilot, Proof-Of-Concept Study Of Sublingual Tizanidine In Children With Chronic Traumatic Brain Injury (TBI) NCT00287157

Completed

 Traumatic Brain Injury NA Teva GTC 1B CHEM

Another example came from demonstration of proliferating hemangiomas, benign endothelial tumors and often referred as hemangiomas of infancy appearing at head or neck, expresses IDO and slowly regressed as a result of immune mediated process. Large scale of genomic analysis shows insulin like growth factor 2 as the key regulator of hematoma growth (Ritter et al. 2003).

We set out to develop new technology with our previous expertise in immunotherapy and immunomodulation (181; 182; 183; 184), correcting Th17/Th1 ratio (185), and siRNA technology (186; 187).  We developed siRNA-IDO-DCvax. Patented two technologies “Immunomodulation using Altered DCs (Patent No: US2006/0165665 A1) and Method of Cancer Treatments using siRNA Silencing (Patent No: US2009/0220582 A1). In melanoma cancer DCs were preconditioned with whole tumor lysate but in breast cancer model pretreatment completed with tumor cell lysate before siRNA-IDO-DCvax applied. Both of these studies presented a success without modifying the autanticity of DCs but decreasing the IDO expression to restore immunegenity by delaying tumor growth in breast cancer (147) and in melanoma (188).  Thus, our DCvax specifically interfere with IDO without disturbing natural structure and content of the DCs in vivo.  Thus, we showed that DCvax can carry on this technology to clinical applications.   Furthermore, our method of intervention is more sophisticated since it has a direct interaction mechanism with ex-vivo DC modulation without creating long term metabolism imbalance in Trp/Kyn metabolite mechanisms with corrective and non-invasive actioins.

There are several reasons for us to combine DCs with siRNA technology for making DCvax.  First, prevention of tumor development studies targeting non-enzymatic pathway initiated by pDCs conditioned with TGFbeta is specific to IDO1 (189). Second, IDO upregulation in antigen presenting cells allowing metastasis show that most human tumors express IDO at high levels (123; 124).  Third, tolerogenic DCs secretes several molecules some of them are transforming growth factor beta (TGFb), interleukin IL10), human leukocyte antigen G (HLA-G), and leukemia inhibitory factor (LIF), and non-secreted program cell death ligand 1 (PD-1 L) and IDO, indolamine 2.3-dioxygenase, which promote tumor tolerance. Thus, we took advantage of DCs properties and IDO specificity to prevent the tolerogenicity with siRNA-IDO DC vaccine in both melanoma and breast cancer.  Fourth, IDO expression in DCs makes them even more potent against tumor antigens and create more T cells against tumors. IDOs are expressed at different levels by both in broad range of tumor cells and many subtypes of DCs including monocyte-derived DCs (10), plasmacytoid DCs (142), CD8a+ DCs (190), IDO compotent DCs (17), IFNgamma-activated DCs used in DC vaccination.  These DCs suppress immune responses through several mechanisms for induction of apoptosis towards activated T cells (156) to mediate antigen-specific T cell anergy in vivo (142) and for enhancement of Treg cells production at sites of vaccination with IDO-positive DCs+ in human patients (142; 191; 192; 168; 193; 194).  If DCs are preconditioned with tumor lysate with 1MT vaccination they increase DCvax effectiveness unlike DCs originated from “normal”, healthy lysate with 1MT in pancreatic cancer (195).  As a result, we concluded that the immunesupressive effect of IDO can be reversed by siRNA because Treg cells enhance DC vaccine-mediated anti-tumor-immunity in cancer patients.

Gene silencing is a promising technology regardless of advantages simplicity for finding gene interaction mechanisms in vitro and disadvantages of the technology is utilizing the system with specificity in vivo yet improved(186; 196).  siRNA technology is one of the newest solution for the treatment of diseases as human genomics is only producing about 25,000 genes by representing 1% of its genome. Thus, utilizing RNA opens the doors for more comprehensive and less invasive effects on interventions. Thus this technology is still improving and using adjuvants.  Silencing of K-Ras inhibit the growth of tumors in human pancreatic cancers (197), silencing of beta-catenin in colon cancers causes tumor regression in mouse models (198), silencing of vascular endothelial growth factor (VGEF) decreased angiogenesis and inhibit tumor growth (199).   Combining siRNA IDO and DCvax from adult stem cell is a novel technology for regression of tumors in melanoma and breast cancers in vivo. Our data showed that IDO-siRNA reduced tumor derived T cell apoptosis and tumor derived inhibition of T cell proliferation.  In addition, silencing IDO made DCs more potent against tumors since treated or pretreated animals showed a delay or decreased the tumor growth (188; 147).

Clinical Trials:

First FDA approved DC-based cancer therapies for treatment of hormone-refractory prostate cancer as autologous cellular immunotherapy (163; 164).  However, there are many probabilities to iron out for a predictive outcome in patients.  Clinical trials report shows 38 total studies specifically IDO related function on cancer (16), eye (3), surgery (2), women health (4), obesity (1), Cardiovascular (2), brain (1), kidney (1), bladder (1), sepsis shock (1), transplant (1),  nervous system and behavioral studies (4), HIV (1).  Among these only 22 of which active, recruiting or not yet started to recruit, and 17 completed and one terminated. Most of these studies concentrated on cancer by the industry, Teva GTC ( Phase I traumatic brain injury), Astra Zeneca (Phase IV on efficacy of CRESTOR 5mg for cardiovascular health concern), Incyte corporation (Phase II ovarian cancer), NewLink Genetics Corporation (Phase I breast/lung/melanoma/pancreatic solid tumors that is terminated; Phase II malignant melanoma recruiting, Phase II active, not recruiting metastatic breast cancer, Phase I/II metastatic melanoma, Phase I advanced malignancies), and Salix Corp-UC, San Francisco and HIV/AIDS Research Programs (for HIV Phase IV enrolling by invitation).  Most of these studies based on chemotherapy but there are few that use biological methods completed study with  IDO vaccine peptide vaccination for Stage III-IV non-small-cell lung cancer patients (NCT01219348), observational study on effect of biological therapy on biomarkers in patients with untreated hepatitis C, metastasis melanoma, or Crohn disease by IFNalpha and chemical (ribavirin, ticilimumab (NCT00897312), polymorphisms of patients after 1MT drug application in treating patients with metastatic or unmovable refractory solid tumors by surgery (NCT00758537), IDO expression analysis on MSCs (NCT01668576), and not yet recruiting intervention with adenovirus-p53 transduced dendric cell vaccine , 1MT , radiation, Carbon C 11 aplha-methyltryptophan (NCT01302821).

Among the registered clinical trials some of them are not interventional but  observational and evaluation studies on Trp/Kyn ratio (NCT01042847), Kyn/Trp ratio (NCT01219348), Kyn levels (NCT00897312, NCT00573300),  RT-PCR analysis for Kyn metabolism (NCT00573300, NCT00684736, NCT00758537), and intrinsic IDO expression of mesenchymal stem cells in lung transplant with percent inhibition of CD4+ and CD8+ T cell proliferation toward donor cells (NCT01668576), determining polymorphisms (NCT00426894). These clinical trials/studies are immensely valuable to understand the mechanism and route of intervention development with the data collected from human populations.

 

Future Actions for Molecular Diagnosis and Targeted Therapies:

Current survival or response rate is around 40 to 50 % range.  By using specific cell type, selected inhibition/activation sequence based on patient’s genomic profile may improve the efficacy of clinical interventions on cancer treatments.

Targeted therapies for specific gene regulation through signal transduction are necessary but there are few studies with genomics based approach.  On the other hand, there are surveys, observational or evaluations (listed in clinical trials section) registered with www.clinicaltrials.gov that will provide a valuable short-list of molecules.  Preventing stimulation of Ido1 as well as Tgfb-1gene expression by modulating receptor mediated phosphorylation between TGFb/SMAD either at Mad-Homology 1 (MH1) or Mad-Homology 1 (MH2) domains is possible (79; 82; 80). Within Smads there is a conserved Mad-Homology 1 (MH1) domain, which is a DNA binding module contains tightly bound Zinc atom. So the zinc can be targeted with a small molecule adjuvant.  Smad MH2 domain is also well conserved as one the most diverse protein-signal interacting molecule during signal transduction due to two important Serine residues located extreme distal C-termini at Ser-Val-Ser in Smad 2 or at pSer-X-PSer in RSmads (80).  Kyn activated orphan G protein–coupled receptor, GPR35 with unknown function with a distinct expression pattern that collides with IDO sites since its expression at high levels of the immune system and the gut (63) (200; 63).

 

The first study to connect IDO with cancer shows that group (75) so direct targeting to regulate IDO expression is another method.  It is best to act through modulating ISREs in its promoter with RNA-peptide combination technology. Indirectly, IDO can be regulated through Bin1 gene expression control over IDO since Bin1 is a negative regulator of IDO and prevents IDO expression.  IDO is under negative genetic control of Bin1, BAR adapter–encoding gene Bin1 (also known as Amphiphysin2). Bin1 functions in cancer suppression, because attenuation of Bin1 observed in many human malignancies (141; 201; 202; 203; 204; 205; 206).  Absence of Bin1, null Bin1-/- mice studies, upregulates IDO through STAT1- and NF-kB-dependent in tumor cells to escape from T cell–dependent antitumor immunity.   Detailed molecular genetics studies showed that alternative spicing of Bin1 creates tumor suppressor affect.  Its activities also depends on these spliced outcome, such as Exon 10, in muscle. On the other hand, alternative spliced Exon12A contributes brain cell differentiation (209; 210).  In turn Exon 13 in mice has importance in role for regulating growth. When Bin1 is deleted or mutated C2C12 myoblasts interrupted due to its missing Myc, cyclinD1, or growth factor inhibiting genes like p21WAF1 (207; 208).  Thus, myc becomes a natural target and biomarker as well.

Myc is a target at the junction between IDO gene interaction and Trp metabolism.  Bin1 interacts with Myc either early-dependent on Myc or late-independent on Myc, meaning Myc is not present. This gene regulation also interfered by the long term signaling mechanism related to moonlighting pathway (73; 74).  Hence, Trp/Kyn, Kyn/Trp, Th1/Th17 ratios are important to be observed in patients peripheral blood. These direct and indirect gene interactions place Bin1 to function in cell differentiation (211; 212; 205).

Moonlighting maintains the tolerance. The key factor is in this pathway is Kyn so by reviewing one of the microarray analysis for Kyn affect is critical. This data showed that there are 25 genes affected by Kyn, two of which are upregulated and 23 of them downregulated (100). The list of genes and additional knowledge based on previous intervention methods are a good place to start creating a diagnostics panel as a biomarker to monitor outcomes of given immunotherapies. The short list of candidates are as an adjuvant or co-stimulation agents are myc, NfKB at IKKA, C2CD2, CREB3L2, GPR115, IL2, IL8, IL6, and IL1B, mir-376 RNA, NFKB3, TGFb, RelA, and SH3RF1. From the preivos studies we can also add LIP, Fox3P, CTLA-4, Bin1 and IMPACT to the list.  In addition, specific use of TLR, conserved sequences of IDO across its homologous structures and ISREs of IDO or glucorticoid response elements of TDO are great direct targets to modulate the mechanism. Furthermore, some of the signaling pathway molecules CCR6, CCR5, RORgammat, Jak, STAT, IRFs, MH1 and MH2 domains of Smads may add a value.

Endothelial cell coagulation activation mechanism and pDC maturation or immigration from lymph nodes to bloodstream should marry to control not only IDO expression but also genesis of preferred DC subsets. Stromal mesenchymal cells are activated by this modulation at vascular system and interferes with metastasis of cancer. First, thrombin (human factor II) is a well regulated protein in coagulation hemostasis has a role in cell differentiation and angiogenesis. Protein kinase activated receptors (PARs), type of GPCRs, moderate the actions. Second, during hematopoietic response endothelial cells produce hematopoietic growth factors (213; 214) to revise the vascular structure.  Third, components of bone marrow stroma cells include monocytes, adipocytes, and mesenchymal stem cells (215), which are addressing occurrence of coagulapathologies, DIC, bleeding, thrombosis, and penalizing patients response rate towards therapies and decreasing survival rates specially in breast, lung, prostate cancers.

Both silencing IDO in DCs and reinstallinig antitumor immunity by inhibiting tumor-derived immunosupressive molecule IDO through RNA inference combined with our specialization in stem cell technology created a novel method with a success in vivo.  This data suggests that IDO siRNA DCvax can provide a clinical intervention to increase survival rate and prevention of cancer.

Personal genomic profiles are powerful tool to improve efficacy in immunotherapies so considering the influence of age (young vs. adult) and state of immune system (innate vs. adopted or acquired immunity) are important as well.

CONCLUSION


IDO has a confined function in immune system through complex interactions to maintain hemostasis of immune responses. The genesis of IDO stem from duplication of bacterial IDO-like genes.  Inhibition of microbial infection and invasion by depleting tryptophan limits and kills the invader but during starvation of tryptophan the host may pass the twilight zone since tryptophan required by host’s T cells.  Thus, the host cells in these small pockets adapt to new microenvironment with depleted tryptophan and oxygen poor conditions. Hence, the cell metabolism differentiates to generate new cellular structures, like nodules and tumors under the protection of constitutively expressed IDO in tumors, DCs to inhibit T cell proliferation. On the other hand, having a dichotomy in IDO function can be a potential limiting factor that means is that IDO’s impact on biological system could be variable at many levels based on target cells, IDO’s capacity, pathologic state of the disease and conditions of the microenvironment.  This complexity requires a very close monitoring to analyze the outcome and to prevent conspiracies over the data since some previous studies generated paradoxical results.  Healthcare cost of current therapies through chemotherapies, radiotherapies is very high and provide low efficacy.  Clinical interventions of immunotherapies require control of more than one system, such as coagulation and vascular biology manipulations for a higher efficacy and survival rate in cancer patients. Our siRNA and DC technologies based on stem cell modulation will provide at least prevention of cancer development and hopefully prevention in cancer.

References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8. . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA. . Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (http://dx.doi.org:/10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C.Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9,, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197.

33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH 1998Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. . Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223,  http://dx.doi.org:/10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp.  http://dx.doi.org:/10.1038/nature10491,.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878.

78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40.
http://dx.doi.org:/10.1016/S0092-8674(00)81696-7.PMID 9865691. .

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810.
http://dx.doi.org:/10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.  http://dx.doi.org:/10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132–   http://dx.doi.org:/10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271, http://dx.doi.org:/10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31. .

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. http://dx.doi.org:/10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606.  http://dx.doi.org:/10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11.   http://dx.doi.org:/10.1126/scisignal.2002963. .

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii:S0006-291X(13)00779-1. http://dx.doi.org:/10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D.Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

114. What is the role of regulatory T cells in the success of implantation and early pregnancy? Saito, S., Shima, T., Nakashima, A., Shiozaki, A., Ito, M., Sasaki, Y. 2007, J Assist Reprod Genet, pp. 24: 379-386.

115. Sleeping Beauty-based gene therapy with indoleamine 2,3-dioxygenase inhibits lung allograft fibrosis. . Liu H, Liu L, Fletcher BS, Visner GA. 2006, FASEB J, pp. 20:2384-2386. .

116. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

117. Solid Cancers after Bone Marrow Transplantatioin. Curtis, R.E., Rowlings, P.A., Deeg, J., Schirer, D.A. et al. 1997, The New England Journal of Medicine., pp. 336, No: 13: 897-904.

118. More ADO about IDO; GVHD (commentary). Curti, A., Trabanelli, S., Lemoli, M. 2008, Blood, p. 2950.

119. Jasperson, et al, . 2008, Blood, p. 3257.

120. Tolerance, DCs and tryptophan: much ado about IDO. Grohmann U, Fallarino F, Puccetti P. 2003, Trends Immunol, pp. 24:242-248.

121. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med , pp. 9:1269–74.

122. Indoleamine 2,3-dioxygenase is a critical regulator of acute graft-versus-host disease lethality. Lisa K. Jasperson, Christoph Bucher, Angela Panoskaltsis-Mortari, Patricia A. Taylor, Andrew L. Mellor, David H. Munn, and Bruce R. Blazar. 2008., Blood., pp. 111:3257-3265.

123. The metabolism of tryptophan. 2. The metabolism of tryptophan in patients suffering from cancer of the bladder. . Boyland, E. & Willliams, D.C. 1956, Biochem. J., pp. 64, 578−582 .

124. Tryptophan metabolism in carcinoma of the breast. . Rose, D. 1967, Lancet , pp. 1, 239−241 .

125. Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees? . Löb S, Königsrainer A, Rammensee HG, Opelz G, Terness P. 2009;, Nat Rev Cancer , pp. 9:445–52.  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

126. The hallmarks of cancer. . Hanahan, D. & Weinberg, R.A. 2000., Cell., pp. 100, 57−70.

127. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Godin-Ethier, J., Hanafi,L.A., Piccirillo,C.A. and Lapointe, R. 2011, Clin Cancer Res, pp. 17; 6985,  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

128. Dendritic cell modification as a route to inhibiting corneal graft rejection by the indirect pathway of allorecognition. Khan A, Fu H, Tan LA, Harper JE, Beutelspacher SC, Larkin DF, Lombardi G, McClure MO, George AJ. 2013, Eur J Immunol., pp. 43(3):734-46.  http://dx.doi.org:/10.1002/eji.201242914. Epub 2013 Jan 18.

129. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. . Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int., pp. 37(2):105-8. doi: 10.1002/cbin.10023. Epub 2013 Jan 2.

130. Implication of indolamine 2,3 dioxygenase in the tolerance toward fetuses, tumors, and allografts. . Dürr S, Kindler V. 2013, J Leukoc Biol. , pp. 93(5):681-7. doi: 10.1189/jlb.0712347. Epub 2013 Jan 16.

131. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med, pp. 9:1269–74.

132. NAturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Sagaguchi, S. 2004, Annu. Rev. of Immunol., pp. 22: 531-562.

133. Regulatory T cells in transplantation tolerance. Wood, K.J., zZSakaguchi, S.,. 2003, Nat. Rev. Immunol., pp. 3; 199-210.

134. The cell awareness of paternal alloantigens during pregnancy. Tafuri, A., Alferink, J., Hammerling, G.J., Arnold, B. 1995, Science, pp. 270; 630-3.

135. Adenovirus mediated CTLA4Ig transgene therapy alleviates abortion by inhibiting spleen lymphocyte proliferation and regulating apoptosis in the feto-placental unit. Li W, Li B, Li S. 2013, J Reprod Immunol. , pp. 97(2):167-74.

136. A distinct tolerogenic subset of splenic IDO(+)CD11b(+) dendritic cells from orally tolerized mice is responsible for induction of systemic immune tolerance and suppression of collagen-induced arthritis. Park MJ, Park KS, Park HS, Cho ML, Hwang SY, Min SY, Park MK, Park SH, Kim HY. 2012, Cell Immunol. , pp. 278(1-2):45-54. http://dx.doi.org:/10.1016/j.cellimm.2012.06.009. Epub 2012 Jul 10.

137. Pharmacological targeting of IDO-mediated tolerance for treating autoimmune disease. Penberthy, W.T. 2007, Curr. Drug Metab., pp. 8:(3):245-266.

138. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

139. Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. . Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS. 2001., NeuroReport. , pp. 12(9):1841–1845. .

140. Tumor vaccines in 2010: need for integration. Koos, D., Josephs, SF, Alexandrescu, DT et al. 2010, Cell Immunol, pp. 263: 138-147.

141. BIN1 is a novel MYC-interacting protein with features of a tumor suppressor. . Sakamuro, D., Elliott, K., Wechsler-Reya, R. & Prendergast, G.C. 1996, Nat. Genet. , pp. 14, 69−77. .

142. Expression of Indolamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor draining nodes. Munn, S.H., Sharma, M.D., Hou, D., Baban, B. et al. 2004, J. Clin. Invest. , pp. 114: 280-290.

143. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Jessica Godin-Ethier, Laïla-Aïcha Hanafi, Ciriaco A. Piccirillo, and Réjean Lapointe. 2011 , Clin Cancer Res, pp. 17; 6985,   http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

144. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. . Munn, D.H. et al. 2002, Science 297, 1867−1870, pp. 297, 1867−1870 .

145. An HDAC inhibitor enhances cancer therapeutic efficiency of RNA polymerase III promoter-driven IDO shRNA. Yen MC, Weng TY, Chen YL, Lin CC, Chen CY, Wang CY, Chao HL, Chen CS, Lai MD. 2013, Cancer Gene Ther. , p.  http://dx.doi.org:/10.1038/cgt.2013.27. [Epub ahead of print].

146. Systemic delivery of Salmonella typhimurium transformed with IDO shRNA enhances intratumoral vector colonization and suppresses tumor growth. Blache CA, Manuel ER, Kaltcheva TI, Wong AN, Ellenhorn JD, Blazar BR, Diamond DJ. 2012, Cancer Res. , pp. 72(24):6447-56.
http://dx.doi.org:/10.1158/0008-5472.CAN-12-0193. Epub 2012 Oct 22.

147. Silencing IDO in dendritic cells: a novel approach to enhance cancer immunotherapy in a murine breast cancer model. Zheng X, Koropatnick J, Chen D, Velenosi T, Ling H, Zhang X, Jiang N, Navarro B, Ichim TE, Urquhart B, Min W. 2013, Int J Cancer., pp. 132(4):967-77. http://dx.doi.org:/10.1002/ijc.27710. Epub 2012 Jul 20.

148. Immunosuppressive CD14+HLA-DRlow/neg IDO+ myeloid cells in patients following allogeneic hematopoietic stem cell transplantation. Mougiakakos D, Jitschin R, von Bahr L, Poschke I, Gary R, Sundberg B, Gerbitz A, Ljungman P, Le Blanc K. 2013, Leukemia. , pp. 27(2):377-88.
http://dx.doi.org:/10.1038/leu.2012.215. Epub 2012 Jul 25.

149. Upregulated expression of indoleamine 2, 3-dioxygenase in primary breast cancer correlates with increase of infiltrated regulatory T cells in situ and lymph node metastasis. Yu J, Sun J, Wang SE, Li H, Cao S, Cong Y, Liu J, Ren X. 2011, Clin Dev Immunol. , p. 11:469135.
http://dx.doi.org:/10.1155/2011/469135. Epub 2011 Oct 24.

150. Skin delivery of short hairpin RNA of indoleamine 2,3 dioxygenase induces antitumor immunity against orthotopic and metastatic liver cancer. Huang TT, Yen MC, Lin CC, Weng TY, Chen YL, Lin CM, Lai MD. 2011, Cancer Sci. , pp. 102(12):2214-20. http://dx.doi.org:/10.1111/j.1349-7006.2011.02094.x. .

151. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. . Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

152. Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan. Zeng, J., Cai, S., Yi, Y., et al. 2009, Cancer Res., pp. 69: 3963-3970, http://dx.doi.org:/10.1158/0008-5472.CAN-08-2476.

153. Medicinal electronomics bricolage design of hypoxia-targeting antineoplastic drugs and invention of boron tracedrugs as innovative future-architectural drugs. Hori H, Uto Y, Nakata E. 2010, Anticancer Res. , pp. 30(9):3233-42. .

154. Synthesis of 4-cyano and 4-nitrophenyl 1,6-dithio-D-manno-, L-ido- and D-glucoseptanosides possessing antithrombotic activity. Bozó E, Gáti T, Demeter A, Kuszmann J. 2002, Carbohydr Res. , pp. 3;337(15):1351-65.

155. Radiopharmaceuticals XXVII. 18F-labeled 2-deoxy-2-fluoro-d-glucose as a radiopharmaceutical for measuring regional myocardial glucose metabolism in vivo: tissue distribution and imaging studies in animals. Gallagher BM, Ansari A, Atkins H, Casella V, Christman DR, Fowler JS, Ido T, MacGregor RR, Som P, Wan CN, Wolf AP, Kuhl DE, Reivich M. 1977, J Nucl Med. , pp. 18(10):990-6.

156. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology, pp. 107:452–460.

157. Induction of indoleamine 2,3-dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial infection. Loughman JA, Hunstad DA. 2012 , J Infect Dis. , pp. 205(12):1830-9. http://dx.doi.org:/10.1093/infdis/jis280.

158. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. . Terness, P., et al. 2002, J. Exp. Med.196:447–457., pp. 196:447–457.

159. The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46- and NKG2D-activating receptors and regulates NK-cell function. . Chiesa, M.D., et al. 2006, Blood. , pp. 108:4118–4125.38.

160. Differential effects of the tryptophan metabolite 3-hydroxyanthranilic acid on the proliferation of human CD8+ T cells induced by TCR triggering or homeostatic cytokines. Weber, W.P., et al. 2006, Eur. J. Immunol. , pp. 36:296-304.

161. Dendritic cell vaccination against ovarian cancer–tipping the Treg/TH17 balance to therapeutic advantage? Cannon MJ, Goyne H, Stone PJ, Chiriva-Internati M. 2011, Expert Opin Biol Ther. , pp. 11(4):441-5.  http://dx.doi.org:/10.1517/14712598.2011.554812. .

162. Phenotype, distribution, generation, and functional and clinical relevance of Th17 cells in the human tumor environments. . Kryczek I, Banerjee M, Cheng P, et al. 2009, Blood., pp. 114:1141–1149. .

163. The use of dendritic cells in cancer immunitherapy. Schuler, G., Schuker-Turner, B., Steinman, RM,. 2003, Curr. Opin. Immunol., pp. 15: 138-147.

164. Clinical applications of dentritic cell vaccines. Morse, MA, Lyerly, HK. 2000, Curr. Opin. Mol Ther., pp. 2:20-28.

165. Vaccination of melanoma patients with peptide or tumor lysate-pulsed dendritic cells. Nestle, FO, Alijagic, S., Gillet, M. et al. 1998, Nat. Med., pp. 4: 328-332.

166. Dentritic cell based tumor vaccination in prostate and renal cell cancer: a systamatic review. Draube, A., Klein-Gonzales, Matheus, S et al. 2011, Plos One, p. 6:e1881.

167. [Online] http://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapy-Products/ApprovedProducts/ucm210215.htm..

168. Dendritic cell based antitumor vaccination: impact of functional indolamine 2,3-dioxygenase expression. Wobster, m., Voigt, H., Houben, R. et al. 2007, Cancer Immunol Immunother, pp. 56:1017-1024.

169. [Online] oncoimmunology.2012 October1; 1(17):1111-1134, doi: 10.4161/onci.21494.

170. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. 2007 , Nat Immunol. , pp. 8(9):942-9. .

