Healthcare analytics, AI solutions for biological big data, providing an AI platform for the biotech, life sciences, medical and pharmaceutical industries, as well as for related technological approaches, i.e., curation and text analysis with machine learning and other activities related to AI applications to these industries.
Nobel Prize in Chemistry 2024 to David Baker, Demis Hassabis and John M. Jumper
Reporter: Aviva Lev-Ari, PhD, RN
UPDATED on 10/22/2024
ProteinMPNN, which is now available free on the open-source software repository GitHub, will give researchers the tools to make unlimited new designs. “The challenge, of course … is what are you going to design?” Baker says.
In a second Nobel win for AI, the Royal Swedish Academy of Sciences has awarded half the 2024 prize in chemistry to Demis Hassabis, the cofounder and CEO of Google DeepMind, and John M. Jumper, a director at the same company, for their work on using artificial intelligence to predict the structures of proteins. The other half goes to David Baker, a professor of biochemistry at the University of Washington, for his work on computational protein design. The winners will share a prize pot of 11 million Swedish kronor ($1 million).
The potential impact of this research is enormous. Proteins are fundamental to life, but understanding what they do involves figuring out their structure—a very hard puzzle that once took months or years to crack for each type of protein. By cutting down the time it takes to predict a protein’s structure, computational tools such as those developed by this year’s award winners are helping scientists gain a greater understanding of how proteins work and opening up new avenues of research and drug development. The technology could unlock more efficient vaccines, speed up research on cures for cancer, or lead to completely new materials.
Hassabis and Jumper created AlphaFold, which in 2020 solved a problem scientists have been wrestling with for decades: predicting the three-dimensional structure of a protein from a sequence of amino acids. The AI tool has since been used to predict the shapes of all proteins known to science.
“I’ve dedicated my career to advancing AI because of its unparalleled potential to improve the lives of billions of people,” said Demis Hassabis. “AlphaFold has already been used by more than two million researchers to advance critical work, from enzyme design to drug discovery. I hope we’ll look back on AlphaFold as the first proof point of AI’s incredible potential to accelerate scientific discovery,” he added.
Baker has created several AI tools for designing and predicting the structure of proteins, such as a family of programs called Rosetta. In 2022, his lab created an open-source AI tool called ProteinMPNN that could help researchers discover previously unknown proteins and design entirely new ones. It helps researchers who have an exact protein structure in mind find amino acid sequences that fold into that shape.
Most recently, in late September, Baker’s lab announced it had developed custom molecules that allow scientists to precisely target and eliminate proteins associated with diseases in living cells.
“[Proteins] evolved over the course of evolution to solve the problems that organisms faced during evolution. But we face new problems today, like covid. If we could design proteins that were as good at solving new problems as the ones that evolved during evolution are at solving old problems, it would be really, really powerful,” Baker told MIT Technology Review in 2022.
born 1962 in Seattle, WA, USA. PhD 1989 from University of California, Berkeley, CA, USA. Professor at University of Washington, Seattle, WA, USA and Investigator, Howard Hughes Medical Institute, USA.
University of Washington, Seattle, WA, USA
Howard Hughes Medical Institute, USA
Demis Hassabis “for protein structure prediction”
born 1976 in London, UK. PhD 2009 from University College London, UK. CEO of Google DeepMind, London, UK.
Google DeepMind, London, UK
John M. Jumper “for protein structure prediction”
born 1985 in Little Rock, AR, USA. PhD 2017 from University of Chicago, IL, USA. Senior Research Scientist at Google DeepMind, London, UK.
Google DeepMind, London, UK
The Nobel Prize in Chemistry 2024 is about proteins, life’s ingenious chemical tools. David Baker has succeeded with the almost impossible feat of building entirely new kinds of proteins. Demis Hassabis and John Jumper have developed an AI model to solve a 50-year-old problem: predicting proteins’ complex structures. These discoveries hold enormous potential.
“One of the discoveries being recognised this year concerns the construction of spectacular proteins. The other is about fulfilling a 50-year-old dream: predicting protein structures from their amino acid sequences. Both of these discoveries open up vast possibilities,” says Heiner Linke, Chair of the Nobel Committee for Chemistry.
Proteins generally consist of 20 different amino acids, which can be described as life’s building blocks. In 2003, David Baker succeeded in using these blocks to design a new protein that was unlike any other protein. Since then, his research group has produced one imaginative protein creation after another, including proteins that can be used as pharmaceuticals, vaccines, nanomaterials and tiny sensors.
The second discovery concerns the prediction of protein structures. In proteins, amino acids are linked together in long strings that fold up to make a three-dimensional structure, which is decisive for the protein’s function. Since the 1970s, researchers had tried to predict protein structures from amino acid sequences, but this was notoriously difficult. However, four years ago, there was a stunning breakthrough.