171. IFNgamma promotes generationof Il-10 secreting CD4+ T cells that suppress generationof CD8responses in an antigen-experienced host. Liu, X.S., Leerberg, J., MacDonald, K., Leggatt, G.R., Frazer, I.H. 2009, J. Immunol., pp. 183: 51-58.

172. Antigen, in the presence of TGF-beta, induces up-regulationof FoxP3gfp+ in CD4+ TCR transgenic T cells that mediate linked supressionof CD8+ T cell responses. . Kapp, J.A., Honjo, K., Kapp, L.M., Goldsmith, K., Bucy, R.P. 2007, J. Immunol., pp. 179: 2105-2114.

173. Opposing effects of TGF-beta and IL-15 cytokines control the number of short lived effecctor CD8+ T cells. Sanjabi, S, Mosaheb, M.M., Flavell, R.A. 2009, Immunity., pp. 31; 131-144.

174. Synergestic enhancement of CD8+ T cell mediated tumor vaccines efficacy by an anti-tumor forming growth factor-beta monoclonal antibody. . Terabe, M., Ambrosino, E., Takaku, S. et al. 2009, Clin. Cancer Res., pp. 15; 6560-9.

175. IL-12 enhances CTL synapse formationand induces self-reactivity. Markinewicz, MA, Wise, EL, Buchwald, ZS et al. 2009, J. Immunol., pp. 182: 1351-1362.

176. Tumor specific Th17-polarized cells eradicate large established melanoma. Muranski, P., Boni, A., Antony, PA, et al. 2008, Blood, pp. 112; 362-373.

177. Type17 CD8+ T cells dispplay enhanced antitumor immunity. Hinrichs, C.S., Kaiser, A., Paulos, C.M., et al. 2008, Blood., pp. 112:362-373.

178. Marying Immunotherapy with Chemotherapy: Why Say IDO? Muller, AJ, and Prendergrast, GC. 2005, Cancer Research, pp. 65: 8065-8068.

179. Enhancing Cancer Vaccine efficacy via Modulationof the Tumor Environment. Disis, ML. 2009, Clin Cancer Res, pp. 15: 6476-6478.

180. Systemic inhibition of transforming growth factor beta 1 in glioma bearing mice improves the therapeutic efficacy of glioma-associated antigen peptide vaccines. Ueda, R., Fujita, M., Zhu, X., et al. 2009, Clin. Cancer res., pp. 15: 6551-9.

181. Immune modulation by silencing IL-12 productionin dendritic cells using smal interfering RNA. Hill, JA, Ichim, TE, Kusznieruk, KP, et al. 2003, J. Immunol, pp. 171:809-813.

182. Immune modulation and tolerance induction by RelB-silenced dentritic cells through RNA interference. Li, M. Zang, X, Zheng, X, et al. 2007, J. Immunol, pp. 178: 5480-7.

183. RNAi mediated CD40-CD54 interruption promotes tolerance in autoimmune arthritis. . Zheng, X., Suzuki, M., Zhang, X., et al. 2010, Arthritis Res. Ther., p. 12:R13.

184. Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival. Min, WP. Gorczynki, R., huang, XY et al. 2000, J. Immunol., pp. 164:161-167.

185. LF15-0195 generates tolerogenic dendritic cells by supressionof NF-kappaB signaling through inhibitionof IKK activity. . Yang, J., Bernier, SM, Ichim, TE, et al. 2003, J Leukoc. Biol., pp. 74: 438-447.

186. RNA interfrence: A potent tool for gene specific therapeutics. . Ichim, TE, Li, M., Qian, H., Popov, HI, Rycerz, K., Zheng, X., White, D., Zhong, R., and Min, WP. 2004, Am. J. Transplant, pp. 4:1227-1236.

187. A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Zheng, X., Vladau, C., Zhang, X. et al. 2009, Blood, pp. 113:2646-2654.

188. Reinstalling Antitumor Immunity by Inhibiting Tumor derived ImmunoSupressive Molecule IDO through RNA interference. Zheng, X et al. 2006, Int. Journal of Immunology., pp. 177:5639-5646.

189. Roles of TGFbeta in metastasis. Padua, D., Massague, J. 2009, Cell Res., pp. 19;89-102.

190. Functional expression of indolamine2,3-dioxygenase by murine CDalpha+dendritic cells. Fallarino, F., Vacca, C, Orabona, C et al. 2002, Int Immunol., pp. 14:65-8.

191. Indolamine2,3-dioxygenase controls conversion of Fox3+ Tregs to TH17-like cells in tumor draining lymph nodes. Sharma, MD, Hou, DY, Liu, Y et al. 2009, Blood, pp. 113: 6102-11.

192. IDO upregulates regulatory T cells via tryptoophan catabolite and supresses encephalitogenic T cell responses in experimental autoimmune encephalomyelitis. Yan, Y, Zhang, GX, Gran, B et al. 2010, J Immunol, pp. 185; 5953-61.

193. IDO activates regulatory T cells and blocks their conversion into Th-17-like T cells. Baban, B, Chandler, PR, Sharma, MD et al. 2009, J Immunol, pp. 183; 2475-83.

194. Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletionof regulatory T cells. Dannull, J., Farrand, KJ, Mathews, SA, et al. 2005, J Clin Invest, pp. 115: 3623-33.

195. 1-MT enhances potency of tumor cell lysate pulled dentritic cells against pancreatic adenocarcinoma by downregulating percentage of Tregs. Li, Y, Xu, J, Zhou, H. et al. 2010, J Huazhong Univ Sci Technol Med Sci , pp. 30: 344-8.

196. siRNA mediated antitumorigenesis for drug target validation and therapeutics. Lu, PY, Xie, FY and Woodle, MC. 2003, Curr Opin Mol. Ther., pp. 5:225-234.

197. Stable supression of tumorigenicity by virus-mediated RNA interference. Brumellkamp, TR, Bernards, R, Agami, R. 2002, Cancer Cell, pp. 2; 243-247.

198. Small interferring RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells. Verma, UN, Surabhi, RM, Schmaltieg, A., Becerra, C., Gaynor, RB. 2003, Clin. Cancer. Res., pp. 9:1291-1300.

199. siRNA mediated inhibition of vascular endothelial growth factor severely limits tumor resistance to antiangiogeneic thromboposdin-1 and slows tumor vascularization and growth. Filleur, S., Courtin, A, Ait-Si-Ali, S., Guglielmi, J., Merel, C., Harel-Bellan, A., CLezardin, P., and Cabon, F. 2003, Cancer Res, pp. 63; 3919-3922.

200. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. . Wang, J., et al. 2006, J. Biol.Chem. , pp. 281:22021–22028.

201. Bin1 functionally interacts with Myc in cells and inhibits cell proliferation by multiple mechanisms. Elliott, K. et al. 1999, Oncogene , pp. 18, 3564−3573 .

202. Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. . Ge, K. et al. 1999, Proc. Natl. Acad. Sci. USA, pp. 96, 9689−9694. .

203. Losses of the tumor suppressor Bin1 in breast carcinoma are frequent and reflect deficits in a programmed cell death capacity. Ge, K. et al. 2000, Int. J. Cancer , pp. 85, 376−383.

204. Loss of heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Ge, K. et al. 2000, Int. J. Cancer , pp. 86, 155−161.

205. Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. . Tajiri, T. et al. 2003, Clin. Cancer Res., pp. 9, 3345−3355.

206. Targeted deletion of the suppressor gene Bin1/Amphiphysin2 enhances the malignant character of transformed cells. Muller, A.J., DuHadaway, J.B., Donover, P.S., Sutanto-Ward, E. & Prendergast, G.C. 2004, Cancer Biol. Ther. , p. 3.

207. Interactions of myogenic factors and the retinoblastoma protein mediates muscle commitment and cell differentiation. Gu, WJ., Scheniider,W., Condrolli,G., Kaushal,, S, Mahdavi,V., Nadal-Gnard, B. 1993, Cell, pp. 72; 309-324.

208. Structural analysis of the human BIN1 gene: evidence of tissue-specific transcriptional regualtion and alternate splicing. Wechsler-Reya, R, Sakamuro, J., Zhang, J., DuHadaway, J., and Predengast. 1998, J of Biol Chem.

209. A role for th ePutative Tuimor Supressor Bin1 in Muscle Differentiation. Wechsler-Reya, R., Elliott, KJ, Prendergast, GC. 1998, Molecular and Cellular Biology, p. 18 (1) :566.

210. The putative tumor repressor BIN1 is a short lived nuclear phosphoprotein whose localization is altered in malignant cells. Wechsler-Reya, R., Elliot, K., Herlyn, M., Prendergast, GC. 1997, Cancer Res, pp. 57: 3258-3263.

211. Transformation selective apoptosis by farnesyltransferase inhibitors requires Bin1. DuHadaway, J.B. et al. 2003, Oncogene, pp. 22, 3578−3588 (2003).

212. The c-Myc-interacting adapter protein Bin1 activates a caspase-independent cell death program. Elliott, K., Ge, K., Du, W. & Prendergast, G.C. 2000., Oncogene , pp. 19, 4669−4684.

213. Growth stimulation of human bone marrow cells in agar culture by vascular cells. Knudtzon, S., and Mortensen, BT. 1975, Blood, pp. 46 (6) 937-943.

214. Exogenous endothelial cells as accelerators of hematopoietic reconstitution. Mizer, C., Ichim, TE, Alexandrescu, DT, DAsanu, CA, Ramos, F., Turner, A., Woods, EJ, Bogon, V., Murphy, MP, Koos, D., and Patel, A. 2013, J. Translational Medicine, p. 10: 231.

215. Dissecting the bone marrow microenvironment . Torok-Storb, B. et al. 1999, Annals of New York Academy of Science, pp. 872: 164-170.

217. Yuasa, XX and Ball YY. 2011.

218. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int. , pp. 37(2):105-8. doi: 10.1002/cbin.10023. .

219. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

220. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

Read Full Post »

English: This diagram shows the chromosomes of...

This diagram shows the chromosomes of Drosophila melanogaster approximately to scale. Chromosome sizes were based on basepair lengths given on the NCBI map viewer, and A. B. Carvalho, 2002. Curr. Op. Genet. & Devel. 12:664-668. Centimorgan distances were derived from selected loci listed in the NCBI website. (credit  Wikipedia)

Introduction

Generally speaking sexually reproducing species are composed of individuals of two complementary mating types or sexes.  An essential aspect of the developmental history of each individual is thus sex determination and differentiation. There exist two sex determination mechanisms, somatic and germline, that based on the chromosomal mechanism in the Drosophila melanogaster.  In the somatic sex determination mechanism, each individual assesses the ratio of X-chromosomes to autosomal chromosome sets), the X:A ratio provides the primary sex-determining signal   (reviewed by Cline and Meyer, 1996).  When X:A=1, female differentiation ensues (Bridges, 1925), along with the male-mode of X-chromosome dosage compensation.  The X:A ratio is calculated within each cell of the developing embryo, 2 hrs after fertilization. The X:A ratio determines the sex in Drosophila (Bridges, 1916, 1921, 1925) in a somatic-cell-autonomous manner that occurs early in embryonic development (Baker and Belote, 1983; Baker, 1989). Females possess two X-chromosomes, and males possess one X-chromosome and one Y-chromosome.   The Y-chromosome is required only for spermatogenesis (Lindsley and Tokuyasu 1980; Bridges 1986), and will not be considered further.  The number of X-chromosomes is counted through a mechanism involving positive-acting X-chromosome-encoded transcription factors, termed X-numerator elements (Cline, 1988), negative-acting autosome-encoded transcription factors or denominators, and signal transduction factors provided maternally.  Among the X-numerators are sisterless-a, sisterless-b (sis-b), sisterless-c, and runt (Schurpbach, 1985; Cline, 1986, 1988; Steinmann-Zwicky et al., 1989; Parkhurst et al., 1990; Ericson and Cline, 1991, 1993; Estes, 1995; Hoshijima et al., 1995; reviewed by Cline, 1993).

The best candidate for a denominator gene is the deadpan (dpn) locus.  Both daughterless (da) and extramacrochaete (emc) fulfill the role of maternally contributed transduction loci (Cline, 1976; Cronmiller et al., 1988).  Both in vitro biochemical evidence and in vivo genetic evidence support the idea that transcription factors of the basic-helix-loop-helix (bHLH) family are able to form homo- and hetero-dimers; thus the X:A ratio counting mechanism seems to involve the relative affinities and chromosome-dependent stoiciometries of the bHLH proteins SIS-B, DA, EMC, and DPN.  When X:A=1, sufficient SIS-B protein is synthesized so that it can effectively compete with the EMC and DPN proteins for binding to DA protein.  DA:SIS:B heterodimers then bind to so-called establishment promoter (Pe) elements of the SXL gene and activates its transcription, resulting in an early burst of SXL protein that sets splicing and dosage compensation in to female-specific modes.  When X:A=0.5, too little SIS-B is produced, and DA protein remains sequestered with EMC and DPN.  The Sxl Pe remains inactive, and splicing and dosage compensation enters male-specific modes. In response to X:A ratio=1, an embryo specific promoter of the gene called Sex-lethal (Sxl) is activated (Keyes et al., 1932).

Sxl protein that acts as a master gene for the somatic germline sex determination, has three somatic functions. First, Sxl protein carries out autoregulation at the level of pre-mRNA splicing.  Second, Sxl controls female-specific differentiation at the level of pre-RNA splicing and polyadenylation at least two genes that code for transcription factors that effect terminal differentiation. Third, Sxl protein negatively regulates X-chromosome dosage compensation.  It does so in two ways, by alternative RNA splicing of a normally male-specific gene, and by translation-level regulation of many X-chromosomal transcripts during embryogenesis. In the male, with Sxl in the off state, male differentiation occurs because tra is in the off state and therefore the differentiation-effector transcription factors are produced in alternative male-specific modes.  Dosage compensation is active, and the male X-chromosome is decorated by a minimum of four proteins and two RNA molecules that form a complex along the entire chromosome (reviewed by Cline and Meyer, 1996).  Transcription of the male X-chromosome is elevated two-fold, and it produces the same amount of RNA per template as found in females.

Germline pathway for sex determination and dosage compensation is different than the somatic sex determination mechanism.  (Figure 1) Figure 1: Sex determination of D. melanogaster (1998)The vast majority of somatic sex determination loci have no function in germline cells.  For example, none of the X-chromosome numerators is required for proper oogenesis (Granadino et al., 1989, 1992; Steinmann-Zwicky 1991), despite the fact that proper oogenesis requires that X:A =1 in the germline (Schupbach, 1982, 1985) nor are tra, tra-2, and dsxF required for oogenesis.  Sxl and snf have germline functions but the former is not a binary switch gene between oogenesis and spermatogenesis (Despande et al., 1996; Bopp et al., 1993, 1995; Hager et al., 1997). Systematic screens for female-sterile mutations have identified a large number of genes required for normal oogenesis (e.g. Gans et al., 1975; Mohler, 1977; Perrimon et al., 1986; Schupbach and Wieschaus, 19889, 1991).  Female-sterility can arise in diverse ways, but one interesting class of mutations is germline-dependent and causes an “ovarian tumor” phenotype.  “Ovarian tumor” mutations cause under-developed ovaries, in which egg chambers and ovarioles are filled with an excess of undifferentiated germ cells that have adopted male-like characteristics that include a prominent spherical nucleus, assembly of mitocondria around the nucleus, and mis-expression of male-specific marker genes (Oliver et al., 1988, 1990, 1993; Steinmann-Zwicky, 1988, 1992; Bopp et al., 1993; Pauli et al., Wei et al., 1994).  Among the “ovarian tumor” class of genes are ovo, ovarian tumor (otu), fused, and two genes with somatic phenotypes, namely snf and Sxl. Strong mutations at the ovo and otu loci result in ovaries totally devoid of germ cells (King and Killey, 1982; Busson et al., 1983; Oliver et al., 1987; Mevel-Ninio et al., 1989; Rodesh et al., 1995), Weaker mutations at both loci result in viable germline cells that have abnormal male-like splicing at the Sxl gene (Oliver et al, 1993). The overall conclusion is that oogenesis requires a chromosomally female germline is wild type for ovo, otu, Sxl, and snf.  If one of these genes is defective, either the germline will die or male-like differentiation and tumor formation ensure.

However, there are soma-germline interactions for a normal sex determination. (Figure 2) Figure 2: Somatic-Germline Interactions. (1998)Unlike the somatic regulatory hierarchy, which genetic mosaic experiments clearly showed functions in cell-autonomous fashion, sexual differentiation of the germline requires inductive signaling from somatic cells.  This was shown by use of pole cell transplantation, the method of making mosaics in which germline cells surgically transferred from donor embryos  (Schubach. 1985; Steinmann-Zwicky et al., 1989).  These experiments show that proper germline differentiation requires a combination of germline-autonomous chromosomal cues and proper signaling from the soma.  Evidence with tra and dsx mutant somatic hosts indicates these soma-germline interactions have detectable effects by larval stages (Steinmann-Zwicky., 1996).

The ovo gene is genetically complex.  At least three transcripts are produced from the ovo region (Mevel-Ninio et al, 1991, 1995, 1996; Garfinkel et al., 1992, 1994).  Two of these are germline-specific and correspond to the ovo function, while the third corresponds to the somatic-epidermal, non-sex-specific shavenbaby (svb) function.  (For a schematic of the gene map please refer to Figure3) 

 The ovo function is transcribed from two closely spaced germline-specific promoters, ovo a and ovob, give rise to 5-kb mRNAs (Mevel-Ninio et al., 1991, 1995; Garfinkel et al., 1992, 1994).   First identified  promoter was ovob  Garfinkel et al., (1994)  and the leader exon it forms is called Exon 1b, 1028-codon-long open reading frame that contains four Cys2-His2 fingers at the carboxy terminus; protein MW of 110.6 kD.  A second germline promoter, ovoa, was identified by Mevel-Ninio et al (1995), 1400 codons long, and predicts a 150.8-kD protein.  This Exon 1a contains an in-frame AUG upstream of the translation start in Exon 2 utilized by the OvoB open reading frame.  The OvoB mRNA isoforms is predominant during adult life, with the OvoA isoforms only appearing during Stage 14 of oogenesis (Mevel-Ninio et al., 1991, 1996; Garfinkel., 1994).  The ovo zinc finger domain binds to its own germline promoter regions, to the otu promoter region (Garfinkel et al., 1997; Lee, 1998; Lee and Garfinkel 1998).  This is consistent with ovo playing an important role in a sex determination hierarchy operating in germline cells that involves these other genes. The svb function is transcribed from an incompletely characterized somatic promoter that forms a 7.1 kb poly(A)+ mRNA (Garfinkel et al., 1994).  This transcript accumulates 9-12-hr post-fertilization, in the somatic tissues that later in embryogenesis form the cuticular structures affected by svb mutations.  Wieschaus et al. (1984) observed that ventral denticle belts and dorsal hairs are defective in svb mutations; hence the name, and svb mutations are polyphasic larval lethals. Exons and exon segments that are found in all mRNA forms coded by the region correspond to genomic DNA where so-called svb-ovo- mutations map (Mevel-Ninio et al., 1989; Garfinkel 1992).  Finally, somatic-specific exons, exon segments, and transcriptional regions correspond to region mutable to the svb- ovo- phenotype.  Since al known mRNA forms utilize the same splice junctions to join Exon3 to Exon4, all protein forms coded by the locus are believed to contain the same four zinc fingers at the carboxy terminus.   A wide variety of evidence points to ovo playing a critical role in germline sex determination.  High-level of ovo transcription in germline cells, as detected with Xgal staining of ovo promoter-lacZ constructs requires that they have a female karyotype (Oliver et al., 1994).  Chromosomally male germline cells have low levels of ovo transcription even if the soma is transformed towards female through the use of hs-traF cDNA minigenes.  Likewise, chromosomally female germline cells have high levels of ovo transcription even if the soma is anatomically male through the action of tra loss-of-function mutations.  This argues that high-level of ovo transcription is a germline X: A ratio-autonomous property, and stands in contrast to related experiments with otu.  In the case of otu, there is evidence that chromosomally male germline cells, which normally have no need of otu+ function at all, require otu- for proliferation when they are in a female host (Nagoshi et al., 1995). The D. melanogaster ovo gene is required for cell viability and differentiation of female germ cells, apparently playing a role in germline sex determination.  While female X: A ratio in germline cells is required for high levels of ovo germline promoters.  Therefore we undertook to identify trans-acting regulatory regions of the X-chromosome, with a particular interest in identifying candidate germline X-chromosome numerator elements. In this study, I screened  X-chromosome using 45 deficiency strains, I found that these trans-regulating regions were grouped into 12 loci based on overlapping cytology.  Five regions were trans-regulating activators, and seven were trans-regulating repressors; extrapolating to the entire genome, this result predicts nearly 85 loci.  A subset of the dozen X-chromosomal regions correlated with previously identified E(ovoD) and Su(ovoD) loci (Pauli et al., 1995).  

Materials and Methods

 

Fly Strains and Growth Flies were maintained on standard yeast/cornmeal medium and kept at 25oC and 18oC unless otherwise indicated.  Mutants are described in Lindsley and Zimm (1992).  The ovo3U21 and ovo4B8 were obtained from Brian Oliver of NIH;  OvoD1rS1 FM3 is from the Garfinkel lab collection.  The remaining stocks were obtained from the Bloomington Stock Center (see Table 2.1 for the list of stocks that had been used and Figure 2.1 for their location on the X Chromosome). 

Outcrosses Outcrosses were designed to create transgenic flies so that screening of the X chromosome for trans-regulators of ovo in the germline can be done.   Virgin female flies were collected 14 hour long windows at 18oC or 8 hour long windows at 25oC, during which newly emerged males remained immature.  Collected females were kept 3-5 days to make sure they are virgin before outcrossing them.  Heterozygous virgin females (5-7), carrying deficiency X-chromosomes balanced over first chromosome balancers were mated with males homozygous for either of two P-element transformation constructs of a lacZ reporter gene fused to the ovo promoter.  Both events were inserted on third chromosome.  They were grown at 25oC unless otherwise noted. The control class of F1 progeny has a complete X-chromosome pair, whereas the experimental class has one complete and one deficient X chromosome in its genome.  The [ovo::lacZ constructs] were designed by Oliver et al., (1994).  In this study two of their strains, ovo4B8 (pCOW+1.9) and ovo3U21 (pCOW-2.1) respectively, were used to determine the ovo promoter activity.

Outcrosses to Remove Duplications Several X-chromosome deficiencies in the Bloomington collection are carried in males, with compensatory duplications of X material on an autosome.  These had to be crossed to eliminate the duplications (Fig 2.4).  This was done as follows:  FM3/FM7a virgin flies were mated to Df/Y; Dp males.  Among the F1 progeny, half of the Df/(FM3 or FM7a) daughters will carry the unwanted duplication, and half will be free of the duplication.  In some cases, presence of the duplication could be determined from the females’ phenotypes.  In other cases, up to twenty individuals virgin Df(FM3 or FM7) F1 progeny were backcrossed to FM7a/Y males to establish stocks.  In the F2, absence of the duplication could be established by examining sons; in all cases, the Df is male-lethal unless “rescued” by the duplication.  Also FM3 is itself male lethal.  Thus, single-female stocks that produce only FM7a sons had the desired genotypes and were kept for experiments.

X-Gal Staining In this assay ovaries from two-day-old adults were dissected in Drosophila Ringer’s solution (182 mM KCl, 46 mM NaCl, 3 mM CaCl2, 10mM TrisHCl, pH 6.8).  Then, these tissues were transferred to a microtiter plate and fixed in 1% gluteraldehyde, 50mM Na-cacodylyte acid solution for 15 minutes. After rinsing the tissues, three times for 5 minutes each staining buffer (7.2 mM Na2HPO4, 2.8 mM NaH2PO4, 1.0 mM MgCl2, 0.15 mM NaCl), they were transferred to incubation buffer (staining buffer, 5 mM Fe2 (CN)3, 5 mM Fe3 (CN)2, 0.2% X-Gal) for an hour at 37oC.  Next, tissues were washed three times 5 minutes each in washing buffer, which is a 1 mM EDTA, added PBS (130 mM NaCl, 7 mM Na2HPO4*2H2O, 3 mM NaH2PO4*2H2O, pH 7.0) solution.  Finally, the tissues were dehydrated in ethanol solutions of increasing concentrations (50%, 75%, 95%) and mounted on a slide in Permount.  Preparate concentrations were examined under a compound microscope to make correlations between staining and gene activity. Although it was easy to determine positive and negative controls, but this assay wasn’t sensitive enough to see subtle differences due to effects of deleted regions on ovo promoters driving LacZ.

Histochemical Assay of LacZ Activity This method allowed us to make quantitative measurements of lacZ activity due to ovo promoter function in animals heterozygous for X-chromosome deletions.  Emerging F1 flies were collected and aged for two days before dissecting ovaries under a dissecting microscope.  For each soluble assay, 10 flies were dissected.  This is repeated at least seven assays (N, sample number) completed per stock for each construct.  Ovaries from ten dissected outcrossed flies were out into eppendorf tubes containing 100ml of Assay Buffer (50 mM K-phosphate, 1 mM MgCl2 at pH 7.8) and homogenized about 20 strokes.  For each dissected pair of ovaries 100 ml  of assay buffer was used and the volume was completed to appropriate amount.  After centrifuging for one minute, 20 ml of the supernatant was transferred into 980 ml of assay buffer (Simon and Lis, 1987; Ashburner, 1989) to make 2mM chlorophenol red-beta-D-galactopyranoside (CPRG).  Absorbance at 574 nm was measured at half hour time intervals starting from zero to two hours hydrolysis of CPRG by chlorophenol (red CPRG).  CPR has a molar extinction coefficient of 75,000 M-1 cm-1 (Boehringer-Manheim data sheet) and this is a very easily detected product of b-galactoside enzyme activity. Range finding experiments showed that 2mM of CPRG gives linear data for 2-3 hours often, color changes could be seen with the unaided eye. Two controls are shown in Figure 2.8 that validates CPRG for this work.  Ovaries from a non-transformed strain (y w RD) were used to prepare soluble extracts.  A near zero-absorbance at 574 nm was observed that did not appreciably change over several hours.  In contrast, ovarian extracts from the ovo promoter-lacZ transformant strain ovo3U21 and ovo4B8 (Oliver et al, 1994) showed a steep linear increase in A 574 during the same period.  The slopes of these lines were proportional to the amount of ovo3U21 and ovo4B8 extract added.

Bradford (1976) Assay For Protein This protein determination method is based on the binding of Coomasie Brilliant Blue G-250 to the protein.  Preparation of protein reagent was done according to Bradford (1976).  After 100 mg of Coomasie Brilliant Blue G-250 was dissolved in 50 ml 95% ethanol, and then 100 ml 85% (w/v) phosphoric acid was added.  The resulting solution was diluted to a final volume of 1 liter [final concentrations in the reagent were 0.01% (w/v) Coomasie Brilliant Blue G-250, 4.7% (w/v) ethanol, and 8.5% (w/v) phosphoric acid].  20ml of prepared soluble extract from the dissected tissues were used.  This volume is diluted to 0.1ml with ddH2O, then 5ml of protein reagent was added to the test tube and contents were mixed.  The absorbance at 595nm was measured after 2 min and before 1 hr in 3 ml cuvettes against a reagent blank prepared from 0.1 ml of the appropriate buffer and 5 ml of protein reagent.  A standard curve using known quantities of bovine serum albumin (BSA) was constructed.  Soluble extract absorbances were plotted on the standard curve and protein amount interpolated.

Statistical Analysis Average specific activity is calculated as nanomoles of substrate used per hour per nanogram protein expressed (nmole CPRG liberated /ng / hr).  Sample number (N) always exceeded seven.  Mean specific activity and standard error of the mean (SEM) were calculated for each experimental and control class.  The F test was used to determine whether variances were equal, and therefore,, which type of student’s t-test calculation was appropriate.  A significant difference between experimental and control values was identified by a P < 0.05 for the t-test score.

RESULTS

In this study and ovo mechanism study, the X-chromosome was screened, using 56 different deficiency strains    Table 1: List of Stocks for X-chromosome Screening (1998), Table 2: Stocks Made in This Study for X-Chromosome Screening , Table 1: Stocks for Negative Autoregulation of ovo (1998)  to identify transregulation of ovo Table 3: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo3U21, Table 4: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo4B8 (Results). 

The results are given in three sections: X chromosome deficiency screening, negative autoregulation of ovo exhibited by deficiencies removing ovo, and gene dose analysis using P element transformants carrying extra copies of ovo.

X Chromosome Screening The presence of polytene chromosomes in the salivary glands, which have distinctive, banding patterns allows the map positions of genes to be correlated with physical features of the chromosomes.  Breakpoint locations rearrangements, and the locations of cloned sequences can be easily established.  Each of the major chromosome arms is divided into 20 numbered segments, except chromosome 4, which is divided into 4 regions.  Each numbered region is then divided into six consecutive lettered regions, and each lettered region into numbered bands, for example 4E1. The precise relationship between physical length and the numbering scheme depends on local topography (Lefevre, 1976).  In the summary tables, each deficiency listed according to cytological positions. The map of the X chromosome, including the deficiencies used in this study is given in Materials and Methods (Fig 1). Figure 1: Sex determination of D. melanogaster (1998) In Drosophila melanogaster germ cells, ovo has a primary role in female sex specific cell viability, proliferation and differentiation.  Ovo responds to the number of X-chromosomes as assessed by high level expression (Oliver et al., 1994).  Thus, the ovo promoter may be dependent upon X germline numerator elements.  To identify possible trans-regulators of the ovo germline promoter (and, I hope, to identify germline numerators) I undertook deficiency screen for quantitative effects on ovo::lacZ reporter constructs.  Determination of trans-regulation effect by any of the deletion mutant, was based on two general rules.  If the excised part of the X chromosomes has any genes with the positive regulatory effects on ovo gene activity, then the levels of LacZ reporter gene function will be reduced in experimentals compared to control siblings.  If the experimental class results in the elevation of the LacZ activity by producing high levels of enzyme compared to controls, the elevated region having removed a repression locus. Significant effects were determined by statistical analysis, which using a student’s t-test P value is less than or equal to 0.05.  X-chromosome screening results are presented in Table 3.1 and 3.2.  The entire X-chromosome deficiency set was tested twice: once with a 3.3kb ovo promoter fragment driving LacZ (strain ovo3u21), and separately with a 3.1kb ovo promoter (ovo4B8).  Of  45 deficiencies that represent about 70% of the X-chromosome 17 deficiencies had significant effects in both ovo3U21 and ovo4B8 reporter activity, 1 deficiency had significant effects on only ovo3U21 and only 1 deficiency effect on ovo4B8.  Some of these deficiencies partly overlap, allowing the identification of 11 regions that apparently contain trans-acting modifiers of ovo promoter activity six are positive regulators and five are negative.

Region 1-4.  This region covers the eight overlapping deficiency lines, Df(1) BA1, Df(1)sc14, Df(1)64c18, Df(1)JC19, Df(1)dm75e19, Df(1)N8, Df(1)A113, DF(1)JC70.  For three of them, Df(1)A113, Df(1)JC70, and Df(1)BA1, the student’s t-test probabilities show a significant difference between control and experimental siblings.  The remaining strain has no significant trans-regulation effect on ovo gene activity.  Df(1)BA1 enhanced the ovo gene expression activity about 20% when either ovo3U21 or ovo4B8 is used.  It was suggested that a suppressor of ovoD (1F-2B+ locus) maps within 1E3-4 to 2B3-4 because of the dramatic gene dose effect of this region on the development of ovoD2/+ ovaries (Pauli et al, 1995).  In contrast, it was found that Df(1)A113 and Df(1)JC70 have repressing effects on ovo expression.  Df(1)A113 (3D6-E1; 4F5) removes several genes beside ovo, showed a very significant repression effect in outcrosses, about 82% and 47% (e/C), in ovo3U21 and ovo4B8 respectively.  That data obtained in Df/+ females has a particular quantitative significance, which implies that the missing loci have the complementary effect. It was shown that this region is contains a gene or genes resulting in genetic unbalance (Cline et al., 1987).  Also, Oliver et al., (1988) show that in deficiency lines, which they have used, strains removing both ovo and snf together are reducing viability of the progeny, that is, there is a synergistic interaction between ovo and snf.  

Region 5-8.  Twelve overlapping deletions have been tested in this region.  Two deletions Df(1)N73 (5C3-5;5E-8) and Df(1)Lz90b24 (8B-D) caused very significant repressing effects, implying the presence of trans-activating loci, one deletion Df(1)RA2 (7D10;8A4-5) resulted in heterozygous experimentals with significant elevation in LacZ compared to siblings, implying a trans-repressor locus.  It has been reposted that Df(1)RA2 strongly enhances ovoD  phenotypes due to the function of otu+ in germline sex determination (Pauli et al., 1993).  However, since out protein is cytoplasmic, it is unlikely that the Df(1)RA2 effect on ovo::lacZ promoter activity is due to changing dosage of otu.  It is also suggested that there is a synergistic interaction between ovo and lozenge, eye phenotype, which is deleted by Df(1)Lz90b24, and here the data showed a trans-activating effect due to this deletion.  The other deletions do not cause any significant effect on gene activity.

Region 9-10.  In this cytological position nine deficiency lines had been tested.  Since this region was very dense for putative trans-regulation repressors, it was group in a small region.  Among nine of the deficiencies were used six of them showed a repressor effect.  These effective regions were: Df91)vL15, Df(1)N110, Df(1)HC133, Df(1)vL11, Df(1)KA7, and Df(1)N71.  This region seems to have a very important effect on ovo, since in the 9Bto 10F interval there are various levels of repressor effect.  Two common overlapping regions were found; one was from 9C4 to 9D1-2, and the other was from 10A to10F6.  Other repressor effects from strongest to weakest was Df(1)vL11 (9C4;10A1-2), Df(1)HC133 (9B9-10;9E-F), Df(1)N110 (9B3-4;9D1-2), and Df(1)v-L15 (9B1-2;10A1-2), Df(1)KA7 (10A9;10F6-7) breakpoint was outside the first loci in the examined region.  Df(1)Ka7 and Df(1)vL15 show about 20% increase in the heterozygous siblings, the longest and the shortest breakpoints, respectively.  Three out of five repressing effect intervals, Df(1)v-L11 (9C4; 10A1-2), Df (1)HC133 (9B9-10; 9E-F), Df(1) N110 (9C4; 10A1-2) is the strongest of all in Df/+ and bearing the common region among the five strains, which is 9C4; 10A1-2.  

Region 11-13.     Eight deficiency lines were in this region, Df(1)JA26, Df(1)HF368, Df(1)N12, Df(1)C246, Df(1)g, Df(1) RK2, Df(1)RK4, and Df(1) sd 72b   .  It has been found that this region involves five overlapping deletions that gave rise to repressing effect on ovo gene expression.  According to common regions of the cytological positions, these overlapping deletions were grouped into three loci.  These three common regions, which are responsible from trans-regulation activity of ovo, reside on 11D0F; 12B-D, and 13F-B regions of the X-chromosome.  Df(1)N12 (11D12;11F1-2) and Df(1)C246 (11D-E; 12A1-2) were in the 11D-F loci, Df(1)g (12B;12E8) and Df(1)RK2 (12D2-E1; 13A2-5) were in the 12B0D region, and Df(1)sd72B (13F1-14B1) in the 13B-14B loci, all of which in this examined region showed a repressor activity. The strongest effect among the X-chromosome screening was located in 11D1-11F1-2 excised region of X-chromosome, this deletion corresponds to Df(1)N12 strain, which shows a significant effect as well as high gene activity repression, Around 140% to 240% E/C in Df/+ flies for both ovo::LacZ constructs.  In addition, it has been reported that reduced dose of the 11D-F region results in synergistic mutant phenotypes with a number of somatic sex determination genes (Belote et., 1985).  Furthermore, Flybase reports that this region seems to include locus involved in early sex determination examined by Scott and baker (1986). However, ambiguities in deficiency breakpoint assignments complicate interpretation.  For example, first loci, which includes Df(1)N12 and Df(1)C246 due to uncertainty at the distal end breakpoints of Df(1)C246 (12D-e; 12A1-2); the trans-acting repressor of ovo maybe located in 11E-F rather than 11D-F. Similarly, for the second loci in this region ambiguity at the distal breakpoint of Df(1)RK2 also cause a dilemma about the location of the trans-acting repressor, since the question was the common region between Df(1)g and Df(1)RK2 was whether in the 12D-E or in the 2E1-2E8 of X-chromosome. On the other hand, the last loci were determined by the only one deficiency strain.  In this case, the problem was whether determination of the loci was accurate enough, or whether another locus is involved in repressing of ovo reporter activity which Df(1)sd72b (13F1–14B1) may have a common region with.  This deficiency removes several lethal mutations, Myb, sd (scalloped), shi (shibiri), and exd (extradenticle).  Two genes previously cloned in the 13F cytological region are the Drosophila c-myb oncogene homolog (Katzen et al, 1985) and a G protein b-subunit (Yarfitz et al 1988).  It has been suggested that the sd+ gene might be associated with more than one product (perhaps a differential processing) or it might reflect differential tissue and/or temporal regulation (Campbell et al., 1991).

Region 14-20.   In this region eight deficiency strains, Df(1)4b18, Df(1)rD1, Df(1)B, Df(1)N19, Df(1)JA27, Df(1)HF396, DF(1)DCB1, and Df(1) A-209, were tested.  According to measured specific activities Df(1)4b18 (14B8; 14C1) and DF(1) B (15F9=16A6-7) showed significant activating effect on ovo promoter, activity of the former was weaker than that of latter.  Since there is no common region between these two putative trans-acting activators, interpretations of the results gave rise to two loci, 14B8-14C1 and 15F-16A1; 16A6-9. In addition, the Flybase report for Df(1) shows that 70 deletion that breaks within the second exon of the non A (no on or transient A) gene from Stanewsky et al (1993). As a result of X-chromosome screening, 45 deficiency strains were tested and found 17 regions were trans-regulating ovo promoter.  These regions were classified into 12 loci according to their overlapping common regions.  Among these, six, of which were showing trans-acting activator effect, and seven, of which were responsible for trans-acting repressor effect on ovo promoter.   Furthermore, one deficiency strain, Df(1)sc14, showed a significant trans-acting repressor effect in only ovo4B8 strain but not in ovo3U21 strain.  This maybe explained by position effect of P[ovo::LacZ] construct due to landing on P element transposase onto insertion site or by difference between the size of the ovo::LacZ constructs, e.g. ovo3U21 carries 200 bp longer than ovo4B8 at the N-terminal end that may cause a better translation product.  Consequently, among the X-chromosome screening data, it was found that two of the deficiency lines. Df(1)A113 and Df(1)JC70, which are removing ovo and snf along with the several genes due to deletions, and correspond to one loci acting as an repressor, were taking into more detailed investigations.  These results suggested a negative autoregulation mechanism in the ovo promoter.  Therefore, negative autoregulation of ovo was examined with three approaches: ovo point mutations, more defined deficiency strain, and downstream genes.

DISCUSSION

  The sex determination involves complex set of mechanisms.  The fly is chosen to be studied since Drosophila is inexpensive to rear, generates large numbers of progeny, and has nearly a century of accumulated data upon which to design experiments.  Mutational analysis of cell biological and developmental process is relatively simple, even if the resulting mutations are organism-lethal when homozygous.  This is decided advantage over mammalian genetics, in which lethal mutations often die in utero, which complicates the ability to examine and interpret mutant phenotypes. The Drosophila genome is one-twentieth the size of the mammalian genome, making insertional mutagenesis and positional cloning much less difficult.  Additionally, mammalian genetics lacks genetic tools such as balancers that make the maintenance of sterile and lethal-mutations nearly trouble free in Drosophila.  Nematodes have many of the same conveniences as Drosophila, with the added advantage of a highly stereotyped pattern of embryonic (and post-hatching) cell lineages.  The more-regulative character of Drosophila development induces complications lacking from worm genetics, with respect to cellular level analysis of mutant phenotypes.  Perhaps, the most compelling reason to take advantage of the specialized properties of Drosophila, is the extent to which prior studies have shown that genes, proteins, and developmental pathways and processes are conserved among metazoan groups.  We can, with high confidence, study sex determination in Drosophila with a reasonable confidence that what we learn can be extrapolated to other species, including man and his clinical diseases.

  The deletion mapping technique was used to identify the locations of genes that are required for ovo trans-regulation.  Each deficiency line removes several to many genes from the genome.  A sufficiently complete set of overlapping deletions can allow, potentially, every individual trans-acting gene to be localized. Seventeen deficiencies that have effects on the ovo germline promoters are shown in Table 4.1.  Twelve deficiencies showed repressor effects, and five deficiencies showed activator effects.  Deleted regions may affect any of several processes, such as numerator elements, cell viability and differentiation, dosage compensation, and response to inductive signals from soma.  Determination of which gene within a specific region is responsible for the effect on ovo requires more defined deletions or having null alleles for each gene. Estimation of the Number of Trans-Regulators.  Among the seventeen deficiencies in Table 4.1, overlapping common regions identify seven that function as trans-acting repressor loci, and five that function as trans-acting activator loci.  Thus, the entire euchromatic X-chromosome may have as many as ≈10 repressor genes and ≈7 activator genes for the ovo germline promoters.  If these results were extrapolated to the entire fly genome, ≈50 repressors and ≈35 activators of ovo transcription are predicted.  These are underestimates from the data, since any given deleted common region need not remove exactly one relevant gene. Is it reasonable for nearly 85 genes to be involved in regulating the ovo germline promoters?  Precedents from other developmental control systems suggest this is not an implausibly high number.

Regulation of the master sex determination gene Sxl is complex.  To establish somatic sex determination in the early embryo, nine genes are required to activate the Sxl early promoter.  These are sis-a, sis-b, sis-c, run, da, emc, gro, dpn, and her.  In biochemical terms, most are DNA-binding proteins.  In genetic terms, some are positive and are others are negative regulators.  Maintenance of Sxl expression involves positive autoregulation at the level of pre-mRNA alternative splicing.  At least five genes are known to play specific roles in this process: Sxl itself, snf, vir, her, and fl(2)d.  Function of Sxl in the germline is regulated in several ways.  Germline-specific transcriptional control of Sxl is still conjectural, but it is clear that the somatic functioning numerator elements play no role in the germline.  It is possible that ovo may play an important role in germline transcriptional control of Sxl (e.g., Lee. 1998); certainly it has an indirect role (e.g., Oliver et al., 1993).  Splicing-level autoregulation of Sxl is active in the female germline, and it involves the same genes that function in this process in somatic cells.  Once Sxl protein is produced in female germline cells, the otu protein plays an important role in this relocalization into the nucleus.  Thus, a minimum of sixteen genes is required for proper regulation of Sxl.

Establishment of the body plan in Drosophila is also under complex transcriptional control.  Maternally localized RNA and protein molecules establish the gross body axes: anterior-posterior and dorsal-ventral.  Hierarchically organized sets of zygotically activated genes are transcribed, and their protein products serve to refine the body axes into progressively finer-grained structures.  The metameric anterior-posterior body axis is specified by so-called gap genes, pair rule genes, and segment polarity genes, which create the segment-sized repeating units of the body.  Homeotic genes encoded by the Antennapedia Complex (ANT-C) and bithorax Complex (BX-C) then confer position-specific identities upon each segment. During the cellular blastoderm stage, gap genes and maternal coordinate genes regulated the activation of primary pair rule genes such as even-skipped (eve).  These are expressed in seven one-segment-wide stripes that alternate with on-segment-wide regions of non-expressing cells.  For example, the second stripe of eve expression is positively regulated by hunchback and bicoid, and negatively regulated by giant and Kruppel.  All four proteins directly bind to a 500-bp-long “eve-stripe 2 enhancer.”  Binding have giant and Kruppel is competitive with binding of hunchback  and bicoid, and vice versa.  Thus, spatially controlled concentrations of giant, Kruppel, bicoid, and hunchback proteins result in spatially restricted activation or repression of the eve stripe 2 enhancer.  The remaining six stripes of eve expression are similarly controlled by other DNA-binding proteins, which are acting another discrete stripe-specific enhancers. Ectopic expression of homeotic genes can have disastrous effects on development.  Thus, a special heterochromatin-like mechanism functions to ensure that ANT-C and BX-C genes are inactive in cells and tissues that do not require their expression.  Stable repression is mediated by the Polycomb class of proteins, which number over forty. Each of these examples illustrates that developmental control of individual gene transcription is mediated by both positive and negative effectors, and that sometimes the number of such upstream regulators numbers between one and several dozen.  Thus, our estimate of 85 regulators of the ovo germline promoters is not out of line with other developmentally regulated systems.

Evaluation of Candidate Loci Within Common Regions.   Based overlapping cytology, seventeen deficiencies that affected the ovo germline promoter fell into twelve common regions.  Each of these will be discussed in turn below. Of particular interest was the relationship each of our trans-acting may have with Su(ovoD) and E(ovoD) loci identified in a generic screen by Pauli et al. (1995).  In general, it is not straightforward to suggest identities between Su(ovoD) or E(ovoD) loci and our trans-acting repressor or activator loci because of the dissimilar means of assaying these gene-dose-sensitive interactions.  We use quantitative measures of LacZ reporter activity as a proxy for ovo transcription, while Pauli et al. (1995) use semi-quantitative measures of vitellogenesis.

Region 1 (polytene bands 1A1; 2A1-4):  The distal region of the X-chromosome showed a trans-regulating activator effect on the ovo promoters.  This region includes the acheate-scute complex (AS-C), home of the X-chromosome numerator element sis-b (Cline, 1988; Parkhurst and Ish-Horowicz, 1990), also known as scute-T4.  This numerator has no function in the female germline (Granadino et al., 1989).  Pauli et al., (1995), using other deficiency strains affecting this section of the X-chromosome, identified a strong Su(ovoD) locus in the polytene region 1E3-4; 2B3-4 that may correspond with our trans-activator.  Flybase indicates that this region contains over 100 genes, among them 23 unassigned open reading frames, 33 genes defined by apparent visible mutations, 53 lethal genes,, and two female sterile loci.

Region 2 (polytene bands 4C15-16; 4F15):  This region includes the ovo and snf loci, and was identified by Pauli et al., (1995) as a strong E(ovoD) due to the effects of these loci.  Further discussion is deferred to mechanism of ovo autoregulation, which deal with ovo negative regulation. Region 3 (polytene bands 5C3-5; 5E8):  This region has a trans-regulatory activation effect on the ovo germline promoters.  Deficiency for this region showed no interaction with ovoD in the vitellogenesis assay (Pauli et al., 1995).  Examination of Flybase records for this region reveals over twenty genes, and no strong candidates that may account for the interaction with the ovo promoters.

Region 4 (polytene bands 7D10; 8A4-5):  Results  showed that this region contains a transacting-repressor of ovo germline promoter activity.  This region reported by Pauli et al. (1995) to contain a strong E(ovoD) locus, which was identified as the ovarian tumor gene (Pauli et al., 1993, 1995).  It is virtually certain that the repressor-of-ovo is distinct from otu.  First, the otu protein is cytoplasmic and plays a role in egg chamber cytoskeletal function (Nagoshi et al., 1997).  Second, the ovo protein binds to the otu promoter in vitro (Garfinkel et al., 1997; Lee, 1998, Lee and Garfinkel 1998; Lu et al., 1998).  Third, under certain conditions, in vivo activity of the otu promoter is dependent upon ovo protein production (Hager and Cline, 1997; Lu et al., 1998).  Examination of Flybase reveals that this region contains fifty genes mutable to lethal, visible, or female-sterile phenotypes, but none appear to be a strong candidate for the repressor-of-ovo locus.

Region 5 (polytene bands 8B5-8; 8DE):  This region also has an apparent repressor of ovo germline promoter activity.  Deficiency for this region showed no interaction with ovoD mutations in the Pauli et al. (1995) vitellogenesis assay.  Examination of Flybase reveals that this region contains thirty genes mutable to lethal, visible, or female sterile phenotypes.  One gene stands out as a candidate for the repressor, namely, lozenge.  This is a complex locus that is mutable to female sterility (Green and Green, 1949, 1956), and it is named for a reduced-eye, smoothened-eye, mutant phenotypes.  Interestingly, certain ovo-mutant alleles are called “lozenge-like” in recognition of a similar eye defect (Oliver et al., 1987; Mevel-Ninio et al., 1989; Garfinkel et al., 1992).  The lz gene codes for a transcription factor (Dag et al., 1996). Region 6 (polytene bands 9C4; 9D1-2):  The cytological assignment of this region is based on the overlap of three deficiencies:  Df(1)N110, Df(1)H133, and Df(1)v L11.  Together, they mark a trans-acting repressor of ovo promoter activity.  According to  Pauli et al. (1995), only two of these three deficiencies behaved as if they exposed an E(ovoD) locus, while the third had no effect.  In combination with positive results from other deficiencies, Pauli et al. positioned the E(ovoD) locus at cytological region 9E-F.  Thus, it is again possible that the repressor-of-ovo we identified is distinct from a nearby E(ovoD) locus, and is among the half-dozen loci identified by Flybase as mapping into this interval.

Region 7 (polytene bands 10A6; 10F6-7):  This region contains a trans-acting repressor of ovo promoter activity.  According to Pauli et al. (1995), the defining deficiency had no significant interaction with ovoD alleles.  Examination of Flybase reveals that this region includes the somatic X-chromosome numerator element sis-a, which also has no function in germline development (Granadino et al., 1989, 1990, 1997).  Given the extent of this region, it is not  surprising that Flybase identifies 65 genes with diverse phenotypes and biochemical roles; however no strong candidate locus that may count for the repressor-of-ovo locus is apparent.

Region 8 (polytene bands11D1-2; 11F1-2):   This region contains perhaps the strongest trans-acting repressor of ovo promoter activity in the survey: deficiency heterozygous experimentals had 2-2.5 fold more lacZ specific activity in their ovaries that the balancer carrying controls.  According to Pauli et al (1995), one of the two deficiencies defining this common region showed a statistically weak enhancement of ovoDalleles, while the other had a significant Su(ovoD) phenotype.  Likewise, Belote et al. (1985) and Scott and Baker (1986) reported that the same deficiency later shown to have Su(ovoD) activity also interacted with loci in the somatic sex determination pathway.  It is an open question how these three results relate to one another.  Among sixteen genes that map into this region are two signal transduction loci: the Mek3 gene, a serine-threonine-specific protein kinase in the MAP kinase pathway, and a beta subunit of the heterotrimeric GTP-binding protein. A solitary female-sterile, fs(1) K4, also maps roughly into this region; it is germline-dependent, and yields fragile eggs, a phenotype occasionally seen in the eggs laid by ovoD3/+ females.

Region 9 (polytene bands 12D2-12E1; 12E8):  This region contains a trans-acting repressor of ovo promoter activity.  According to Pauli et al. (1995), neither deficiency defining this common region interacted with ovoDalleles.  This region contains the yolkless gene (DiMario et al., 1987), which has been cloned and codes for a member of 35 known genes, including a cluster of tRNA genes, the male-germline-specific Stellate genes, and several lethal and female-sterile genes.

Region 10 (polytene bands 13F1; 14B1):  This region contains a trans-acting repressor of ovo promoter activity.  Again, no significant interaction with ovoD allel4es was observed by Pauli et al. (1995).  Podry, Katzen and others have extensively mutagenized this region due to its containing shibiri (the Drosophila homolog of dynamin), c-myb, another Gb subunit, and the homeodomain protein extradenticle.  Their work revealed a total of twenty lethal genes, ten apparent visibles, and over a half-dozen unassigned open reading frames.

Region 11 (polytene bands 14B8; 14C1):  This region contains a trans-acting activator of ovo promoter activity.  According to Pauli et al., (1995), the defining deficiency had no significant interaction with ovoD alleles.  This region is surprisingly dense genetically, as it apparently contains over forty genes.  Several behavioral genes coding for neuronal functions map here, including nonA, paralytic, and easily shocked.  The nonA gene codes for an RNA-binding protein, and is mutable to a variety of phenotypes including recessive lethality, male-courtship-strong abnormalities, and defective vision.  The location of para (a sodium channel) is particularly intriguing since parats mutations fail to complement certain napts alleles, and nap genetically overlaps the dosage compensation function maleless.  Mutations in maleless are unique among the known dosage compensation loci in having a mutant phenotype in germline clones, and they are said to suppress the female-germline-lethality of ovo null mutations.  The easily shocked locus codes for ethanolmine kinase, and mutations at this locus also interact with mle.

Region 12 (polytene bands 15F9-16A1; 16A7):  This region contains a trans-acting activator of ovo promoter activity.  According to Pauli et al. (1995), the defining deficiency had no significant interaction with ovoDalleles.  Examination of Flybase reveals that this region contains at least a dozen female-sterile loci, a dozen lethal loci (including the Bar homeodomain protein gene). There is an ambiguity in compared mean of activities.  According to the negative autoregulation mechanism, there suppose to be a linear decrease pattern correlated to increase in copy of ovo.  However, the pattern of the gene dose was reaching plato, when three copies of ovo were present in the genome. Yet, this also shows that there is a protection mechanism that counts the number of ovo versus number of X chromosome exists.  Therefore, the sex determination mechanism turns off the extra ovo in the system immediately. 