In 2020, Demis Hassabis and John Jumper presented an AI model called AlphaFold2. With its help, they have been able to predict the structure of virtually all the 200 million proteins that researchers have identified. Since their breakthrough, AlphaFold2 has been used by more than two million people from 190 countries. Among a myriad of scientific applications, researchers can now better understand antibiotic resistance and create images of enzymes that can decompose plastic.
Life could not exist without proteins. That we can now predict protein structures and design our own proteins confers the greatest benefit to humankind.
@@@@
This year’s Nobel Prize laureates in chemistry Demis Hassabis and John Jumper have developed an AI model to solve a 50-year-old problem: predicting proteins’ complex structures.
In 2020, Hassabis and Jumper presented an AI model called AlphaFold2. With its help, they have been able to predict the structure of virtually all the 200 million proteins that researchers have identified. Since their breakthrough, AlphaFold2 has been used by more than two million people from 190 countries. Among a myriad of scientific applications, researchers can now better understand antibiotic resistance and create images of enzymes that can decompose plastic.
2024 Nobel Prize in Physiology or Medicine jointly to Victor Ambros and Gary Ruvkun for the discovery of microRNA and its role in post-transcriptional gene regulation
Reporter: Aviva Lev-Ari, PhD, RN
Updated 10/22/2024
The revolution in our understanding of transcriptional regulation and dark regions of the genome
The genome of higher eukaryotes are comprised of multiple exonic and intronic regions, with coding and noncoding DNA respectively. Much of the DNA sequence between exonic regions of genes, the sequences encoding the amino acids of a polypeptide, was considered either promoter regions regulating an exonic sequence or ‘junk DNA’, which had merely separated exons and their regulatory elements. It was not considered that this dark DNA or junk DNA was important in regulating transcription of genes. It was felt that most gene regulation occurred in promoter regions by response element factors which bound to specific sequences within these regions.
MicroRNA (miRNA), originally discovered in Caenorhabditis elegans, is found in most eukaryotes, including humans [1–3]. It is predicted that miRNA account for 1-5% of the human genome and regulate at least 30% of protein-coding genes [4–8]. To date, 940 distinct miRNAs molecules have been identified within the human genome [9–12] (http://microrna.sanger.ac.uk accessed July 20, 2010). Although little is currently known about the specific targets and biological functions of miRNA molecules thus far, it is evident that miRNA plays a crucial role in the regulation of gene expression controlling diverse cellular and metabolic pathways.
MiRNA are small, evolutionary conserved, single-stranded, non-coding RNA molecules that bind target mRNA to prevent protein production by one of two distinct mechanisms. Mature miRNA is generated through two-step cleavage of primary miRNA (pri-miRNA), which incorporates into the effector complex RNA-induced silencing complex (RISC). The miRNA functions as a guide by base-pairing with target mRNA to negatively regulate its expression. The level of complementarity between the guide and mRNA target determines which silencing mechanism will be employed; cleavage of target messenger RNA (mRNA) with subsequent degradation or translation inhibition
Fig. (1). MicroRNA maturation and function.
Figure. miRNA maturation and function. Source: Macfarlane LA, Murphy PR. MicroRNA: Biogenesis, Function and Role in Cancer. Curr Genomics. 2010 Nov;11(7):537-61. doi: 10.2174/138920210793175895.
The following is an interview in the journal Journal of Cellular Biology with Dr, Victor Ambros on his discovery of miRNA.
Source: Ambros V. Victor Ambros: the broad scope of microRNAs. Interview by Caitlin Sedwick. J Cell Biol. 2013 May 13;201(4):492-3. doi: 10.1083/jcb.2014pi. PMID: 23671307; PMCID: PMC3653358.
Once, we thought we understood all there was to know about how gene expression is regulated: A cell can tinker with the expression level of a given protein’s messenger RNA by modifying the activity, abundance, and type of transcription factors in the nucleus or with the RNA’s stability once it is made. But then came a surprising story about a short RNA in C. elegans called lin-4, which didn’t encode a protein but prevented expression of the protein encoded by another gene, lin-14, through antisense binding to lin-14 mRNA (1, 2). Today, we know that lin-4 was just the first example of a large number of small RNAs, called microRNAs, which regulate the expression of various other proteins in a similar way.
Victor Ambros, whose lab published that first story about lin-4, has been studying microRNAs (3, 4) and their regulation (5, 6) ever since, pushing forward our understanding of this powerful mechanism. We called him at his office at the University of Massachusetts Medical School to get some perspective on microRNAs and his career and to learn about some of the latest developments in his lab.
“That shared discovery is one of the most precious moments in my career.”
FROM FARM TO LAB TABLE
How did you end up doing a PhD with David Baltimore?
I was the first scientist in my family. My dad was an immigrant from Poland. He came to the States just after World War II and met my mom. They got married, moved to a farm in Vermont, and started farming. My siblings and I grew up amongst the cows and pigs and helped with the haying and cutting corn, stuff like that.