Consequently, the system prohibits more wrong information to be processed according to its default setting where if the X:A ratio equals to one the outcome is going to be prepared as female, if not turn off the mechanism towards male-like, sterile mode, or death at the embryonic stage.  This discontinuity in the linear correlation may be due to position effect of P[w+ ovo+].  Future Directions and Concluding Remarks The results of this study suggest that the ovo germline promoters are regulated by a large set of upstream factors.  Nearly a dozen of these maps to the X-chromosome, some to region that are well characterized genetically.  Further deficiency mapping experiments, and assessment of the phenotypes of single-P insertion lines with female-sterile or perhaps lethal phenotypes, would be required to identify the relevant genes.  Some regions contain candidate loci that have been cloned (e.g. lozenge); in this example, either in vitro DNA-binding experiments using Lz protein and the ovo promoter region, or computational assessment of the likelihood that the ovo promoter contains binding sites for Lz can be done. Another potential upstream factor not assessed in these experiments is the ecdysone regulatory hierarchy.  The steroid ecdysone is the endocrine hormone that controls molting and metamorphosis in arthropods.  It is an allosteric effector for a heterodimeric receptor of the steroid-receptor superfamily.  The ovaries of adult females manufacture their own ecdysone, and the gene for the rate-limiting steroidogenic enzyme transcribed beginning in Stage 7-8 egg chambers.  This stage immediately precedes the onset of the highest level of ovo transcription (Mevel-Ninio et al., 1991; Garfinkel et al., 1994).  Mutations in the E74 and E75 genes, when made homozygous in germline clones, cause arrest of oogenesis at Stage 7-8, as if egg chambers are unable to respond to endogenous ecdysone and continue differentiation.  Both E74 and E75 code for transcription factors that are induced as immediate-early primary responses to added ecdysone both in-vivo and in tissue culture assays.  Thus, it is reasonable to suggest that one or both of these proteins will bind to the ovo germline promoter in an in vivo effect on expression of the ovo::lacZ reporter using the methods established in this dissertation.  

Acknowledgement:  This work had been comppleted in the laboratory of Dr. Mark Garfinkel at Illinois Institute of Technology.   Dr. Demet Sag initiated the project with her own  ideas, was fully supported by Turkish National Merit Fellowship, and  earned NATO Advanced Science institute  Grant on Genome Structure and Functional Genomics, Elba Island, Italy, accepted to work with Dr. Mevel Ninio, based on the proposal submitted by Demet Sag on Molecular Mechanism of  ovo, through EMBO long term scholarship in France.

BIBLIOGRAPHY
  1. Ashburner, M., Drosophila Laboratory Manual, Cold Spring Harbor Laboratory Press, pp. 317-318, 1989
  2. Baker, B.S., “Sex in flies: the splice of life,” Nature 340, pp.521-524, 1989.
  3.  Baker, B.S. and Belote, J.M., “Sex determination an dosage compensation in Drosophila melanogaster” Ann. Rev of Genetics 17, pp345-393, 1983.
  4. Baker B.S. and Ridge, K.A., “Sex and the single cell I. On the action of major loci affecting sex determination in Drosophila melanogaster,” Genetics 94, pp.383-423, 1980.
  5.  Bell, L.R. Horabin, J.I., Schedl, P., and Cline, T.W., “Sex-lethal, a Drosophila sex determination switch gene, exhibits sex specific RNA spilicing and sequence similarity to RNA binding proteins,” Cell 55, pp.1037-1046, 1988.
  6. Bell, L.R. Horabin, J.I., Schedl, P., and Cline, T.W., Positive autoregulation of Sex-lethal by alternative spilicing maintains the female determined state in Drosophila, Cell Vol 65, pp.229-239, 1991.
  7.  Belote, J.M., Handler, A.M., Wolfner, M.F., Livak, K.J., and Baker, B.S., Sex-specific regulation of yolk protein expression in Drosophila, Cell 40, pp.339-348, 1985.
  8.  Bohringer- Manheim Product Support, Chloroform Red-beta-D_Galactopyranoside sodium salt (CPRG) provided by ID#0223p, June 1986 dated information, fax received on 2/26/1996.
  9.  Bopp, D., Bell, L.R., Cline, T.W., Schedl, P. Developmental distribution of female specific Sex-Lethal proteins in Drosophila melanogaster, Genes and Development 5, pp.403-415,, 1991.
  10.  Bopp, D., Sex-specific control of Sex-lethal is a conserved mechanism for sex determination in the genus Drosophila, Development 122, pp.971-982, 1996.
  11.  Bopp, D., Horabin, J.I., Lersch, R.A., Cline, T.W., Schedl, P., Expression of the Sex-lethal gene is controlled at multiple levels during Drosophila oogenesis, Development 118, pp.797-812, 1993.
  12.  Bradford, M. M., A Rapid and sensitive method for the Qantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding, Analytical Biochemistry 72, pp.248-254, 1976.
  13.  Bridges, C.B., Sex in relation to chromosomes, Am. Nat.59, pp.127-137, 1925.
  14.  Bridges, C.B., Triploid intersexes in Drosophila melanogaster, Science 54, pp.252-254, 1921.
  15.  Bridges, C.B., Non-disjunction as proof of the chromosome theory of heredity, Genetics 1, pp.1-52, 1916.
  16.  Burtis, K.C. and Baker, B.S., Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoded related sex-specific yolk protein gene enhancer, The EMBO J., Vol. 10, No. 9, pp.2557-2582, 1991.
  17.  Busson, D., Gans, M., Komitopoulou, and Masson, M., Genetic Analysis of three dominant female-sterile mutations located on the X-chromosome of Drosophila melanogaster, Genetics 105, pp.309-325, 1983.
  18.  Campbell, S.D., Duttoroy, A., Katzen, A.L., and Chovnick, A., Cloning and characterization of the scalloped region of Drosophila melanogaster, Genetics 127, pp.367-380, 1991.
  19.  Cline, T.W., The Drosophila sex determination signals: how do flies count two?, Ann. Rev. Genet 30, pp637-702, 1996.
  20.  Cline, T.W., Evidence that sisterless-a and sisterless-b are two of several discrete numerator elements of the X/A ratio sex-determination signal in Drosophila that switch Sxl between two alternative stable expression states, Genetics 119, pp.829-862, 1988.
  21.  Cline, T.W., Re-evaluation of the functional relationship in Drosophila between a small region on the X-chromosome (3E8-4F11) and the sex determination gene, Sex-lethal, Genetics 116, s:12, 1987.
  22.  Cline, T.W., A female specific lethal lesion in an X-linked positive regulator of the Drosophila sex determination gene, Sex-lethal, Genetics 113, pp.641-663, 1986.
  23.  Cline, T.W., Autoregulatory functioning of a Drosophila gene product that establishes and maintains the sexuality determined state, Genetics 107, pp.231-277, 1984.
  24.  Cline, T.W., Functioning of the gene daughterless and Sex-lethal in Drosophila germ cells, Genetics 107, s16-17, 1983.
  25.  Cline, T.W., A sex specific temperature-sensitive maternal effect of the daughterless mutation of Drosophila melanogaster, Genetics 84, pp.723-742, 1976.
  26.  Cronmiller, C., Schedl, P., Cline, T.W., Molecular characterization of daughterless, a Drosophila sex determination gene with multiple roles in development, Genes Dev. 2: 155-167, 1988.
  27.  Despande, G., Samuels., M.E., and Schedl, P.D. “Sex-lethal interacts with splicing in vitro and in vivo, Molecular and Cellular Biology, Vol. 16, No 8, pp. 5036-5047, 1996.
  28.  Despande, Stukey, J., and Schedl, P., scute (sis-b) function in Drosophila sex determination, Moll. Cell Biology 15, pp. 4430-4440, 1995.
  29.  DiMario, P.J., and Mahowald, A.P., Female sterile (1) yolkless: A recessive female sterile mutation in Drosophila melanogaster with depressed numbers of coated pits and coated vesicles within the developing oocytes, J. Cell Biology 105: 199-206, 1987.
  30.  Erickson, J.W. and Cline, T.W., A bZIP protein, sisterless-a, collaborates with bHLH transcription factors early in Drosophila development to determine sex, Genes and Dev. 7: 1688-1702, 1993.
  31.  Erickson, J.W. and Cline, T.W., Molecular nature of the Drosophila sex determination signal and its link to neuorogenesis, Science 251, pp. 1071-1074, 1991.
  32.  Estes, P.A., Keyes, L.N., and Schedl, P., Multiple response elements in the sex-lethal early promoter ensure its female-specific expression pattern, Mol Cell Biol 15, pp. 904-917, 1995.
  33.  Flickinger, T.W. and Salz, H.K., The Drosophila sex determination gene snf encodes a nuclear protein with sequence and functional similarity to the mammalian U1A snRNP, Gene and Development 8, pp. 914-925, 1994.
  34.  Flybase, The Drosophila genetic database, http://www.flybase.bio.indiana.edu, 1998.
  35.  Gans, M.C., Audit and Massson, M., Isolation and characterization of sex-linked female-sterile mutations in Drosophila melanogaster, Genetics 81, pp. 683-704, 1975.
  36.  Garfinkel, M.D., Lee, S., and Sigar, I., DNA-binding targets of the Drosophila melanogaster OVO protein, 38th Annual Drosophila Research Conference, Chicago, IL, 1997.
  37.  Garfinkel, M.D., Wang, J., Liang, Y., and Mahowald, A. P., Multiple products from the shavenbaby-ovo gene region of Drosophila melanogaster: relationship to genetic complexity, Molecular and Cell Biology, Vol. 14, No., 10, pp. 6809-6818, 1994.
  38.  Garfinkel, M.D., Lohe, A.H., and Mahowald, A.P., Molecular genetics of the Drosophila melanogaster ovo locus, a gene required for sex determination of germline cells, Genetics 130, pp. 791-803, 1992.
  39.  Gollin, S. M. and King, R. C., Studies on fs(1)1621, a mutation producing ovarian tumors in Drosophila melanogaster, Developmental Genetics 2, pp. 203-218, 1981.
  40.  Granadino, B., Compuzano, S., and Sanchez, L., The Drosophila melanogaster fl(2)d, a gene needed for Sex-lethal expression in Drosophila melanogaster, Genetics 130, pp. 597-612, 1990.
  41.  Granadino, B., Santamaria, P., and Sanchez, L., Sex-determination in the germ line of Drosophila melanogaster: activation of the gene Sex-lethal, Development 118, pp. 813-816, 1993.
  42.  Granadino, B., Juan, A. B. S. B, Santamaria, P., Sanchez, L., Distinct mechanisms of splicing regulation in vivo by the Drosoophila protein Sex-lethal, PNAS USA, 94, pp. 7343-7348, 1997.
  43.  Hager, J.H. and Cline, T.W., Induction of female Sex-lethal RNA splicing in male germ cells: implications for Drosophila germline sex-determination, Development 124, pp. 5033-5048, 1997.
  44.  Hilfiker, A., Amrein, H., H., Dobendorfer, A., Schneiter, R, and Nuthiger, R., The gene virilizer is required for female-specific splicing controlled by Sxl, master gene for development in Drosophila, Development 121, pp. 4017-4026, 1995.
  45.  Horabin, J.I., Bopp, D., Waterburry, J., and Schedl, P., Selection and maintenance of sexual identity in the Drosophila melanogaster, Genetics 141, pp. 1521-1565, 1995.
  46.  Horabin, J. I. And Schedl, P., Regulated spilicing of the Drosophila Sex-lethal male exon involves a blockage mechanism, Moll. Cell. Biol. 13, pp. 1408-1414, 1993.
  47.  Horabin, J.L., and Schedl, P., Sex-lethal autoregulation requires multiple cis-acting elements upstream and downstream of the male exon and appears to depend largely on controlling the use of the male exon 5’ splice site, Moll. Cell. Biol. 13: pp. 7734-7746, 1993.
  48.  Hoshijima, K., Kohyama, A., Watakabe, I., Inonue, K., Sakamato, H., and Shimura, Y., Transcriptiuonal regulation of the Sex-lethal gene by helix-loop-helix proteins, Nucleic Acids Res. 23, pp. 3441-3448, 1995.
  49.  Inonue, K., Hojhijima, K., Sakamato,, H., and Shimura, Y., Binding of the Drosophila Sex-lethal gene product to the alternative splice site of transformer primary transcript, Nature 344, pp. 461-463, 1990.
  50.  Keyes, L.N., Cline, T.W., and Schedl, P., The primary sex-determination signal of Drosophila acts at the level of transcription, Cell, Vol. 68, pp. 933-943, 1992.
  51.  Komitopoulou, K., Gans, M., Margaritis, L.H., Kafatos, F.C., and Masson, M., Isolation and characterization of sex-linked female-sterile mutants in Drosophila melanogaster with special attention to eggshell mutants, Genetics 105: 897-921, 1983.
  52.  Lee, S., DNA binding targets of the Drosophila melanogaster OVO protein, PhD Dissertation, Illinois Institute of Technology, Chicago, IL, USA, 1998.
  53.  Lee, S. and Garfinkel, M.D., DNA-binding targets of the Drosophila melanogaster OVO protein, Nucleic Acid. Res.
  54.  Linsley, D.L., and Zimm, G., The genome of the Drosophila melanogaster, Academic Press, San Diego, New York, 1980.
  55.  Lu, J., Andrews, J., Pauli, D., and Oliver, B., Drosophila OVO zinc finger protein regulates ovo and ovarian tumor target promoters, Dev. Genes. Evol., pp. 1-10, 1998.
  56.  Luccesi, J.C. and Manning, E., Gene dosage compaensation in Drosophila melanogaster, Adv. Genetics 24, pp. 371-429, 1987.
  57.  Madl, J.E., and Herman, R.K., Polyploids and sex determination in Caenornabtidis elegans, Genetics 93, pp. 393-402, 1979.
  58.  Mevel-Ninio, M., Mariol, M.C. and Gans, M., Mobilization of the gypsy and copia retrotransposans in Drosophila melanogaster induces reversion of the ovoD dominant female-sterile-mutations: molecular analysis of revertant alleles, EMBO J. 8, pp. 1549-1558, 1989.
  59.  Mevel-Ninio, M., Terracol, R., and Kafatos, F.C., The ovo gene of Drosophila encodes a zinc finger protein required for female germ line development, EMBO J. 10, pp.2259-2266, 1991.
  60.  Mevel-Ninio, M., Guenal, I., and Limburg-Bouchen, B., Production of dominant female sterility in Drosophila melanogaster by insertion of the ovoD1 allele autosomes: use of transformed starins to generate germline mosaic, Mechanism of development 45, pp. 155-162, 1994.
  61.  Mevel-Ninio, M., Terracol, R., Salles, C., Vincent, A., and Payre, F., ovo, a Drosophila gene required for ovarian development, is specially expressed in the germline and shares most of its coding sequences with shavenbaby, a gene involved in embryo patterning, Mecahnism of Development 49, pp. 83-95, 1995.
  62.  Mevel-Ninio, M., Fouilloux, E., Genal, I.  and Vincent, A., The three point dominant female-staerile mutations of Drosophila ovo gene are point mutations that create new translation-initiatorAUG codons, Development 122, pp. 4131-4138, 1996.
  63.  Mohler, J.D., Developmental genetics of the Drosophila egg. I.: Identification of 50 sex-linked cistrons with maternal effects on embryonic development, genetics 85, pp. 259-272, 1977.
  64.  Nagai, K., Oubridge, C., Jessen, T. H., Li, J., and Evans, P.R., Crystal structure of the RNA-binding domain of the U1 small nuclear ribonucleoprotein A, Nature 348, pp. 515-520, 1990.
  65.  Nagoshi, R.N., McKeown, M., Burtis, K.C., Belote, J.M., and Baker, B., The control of alternative spilicing at genes regulating differentiation in D. melanogaster, Cell, Vol. 53, pp.229-236, 1988.
  66.  Nagoshi, R.N., and Baker, B., Regulation of sex-specific RNA splicing at the Drosophila doublesex gene: cis-acting mutations in exon sequences alter sex specific RNA splicing patterns, Genes and Development 4, pp. 89-97, 1990.
  67.  Nagoshi, R.N., Patton, J.S., Bae, E., and Geyer, P., The somatic sex determines the requirement for ovarian tumor gene activity in the proliferation of the Drosophila germline, development 121, pp.579-587, 1995.
  68.  Nothiger, R., and Steinmann-Zwicky, M., Meier-Gerschwiller, P., and Weber, T., Sex determination in the germline of Drosophila depends on genetic signals and inductive somatic factors, development 107, pp.505-518, 1989.
  69.  Oliver, B., Singer, J., Laget, V., Pennetta, G. and Pauli, D., Function of Drosophila melanogaster ovo– in germ line sex determination depend on X-Chromosome number, Development 120, pp.1-11, 1994.
  70.  Oliver, B., Kim, Y. and Baker, B., Sex-lethal, master and slave: a hierarchy of germ line sex determination in Drosophila, Development 119, pp. 897-908, 1993.
  71.  Oliver, B., Pauli, D., and Mahowald, A.P., Genetic evidence that the ovo locus is involved in Drosophila germ line sex determination, Genetics 125, pp. 535-550, 1990.
  72.  Oliver, B., Perrimon, N, an Mahowald, A.P., The ovo locus is required for sex-specific germ line maintenance in Drosophila, Genes and Development 1, pp. 913-923, 1987.
  73.   Oubridge, C., Ito, N., Evans, P.R., Teo, C.H., and Nagai, K., Crystal structure at the 1.92A resolution of the RNA binding domain of the U1A splicesomal protein completed with an RNA hairpin, Nature 372, pp.432-438, 1994.
  74.  Pauli, D., Oliver, B., and Mahowald, A.P., Identifications of regions interacting with ovo D mutations: potential new genes involved in germline sex determination in Drosophila melanogaster, Genetics 139, pp.713-732, 1995.
  75.  Pauli, D., Oliver, B., and Mahowal, A.P., The role of the ovarian tumor locus in Drosophila melanogaster germ line sex determination, Development 119, pp.123-134, 1993.
  76.  Pauli, D. and Mahowald, A.P., Germline sex determination in Drosophila melanogaster, Trends in Genetics, Vol. 6, No. 8, pp.259-264, 1990.
  77.  Parkhurst, S.M., Bopp, D., and Ish-Horowicz,  X:A ratio, the primary sex determining signal in Drosophila, is transduced by helix-loop-helix proteins, Cell, Vol. 63, pp.1179-1191, 1990.
  78.  Perrimon, N., Mohler, D., Engsttrom, L., and Mahowald, A.P., X-linked female-sterile loci in Drosophila melanogaster, Genetics 113, pp.695-712, 1986.
  79.  Perrimon, N., Engstrom, L., and Mahowald, A.P., The effects of zygotic lethal mutations on female-germ-line functions in Drosophila, Developmental Biology 105, pp. 404-414, 1984.
  80.  Perrimon, N., Clonal analysis of dominant female-sterile, germline-dependent mutations in Drosophila melanogaster, Genetics 108, pp.927-939, 1984.
  81.  Perrimon, N. and Gans, M., Clonalo analysis of the tissue specificity of recessive female-sterile mutations of Drosophila melanogaster using a dominant female sterile mutation Fs(1)K1237, Developmental Biology 100, pp. 365-373, 1983.
  82.  Rodesch, C., Geyer, P.K., Patton, J.S., Bae, E., and Nagoshi, R.N., Developmental analysis of the ovarian tumor gene during Drosophila oogenesis, Genetics 141, pp.191-202, 1995.
  83.  Sag-Ozkol, D., Tekin, S., Garfinkel, M.D., Gene-dose sensitive trans-acting regulators of the Drosophila melanogaster germline promoter, 38th Annual Drosophila Research Conference, Chicago, IL, USA, 1997.
  84.  Sag-Ozkol, D., and Garfinkel, M.D., Negative autoregulation of Drosophila melanogaster female germline specific gene, ovo (in preparation).
  85.  Sag-Ozkol, D., and Garfinkel, M.D., X-chromosome screening of Drosophila melanogaster to find numerator elements of germline sex determination (in preparation).
  86.  Salz, H.K. and Flickinger, T.W., Both loss of function and gain-of-function mutations in snf define a role for snRNP proteins in regulating Sex-lethal pre-mRNA splicing in Drosophila development, Genetics 144, pp.95-108, 1996.
  87.  Salz, H.K., Maine, E.M., Keyes, L.N., Samuels, M.E., Cline, T.W., and Schedl, P., The Drosophila female-specific sex-determination gene, Sex-lethal has stage-, tissue-, and sex-specific RNAs suggesting multiple models of regulation, Genes and Development 3, pp.708-709, 1989.
  88.  Salz, H.K., Cline, T.W., and Schedl, P., Functional changes associated with structural alterations induced by mobilization of a p element inserted in the Sex-lethal gene of Drosophila, Genetics 117, pp.221-231, 1987.
  89.  Sanchez, L., Granadino, B., and Torres, M., Sex determination in Drosophila melanogaster, X-linked genes involved in the initial step of Sex-lethal activation, Developmental Genetics 15: 251-264, 1994.
  90.  Sass, G., Mohler, J.D., Walsh, R.C., Kalfayan, L.J. and Searles, L.L., Structure an the expression of hybrid dysgenesis-induced alleles of the ovarian-tumor (otu) gene in Drosophila melanogaster, Genetics 133, pp.253-263, 1993.
  91.  Sass, G., Comer, A.R. and Searles, L.L., The ovarian tumor protein isoforms of Drosophila melanogaster exhibit differences in function, expression, and localization, developmental Biology 167, pp.201-212, 1995.
  92.  Schedl, A, Ross, A., Lee, M., Engelkamp, D., Rashbass, van Heyningen, V., and Hastie, N., Influence of PAX6 gene dosage on development: over-expression causes sever eye abnormalities, Cell 86, pp.71-82, 1992.
  93.  Schupbach, T., and Wieschhaus, E., Female sterile mutations on the second chromosome of Drosophila melanogaster II mutations blocking oogenesis an altering egg morphology, Genetics 129, pp.1119-1136, 1991.
  94.  Shupbach, T., an Wieschaus, E., Female sterile mutations on the second chromosome of Drosophila melanogaster I. Maternal effect mutations, Genetics 121, pp.101-17, 1989.
  95.  Schupbach, T., Normal female germ cell differentiation requires the female X-chromosome to autosome ratio and expression of Sex-lethal in Drosophila melanogaster, Genetics 109, pp.529-548, 1985.
  96.  Simon, J.A. and Lis, J.T., A germline transformation analysis reveals flexibility in the organization of the heat-shock consensus elements, Nucleic Acids Research, Vol 15, No.7, 1987.
  97.  Staab, H., Heller, A., Steinmann-Zwicky, M., Somatic sex determining signals act on XX germ cells in Drosophila embryos, Development 122, pp.4065-4071, 1996.
  98.  Staab, H., and Steinmann-Zwicky, M., Female germ cells of Drosophila require zygotic ovo and out product for survival in larvae and pupae, Mech. Dev. 54, pp.205-210, 1995.
  99.  Stanewsky, R., Rendahl, K.G., Dill, M., and Saumweber, H., Genetic and molecular analysis of the X-chromosomal region 14B17-14C4 in Drosophila melanogaster: Loss of function in NONA, a nuclear protein common to many cell types, results in specific physiological and behavioral defects, Genetics 135, pp.419-442, 1993.
  100.   Steinman-Zwicky, M., Sex determination of the Drosophila germ line: tra and dsx control somatic inductive signals, Development 120, pp. 707-716, 1994.
  101.  Steinman-Zwicky, M., Sxl in the germline of Drosophila: A target for somatic late induction, Developmental Genetics 15, pp.265-274, 1994.
  102.  Steinman-Zwicky, M., Sex determination in Drosophila: sis-b, a major numerator element of the X:A ratio in the soma, does not contribute to the X:A ratio in germ line, Development 117, pp. 763-767, 1993.
  103.  Steinman-Zwicky, M., How do the germ cells choose their sex? Drosophila as a paradigm, Bioassays 14 (8), pp.513-518, 1992.
  104.  Steinman-Zwicky, M.,  Anrein, H. and Nothiger, R., Genetic control of sex determination in Drosophila, Advanced Genetics 27, pp.189-237, 1990.
  105.  Steinman-Zwicky, M.,  Schmid, H. and Nothiger, R., Cell-autonomous an inductive signals can determine the sex of the germ line of Drosophila by regulating the gene Sxl, Cell, Vol. 57, pp.157-166, 1989.
  106.  Steinman-Zwicky, M., Sex determination in Drosophila. The X-chromosomal gene liz is required for Sxl activity, The EMBO Journal 7, pp.3889-3898, 1988.
  107.  Steinman-Zwicky, M. and Nothiger, R., The small region on the X chromosome of Drosophila regulates a key gene that controls sex determination and dosage compensation, Cell, Vol. 42, pp.877-887, 1985.
  108.   Sosnowski, B. A., Belote, J. M. and McKeown, M., Sex specific alternative spilicing of RNA gene results from sequence-dependent splice site blockage, Cell, Vol. 3, pp.449-459, 1989.
  109.   Yarfitz, S., Provost, N. M., and Hurley, J. B., Cloning of Drosophila melanogaster guanine nucleotide regulatory protein subunit gene and characterization of its expression during development, PNAS USA 85, pp.7134-7138, 1988.
  110. Wieschaus, E., Audit, C., and Masson, M., A clonal analysis of the rules of somatic cells and germline during oogenesis in Drosophila, Developmental Biology 88, pp.92-103, 1981.
  111.  Wieschaus, E., Nusslein-Volhard, C., an Jurgen, G., Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Part III. Zygotic loci on the X-chromosome and fourth chromosome, Roux. Arch. Dev. Biol., 193, pp.296-307, 1984.

FIGURES and TABLES:

Figure 1: Sex determination of D. melanogaster (1998)

Figure 2: Somatic-Germline Interactions. (1998)

Figure 3: Molecular Structure of the ovo locus

Figure 4: In vivo Biochemical_genetic Assay for Regulators

Figure 5: ovo-LacZ Reporter Construction. (1998)

Figure 6 : Establishing Stocks From Duplication Carrying Lines.

Figure 7: Control Assay for b-galactosidase Assay. (1998).

Table 1: List of Stocks for X-chromosome Screening (1998)

Table 2: Stocks Made in This Study for X-Chromosome Screening

Table 3: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo3U21

Table 4: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo4B8 (Results)

Table 5: Deficiency Lines Affecting the ovo Gene Activity (X-chromosome screening result)

 

Previously Posted:  

ovo Female Germline Specific Drosophila melanogaster Gene has two auto-regulation mechanism: negative and positive

Blavatar

 

 

Read Full Post »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and Pathology2  Duke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »

Understanding of OVO-like proteins (OVOL), which are members of the zinc finger protein family, serve as transcription factors to regulate gene expression in various differentiation processes and are involved in epithelial development and differentiation in a wide variety of organisms. Thus, comparative genomic analysis among three different OVOL genes (OVOL1-3) in vertebrates may shed a light onto this crucial gene for development of molecular diagnostics and targeted therapies.

The Figure is from:

Genomics. Author manuscript; available in PMC 2010 June 29.

Published in final edited form as: Genomics. 2002 September; 80(3): 319–325.

Analysis of mouse and human OVOL2 gene products. (A) The 5′ end sequences of the mouse Ovol2B cDNA and the deduced OVOL2B protein. The “#” symbol indicates the position of an internal methionine previously mistaken as the initiation codon [14]. (B) Deduced amino acid sequences of OVOL2A proteins in mouse (mOvol2A) and human (hOvol2A). The “*” symbol indicates amino acid identity. The four C2H2 zinc fingers are underlined. The predicted NLS sequences are boxed. Sequences common to mouse OVOL2A and OVOL2B start at the brackets in (A) and (B). Human OVOL2B starts at the internal methionine (bold). Shown in bold and italics are positions where our predicted sequence differs from the previously reported sequence [14]. (C) Phylogenetic analysis of OVO proteins. cOvo, C. elegans OVO (GenBank acc. no. AF134806); dOvo, Drosophila OVO (GenBank acc. no. X59772); mOvol1, mouse OVOL1 (GenBank acc. no. AF134804); hOvol1, human OVOL1 (GenBank acc. no. AF016045); mOvol2, mouse OVOL2 (GenBank acc. no.AY090537); hOvol2, human OVOL2 (GenBank acc. no. AK022284); mOvol3, mouse OVOL3 (GenBank acc. no. BF714064); hOvol3, human OVOL3 (GenBank acc. no. AD001527).

The Ovo gene family encodes evolutionarily conserved proteins contain four DNA-binding C2H2 zinc fingers at the C termini and possess transcriptional regulatory activities in diverse array of organisms from Caenorhabditis elegans, Drosophila, Zebrafish, chick, and mammals.  Drosophila ovo, the founding member of the family, acts genetically downstream of Wg (fly Wnt homolog) and DER (fly epidermal growth factor receptor homolog) signaling pathways and is required for epidermal denticle formation and oogenesis.

OVOL proteins are characterized by the presence of hypervariable ID regions.

A. Mouse OVOL1 has ID residues in the first 100 amino acids. B. Mouse OVOL2 possesses ID residues in the first 50 amino acids with a glycine-rich and serine rich region as marked in red color. C. Mouse OVOL3 has ID segments within the N-terminal 100 residues. D. Drosophila OVO is intrinsically disordered with large patches of residue biasness as indicated by the red color. We used DISOPRED2 software [47] for the prediction of ID regions. The horizontal line indicates the ordered/disordered threshold for the default false positive rate of 5%. The ‘filter’ curve represents the outputs from DISOPRED2 and the ‘output’ curve represents the outputs from a linear support vector machine (SVM) classifier (DISOPREDsvm). The outputs from DISOPREDsvm are included to indicate shorter as low confidence predictions of disorder.

doi:10.1371/journal.pone.0039399.g001, http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0039399)

This gene family is identified as mammalian Ovol (Ovo-like) genes, including Ovol1(movo1), Ovol2 (movo2), and Ovol3 (movo3) in mice and OVOL1, OVOL2, andOVOL3 in humans. Ovol1 is the most studied compared to Ovol2 and Ovol3.

Kumar A, Bhandari A, Sinha R, Sardar P, et al. (2012) Molecular Phylogeny of OVOL Genes Illustrates a Conserved C2H2 Zinc Finger Domain Coupled by Hypervariable Unstructured Regions. PLoS ONE 7(6): e39399. doi:10.1371/journal.pone.0039399

http://www.plosone.org/article/info:doi/10.1371/journal.pone.0039399

Phylogenetic history of OVOL proteins using the Bayesian method. A. Full-length OVOL proteins. B. Selected region of OVOL proteins.

Posterior probabilities scores are depicted by various color balls. The placozoan OVOL protein (e_gw1.4.509.1) was used as the outgroup in this phylogenetic tree. Red x indicates sequence position, which did not accord with species phylogeny. BFL: B. floridae (lancelet), SPU: S. purpuratus (sea urchin), NVE: N. vectensis (sea anemone), HRO: H. robusta (annelids), LGI: L. gigantean (molluscs) and TAD: T. adhaerens(placozoan). Trees in figures 7A and 7B are generated using the MrBayes 3.2 [53] from alignments supplied in supplementary Files S1 and S2, respectively. (Figure 7 of doi:10.1371/journal.pone.0039399.g007, http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0039399)

“Fine scale analysis of gene expression in Drosophila melanogaster gonads reveals Programmed cell death 4 promotes the differentiation of female germline stem cells” Amy C Cash and Justen Andrews* BMC Developmental Biology 2012, 12:4 doi:10.1186/1471-213X-12-4 

”Regulatory and functional interactions between ovarian tumor and ovo during Drosophila oogenesis. “ Shannon Hinson, Janette Pettus, Rod N Nagoshi Mechanisms of Development Volume 88, Issue 1, 1 October 1999, Pages 3–14  http://www.sciencedirect.com/science/article/pii/S0925477399001677

“Molecular phylogeny of OVOL genes illustrates a conserved C2H2 zinc finger domain coupled by hypervariable unstructured regions.” Kumar A, Bhandari A, Sinha R, Sardar P, Sushma M, Goyal P, Goswami C, Grapputo A. PLoS One. 2012;7(6):e39399. doi: 10.1371/journal.pone.0039399. Epub 2012 Jun 21.

“Gapped BLAST and PSI-BLAST: a new generation of protein database search programs.” Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ.

Nucleic Acids Res. 1997 Sep 1; 25(17):3389-402.

Ovol1:

 

 

Chromosomal localization of OVOL1 gene from selected vertebrates, flanked by a set of conserved marker genes.   SIPA1: signal-induced proliferation-associated 1; RELA: v-rel reticuloendotheliosis viral oncogene homolog A (avian); KAT5: K (lysine) acetyltransferase; SNX32: sorting nexin 32; MUS81: MUS81 endonuclease homolog (S. cerevisiae); BANF1: barrier to autointegration factor 1; EXOC6B: exocyst complex component 6B; DYSF: dysferlin, limb girdle muscular dystrophy 2B; COL4A5: collagen, type IV, alpha 5; DAK: dihydroxyacetone kinase 2 S. cerevisiae homolog.   doi:10.1371/journal.pone.0039399.g003, http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0039399)

 

Drosophila ovo/svb (dovo) is required for epidermal cuticle/denticle differentiation and is genetically downstream of the wg signaling pathway, so does a mouse homolog of dovo, movo1.  Also, Li group showed that movo1 promoter is activated by the lymphoid enhancer factor 1 (LEF1)/β-catenin complex, a transducer of wnt signaling. Simply these data showed movo1 is a developmental target of wnt signaling during hair morphogenesis in mice, and there is a conserved regulatory pathway at wg/wnt-ovolink in epidermal appendage. human OVOL1 has been identified as a gene that is responsive to TGF-β1/BMP7 treatment via a Smad4-dependent pathway (Kowanetz et al., 2004).

Ovo1 li“Characterization of a human homolog (OVOL1) of the Drosophila ovo gene, which maps to chromosome 11q13.” Chidambaram A, Allikmets R, Chandrasekarappa S, Guru SC, Modi W, Gerrard B, Dean M. Mamm Genome. 1997 Dec;8(12):950-1.nks Wnt signaling with N-cadherin localization during neural crest migrationDevelopment 2010 137 (12) 1981-1990.

“Id2 and Id3 define the potency of cell proliferation and differentiation responses to transforming growth factor beta and bone morphogenetic protein.” Marcin Kowanetz, 

Ulrich Valcourt, Rosita Bergström‡,Carl-Henrik Heldin and Aristidis Moustakas*

. Mol. Cell. Biol., 24 (2004), pp. 4241–4254 http://mcb.asm.org/content/24/10/4241

“The LEF1/β-catenin complex activates movo1, a mouse homolog of Drosophila ovo required for epidermal appendage differentiation” Baoan Li, Douglas R. Mackay, Qian Dai, Tony W. H. Li, Mahalakshmi Nair, Magid Fallahi, Christopher P. Schonbaum, Judith Fantes, Anthony P. Mahowald, Marian L. Waterman,Elaine Fuchs, and Xing DaiPNAS  vol. 99 no. 9  Baoan Li,  6064–6069. http://www.pnas.org/content/99/9/6064.abstract?ijkey=a7d2985635ef09ca63982ae4397ef325aa46252b&keytype2=tf_ipsecsha

 

“Expression of murine novel zinc finger proteins highly homologous to Drosophila ovo gene product in testis.” Masu Y, Ikeda S, Okuda-Ashitaka E, Sato E, Ito S. FEBS Lett. 1998 Jan 16;421(3):224-8.

“The ovo gene required for cuticle formation and oogenesis in flies is involved in hair formation and spermatogenesis in mice” Xing Dai, Christopher Schonbaum, Linda Degenstein, Wenyu Bai,Anthony Mahowald, and Elaine Fuchs. (1998) Genes Dev. 12, 3452–3463 http://www.ncbi.nlm.nih.gov/pubmed/9808631

 

OvoL2 at the Junction of Decisions:

 

Brain development is fascinating and complex since cranial neurulation is an integral component of brain morphogenesis  and there are factors present outside of the neuroepithelium can also affect the morphogenesis of the cranial neural tube.  Previous studies revealed Ovol2 expression in brain, testis, and epithelial tissues such as skin and intestine of adult mice (Li et al., 2002a).

 

 

OVOL2 orthologs identified in vertebrates by comparing chromosomal localization.

RRBP1: ribosome binding protein 1 homolog; BANF2: barrier to autointegration factor 2; SNX5: sorting nexin 5; CSRP2BP: CSRP2 binding protein; SEC23B: protein transport protein Sec23B; POLR3F: polymerase (RNA) III (DNA directed) polypeptide F; RBBP9: Retinoblastoma-binding  protein 9; DTD1: D-tyrosyl-tRNA deacylase 1. doi:10.1371/journal.pone.0039399.g004, http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0039399)

 

Neural/non-neural cell fate decisions is carried by bone morphogenetic protein (BMP) signaling, which inhibits precocious neural differentiation and allows for proper differentiation of mesoderm, endoderm, and epidermis, during early embryonic development. There are many unknown in this mechanism yet the expression of Ovol2, which encodes an evolutionarily conserved zinc finger transcription factor, is down-regulated during neural differentiation of mouse embryonic stem cells since null Ovol2 in embryonic stem cells facilitates neural conversion and inhibits mesendodermal differentiation, whereas Ovol2 overexpression gives rise to the opposite phenotype. Furthermore, the studies also prove BMP4 and ovo2 interacted to rescue these changes. If BMP4 is provided,  Ovol2 knockdown partially rescues the neural inhibition.  Mechanism studies show the regulation pattern between these BMP and Ovol2.  BMP4 directly regulates Ovol2 expression through the binding of Smad1/5/8 to the second intron of the Ovol2 gene. Thus, Ovol2 acts downstream of BMP pathway.  In addition, in vivo chick studies presented that when Ovol2 is ectopically expressed the prospective neural plate represses the expression of the definitive neural plate marker cSox2In the chick embryo.  Also, lack of Ovol2 prevented increase BMP4 expression.  During early germ layer development there is an important comment between neuroectoderm and mesendoderm provided by Ovol2.

In addition, Ovol2 acts in downstream of key developmental signaling pathways including Wg/Wnt and BMP/TGF-β.  Based on findings from chromatin immunoprecipitation, luciferase reporter, and functional rescue assays, Wells group demonstrated that Ovol2 directly represses two critical downstream targets, c-Mycand Notch1.  Hence, this action suppresses keratinocyte transient proliferation and terminal differentiation.  Like a twilight zone to choose when to proliferate and when to resist differentiation.

“Ovol

“Ovol2, a Mammalian Homolog of Drosophila ovo: Gene Structure, Chromosomal Mapping, and Aberrant Expression in Blind-Sterile Mice.” Baoan Li, Qian Dai, Ling Li, Mahalakshmi Nair, Douglas R. Mackay, Xing DaiGenomics Volume 80, Issue 3, September 2002, Pages 319–325.

Ovol2 directly represses two critical downstream targets, c-Myc and Notch1, thereby suppressing keratinocyte transient proliferation and terminal differentiation, respectively

Wells J, Lee B, Cai AQ, Karapetyan A, Lee WJ, Rugg E, Sinha S, Nie Q, Dai X.

J Biol Chem. 2009 Oct 16;284(42):29125-35. doi: 10.1074/jbc.M109.008847. Epub 2009 Aug 21.

“The zinc finger transcription factor Ovol2 acts downstream of the bone morphogenetic protein pathway to regulate the cell fate decision between neuroectoderm and mesendoderm.” Zhang T, Zhu Q, Xie Z, Chen Y, Qiao Y, Li L, Jing N. J Biol Chem. 2013 Mar 1;288(9):6166-77. doi: 10.1074/jbc.M112.418376. Epub 2013 Jan 14.

“The mouse Ovol2 gene is required for cranial neural tube development”  Douglas R. Mackaya,  Ming Hua,   Baoan Lia,  Catherine Rhéaumea,  Xing Dai.l Developmental Biology Volume 291, Issue 1, 1 March 2006, Pages 38–52. 

Ovol3

While tracing the OVOL genes, we identified a third OVOL gene, OVOL3, in a wide array of mammals including humans (chromosome 19), chimpanzees (chromosome 19), mice (chromosome 7), rats (chromosome 1), cows (chromosome 18), pigs (chromosome 6), and opossums (chromosome 4) with a conserved synteny. The conserved synteny comprises an octet of genes, LIN37-PRODH2-KIRREL2-APLP11-NKF3ID-LPFN3​-SDHAF1-CLIF3,on one side and POLR2L-CAPSN1-COX7A1 on the other side of OVOL3 in a region of about 400 kb (Figure 5 of http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0039399).

Synteny analysis of OVOL3 genes illustrates the loss of OVOL3a after duplication event and maintenance of paralogous OVOL3b in fishes.

LIN37: lin-37 homolog (C. elegans); PRODH2: proline dehydrogenase (oxidase) 2; KIRREL2: kin of IRRE like 2 (Drosophila); APLP1: amyloid beta (A4) precursor-like protein 1; NFKBID: nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, delta; LRFN3: leucine rich repeat and fibronectin type III domain containing 3; SDHAF1: succinate dehydrogenase complex assembly factor 1; CLIP3: CAP-GLY domain containing linker protein 3; POLR2I: polymerase (RNA) II (DNA directed) polypeptide I, 14.5 kDa; CAPNS1: calpain, small subunit 1; COX7A1: cytochrome c oxidase subunit VIIa polypeptide 1 (muscle); DMPK: dystrophia myotonica-protein kinase; HLCS: holocarboxylase synthetase; AMOT: angiomotin; REXO2: REX2 RNA exonuclease 2 homolog (S. cerevisiae). (Reference from doi:10.1371/journal.pone.0039399.g005 , http://www.plosone.org/article/info%3Adoi%2F10.1371%2Fjournal.pone.0039399)

There are not many studies on Ovol 3but my interest in this region lies on Chromosome 19 since “it has the highest gene density of all human chromosomes and the large clustered gene families, corresponding high G + C content, CpG islands and density of repetitive DNA indicate a chromosome rich in biological and evolutionary significance.”

“The DNA sequence and biology of human chromosome 19.” Grimwood J, et al.  Nature. 2004 Apr 1;428(6982):529-35.

Read Full Post »

Brief background:

Germline stem cells (GSCs) are essential for fertility and fecundity so the molecular characterization of factors involved in initiation, maintenance and differentiation is an important goal not only for in Drosophila but also in stem cell research.  In addition to genetic studies genomics studies carry a weight to explain the function of these factors, genes and structures. For example ovo, female germline specific gene, is an complex transcription gene producing three proteins from a one transcript in Drosophila yet in human ovo is expressed from three different chromosomes to produce three proteins with various roles.  There can be a relevance as a biomarker for fertility and ovarian cancer in human. Genomics increase our knowledge of these pathways in cancer development. Thus, in first section I will present the classical genetic work.  Then,  in the second section, I  will include modern genomics studies like http://www.biomedcentral.com/1471-213X/12/4  in both model organisms and human to correlate ovo and its importance in female cancers.

1.1  Germline Stem Cells and Sex determination

In chromosomally based sex determination, the two sexes differ in karyotype, and the task embryos face is to “count chromosomes” and to set and maintain sex-dimorphic regulatory mechanisms to the appropriate state.  Often associated with sex determination is the problem of adjusting transcription rates of the sex chromosomes so that individuals with dissimilar chromosome and gene doses become equalized for gene product dose, a process called “dosage compensation”.  One example of chromosomal based sex determination is Drosophila melanogaster, the common laboratory fruit fly.  The X:A ratio determines the sex in Drosophila (Bridges, 1916, 1921, 1925) in a somatic-cell-autonomous manner that occurs early in embryonic development (Baker and Belote, 1983; Baker, 1989).  Females possess two X-chromosomes, and males possess one X-chromosome and one Y-chromosome.   As it turns out the only obligatory function of the Y-chromosome in Drosophila is to provide genes required for the completion of spermatogenesis; the Y-chromosome has no primary role in sex determination (Lindsley and Tokuyasu 1980; Bridges 1986).

The number of X-chromosomes is counted through a mechanism involving positive-acting X-chromosome-encoded transcription factors, termed X-numerator elements (Cline, 1988), negative-acting autosome-encoded transcription factors or denominators, and signal transduction factors provided maternally.  Among the X-numerators are sisterless-a, sisterless-b (sis-b), sisterless-c, and runt (Schurpbach, 1985; Cline, 1986, 1988; Steinmann-Zwicky et al., 1989; Parkhurst et al., 1990; Ericson and Cline, 1991, 1993; Estes, 1995; Hoshijima et al., 1995; reviewed by Cline, 1993).   The best candidate for a denominator gene is the deadpan (dpn) locus.  Both daughterless (da) and extramacrochaete (emc) fulfill the role of maternally contributed transduction loci (Cline, 1976; Cronmiller et al., 1988).  Both in vitro biochemical evidence and in vivo genetic evidence support the idea that transcription factors of the basic-helix-loop-helix (bHLH) family are able to form homo- and hetero-dimers; thus the X:A ratio counting mechanism seems to involve the relative affinities and chromosome-dependent stoiciometries of the bHLH proteins SIS-B, DA, EMC, and DPN.  When X:A=1, sufficient SIS-B protein is synthesized so that it can effectively compete with the EMC and DPN proteins for binding to DA protein.  DA:SIS:B heterodimers then bind to so-called establishment promoter (Pe) elements of the SXL gene and activates its transcription, resulting in an early burst of SXL protein that sets splicing and dosage compensation in to female-specific modes.  When X:A=0.5, too little SIS-B is produced, and DA protein remains sequestered with EMC and DPN.  The Sxl Pe remains inactive, and splicing and dosage compensation enters male-specific modes.

Germline Pathway for Sex Determination and Dosage Compensation

The vast majority of somatic sex determination loci have no function in germline cells.  For example, none of the X-chromosome numerators is required for proper oogenesis (Granadino et al., 1989, 1992; Steinmann-Zwicky 1991), despite the fact that proper oogenesis requires that X:A =1 in the germline (Schupbach, 1982, 1985).  Nor are tra, tra-2, and dsxF required for oogenesis.  Sxl and snf have germline functions but the former is not a binary switch gene between oogenesis and spermatogenesis (Despande et al., 1996; Bopp et al., 1993, 1995; Hager et al., 1997).

Systematic screens for female-sterile mutations have identified a large number of genes required for normal oogenesis (e.g. Gans et al., 1975; Mohler, 1977; Perrimon et al., 1986; Schupbach and Wieschaus, 19889, 1991).  Female-sterility can arise in diverse ways, but one interesting class of mutations is germline-dependent and causes an “ovarian tumor” phenotype.  “Ovarian tumor” mutations cause under-developed ovaries, in which egg chambers and ovarioles are filled with an excess of undifferentiated germ cells that have adopted male-like characteristics that include a prominent spherical nucleus, assembly of mitocondria around the nucleus, and mis-expression of male-specific marker genes (Oliver et al., 1988, 1990, 1993; Steinmann-Zwicky, 1988, 1992; Bopp et al., 1993; Pauli et al., Wei et al., 1994).  Among the “ovarian tumor” class of genes are ovo, ovarian tumor (otu), fused, and two genes with somatic phenotypes, namely snf and Sxl.

Strong mutations at the ovo and otu loci result in ovaries totally devoid of germ cells (King and Killey, 1982; Busson et al., 1983; Oliver et al., 1987; Mevel-Ninio et al., 1989; Rodesh et al., 1995), Weaker mutations at both loci result in viable germline cells that have abnormal male-like splicing at the Sxl gene (Oliver et al, 1993).

The overall conclusion is that oogenesis requires a chromosomally female germline is wild type for ovo, otu, Sxl, and snf.  If one of these genes is defective, either the germline will die or male-like differentiation and tumor formation ensure.

 

The ovo locus

A wide variety of evidence points to this gene playing a critical role in germline sex determination.

Mutations:  ovo mutations are female-sterile, with no discernible effect in male germline or in somatic tissues.  The latter conclusion is based on clonally analysis, which showed that the ovo mutant phenotype is germline-dependent (Perrimon and Gans 1983; Perrimon, 1984).  Homozygous null ovo mutations are female-sterile because germline cell death begins during gastrulation (Oliver et al., 1987; but see Rodesh et al., 1995 and Staab and Steinman-Zwicky et al., 1995), resulting in females whose ovaries lack germ cells altogether.  A second type of ovo mutation results in viable germ cells that adopt a morphology resembling male germ cells (Oliver et al., 1990).  A third type of ovo mutation results in defective oogenesis, but has no apparent germline sex transformation (Busson et al., 1983; Oliver et al, 1987).

 

Expression:  High-level of ovo transcription in germline cells, as detected with Xgal staining of ovo promoter-lacZ constructs requires that they have a female karyotype (Oliver et al., 1994).  Chromosomally male germline cells have low levels of ovo transcription even if the soma is transformed towards female through the use of hs-traF cDNA minigenes.  Likewise, chromosomally female germline cells have high levels of ovo transcription even if the soma is anatomically male through the action of tra loss-of-function mutations.  This argues that high-level of ovo transcription is a germline X: A ratio-autonomous property, and stands in contrast to related experiments with otu.  In the case of otu, there is evidence that chromosomally male germline cells, which normally have no need of otu+ function at all, require otu- for proliferation when they are in a female host (Nagoshi et al., 1995).

Genetic complexity of ovo: At least three transcripts are produced from the ovo region (Mevel-Ninio et al, 1991, 1995, 1996; Garfinkel et al., 1992, 1994).  Two of these are germline-specific and correspond to the ovo function, while the third corresponds to the somatic-epidermal, non-sex-specific shavenbaby (svb) function.  For a schematic of the gene map please refer to Figure 1.3. Molecular Structure of the ovo locus

The svb function is transcribed from an incompletely characterized somatic promoter that forms a 7.1 kb poly(A)+ mRNA (Garfinkel et al., 1994).  This transcript accumulates 9-12-hr post-fertilization, in the somatic tissues that later in embryogenesis form the cuticular structures affected by svb mutations.  Wieschaus et al. (1984) observed that ventral denticle belts and dorsal hairs are defective in svb mutations; hence the name, and svb mutations are polyphasic larval lethals.

The ovo function is transcribed from two closely spaced germline-specific promoters, and gives rise to 5-kb mRNAs (Mevel-Ninio et al., 1991, 1995; Garfinkel et al., 1992, 1994).  The promoter identified by Garfinkel et al., (1994) codes for an mRNA with a 1028-codon-long open reading frame that contains four Cys2-His2 fingers at the carboxy terminus; the predicted protein has a molecular weight of 110.6 kD.  This promoter now called ovob, and the leader exon it forms is called Exon 1b.  The open reading frame is called OvoB.  OvoB mRNA appears in germline cells during embryogenesis and is present the throughout the life cycle.  It is relatively love abundance in germaria and early egg chambers, but accumulates dramatically beginning in Stage 8 of oogenesis.  Substantial quantities are deposited into the egg as a maternal RNA.  A second germline promoter, ovoa, was identified by Mevel-Ninio et al (1995).  This Exon 1a contains an in-frame AUG upstream of the translation start in Exon 2 utilized by the OvoB open reading frame.  As a result, the OvoA open reading frame is 1400 codons long, and predicts a 150.8-kD protein.  Both proteins are collinear, with the OvoA protein possessing an N-terminal extension relative to OvoB.  The OvoB mRNA isoforms is predominant during adult life, with the OvoA isoforms only appearing during Stage 14 of oogenesis (Mevel-Ninio et al., 1991, 1996; Garfinkel., 1994).

Exons and exon segments that are found in all mRNA forms coded by the region correspond to genomic DNA where so-called svb-ovo- mutations map (Mevel-Ninio et al., 1989; Garfinkel 1992).  Finally, somatic-specific exons, exon segments, and transcriptional regions correspond to region mutable to the svb- ovo- phenotype.  Since al known mRNA forms utilize the same splice junctions to join Exon3 to Exon4, all protein forms coded by the locus are believed to contain the same four zinc fingers at the carboxy terminus.

That the svb-ovo protein isoforms code for putative transcription factors is supported by the primary sequence of the predicted products, and by in vitro biochemical data showing the zinc finger domain binds to DNA with sequence specificity.  The ovo zinc finger domain binds to its own germline promoter regions, to the otu promoter region (Garfinkel et al., 1997; Lee, 1998; Lee and Garfinkel 1998).  This is consistent with ovo playing an important role in a sex determination hierarchy operating in germline cells that involves these other genes.

The Goals of This Study

The D. melanogaster ovo gene is required for cell viability and differentiation of female germ cells, apparently playing a role in germline sex determination.  While female X: A ratio in germline cells is required for high levels of ovo germline promoters.  Therefore we undertook to identify trans-acting regulatory regions of the X-chromosome, with a particular interest in identifying candidate germline X-chromosome numerator elements.  In that study, it had been found that certain regions affecting negative auto-regulation of ovo. Then it had been asked how having disturb expression of ovo by deletions within the gene, upstream or downstream of the gene, and increase of number of gene as well as origin of the copy could affect the germline sex determination mechanism.

Interestingly, deficiencies that removed ovo were scored as trans-acting repressors.  This implied that one of the functions of ovo+ is to down-regulate its own expression, which we called negative autoregulation.  Several point mutations in ovo had the same effect; P [ovo+] transgenes were predicted to have the opposite effect, but this was not observed.  Other gene regions containing candidate downstream targets of ovo, such as Sxl, had no effect on the ovo promoter, as expected.

 

 

Materials and Methods

 

2.1 Fly Strains and Growth

Flies were maintained on standard yeast/cornmeal medium and kept at 25oC and 18oC unless otherwise indicated.  Mutants are described in Lindsley and Zimm (1992).  The ovo3U21 and ovo4B8 were obtained from Brian Oliver of NIH; the snf–e8H:snfe8H, snf1621 FM7c, Sxl7B0/FM7c from Helen K. Salz of Case Western Reserve University; ALK coded deficiency stocks from Alisa Katzen of the University of Illinois at Chicago; w1118 Sco/Cyo, w1118 TM3, Sb/TM6 Ubx from Chris Schonbaum of the University of Chicago; y w ovoD1rS1/ y+ Y FM6; TM3, Sb/TM6, Ubx from Rod Nagoshi of University of Iowa.  OvoD1rS1 FM3 is from the Garfinkel lab collection.  The remaining stocks were obtained from the Bloomington Stock Center (see Table 2.1 for the list of stocks that had been used and Figure 2.1 for their location on the X Chromosome).

2.2 Outcrosses

 

Outcrosses were designed to create transgenic flies so that screening of the X chromosome for trans-regulators of ovo in the germline can be done (Fig 2.2).  Virgin female flies were collected 14 hour long windows at 18oC or 8 hour long windows at 25oC, during which newly emerged males remained immature.  Collected females were kept 3-5 days to make sure they are virgin before outcrossing them.  Heterozygous virgin females (5-7), carrying deficiency X-chromosomes balanced over first chromosome balancers were mated with males homozygous for either of two P-element transformation constructs of a lacZ reporter gene fused to the ovo promoter.  Both events were inserted on third chromosome.  They were grown at 25oC unless otherwise noted.

The control class of F1 progeny has a complete X-chromosome pair, whereas the experimental class has one complete and one deficient X chromosome in its genome.  The [ovo::lacZ constructs] were designed by Oliver et al., (1994).  In this study two of their strains, ovo4B8 (pCOW+1.9) and ovo3U21 (pCOW-2.1) respectively, were used to determine the ovo promoter activity.

2.2.2. Outcrosses to Remove Duplications.  Several X-chromosome deficiencies in the Bloomington collection are carried in males, with compensatory duplications of X material on an autosome.  These had to be crossed to eliminate the duplications (Fig 2.4).  This was done as follows:  FM3/FM7a virgin flies were mated to Df/Y; Dp males.  Among the F1 progeny, half of the Df/(FM3 or FM7a) daughters will carry the unwanted duplication, and half will be free of the duplication.  In some cases, presence of the duplication could be determined from the females’ phenotypes.  In other cases, up to twenty individuals virgin Df(FM3 or FM7) F1 progeny were backcrossed to FM7a/Y males to establish stocks.  In the F2, absence of the duplication could be established by examining sons; in all cases, the Df is male-lethal unless “rescued” by the duplication.  Also FM3 is itself male lethal.  Thus, single-female stocks that produce only FM7a sons had the desired genotypes and were kept for experiments.

2.2.3. Outcrosses for Negative Autoregulation.  In these experiments to prove the negative autoregulation of ovo three types of mutation groups were examined (Table 2.3).  The first group was ovo locus point mutations that were tested to determined whether or not any region of the locus was involving in negative autoregulation.  Four strains of mutant ovo, ovoD1rS1/FM3, y w ovoD1rS1 v24/FM6/y+ Y, which are spontaneous mutations, ovoD1rG2/FM7c, ovoD1rG3/FM7c, which are gamma irradiations from spontaneous mutations, and one svb mutant (svb- ovo +) svb YP17B/FM7c, null of svb, were used.  (Table 2.3).  In the second group deficiency lines due to deletions Df (1) JC70 and Df(1)RC-40, which are null for ovo and snf, and DF(1)A113, which takes out several genes including ovo, were used.  The third group strains were chosen to test downstream genes, such as Sxl and snf, via point null point mutations of these genes.  Thus, snfe8H/FM7a, snf1621/FM7c, and w cm Sxl 7B0) / FM7cwere examined.  All of the tree groups were outcrossed as it is described in basic experimental design for regular stocks outcrosses (Figure 2.2).  Except for snfe8H which is kept as a homozygous (snfe8H / snf e8H) in the stock one extra outcross is carried to produce snfe8H / FM7a stock for my study purposes.  Thus to create balancer carrying stock virgin females of homozygous snfe8H had mated with FM7a males, as a result snfe8H / FM7a stock established.

2.2.4. Outcrosses for ovo Gene Dosage Analysis.    The X:A ratio primary sex determination signal is required in both soma and germline sex determinations.  In germline sex determination ovo receives the X:A signal and responses to the number of X chromosome in the genome for proper female germline sex determination and differentiation.  Moreover, ovo plays a role in transcription by producing zinc finger protein.  Then, the question is how increasing copy number of ovo either in X chromosome or in the autosome would interfere with the ovo’s function and negative regulation character.

Therefore sets of outcrosses were prepared to test these effects by use of Tf(1)OW-10kb-17B (Tf(1) in short) and Tf(A)OW-10kb-13B (Tf(A) in short) stocks (Garfinkel et al., 1992).  Both contain P element mediated transformed of 10kb ovo- with white minigenes as a cell marker, but the difference is the location of the insertion.

 

ovo Dose Effects in X-Chromosome.  Since there is the negative regulation of ovo in the genome of ovo (Sag-Ozkol et al., 1997), what is the effect of having extra dose of ovo in the genome has decided to be examined Oliver et al., 1994.  Also, considering the fact that ovo is counting the number of X chromosomes, presumably, gene functioning as numerator elements, and itself, increasing the number of ovo more than two copies in the genome would yield similar negative autoregulation effect, too.

Therefore, appropriate outcrosses were designed to ascertain the regulation of ovo.  First, two copies versus three copies of ovo carrying lines were established (Fig 2.5) in two generation outcrosses.  In G0, generation zero, homozygous Tf(1)OW10.0-17B virgin females were mated to FM7a males to get heterozygous females bearing Tf(1)OW10.0-17B Oliver et al, 1994 balanced with FM7a in the F1.  These F1 females then outcrosses to males homozygous for ovo::LacZ reporter constructs, ovo3U21 and ovo4B8.  Control group, carrying two copies of ovo, (FM7a w; ovolacZ /+) gene expression activity was compared to of experimental group, carrying three copies of ovo, (Tf(1) / w; ovo:lacZ /+).

The Tf(1)OW10.0-17B second set of outcrosses is designed to examine the loss of ovo with complete ovo insertion (Fig 2.6).  Therefore, first Tf(1)/w; P[ovo::LacZ];+ (from first test, above) and FM7a/w; P[ovo::LacZ] (F1 of G0) stocks were created.  Then outcross between these stocks were made to generate Tf(1)/FM7a; P[ovo::LacZ]/P[ovo::LacZ] (f1 of G1) line.  Finally, selected F1 to G1 virgin females were mated with ovoD1rS1 males to establish one copy versus two copies of ovo in the F1 of G2.  Then these flies were tested for their gene activity.  In this case, control group has one copy number of ovo, and experimental group has two copies of ovo (figure 2.6).  In third type of outcrosses genes, snf and Sxl, place downstream of ovo in the germline sex determination hierarchy were evaluated (Fig 2.6).  The same methods of basic regular outcross design (Fig 2.3) were applied.

ovo Dose Effect in Autosome.  The effect of increased ovo+ copy number was also analyzed using an autosomal source ovo+ gene insertion.  P element transformed line, Tf(A)OW10.0-17B (Garfinkel et al., 1992).  At the start of this work the insertion was localized.  Therefore, two rounds of outcrosses were designed to identify the chromosome carrying insertion whether in second or fourth chromosome (Fig2.7).  Standard second chromosome and third chromosome balancer stocks were used; X-chromosome location had been ruled out by early segregation data (e.g. Garfinkel, 1991, unpublished).  In these crosses, an assigned location to chromosome four can be inferred.  Chromosomes were chosen appropriate to insertion place for selection of control and experimental class (Fig 2.7).  After collecting yellow eyed balancer marker, like curly, showing phenotypic class (y w-; Bal.  Tf(1);lacZ-) of female flies, they had mated to males homozygous for ovo::LacZ insertion.  These flies were analyzed for their effect of gene activity.

X-Gal Staining

 

In this assay ovaries from two-day-old adults were dissected in Drosophila Ringer’s solution (182 mM KCl, 46 mM NaCl, 3 mM CaCl2, 10mM TrisHCl, pH 6.8).  Then, these tissues were transferred to a microtiter plate and fixed in 1% gluteraldehyde, 50mM Na-cacodylyte acid solution for 15 minutes. After rinsing the tissues, three times for 5 minutes each staining buffer (7.2 mM Na2HPO4, 2.8 mM NaH2PO4, 1.0 mM MgCl2, 0.15 mM NaCl), they were transferred to incubation buffer (staining buffer, 5 mM Fe2 (CN)3, 5 mM Fe3 (CN)2, 0.2% X-Gal) for an hour at 37oC.  Next, tissues were washed three times 5 minutes each in washing buffer, which is a 1 mM EDTA, added PBS (130 mM NaCl, 7 mM Na2HPO4*2H2O, 3 mM NaH2PO4*2H2O, pH 7.0) solution.  Finally, the tissues were dehydrated in ethanol solutions of increasing concentrations (50%, 75%, 95%) and mounted on a slide in Permount.  Preparate concentrations were examined under a compound microscope to make correlations between staining and gene activity.

Although it was easy to determine positive and negative controls, but this assay wasn’t sensitive enough to see subtle differences due to effects of deleted regions on ovo promoters driving LacZ. 

 

Histochemical Assay of LacZ Activity

This method allowed us to make quantitative measurements of lacZ activity due to ovo promoter function in animals heterozygous for X-chromosome deletions.  Emerging F1 flies were collected and aged for two days before dissecting ovaries under a dissecting microscope.  For each soluble assay, 10 flies were dissected.  This is repeated at least seven assays (N, sample number) completed per stock for each construct.  Ovaries from ten dissected outcrossed flies were out into eppendorf tubes containing 100ml of Assay Buffer (50 mM K-phosphate, 1 mM MgCl2 at pH 7.8) and homogenized about 20 strokes.  For each dissected pair of ovaries 100 ml  of assay buffer was used and the volume was completed to appropriate amount.  After centrifuging for one minute, 20 ml of the supernatant was transferred into 980 ml of assay buffer (Simon and Lis, 1987; Ashburner, 1989) to make 2mM chlorophenol red-beta-D-galactopyranoside (CPRG).  Absorbance at 574 nm was measured at half hour time intervals starting from zero to two hours hydrolysis of CPRG by chlorophenol (red CPRG).  CPR has a molar extinction coefficient of 75,000 M-1 cm-1 (Boehringer-Manheim data sheet) and this is a very easily detected product of b-galactoside enzyme activity. Range finding experiments showed that 2mM of CPRG gives linear data for 2-3 hours often, color changes could be seen with the unaided eye.

Two controls are shown in Figure 2.8 that validates CPRG for this work.  Ovaries from a non-transformed strain (y w RD) were used to prepare soluble extracts.  A near zero-absorbance at 574 nm was observed that did not appreciably change over several hours.  In contrast, ovarian extracts from the ovo promoter-lacZ transformant strain ovo3U21 and ovo4B8 (Oliver et al, 1994) showed a steep linear increase in A 574 during the same period.  The slopes of these lines were proportional to the amount of ovo3U21 and ovo4B8 extract added.

Bradford (1976) Assay For Protein

 

This protein determination method is based on the binding of Coomasie Brilliant Blue G-250 to the protein.  Preparation of protein reagent was done according to Bradford (1976).  After 100 mg of Coomasie Brilliant Blue G-250 was dissolved in 50 ml 95% ethanol, and then 100 ml 85% (w/v) phosphoric acid was added.  The resulting solution was diluted to a final volume of 1 liter [final concentrations in the reagent were 0.01% (w/v) Coomasie Brilliant Blue G-250, 4.7% (w/v) ethanol, and 8.5% (w/v) phosphoric acid].  20ml of prepared soluble extract from the dissected tissues were used.  This volume is diluted to 0.1ml with ddH2O, then 5ml of protein reagent was added to the test tube and contents were mixed.  The absorbance at 595nm was measured after 2 min and before 1 hr in 3 ml cuvettes against a reagent blank prepared from 0.1 ml of the appropriate buffer and 5 ml of protein reagent.  A standard curve using known quantities of bovine serum albumin (BSA) was constructed.  Soluble extract absorbances were plotted on the standard curve and protein amount interpolated. 

Statistical Analysis

Average specific activity is calculated as nanomoles of substrate used per hour per nanogram protein expressed (nmole CPRG liberated /ng / hr).  Sample number (N) always exceeded seven.  Mean specific activity and standard error of the mean (SEM) were calculated for each experimental and control class.  The F test was used to determine whether variances were equal, and therefore,, which type of student’s t-test calculation was appropriate.  A significant difference between experimental and control values was identified by a P < 0.05 for the t-test score.

RESULTS

In this study and previous study (X-chromosome Screening), about 70% of the euchromatic X-chromosome was screened, using 56 different deficiency strains, to identify transregulation of ovo. 

 

The results are given in three sections: X chromosome deficiency screening, negative autoregulation of ovo exhibited by deficiencies removing ovo, and gene dose analysis using P element transformants carrying extra copies of ovo.

Consequently, among the X-chromosome screening data, it was found that two of the deficiency lines. Df(1)A113 and Df(1)JC70, which are removing ovo and snf along with the several genes due to deletions, and correspond to one loci acting as an repressor, were taking into more detailed investigations.  These results suggested a negative autoregulation mechanism in the ovo promoter.  Therefore, negative autoregulation of ovo was examined with three approaches: 1. ovo point mutations,  more defined deficiency strain, and 2. downstream genes, 3. gene dose and origin.

Negative Autoregulation

Table: Stocks for Negative Autoregulation of ovo (1998),

1. ovo point mutations

Deficiency screen identified the ovo region itself as a having negative effects on ovo promoter activity.  Ovo showed significant depressant effect, negative autoregulation, according to preliminary data results (Sag-Ozkol, et al. 1997), along with, in our lab it was shown that ovo protein binds ovo promoter in vitro (Garfinkel and Lee, 1997).  Furthermore, other data are also mimic the ovo autoregulation includes females containing two copies of the ovoD1 transgene, or those containing one recessive allele at the ovo locus, were as sterile as ovo D1 females, which (Mevel-Ninio et al., 1994).  In addition, it is suggested that two transcripts of ovo, a, and b, are regulating itself for their expression at different times of the development (Mevel-Ninio et., 1996).  These data imply that transcription factor function of ovo is also tittering its gene activity in the germline sex determination of D. melanogaster.  Therefore, ovo locus was tested for the negative regulation as well as the presence of genes where trans-acting repressor effect which are found to be downstream of ovo to ascertain that ovo is overting itself and genes reside downstream of ovo to ascertain that ovo is overting itself and genes reside downstream of ovo.

 

Deficiencies in the ovo locus.  In addition to the previously described experiments with Df(1)JC70, and Df(1)A113 a third deficiency, Df(1)RC40, was also used [Tables 3.3. and 3.4].  The new deficiency is smaller, as it has breakpoints at ovo and snf, thus, it was used to better localize the negative autoregulation Df(1)RC40 effect.  Ovo deficient lines due to deletions that remove ovo along with the other sets of genes have been examined.  According to the gene of interest in this study, Df(1)JC70, and Df(1)RC40 (4D-F) remove both ovo and snf, but Df(1)A113 only removes ovo, but these deletions also take out several other genes in that deleted region.  All three of deficiency lines in the heterozygous Df / + (experimental) are significantly different from the controls (+/Balancer), that is, negative autoregulation of ovo was supported.Table: Stocks for Negative Autoregulation of ovo (1998)

 

ovo region point mutations.  In these preliminary experiments ovo D1rS1 had been used.  This strain has an 5.8 kb insertion at +4.2 kb of ovo region and produces svb+ ovo- putative null mutant strain, (LOF) mutation, that homozygous mutants cannot produce germ cells and gives sterile females.  ovoD1rS1/FM3 strain is outcrossed and tissues from F1 progeny were examined with b-gal assay (Fig. 3.1).  This graph shows the results of ovo mutant dose on ovo::LacZ reporter activity.  In both reporter constructs enzyme activity of controls showed about two-times higher than that of experimentals.  Differences between LacZ activities of the constructs may depend on either position effect of the P[ovo::LacZ] insertion onto chromosome or better translation product due to 200 bp longer N-terminal of ovo3U21 construct.Table: Stocks for Negative Autoregulation of ovo (1998)

 

2. Point Mutations for genes Downstream of ovo.  Candidate downstream genes were tested via point mutations,snfeH8, snf1621, and w cm Sxl 7B0.

It was important to test snf point mutations since Df(1)JC70 and Df(1)RC40 takes out ovo and svb as well as several additional genes including snf.  Two, gain of function snf point mutations were used: snf1621, is an arginine-histidine missense mutation at codon 49 in RNA reading motif (R49H in RRM1), and snfe8H, is an threonine-proline missense mutation at codon 97 in RNA reading frame motif (T97P) (Salz and Flicker, 1996).  As is seen in Tables 3.3 and 3.4, these two mutations have surprisingly different effects, one of which gave evidence of being a trans-acting repressor, contrast to predictions.  snfe8H shows 20% and 30% decrease in gene activity, with ovo3U21 and ovo4B8, respectively.  However, snf1621 had no significant effect on ovo::LacZ activity with either construct.  These results do not correlate simply with Salz and Flicker, 1994.  Flicker and Salz 1996 that snf e8H is a weaker allele than snf1621 (example: snfe8H can be kept as a homozygous stock, but snf1621 must be kept heterozygous over a balancer chromosome. Table: Stocks for Negative Autoregulation of ovo (1998)

Sxl7B0  ,which is a molecular-null for all of Sxl (Salz et al., 1987) had no transregulation effect on ovo expression when assayed with either construct strains.  This is consisted with other genetic data (Oliver et al., 1993) that showed ovo to be upstream of Sxl in a germline regulatory hierarchy.

 

3. Gene dose and origin: Effects of Increasing ovo+ Gene Dose

 

Negative autoregulation of ovo as seen with deficiency and point mutations that reduce ovo+ function, predicts that extra doses of ovo+ (introduced by P[w+ ovo+] ) would have an overall repressing effect on ovo repressor activity.  Crosses and soluble extract assays to determine this were performed, and described below.Table: Stocks for Negative Autoregulation of ovo (1998),

 

 insertion of ovo+ Gene onto X-Chromosome with Tf(1)OW-10.0-17B.  Additional ovo into the genome is decreasing the viability of organism as it is seen in this study, therefore keeping the stock for these strains were not easy at 25oC.  Also, as it is seen in summary tables (Table 4 and Table 5) of gene dose assay increasing the number of ovo is causing high ovo protein production in the experimental strains, hence a relatively large amount of enzyme is processed per time.  At the same token, decreasing number of ovo in the genome has caused an increase in the gene activity in the experimentals.

In this study, it was found that wild type ovo expression is counting the number of ovo in the germline and if the number is low or higher than two repressing its gene expression.  In Table 3.5 and 3.5, transformed ovo insertion showed negative autoregulation in all the outcrosses.  First positive internal control outcrosses were made and they showed about the same level of enzyme activity in both transformed insertion lines, Tf(1), 0.043± 0.006, and Tf(A), 0.038± 0.003.

Two types of outcrosses were designed to identify relation between number of ovo copies and ovo promoter expression.  In first set, two copies of ovo was compared to thee copies of ovo and found that there is about 24% and 20% (E/C) increase in the significant enzyme activity.  In the second set, genotypically recessive ovo mutation carrying males were crossed to heterozygous female genotype transformed ovo insertion with balancer.  Collected transgenic female progeny was tested for the ovo gene dose effect.  One dose of ovo in ovoD1rS1 /FM3, controls, causes about two fold low enzyme activity than that of two doses of ovo in the experimental genotype Tf(1)/ovoD1rS1.  Furthermore comparison of E/C ratios between 1 vs.2, and 3 vs. 2 doses of ovo showed bout 2.2 fold, (270%/124% of E/C) in ovo3U21, and 1.5, fold, (176% /120% E/C) in ovo4B8, increase in repressing activity of ovo.  In the ovo4B8 construct controls of the one dose versus two dose heterozygous females have high standard error of mean that may effect the level of repression.  The lower dose becomes the higher the negative autoregulation activity results.

 

 Parental Origin Effect of Tf(1) OW-13B.

 

  In addition, whether it is from maternal or paternal origin of ovo insertion has many affect on gene activity of ovo was tested (Table 3.5 and Table 3.6),

 

since ovo gene expression is female germline sex specific in germline sex determination of Drosophila melanogaster. Although in both outcrosses there is repressing effect, the paternal origin of ovo insertion of ovo cause 1.2 fold higher repression gene activity. 

 

Insertion of ovo Gene onto Autosomal Chromosome with Tf(A)OW10.0-13B.  In this study, the effect of ovo insertion onto autosome was also measured to ascertain the information gathered from X-chromosome insertion of ovo.  The results of these experiments showed that elevation of ovo copies in the genome is also tittering itself and causing high ovo protein is produced in the experimental lines.  Therefore, it is also concluded from the insertion data that ovo expression is independent from the location of insertion but dependent on number of ovo in the genome.  Autosomal insertion also showed similar repressing effect, 54%, and 26%, as insertion of ovo in X-chromosome in heterozygous deficiency female progenies.

There is an ambiguity in compared mean of activities.  According to the negative autoregulation mechanism, there suppose to be a linear decrease pattern correlated to increase in copy of ovo.  However, the pattern of the gene dose was reaching plato, when three copies of ovo were present in the genome.  This discontinuity in the linear correlation may be due to position effect of P[w+ ovo+]. 

DISCUSSION

The goal of this study was to find transcriptional trans-regulation of the ovo germline promoters and to identify candidate germline X-chromosome numerator elements.  We surveyed approximately 70% of the X-chromosome using 45 deficiency strains, assessed the negative autoregulation of ovo with ten deficiency or recessive-mutant strains; and performed a complementary gene dose analysis of ovo+ with two P element insertion strains.  In all cases our assay for ovo germline promoter activity relied on measuring ovo::lacZ reported expression in dissected ovaries.

ovo Negative Autoregulation

Table 3.3. Negative Autoregulation of ovo Results Obtained w/ovo3U21

Table: Negative Autoregulation of ovo Results Obtained (result) with/ovo4B8

Table: Gene Dose Assay with ovo3U21 Construct (1998) (result)

Table: Gene Dose Assay with ovo4B8 Construct (1998). (result)

 

One of the key findings of the X-chromosome screen was the observation that deficiencies that removed the chromosomal interval harboring ovo+ results in a marked increase in the b-galactosidase specific activity of experimental females carrying the ovo: lacZ reporter constructs.  This suggested the possibility that one of the functions of the ovo+ gene is to down-regulate its own expression.  The ovo genetic function is derived from two germline-specific promoters that generate 5-kb mRNAs translatable into a nested pair of proteins, the 1028-aa-long OvoB isoforms and the 1400-aa-long OvoA isoforms (Garfinkel et al., 1994; Mevel-Ninio et al., 1995, 1996).  Both the OvoA and OvoB proteins contain four zinc finger motifs at the carboxy terminus (Garfinkel et al., 1994; Mevel-Ninio et al., 1991, 1995, 1996).  Their amino-terminal domains contain homopolymeric runs of alanine, histidine, aspargine, typical of many transcription factors.  Acidic patches of the sort that the play a role in protein-protein interactions and transcriptional activation are present; OvoB has three acidic regions (Garfinkel et al., 1994) and OvoA has four (Mevel-Ninio et al., 1995).  Bacterially expressed Ovo zinc finger domain is capable of binding a variety of germline-specific promoters in vitro, including the ovo germline promoter region (Garfinkel et al., 1997; Lee, 1998; Lee and Garfinkel, 1998; Lu et al., 1998).  In vivo experiments suggest that the OvoA protein isoform may down-regulate the promoter that generates OvoB protein during the late stages of oogenesis (Mevel-Ninio et al., 1996), and that mutations causing heterochronic production of OvoA-like proteins may result in a heterochronic reduction in OvoB protein synthesis (Mevel-Ninio et al., 1996).  Furthermore, increasing ovo+ gene dose seems to activate ovo::lacZ reporter genes in testes (Oliver et al., 194; Lu et al., 1998).  Thus, both in vitro biochemical data and in vivo genetic data support the idea that ovo regulates its own expression.

To corroborate our findings obtained with deficiencies, we repeated the outcrosses using ovo::lacZ reporter constructs and strains carrying each of several point mutations affecting the svb-ovo gene region.  Every mutation we tested-two gamma-ray-induced svb-ovo- mutations, one spontaneously arisen svb+ovo- mutation in two different chromosomal backgrounds, and one EMS-induced svb-ovo+ mutation-recapitulated the effects seen with Df(1)A113, DF(1)RC-40, and Df(1)JC70.  The results with the gamma-ray-induced svb-ovo- mutations and the svb+ovo- mutation were expected, since all three represent putative null alleles for the germline-specific ovo function.  Unexpected was the finding that the EMS-induced svb- ovo+ mutation also affected the ovo::LacZ reporter constructs.  This was surprising, because svb mutations have no phenotype in germline clones, and thus they were believed to have no effect on oogenesis.

If deficiencies and point mutations that eliminate ovo function cause a depression of ovo::lacZ reporter activity, one would predict that P element transgenes carrying extra copies of ovo+ would have the opposite effect, namely the reduction of ovo::lacZ reporter activity.  Using of different P element insertions of a single w+ minigenes / ovo+ construct (Garfinkel et al, 1992), we performed crosses that generated progeny flies carrying one copy of the ovo::lacZ reporter in combination with one or two ovo+ copies, and in combination with two or three copies.  We anticipated that the three-dose progeny would have less b-galactosidase activity than the two-dose sibling progeny, and that other two-dose progeny would have less than their one-dose siblings.  This was not the case.  One possibility is that the two independent insertions of the ovo+ transgene are subject to different chromosomal position effects and that neither produces precisely one “unit” of ovo function.  Another possible cause of non-linear gene-dose-response is the summation of both positive and negative autoregulatory effects.

Effects of Downstream Genes on Expression of ovo::lacZ Reporters

Table: Deficiency Lines Affecting the ovo Gene Activity (X-chromosome screening result)

 

The previously proposed germline sex determination hierarchy (Pauli et al., 1993; Oliver et al., 1993) laced Sxl and snf downstream of both ovo and otu.  This was based on weakening of the Sxl autoregulatory loop in female germline cells carrying mutations in ovo or otu, and the restoration of proper Sxl autoregulation by dominant Sxl M#1 mutation.  In contrast to its role in somatic sex determination, Sxl does not act as a binary switch gene for sexual identity in the germline, rather it is thought to control a variety of female-specific germline differentiation and cell proliferation activities (Bopp et al., 1993, 1995; Despande et al., 1996; Hager and Cline a997; Horabin et al., 1995, 1997).  Placement of Sxl downstream of ovo was corroborated by our results that showed no significant effect of cytologically visible deficiencies that remove the Sxl region on the expression of the ovo::lacZ transgenes.  Likewise, a molecular-null for Sxl also had no effect.

The snf gene, despite its original detection as a female-sterile mutation that had dominant-lethal and dominant-sterile synergistic interactions with Sxl (Steinmann-Zwicky and Nothiger, 1985; Steinmann-Zwicky 1988; Oliver et al., 1988, 1990), is not strictly speaking a “sex determination” gene.  While the mutant phenotype of certain missense snf alleles is a breakdown in the efficiency of Sxl autoregulation (e.g., Salz, 1992), both the null phenotype (lethality to both male and female embryos) and the protein contains two tandem copies of the so-called RRM (RNA recognition motif), and is the functional equivalent of mammalian U1A snRNP.  The two characterized snf point mutations are both amino acid substitutions: snf1621replaces arginne-49 with histidine in the amino-terminal RRM, and snfe8H replaces threonine-97 with proline (Flickinger and Salz, 1994).  The snf1621 mutation is predicted from structural studies of the mammalian U1A protein (Nagai et al., 1990; Jessen et al., Howe et al., 1994; Oubridge et al., 1994) to destabilize the RRM and to weaken its binding to U1A snRNA.  The snfe8H mutation, in contrast, maps to a loop structure that is less highly conserved.  Consistent with the predicted structural properties of the mutant alleles, snf1621 is the stronger of the two mutations in the Sxl lethal/synergy assay (Oliver et al., 1988, 1990; Salz, 1992; Salz and Flickinger, 1996).  Paradoxically, the snf1621 mutation had no effect on the ovo::lacZ reporter constructs while the snfe8H mutation did.  One possible explanation is that the two snf mutations differentially affect the protein’s ability to stimulate splicing of generic intervening sequences, the unregulated type such as appears in the ovo pre-mRNA fragment fused to the LacZ reporter gene.

Future Directions and Concluding Remarks

The results of this study suggest that the ovo germline promoters are regulated by a large set of upstream factors.  Nearly a dozen of these maps to the X-chromosome, some to region that are well characterized genetically.  Further deficiency mapping experiments, and assessment of the phenotypes of single-P insertion lines with female-sterile or perhaps lethal phenotypes, would be required to identify the relevant genes.  Some regions contain candidate loci that have been cloned (e.g. lozenge); in this example, either in vitro DNA-binding experiments using Lz protein and the ovo promoter region, or computational assessment of the likelihood that the ovo promoter contains binding sites for Lz can be done.

Another potential upstream factor not assessed in these experiments is the ecdysone regulatory hierarchy.  The steroid ecdysone is the endocrine hormone that controls molting and metamorphosis in arthropods.  It is an allosteric effector for a heterodimeric receptor of the steroid-receptor superfamily.  The ovaries of adult females manufacture their own ecdysone, and the gene for the rate-limiting steroidogenic enzyme transcribed beginning in Stage 7-8 egg chambers.  This stage immediately precedes the onset of the highest level of ovo transcription (Mevel-Ninio et al., 1991; Garfinkel et al., 1994).  Mutations in the E74 and E75 genes, when made homozygous in germline clones, cause arrest of oogenesis at Stage 7-8, as if egg chambers are unable to respond to endogenous ecdysone and continue differentiation.  Both E74 and E75 code for transcription factors that are induced as immediate-early primary responses to added ecdysone both in-vivo and in tissue culture assays.  Thus it is reasonable to suggest that one or both of these proteins will bind to the ovo germline promoter in an in vivo effect on expression of the ovo::lacZ reporter using the methods established in this dissertation.

Acknowledgement:  The experiments were completed in the laboratory of Dr. Mark D. Garfinkel Department of Biological Chemical and Physical Sciences of  Illinois Institute of Technology at Chicago.  Dr. Demet Sag was supported by the Turkish National Merit Fellowship.

BIBLIOGRAPHY
  1. Ashburner, M., Drosophila Laboratory Manual, Cold Spring Harbor Laboratory Press, pp. 317-318, 1989.
  2. Baker, B.S., “Sex in flies: the splice of life,” Nature 340, pp.521-524, 1989.
  3. Baker, B.S. and Belote, J.M., “Sex determination an dosage compensation in Drosophila melanogaster” Ann. Rev of Genetics 17, pp345-393, 1983.
  4. Baker B.S. and Ridge, K.A., “Sex and the single cell I. On the action of major loci affecting sex determination in Drosophila melanogaster,” Genetics 94, pp.383-423, 1980.
  5. Bell, L.R. Horabin, J.I., Schedl, P., and Cline, T.W., “Sex-lethal, a Drosophila sex determination switch gene, exhibits sex specific RNA spilicing and sequence similarity to RNA binding proteins,” Cell 55, pp.1037-1046, 1988.
  6. Bell, L.R. Horabin, J.I., Schedl, P., and Cline, T.W., Positive autoregulation of Sex-lethal by alternative spilicing maintains the female determined state in Drosophila, Cell Vol 65, pp.229-239, 1991.
  7. Belote, J.M., Handler, A.M., Wolfner, M.F., Livak, K.J., and Baker, B.S., Sex-specific regulation of yolk protein expression in Drosophila, Cell 40, pp.339-348, 1985.
  8. Bohringer- Manheim Product Support, Chloroform Red-beta-D_Galactopyranoside sodium salt (CPRG) provided by ID#0223p, June 1986 dated information, fax received on 2/26/1996.
  9. Bopp, D., Bell, L.R., Cline, T.W., Schedl, P. Developmental distribution of female specific Sex-Lethal proteins in Drosophila melanogaster, Genes and Development 5, pp.403-415,, 1991.
  10. Bopp, D., Sex-specific control of Sex-lethal is a conserved mechanism for sex determination in the genus Drosophila, Development 122, pp.971-982, 1996.
  11. Bopp, D., Horabin, J.I., Lersch, R.A., Cline, T.W., Schedl, P., Expression of the Sex-lethal gene is controlled at multiple levels during Drosophila oogenesis, Development 118, pp.797-812, 1993.
  12. Bradford, M. M., A Rapid and sensitive method for the Qantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding, Analytical Biochemistry 72, pp.248-254, 1976.
  13. Bridges, C.B., Sex in relation to chromosomes, Am. Nat.59, pp.127-137, 1925.
  14. Bridges, C.B., Triploid intersexes in Drosophila melanogaster, Science 54, pp.252-254, 1921.
  15. Bridges, C.B., Non-disjunction as proof of the chromosome theory of heredity, Genetics 1, pp.1-52, 1916.
  16. Burtis, K.C. and Baker, B.S., Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoded related sex-specific yolk protein gene enhancer, The EMBO J., Vol. 10, No. 9, pp.2557-2582, 1991.
  17. Busson, D., Gans, M., Komitopoulou, and Masson, M., Genetic Analysis of three dominant female-sterile mutations located on the X-chromosome of Drosophila melanogaster, Genetics 105, pp.309-325, 1983.
  18. Campbell, S.D., Duttoroy, A., Katzen, A.L., and Chovnick, A., Cloning and characterization of the scalloped region of Drosophila melanogaster, Genetics 127, pp.367-380, 1991.
  19. Cline, T.W., The Drosophila sex determination signals: how do flies count two?, Ann. Rev. Genet 30, pp637-702, 1996.
  20. Cline, T.W., Evidence that sisterless-a and sisterless-b are two of several discrete numerator elements of the X/A ratio sex-determination signal in Drosophila that switch Sxl between two alternative stable expression states, Genetics 119, pp.829-862, 1988.
  21. Cline, T.W., Re-evaluation of the functional relationship in Drosophila between a small region on the X-chromosome (3E8-4F11) and the sex determination gene, Sex-lethal, Genetics 116, s:12, 1987.
  22. Cline, T.W., A female specific lethal lesion in an X-linked positive regulator of the Drosophila sex determination gene, Sex-lethal, Genetics 113, pp.641-663, 1986.
  23. Cline, T.W., Autoregulatory functioning of a Drosophila gene product that establishes and maintains the sexuality determined state, Genetics 107, pp.231-277, 1984.
  24. Cline, T.W., Functioning of the gene daughterless and Sex-lethal in Drosophila germ cells, Genetics 107, s16-17, 1983.
  25. Cline, T.W., A sex specific temperature-sensitive maternal effect of the daughterless mutation of Drosophila melanogaster, Genetics 84, pp.723-742, 1976.
  26. Cronmiller, C., Schedl, P., Cline, T.W., Molecular characterization of daughterless, a Drosophila sex determination gene with multiple roles in development, Genes Dev. 2: 155-167, 1988.
  27. Despande, G., Samuels., M.E., and Schedl, P.D. “Sex-lethal interacts with splicing in vitro and in vivo, Molecular and Cellular Biology, Vol. 16, No 8, pp. 5036-5047, 1996.
  28. Despande, Stukey, J., and Schedl, P., scute (sis-b) function in Drosophila sex determination, Moll. Cell Biology 15, pp. 4430-4440, 1995.
  29. DiMario, P.J., and Mahowald, A.P., Female sterile (1) yolkless: A recessive female sterile mutation in Drosophila melanogaster with depressed numbers of coated pits and coated vesicles within the developing oocytes, J. Cell Biology 105: 199-206, 1987.
  30. Erickson, J.W. and Cline, T.W., A bZIP protein, sisterless-a, collaborates with bHLH transcription factors early in Drosophila development to determine sex, Genes and Dev. 7: 1688-1702, 1993.
  31. Erickson, J.W. and Cline, T.W., Molecular nature of the Drosophila sex determination signal and its link to neuorogenesis, Science 251, pp. 1071-1074, 1991.
  32. Estes, P.A., Keyes, L.N., and Schedl, P., Multiple response elements in the sex-lethal early promoter ensure its female-specific expression pattern, Mol Cell Biol 15, pp. 904-917, 1995.
  33. Flickinger, T.W. and Salz, H.K., The Drosophila sex determination gene snf encodes a nuclear protein with sequence and functional similarity to the mammalian U1A snRNP, Gene and Development 8, pp. 914-925, 1994.
  34. Flybase, The Drosophila genetic database, http://www.flybase.bio.indiana.edu, 1998.
  35. Gans, M.C., Audit and Massson, M., Isolation and characterization of sex-linked female-sterile mutations in Drosophila melanogaster, Genetics 81, pp. 683-704, 1975.
  36. Garfinkel, M.D., Lee, S., and Sigar, I., DNA-binding targets of the Drosophila melanogaster OVO protein, 38th Annual Drosophila Research Conference, Chicago, IL, 1997.
  37. Garfinkel, M.D., Wang, J., Liang, Y., and Mahowald, A. P., Multiple products from the shavenbaby-ovo gene region of Drosophila melanogaster: relationship to genetic complexity, Molecular and Cell Biology, Vol. 14, No., 10, pp. 6809-6818, 1994.
  38. Garfinkel, M.D., Lohe, A.H., and Mahowald, A.P., Molecular genetics of the Drosophila melanogaster ovo locus, a gene required for sex determination of germline cells, Genetics 130, pp. 791-803, 1992.
  39. Gollin, S. M. and King, R. C., Studies on fs(1)1621, a mutation producing ovarian tumors in Drosophila melanogaster, Developmental Genetics 2, pp. 203-218, 1981.
  40. Granadino, B., Compuzano, S., and Sanchez, L., The Drosophila melanogaster fl(2)d, a gene needed for Sex-lethal expression in Drosophila melanogaster, Genetics 130, pp. 597-612, 1990.
  41. Granadino, B., Santamaria, P., and Sanchez, L., Sex-determination in the germ line of Drosophila melanogaster: activation of the gene Sex-lethal, Development 118, pp. 813-816, 1993.
  42. Granadino, B., Juan, A. B. S. B, Santamaria, P., Sanchez, L., Distinct mechanisms of splicing regulation in vivo by the Drosoophila protein Sex-lethal, PNAS USA, 94, pp. 7343-7348, 1997.
  43. Hager, J.H. and Cline, T.W., Induction of female Sex-lethal RNA splicing in male germ cells: implications for Drosophila germline sex-determination, Development 124, pp. 5033-5048, 1997.
  44. Hilfiker, A., Amrein, H., H., Dobendorfer, A., Schneiter, R, and Nuthiger, R., The gene virilizer is required for female-specific splicing controlled by Sxl, master gene for development in Drosophila, Development 121, pp. 4017-4026, 1995.
  45. Horabin, J.I., Bopp, D., Waterburry, J., and Schedl, P., Selection and maintenance of sexual identity in the Drosophila melanogaster, Genetics 141, pp. 1521-1565, 1995.
  46. Horabin, J. I. And Schedl, P., Regulated spilicing of the Drosophila Sex-lethal male exon involves a blockage mechanism, Moll. Cell. Biol. 13, pp. 1408-1414, 1993.
  47. Horabin, J.L., and Schedl, P., Sex-lethal autoregulation requires multiple cis-acting elements upstream and downstream of the male exon and appears to depend largely on controlling the use of the male exon 5’ splice site, Moll. Cell. Biol. 13: pp. 7734-7746, 1993.
  48. Hoshijima, K., Kohyama, A., Watakabe, I., Inonue, K., Sakamato, H., and Shimura, Y., Transcriptiuonal regulation of the Sex-lethal gene by helix-loop-helix proteins, Nucleic Acids Res. 23, pp. 3441-3448, 1995.
  49. Inonue, K., Hojhijima, K., Sakamato,, H., and Shimura, Y., Binding of the Drosophila Sex-lethal gene product to the alternative splice site of transformer primary transcript, Nature 344, pp. 461-463, 1990.
  50. Keyes, L.N., Cline, T.W., and Schedl, P., The primary sex-determination signal of Drosophila acts at the level of transcription, Cell, Vol. 68, pp. 933-943, 1992.
  51. Komitopoulou, K., Gans, M., Margaritis, L.H., Kafatos, F.C., and Masson, M., Isolation and characterization of sex-linked female-sterile mutants in Drosophila melanogaster with special attention to eggshell mutants, Genetics 105: 897-921, 1983.
  52. Lee, S., DNA binding targets of the Drosophila melanogaster OVO protein, PhD Dissertation, Illinois Institute of Technology, Chicago, IL, USA, 1998.
  53. Lee, S. and Garfinkel, M.D., DNA-binding targets of the Drosophila melanogaster OVO protein, Nucleic Acid. Res.
  54. Linsley, D.L., and Zimm, G., The genome of the Drosophila melanogaster, Academic Press, San Diego, New York, 1980.
  55. Lu, J., Andrews, J., Pauli, D., and Oliver, B., Drosophila OVO zinc finger protein regulates ovo and ovarian tumor target promoters, Dev. Genes. Evol., pp. 1-10, 1998.
  56. Luccesi, J.C. and Manning, E., Gene dosage compaensation in Drosophila melanogaster, Adv. Genetics 24, pp. 371-429, 1987.
  57. Madl, J.E., and Herman, R.K., Polyploids and sex determination in Caenornabtidis elegans, Genetics 93, pp. 393-402, 1979.
  58. Mevel-Ninio, M., Mariol, M.C. and Gans, M., Mobilization of the gypsy and copia retrotransposans in Drosophila melanogaster induces reversion of the ovoD dominant female-sterile-mutations: molecular analysis of revertant alleles, EMBO J. 8, pp. 1549-1558, 1989.
  59. Mevel-Ninio, M., Terracol, R., and Kafatos, F.C., The ovo gene of Drosophila encodes a zinc finger protein required for female germ line development, EMBO J. 10, pp.2259-2266, 1991.
  60. Mevel-Ninio, M., Guenal, I., and Limburg-Bouchen, B., Production of dominant female sterility in Drosophila melanogaster by insertion of the ovoD1 allele autosomes: use of transformed starins to generate germline mosaic, Mechanism of development 45, pp. 155-162, 1994.
  61. Mevel-Ninio, M., Terracol, R., Salles, C., Vincent, A., and Payre, F., ovo, a Drosophila gene required for ovarian development, is specially expressed in the germline and shares most of its coding sequences with shavenbaby, a gene involved in embryo patterning, Mecahnism of Development 49, pp. 83-95, 1995.
  62. Mevel-Ninio, M., Fouilloux, E., Genal, I.  and Vincent, A., The three point dominant female-staerile mutations of Drosophila ovo gene are point mutations that create new translation-initiatorAUG codons, Development 122, pp. 4131-4138, 1996.
  63. Mohler, J.D., Developmental genetics of the Drosophila egg. I.: Identification of 50 sex-linked cistrons with maternal effects on embryonic development, genetics 85, pp. 259-272, 1977.
  64. Nagai, K., Oubridge, C., Jessen, T. H., Li, J., and Evans, P.R., Crystal structure of the RNA-binding domain of the U1 small nuclear ribonucleoprotein A, Nature 348, pp. 515-520, 1990.
  65. Nagoshi, R.N., McKeown, M., Burtis, K.C., Belote, J.M., and Baker, B., The control of alternative spilicing at genes regulating differentiation in D. melanogaster, Cell, Vol. 53, pp.229-236, 1988.
  66. Nagoshi, R.N., and Baker, B., Regulation of sex-specific RNA splicing at the Drosophila doublesex gene: cis-acting mutations in exon sequences alter sex specific RNA splicing patterns, Genes and Development 4, pp. 89-97, 1990.
  67. Nagoshi, R.N., Patton, J.S., Bae, E., and Geyer, P., The somatic sex determines the requirement for ovarian tumor gene activity in the proliferation of the Drosophila germline, development 121, pp.579-587, 1995.
  68. Nothiger, R., and Steinmann-Zwicky, M., Meier-Gerschwiller, P., and Weber, T., Sex determination in the germline of Drosophila depends on genetic signals and inductive somatic factors, development 107, pp.505-518, 1989.
  69. Oliver, B., Singer, J., Laget, V., Pennetta, G. and Pauli, D., Function of Drosophila melanogaster ovo– in germ line sex determination depend on X-Chromosome number, Development 120, pp.1-11, 1994.
  70. Oliver, B., Kim, Y. and Baker, B., Sex-lethal, master and slave: a hierarchy of germ line sex determination in Drosophila, Development 119, pp. 897-908, 1993.
  71. Oliver, B., Pauli, D., and Mahowald, A.P., Genetic evidence that the ovo locus is involved in Drosophila germ line sex determination, Genetics 125, pp. 535-550, 1990.
  72. Oliver, B., Perrimon, N, an Mahowald, A.P., The ovo locus is required for sex-specific germ line maintenance in Drosophila, Genes and Development 1, pp. 913-923, 1987.
  73.  Oubridge, C., Ito, N., Evans, P.R., Teo, C.H., and Nagai, K., Crystal structure at the 1.92A resolution of the RNA binding domain of the U1A splicesomal protein completed with an RNA hairpin, Nature 372, pp.432-438, 1994.
  74. Pauli, D., Oliver, B., and Mahowald, A.P., Identifications of regions interacting with ovo D mutations: potential new genes involved in germline sex determination in Drosophila melanogaster, Genetics 139, pp.713-732, 1995.
  75. Pauli, D., Oliver, B., and Mahowal, A.P., The role of the ovarian tumor locus in Drosophila melanogaster germ line sex determination, Development 119, pp.123-134, 1993.
  76. Pauli, D. and Mahowald, A.P., Germline sex determination in Drosophila melanogaster, Trends in Genetics, Vol. 6, No. 8, pp.259-264, 1990.
  77. Parkhurst, S.M., Bopp, D., and Ish-Horowicz,  X:A ratio, the primary sex determining signal in Drosophila, is transduced by helix-loop-helix proteins, Cell, Vol. 63, pp.1179-1191, 1990.
  78. Perrimon, N., Mohler, D., Engsttrom, L., and Mahowald, A.P., X-linked female-sterile loci in Drosophila melanogaster, Genetics 113, pp.695-712, 1986.
  79. Perrimon, N., Engstrom, L., and Mahowald, A.P., The effects of zygotic lethal mutations on female-germ-line functions in Drosophila, Developmental Biology 105, pp. 404-414, 1984.
  80. Perrimon, N., Clonal analysis of dominant female-sterile, germline-dependent mutations in Drosophila melanogaster, Genetics 108, pp.927-939, 1984.
  81. Perrimon, N. and Gans, M., Clonalo analysis of the tissue specificity of recessive female-sterile mutations of Drosophila melanogaster using a dominant female sterile mutation Fs(1)K1237, Developmental Biology 100, pp. 365-373, 1983.
  82. Rodesch, C., Geyer, P.K., Patton, J.S., Bae, E., and Nagoshi, R.N., Developmental analysis of the ovarian tumor gene during Drosophila oogenesis, Genetics 141, pp.191-202, 1995.
  83. Sag-Ozkol, D., Tekin, S., Garfinkel, M.D., Gene-dose sensitive trans-acting regulators of the Drosophila melanogaster germline promoter, 38th Annual Drosophila Research Conference, Chicago, IL, USA, 1997.
  84. Sag-Ozkol, D., and Garfinkel, M.D., Negative autoregulation of Drosophila melanogaster female germline specific gene, ovo (in preparation).
  85. Sag-Ozkol, D., and Garfinkel, M.D., X-chromosome screening of Drosophila melanogaster to find numerator elements of germline sex determination (in preparation).
  86. Salz, H.K. and Flickinger, T.W., Both loss of function and gain-of-function mutations in snf define a role for snRNP proteins in regulating Sex-lethal pre-mRNA splicing in Drosophila development, Genetics 144, pp.95-108, 1996.
  87. Salz, H.K., Maine, E.M., Keyes, L.N., Samuels, M.E., Cline, T.W., and Schedl, P., The Drosophila female-specific sex-determination gene, Sex-lethal has stage-, tissue-, and sex-specific RNAs suggesting multiple models of regulation, Genes and Development 3, pp.708-709, 1989.
  88. Salz, H.K., Cline, T.W., and Schedl, P., Functional changes associated with structural alterations induced by mobilization of a p element inserted in the Sex-lethal gene of Drosophila, Genetics 117, pp.221-231, 1987.
  89. Sanchez, L., Granadino, B., and Torres, M., Sex determination in Drosophila melanogaster, X-linked genes involved in the initial step of Sex-lethal activation, Developmental Genetics 15: 251-264, 1994.
  90. Sass, G., Mohler, J.D., Walsh, R.C., Kalfayan, L.J. and Searles, L.L., Structure an the expression of hybrid dysgenesis-induced alleles of the ovarian-tumor (otu) gene in Drosophila melanogaster, Genetics 133, pp.253-263, 1993.
  91. Sass, G., Comer, A.R. and Searles, L.L., The ovarian tumor protein isoforms of Drosophila melanogaster exhibit differences in function, expression, and localization, developmental Biology 167, pp.201-212, 1995.
  92. Schedl, A, Ross, A., Lee, M., Engelkamp, D., Rashbass, van Heyningen, V., and Hastie, N., Influence of PAX6 gene dosage on development: over-expression causes sever eye abnormalities, Cell 86, pp.71-82, 1992.
  93. Schupbach, T., and Wieschhaus, E., Female sterile mutations on the second chromosome of Drosophila melanogaster II mutations blocking oogenesis an altering egg morphology, Genetics 129, pp.1119-1136, 1991.
  94. Shupbach, T., an Wieschaus, E., Female sterile mutations on the second chromosome of Drosophila melanogaster I. Maternal effect mutations, Genetics 121, pp.101-17, 1989.
  95. Schupbach, T., Normal female germ cell differentiation requires the female X-chromosome to autosome ratio and expression of Sex-lethal in Drosophila melanogaster, Genetics 109, pp.529-548, 1985.
  96. Simon, J.A. and Lis, J.T., A germline transformation analysis reveals flexibility in the organization of the heat-shock consensus elements, Nucleic Acids Research, Vol 15, No.7, 1987.
  97. Staab, H., Heller, A., Steinmann-Zwicky, M., Somatic sex determining signals act on XX germ cells in Drosophila embryos, Development 122, pp.4065-4071, 1996.
  98. Staab, H., and Steinmann-Zwicky, M., Female germ cells of Drosophila require zygotic ovo and out product for survival in larvae and pupae, Mech. Dev. 54, pp.205-210, 1995.
  99. Stanewsky, R., Rendahl, K.G., Dill, M., and Saumweber, H., Genetic and molecular analysis of the X-chromosomal region 14B17-14C4 in Drosophila melanogaster: Loss of function in NONA, a nuclear protein common to many cell types, results in specific physiological and behavioral defects, Genetics 135, pp.419-442, 1993.
  100.  Steinman-Zwicky, M., Sex determination of the Drosophila germ line: tra and dsx control somatic inductive signals, Development 120, pp. 707-716, 1994.
  101. Steinman-Zwicky, M., Sxl in the germline of Drosophila: A target for somatic late induction, Developmental Genetics 15, pp.265-274, 1994.
  102. Steinman-Zwicky, M., Sex determination in Drosophila: sis-b, a major numerator element of the X:A ratio in the soma, does not contribute to the X:A ratio in germ line, Development 117, pp. 763-767, 1993.
  103. Steinman-Zwicky, M., How do the germ cells choose their sex? Drosophila as a paradigm, Bioassays 14 (8), pp.513-518, 1992.
  104. Steinman-Zwicky, M.,  Anrein, H. and Nothiger, R., Genetic control of sex determination in Drosophila, Advanced Genetics 27, pp.189-237, 1990.
  105. Steinman-Zwicky, M.,  Schmid, H. and Nothiger, R., Cell-autonomous an inductive signals can determine the sex of the germ line of Drosophila by regulating the gene Sxl, Cell, Vol. 57, pp.157-166, 1989.
  106. Steinman-Zwicky, M., Sex determination in Drosophila. The X-chromosomal gene liz is required for Sxl activity, The EMBO Journal 7, pp.3889-3898, 1988.
  107. Steinman-Zwicky, M. and Nothiger, R., The small region on the X chromosome of Drosophila regulates a key gene that controls sex determination and dosage compensation, Cell, Vol. 42, pp.877-887, 1985.
  108.  Sosnowski, B. A., Belote, J. M. and McKeown, M., Sex specific alternative spilicing of RNA gene results from sequence-dependent splice site blockage, Cell, Vol. 3, pp.449-459, 1989.
  109.  Yarfitz, S., Provost, N. M., and Hurley, J. B., Cloning of Drosophila melanogaster guanine nucleotide regulatory protein subunit gene and characterization of its expression during development, PNAS USA 85, pp.7134-7138, 1988.
  110. Wieschaus, E., Audit, C., and Masson, M., A clonal analysis of the rules of somatic cells and germline during oogenesis in Drosophila, Developmental Biology 88, pp.92-103, 1981.
  111. Wieschaus, E., Nusslein-Volhard, C., an Jurgen, G., Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Part III. Zygotic loci on the X-chromosome and fourth chromosome, Roux. Arch. Dev. Biol., 193, pp.296-307, 1984

Figures and Tables:

Figure: Sex determination of D. melanogaster (1998)

Figure: Somatic-Germline Interactions. (1998)

Figure: Molecular Structure of the ovo locus

Figure: In vivo Biochemical_genetic Assay for Regulators

Figure: ovo-LacZ Reporter Construction. (1998)

Figure: Establishing Stocks From Duplication Carrying Lines.

Figure: Two versus three copies of ovo in the genome.

Figure: Locating the Autosomal Insertion of ovo. (1998)

Figure: Control Assay for b-galactosidase Assay. (1998).

Table: Stocks for Negative Autoregulation of ovo (1998)

Results:

 

Table1: Negative Autoregulation of ovo Results Obtained with ovo3U21

Table 2: Negative Autoregulation of ovo Results Obtained with 4B28 (result)

Table 3: Gene Dose Assay with ovo3U21 Construct (1998) (results)

Table 4: Gene Dose Assay with ovo4B8 Construct (1998). (results)

Read Full Post »

Genome Jigsaws

Genome Jigsaws (Photo credit: dullhunk)

Screen Shot 2021-07-19 at 6.31.37 PM

Word Cloud By Danielle Smolyar

Sequencing became the household name.  In 2000s, it was thought to be the key of the Pandora’s box for cure.  Then, after completion of Human Genome Projects showed that there are less number of genes than expected.  This outcome induce to originate yet another set of sequencing programs and collaborations around the world, such as Human Protein Project, Human Microorganisms Projects, ENCODE, Transcriptome Sequencing and Consortiums etc.

It is in humankind to believe in magic and illusion.  The strength of biological diversity and complex mechanism of expression may chalanges the set up of a simple but informative specific essay.  Thus, there is a new developing field to mash rules of biology with mathematical formulas to develop the best bioinformatics or also called computational biology.  Predicting transcription start or termination sites, exon boundaries, possible binding sites of transcription regulators for chromatin modification activities, like histone acetylates and enhancer- and insulator-associated factors based on the human genome sequence.  Deep in mind, this assumption supports that the sequence contains signatures for chromatin modifications essential for gene regulation and development.

There are three primary colors, red, yellow and blue, however, an artist can create many shades. Recently, scientists combining and organizing more data to make sense of our blueprint of life to transfer info generation to generation with the hope to cure diseases of human kind.

Analyzing genome and transcriptome open the door.  These studies suggested that all eukaryotic cells has a rich portfolio of RNAs. Among these long non-coding RNAs has impact on protein coding gene expression, regulating multiple processes even including epigenetic gene expression.

Epigenetics, stemness and non-coding RNAs  play a great role to manipulate and correct the gene expression not only at a proper cell type but also location and time within genome without disturbing the host.

Main concern is differentiation of embryonic stem cells under these epigenetics and influencers.  The best known post-transcriptional modifications, which include methylation, acetylation, ubiquination, and SUMOylation of lysine residues, methylation of arginine residues, and phosphorylation of serines, occur on histone tails. “Epi” means “top” or
“above” so this mechanism give a new direction to the genetic pathways as long as the organism live sometime and may lead into evolutions.  It is critical to show the complexity of
mechanism and relativity of a gene role with a single example for each. 

For example,  DNA methylation occurs mostly on cytosine residues on the CpG islands usually located on promoter regions that are associated with tissue-specific gene expression.  However, there are many other forms of DNA methylations, such as  monoallelic methylation in gene imprinting and inactivation of the X chromosome,  in repetitive elements, like transposons.  There are two main mechanisms but this is not our main topic.  Yet, Myc and hypoxia-inducible factor-1α versus certain methyl-CpG-binding proteins, such as MBD1,MBD2, MBD4, MeCP2, and Kaiso works differently.

Stemness is an important factor for an intervention to correct a pathological condition. In terms of epigenetics, regulation and non-coding RNA Vascular endothelial growth factor A (VEGF-A) is an interesting example for differentiation of endothelial cells and morphogenesis of the vascular system during development with several reasons, epigenetics, gene interactions, time and space.  Everything has to be just right, because neither less nor too much can fulfill the destiny to become a complete adult cell or an organism.   For example, both having only one VEGF-A allele and having two-fold excess of VEGF-A results in death during early embryogenesis, since mice can’t develop proper vascular network.  However, explaining diverse mechanisms and functions of VEGF-A is require more information with specific details.  VEGF-A plays many roles in many pathological cases, such as cancer, inflammation, retinopathies, and arthritis because VEGF-A has also function in epigenetic reprogramming of the promoter regions of Rex1 and Oct4 genes, that are critical for a stem cell. Preferred mechanism is anti-angiogeneic state but tumor cells prefer hypermethylation to induce pro-angiogeneic state, thus VEGF-A stimulates PIGF in tumour cells among many other factors.

Now, let’s turn around to observe development of a cell with Polycomb repressive complexes (PRCs) because they are important chromatin regulators of embryonic stem (ES) cell function.  Originally, RYBP shown to function  as transcriptional repressor in reporter assays from both in tissue culture cells and in fruit fly (Drosophila melanogaster ) and as a direct interactor with Ring1A during embryogenesis through methylation. In addition, RYBP in epigenetic resetting during preimplantation development through repression of germ line genes and PcG targets before formation of pluripotent epiblast cells.  However, I do believe that the most important element is efficient repression of endogenous retroviruses (murine endogenous retrovirus called MuERV class),  preimplantation containing zygotic genome activation stage and germ line specific genes. The selective repressor activity of  RYBP  is in the ES cell state. When RYBP−/− ES cells were analyzed by measuring gene expression during differentiation as embryo bodies formed from mutant and wild-type cells, the result presented that  expression of pluripotency genes Oct4 and Nanog was usually downregulated. However, RYBP is able to bind genomic regions independently of H3K27me3 and there is no relation between altered RYBP binding in Dnmt1-mutant cells to DNA methylation status. In sum, RYBP has a large value in undifferentiated ES cells and may affect or even reset epigenetic landscape during early developmental stages. These are the gaps filled by long non coding RNAs.

We learn more compelling information by comparing and contrasting what is normal and what is abnormal. As a result, pathology is a key learning canvas for basic mechanisms in molecular genetics. Then peppered with functional genomics completes the story for an edible outcome.  We generally refer this as a Translational Research.  For example, recent foundlings suggest that H19 contributes to cancer, including hepatocellular carcinoma (HCC) after reviewing Oncomine resource.  According to these observations, in most HCC cases there is a lower expression of  H19 level is compared to the liver. Thus, in vitro and in vivo studies were undertaken with classical genetic analyzes based on loss- and gain-of-function on H19 to characterize two outcomes depend on H19, that are the effects on gene expression and on HCC metastasis. First, the expression of H19 showed gene expression variation since H19 expression was low in tumor cells than peripheral tumor cells.  Second, the metastasis of cancer based on alteration of miR-200 pathway contributing mesenchymal-to-epithelial transition by H19. Therefore, H19 and miR-200 are targets to be utilized during molecular diagnostics development and establishing targeted therapies in cancer.

Long story short, there is a circle of life where everything is connected even though they look different.  As a result, when we see a sunflower or a baby we remember to smile, because life is still an act to puzzle human.

References and Further Readings:

“Non-coding RNAs as regulators of gene expression and epigenetics” Cardiovascular Res 1 June 2011: 430-440.

“Epigenetic regulation of key vascular genes and growth factors” Cardiovasc Res 1 June 2011: 441-446.

“Epigenetic Regulation by Long Noncoding RNAs” Science 14 December 2012: 1435-1439.

“Epigenetic control of embryonic stem cell fate” JEM 25 October 2010: 2287-2295.

“Transcribed dark matter: meaning or myth?” Hum Mol Genet 15 October 2010: R162-R168.

“Epigenetic activation of the MiR-200 family contributes to H19-mediated metastasis suppression in hepatocellular carcinoma” Carcinogenesis 1 March 2013: 577-586.

“Vernalization-Mediated Epigenetic Silencing by a Long Intronic Noncoding RNA” Science 7 January 2011: 76-79.

“Predicting the probability of H3K4me3 occupation at a base pair from the genome sequence context” Bioinformatics 1 May 2013: 1199-1205.

Further Readings specific to Embryonic Stem Cell Differentiation and Development :

“BMP Induces Cochlin Expression to Facilitate Self-renewal and Suppress Neural Differentiation of Mouse Embryonic Stem Cells” J. Biol. Chem. 2013 288:8053-8060

Abstract

“Regulation of DNA Methylation in Rheumatoid Arthritis Synoviocytes”  J. Immunol. 2013 190:1297-1303

Abstract

“DNA methylome signature in rheumatoid arthritis” Ann Rheum Dis 2013 72:110-117

Abstract

“The histone demethylase Kdm3a is essential to progression through differentiation” Nucleic Acids Res 2012 40:7219-7232

Abstract

“Targeted silencing of the oncogenic transcription factor SOX2 in breast cancer” Nucleic Acids Res 2012 40:6725-6740

Abstract

“Yin Yang 1 extends the Myc-related transcription factors network in embryonic stem cells” Nucleic Acids Res 2012 40:3403-3418

Abstract

“RYBP Represses Endogenous Retroviruses and Preimplantation- and Germ Line-Specific Genes in Mouse Embryonic Stem Cells” Mol. Cell. Biol. 2012 32:1139-1149

Abstract

“Polycomb Repressor Complex-2 Is a Novel Target for Mesothelioma Therapy” Clin. Cancer Res. 2012 18:77-90

Abstract

“OCT4 establishes and maintains nucleosome-depleted regions that provide additional layers of epigenetic regulation of its target genes” Proc. Natl. Acad. Sci. USA 2011 108:14497-14502

Abstract

“Genome-wide promoter DNA methylation dynamics of human hematopoietic progenitor cells during differentiation and aging” Blood 2011 117:e182-e189

Abstract

“The CHD3 Chromatin Remodeler PICKLE and Polycomb Group Proteins Antagonistically Regulate Meristem Activity in the Arabidopsis” RootPlant Cell 2011 23:1047-1060

Abstract

“Chromatin structure of pluripotent stem cells and induced pluripotent stem cells” Briefings in Functional Genomics 2011 10:37-49

Abstract

Abbreviations used:

DNMT       DNA methyl transferase

ES             embryonic stem

JmjC         Jumonji C

lincRNA     long ncRNA

ncRNA       noncoding RNA

PcG          Polycomb group

PRC          Polycomb repressive complex

PRE          Polycomb repressive element

Previous Posts on Stem Cells:

…  Aviva Lev-Ari, PhD, RN New Life – The Healing Promise of Stem Cells View … p://www.technioniit.com/2012/09/new-life-healing-promise-of-stem-cells.html       Diseases and conditions where stem cell treatment is promising or emerging. Source: Wikipedia Since the …

…  Aviva Lev-Ari, PhD, RN Stem cells create new heart cells in baby mice, but not in adults, study …  picture on the left shows green c-kit+ precursor stem cells within an infarct (lower right) in a

14 January 2013  by Dr. Sudipta Saha on Pharmaceutical Intelligence
…  and Curator: Dr. Sudipta Saha, Ph.D. Germline stem cells that produce oocytes in vitro and fertilization-competent eggs in …  from adult mouse ovaries. A fluorescence-activated cell sorting-based protocol has been standardized that can be used with adult …  compared to the ESC-derived or induced pluripotent stem cell-derived germline cells that are currently used as models for human …

…  PhD, RN The two leading therapy classes are: Cell-based Therapies for angiogenesis and myocardial …  Research Projects Stem Cell biology Embryonic stem cells in cardiovascular repairEarly differentiation of human endothelial …

…  Stem Cells with Unread Genome: microRNAs Author, Demet Sag, PhD Life is …  a coherent outcome. Thus, providing an engineered whole cell as a system of correction for “Stem Cell Therapy” may resolve unmet health problems.  Only 1% of the genome …

…  are not yet known. Some studies suggest a high rate of stem cell activity with differentiation of progenitors to cardiomyocytes. Other …

…  T-cells, said Dr. Margaret Goodell, director of the Stem Cells and Regenerative Medicine Center of Baylor College of Medicine. …  of pediatrics at BCM and a member of the Center for Cell and Gene Therapy at BCM, Texas Children¹s Hospital and The Methodist …  found that mice lacking the gene for this factor had a T-cell deficiency and in particular, too few of these early progenitor …

28 March 2013  by ritusaxena on Pharmaceutical Intelligence
…  and Curator: Ritu Saxena, Ph.D Although cancer stem cells constitute only a small percentage of the tumor burden, their …  after therapeutic target in cancer. The post on cancer stem cells published on the 22nd of March, 2013, describes the identity of CSCs, their functional characteristics, possible cell of origin and biomarkers. This post focuses on the therapeutic potential …

…  programs in the fields of personalized medicine, cell biology, cytogenetics, genotyping, and biobanking drive our …  by playing an important role in induced pluripotent stem (iPS) cell research. Induced pluripotent stem cells are powerful cells which can be made from skin or blood cells, and …

30 November 2012  by sjwilliamspa on Pharmaceutical Intelligence
…  seen in hematologic malignancies such as cutaneous T-cell lymphoma and peripheral T-cell lymphoma and little or no positive outcome …  resistance to chemotherapeutics, and similarity to cancer stem cells(6-10). Figure 1. HDACis led to the induction of EMT phemotype. (A …

Read Full Post »

“The SILENCE of the Lambs” Introducing The Power of Uncoded RNA

Curator: Demet Sag, PhD

Screen Shot 2021-07-19 at 7.06.12 PM

 

 

 

 

 

 

 

Word Cloud By Danielle Smolyar

An illustration of the central dogma of molecu...

An illustration of the central dogma of molecular biology annotated with the processes ncRNAs are involved in. (Photo credit: Wikipedia)

X-ray structure of the tRNA Phe from yeast. Da...

X-ray structure of the tRNA Phe from yeast. Data was obtained by PDB 1ehz and rendered with PyMOL. violet: acceptor stem wine red: D-loop blue: anticodon loop orange: variable loop green: TPsiC-loop yellow: CCA-3′ of the acceptor stem grey: anticodon (Photo credit: Wikipedia)

 Our genome must be packed tightly to fit into the nucleus. Genome is the blue print of a living organism whether made up off a single or multiple cell.   Recently, the genome seen as a functional network of physical contacts within (cis) and between (trans) chromosomes.  It became necessary to map these physical DNA contacts at high-resolution with technologies such as the “chromosome conformation capture” (3C) and other 3C-related methods including 3C-Carbon Copy (5C) and Hi-C.  Yet, we all know that in vivo conformation, gene to gene interactions from a long distance, histones and 3D have an impact on gene regulation and expression.  The game is not just a sequence but functional genomics with a correct translation of sequence for development so that proper molecular diagnostics can be applied not only for prevention but also for monitoring the efficacy of the intervention. Thus, we can provide a targeted therapy for personalized medicine.

On the other hand, we still know very little about genome organization at the molecular level, although spatial genome organization can critically affect gene expression.  It is important to recognize who is there to be present and who is there to create the functional impact for regulation in a specific tissue and time.  In addition, mediation of these chromatin contacts based on a specific tissue is quite essential.  For example, during long-range control mechanism specific enhancers and distal promoters needed to be invited to a close physical proximity to each other by transcription factors that has been found at other loci.  Furthermore, chromatin-binding proteins such as the CCCTC-binding factor (CTCF) and cohesin seem to have critical roles in genome organization and gene expression.  Let’s not forget about epigenetics, since there are so many methods to regulate chromatin interactions like cytosine methylation, maternal gene, gradient level, post-translational modifications and non-coding RNAs.

The non-coding RNAs (ncRNAs) are silent but they have the 99% power because ncRNAs are a broad class of transcripts consisting of structural (rRNAs, tRNAs, snRNAs, snoRNAs, etc.), regulatory (miRNAs, piRNAs, etc.), and of sense/antisense transcripts.  Among these an interesting class is the latter group.   This class includes transcriptional “features” (eRNAs, tiRNAs), and a very large number of long non-coding RNAs (lncRNAs), length from 200 nt to 100 kb.  The magnificent future of lncRNAs comes from their production, as they can be transcribed nearby known protein-coding genes or from their introns. As a result, because of their intergenical production they are also called as “lincRNAs (long intergenical non-coding RNAs).  They are abundant and specific as microRNAs.  Hence, their inclusion into the biomarker list and assuming their roles during targeted therapy don’t require us to be a wizard but a functional genomicist knowing evolution, development and molecular genetics and plus signaling.

lincRNA can both activate and repress the gene either cis or trans acting to effect gene regulation will be discussed next.

As a result, one gene expression regulation needs from twenty to several hundred genes. As they say raising a child needs a village.

References:

“Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs”.

Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA, Goodnough LH, Helms JA, Farnham PJ, Segal E, Chang HY.  Cell. 2007 Jun 29; 129(7):1311-23.

“Long noncoding RNA as modular scaffold of histone modification complexes”

Tsai MC, Manor O, Wan Y, Mosammaparast N, Wang JK, Lan F, Shi Y, Segal E, Chang HYScience. 2010 Aug 6; 329(5992):689-93.

“Capturing Chromosome Conformation”.

Dekker J, Rippe K, Dekker M, Kleckner N.Science.2002;295:1306–1311.

“Chromosome Conformation Capture Carbon Copy (5C): a massively parallel solution for mapping interactions between genomic elements”.

Dostie J, Richmond TA, Arnaout RA, Selzer RR, Lee WL, Honan TA, Rubio ED, Krumm A, Lamb J, Nusbaum C, Green RD, Dekker J.Genome Res. 2006;16:1299–1309.

“Chromosome conformation capture carbon copy technology”.

Dostie J, Zhan Y, Dekker J. Curr. Protoc. Mol. Biol. 2007 Chapter 21, Unit 21 14.

“Comprehensive mapping of long-range interactions reveals folding principles of the human genome”.

Lieberman-Aiden E, van Berkum NL, Williams L, Imakaev M, Ragoczy T, Telling A, Amit I, Lajoie BR, Sabo PJ, Dorschner MO, Sandstrom R, Bernstein B, Bender MA, Groudine M, Gnirke A, Stamatoyannopoulos J, Mirny LA, Lander ES, Dekker J.  Science. 2009;326:289–293.

“Chromatin conformation signatures: ideal human disease biomarkers?”

Crutchley JL, Wang XQ, Ferraiuolo MA, Dostie J.Biomark. Med. 2010;4:611–629.

“Relationship between CAD risk genotype in the chromosome 9p21 locus and gene expression. Identification of eight new ANRIL splice variants”.

Folkersen L, Kyriakou T, Goel A, Peden J, Mälarstig A, Paulsson-Berne G, Hamsten A, Hugh Watkins, Franco-Cereceda A, Gabrielsen A, Eriksson P, PROCARDIS consortia

PLoS One. 2009 Nov 2; 4(11):e7677.

” A myelopoiesis-associated regulatory intergenic noncoding RNA transcript within the human HOXA cluster”.

Zhang X, Lian Z, Padden C, Gerstein MB, Rozowsky J, Snyder M, Gingeras TR, Kapranov P, Weissman SM, Newburger PE.  Blood. 2009 Mar 12; 113(11):2526-34.

Monk M.   Genes Dev. 1988 Aug; 2(8):921-5.

“Hox genes specify vertebral types in the presomitic mesoderm“

Marta Carapuço,1 Ana Nóvoa,1 Nicoletta Bobola,2 and Moisés Mallo1,3 .  Genes Dev. 2005 September 15; 19(18): 2116–2121.

Krumlauf R.  Cell. 1994 Jul 29; 78(2):191-201.

“Noncoding RNA synthesis and loss of Polycomb group repression accompanies the colinear activation of the human HOXA cluster”.

Sessa L, Breiling A, Lavorgna G, Silvestri L, Casari G, Orlando V.  RNA. 2007 Feb; 13(2):223-39.

“Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs”.

Rinn JL, Kertesz M, Wang JK, Squazzo SL, Xu X, Brugmann SA, Goodnough LH, Helms JA, Farnham PJ, Segal E, Chang HY.  Cell. 2007 Jun 29; 129(7):1311-23.

“Long noncoding RNAs with enhancer-like function in human cells”.

Ørom UA, Derrien T, Beringer M, Gumireddy K, Gardini A, Bussotti G, Lai F, Zytnicki M, Notredame C, Huang Q, Guigo R, Shiekhattar R

“Histone modifications at human enhancers reflect global cell-type-specific gene expression”.

Heintzman ND, Hon GC, Hawkins RD, Kheradpour P, Stark A, Harp LF, Ye Z, Lee LK, Stuart RK, Ching CW, Ching KA, Antosiewicz-Bourget JE, Liu H, Zhang X, Green RD, Lobanenkov VV, Stewart R, Thomson JA, Crawford GE, Kellis M, Ren B.   Nature. 2009 May 7; 459(7243):108-12.

“Tiny RNAs associated with transcription start sites in animals”.

Taft RJ, Glazov EA, Cloonan N, Simons C, Stephen S, Faulkner GJ, Lassmann T, Forrest AR, Grimmond SM, Schroder K, Irvine K, Arakawa T, Nakamura M, Kubosaki A, Hayashida K, Kawazu C, Murata M, Nishiyori H, Fukuda S, Kawai J, Daub CO, Hume DA, Suzuki H, Orlando V, Carninci P, Hayashizaki Y, Mattick JS.  Nat Genet. 2009 May; 41(5):572-8.

“Chromatin modifications and their function”.

Kouzarides T.   Cell. 2007 Feb 23; 128(4):693-705.

Tripathi V, Ellis JD, Shen Z, Song DY, Pan Q, Watt AT, Freier SM, Bennett CF, Sharma A, Bubulya PA, Blencowe BJ, Prasanth SG, Prasanth KV.   Mol Cell. 2010 Sep 24; 39(6):925-38.

Selected Further Reading

“Small and long non-coding RNAs in cardiac homeostasis and regeneration”

Ounzain, S.; Crippa, S.; Pedrazzini, T.  BBA – Molecular Cell Research vol. 1833 issue 4 April, 2013. p. 923-933

“Regulatory mechanisms of long noncoding RNAs in vertebrate central nervous system development and function.” 

Knauss, J.L.; Sun, T.  “Neuroscience vol. 235 April 3, 2013. p. 200-214

“Comparative genomics reveals ‘novel’ Fur regulated sRNAs and coding genes in diverse proteobacteria.”

Sridhar, J.; Sabarinathan, R.; Gunasekaran, P.; Sekar, K.   Gene vol. 516 issue 2 March 10, 2013. p. 335-344 DOI: 10.1016/j.gene.2012.12.057. ISSN: 0378-1119.

“miRNAs Regulate Expression and Function of Extracellular Matrix Molecules”

Rutnam, Z.J.; Wight, T.N.; Yang,  B.B.Matrixixix Biology vol. 32 issue 2 March 11, 2013. p. 74-85 DOI: 10.1016/j.matbio.2012.11.003. ISSN: 0945-053X.

“Transcript profiling of microRNAs during the early development of the maize brace root via Solexa sequencing”

Liu, P.; Yan, K.; Lei, Y.x.; Xu, R.; Zhang, Y.m.; Yang, G.d.; Huang, J.g.; Wu, C.A.; Zheng, C.C.Genomics vol. 101 issue 2 February, 2013. p. 149-156 DOI: 10.1016/j.ygeno.2012.11.004. ISSN: 0888-7543.

“Regulatory mechanisms of long noncoding RNAs in vertebrate central nervous system development and function”

Knauss, J.L.; Sun, T.  Neuroscience vol. 235 April 3, 2013. p. 200-214 DOI: 10.1016/j.neuroscience.2013.01.022. ISSN: 0306-4522.

“The dynamic biliary epithelia: Molecules, pathways, and disease”

O’Hara, Steven P.; Tabibian, James H.; Splinter, Patrick L.; LaRusso, Nicholas F. Journal of Hepatology vol. 58 issue 3 March, 2013. p. 575-582 DOI: 10.1016/j.jhep.2012.10.011. ISSN: 0168-8278

ABBREVIATIONS

3C = Chromosome conformation capture

rRNAs = Ribosomal RNAs

tRNAs = Transfer RNAs

snRNAs = Small nuclear RNAs

snoRNAs = Small nucleolar RNAs

miRNAs = MicroRNAs

piRNAs = Piwi-interacting RNAs

eRNAs = Enhancer RNAs

tiRNAs = Transcription initiation RNAs

spliRNAs = Splice-site RNAs

lincRNAs = Long intergenic non-coding RNAs

lncRNPs = Long non-coding ribonucleoprotein complexes

Igf2r = Insulin-like growth factor II receptor

HMTs = Histone methyl transferases

TSSs = Transcriptional start sites

TFs = Transcription factors

RNAi = RNA interference

PTMs = Post-translational modifications

  • Patent. (postdocstreet.wordpress.com)

Related  Published Blogs

long noncoding RNA network regulates PTEN transcription

…  noncoding RNA network regulates PTEN transcription  Scientists Find Surprising New Influence On Cancer Genes A pseudogene long noncoding RNA networkregulates PTEN transcription

…  kit that uses a simple blood draw to measure the RNA levels of 23 genes. Using an algorithm, it then creates a score that …

…     Feb 17, 2013   Long segments of noncoding RNA are key to physically manipulating DNA in order to activate certain genes. These noncoding RNA-activators (ncRNA-a) have a crucial role in turning genes on and …

31 October 2012  by sjwilliamspa on Pharmaceutical Intelligence
…  The ENCODE project reveals that many genes encode for an RNA, not protein product, so called regulatory RNAs. However some of the …  are capable of generating new insertions through

3 October 2012  by ritusaxena on Pharmaceutical Intelligence
…  and Craig Mello for their discovery of this new role of RNA molecules. A breakthrough research was published in the September 2010 …

Read Full Post »

« Newer Posts - Older Posts »