When I was about nine, I got interested in science, and after that I always wanted to be a scientist. I was an amateur astronomer; I built a telescope and started to imagine that I could actually do astronomy or physics as an occupation. But I quickly changed my mind when I reached college, in part because I realized that my math skills weren’t really up to the task of being a physicist and also because I discovered molecular biology and genetics and just fell in love with both subjects. David taught one of the advanced biology classes I took as an undergraduate at MIT, and that probably had some influence on my decision to work with him. After college, I worked as a technician in David’s lab for a year. I liked it a lot and stayed on in his lab when I entered graduate school at MIT. I was lucky because I had gotten a little bit of traction on a project and continued on that as a grad student, so I ended up finishing grad school fairly efficiently.
Had you any idea at the time what the nature of the lin-4 mutant was?
The assumption was that it was a protein product. I mean, nobody ever thought that there would be any other kind of regulator. There really wasn’t any reason to imagine that there were any other kinds of molecules necessary, other than proteins, to carry out everything that’s done in a cell—especially with regard to the regulation of gene expression. The complexity of gene regulation by proteins alone was so enormous that I never imagined—and nobody I knew imagined—that we needed to look for new kinds of regulatory molecules. The realization that lin-4 was antisense to the 3′-untranslated region of lin-14 was totally the result of communication between Gary and me. That shared discovery is one of the most precious moments in my career. But at the time I didn’t realize that this might be the first example of a general mechanism for regulating gene expression because I was prone to thinking that whatever I was studying in the worm was not generally applicable. It wasn’t until genome sequences were made available that the prevalence of this mechanism became clear.
THE RIGHT CONTEXT
You’ve moved to studying processes that modulate microRNA function…
One protein we’ve studied is called Nhl-2. It’s an example of an emerging class of proteins that can modulate, positively or negatively, the RNA-induced silencing complex (RISC) that inhibits mRNAs targeted by microRNAs. This class of genes may have either general effects on RISC activity or, in some cases, more specific effects. One area of interest in the lab right now is trying to understand the specific outcomes for the regulation of particular microRNAs. Do they always interact with all their targets, or is their activity on some targets promoted or inhibited at the expense of other targets? Can their interaction with certain targets be modified depending on context? We’re using genetic and genomic approaches to identify new modulatory cofactors.
Watch Video
Victor Ambros was born in 1953 in Hanover, New Hampshire, USA. He received his PhD from Massachusetts Institute of Technology (MIT), Cambridge, MA, in 1979 where he also did postdoctoral research 1979-1985. He became a Principal Investigator at Harvard University, Cambridge, MA in 1985. He was Professor at Dartmouth Medical School from 1992-2007 and he is now Silverman Professor of Natural Science at the University of Massachusetts Medical School, Worcester, MA.
Gary Ruvkun was born in Berkeley, California, USA in 1952. He received his PhD from Harvard University in 1982. He was a postdoctoral fellow at Massachusetts Institute of Technology (MIT), Cambridge, MA, 1982-1985. He became a Principal Investigator at Massachusetts General Hospital and Harvard Medical School in 1985, where he is now Professor of Genetics.
This year’s Nobel Prize honors two scientists for their discovery of a fundamental principle governing how gene activity is regulated.
The information stored within our chromosomes can be likened to an instruction manual for all cells in our body. Every cell contains the same chromosomes, so every cell contains exactly the same set of genes and exactly the same set of instructions. Yet, different cell types, such as muscle and nerve cells, have very distinct characteristics. How do these differences arise? The answer lies in gene regulation, which allows each cell to select only the relevant instructions. This ensures that only the correct set of genes is active in each cell type.
Victor Ambros and Gary Ruvkun were interested in how different cell types develop. They discovered microRNA, a new class of tiny RNA molecules that play a crucial role in gene regulation. Their groundbreaking discovery revealed a completely new principle of gene regulation that turned out to be essential for multicellular organisms, including humans. It is now known that the human genome codes for over one thousand microRNAs. Their surprising discovery revealed an entirely new dimension to gene regulation. MicroRNAs are proving to be fundamentally important for how organisms develop and function.
Ambros and Ruvkun were interested in genes that control the timing of activation of different genetic programs, ensuring that various cell types develop at the right time. They studied two mutant strains of worms, lin-4 and lin-14, that displayed defects in the timing of activation of genetic programs during development. The laureates wanted to identify the mutated genes and understand their function. Ambros had previously shown that the lin-4 gene appeared to be a negative regulator of the lin-14 gene. However, how the lin-14 activity was blocked was unknown. Ambros and Ruvkun were intrigued by these mutants and their potential relationship and set out to resolve these mysteries.
Ambros and Ruvkun performed further experiments showing that the lin-4 microRNA turns off lin-14 by binding to the complementary sequences in its mRNA, blocking the production of lin-14 protein. A new principle of gene regulation, mediated by a previously unknown type of RNA, microRNA, had been discovered! The results were published in 1993 in two articles in the journal Cell.
Ruvkun cloned let-7, a second gene encoding a microRNA. The gene is conserved in evolution, and it is now known that microRNA regulation is universal among multicellular organisms.
Andrew Z. Fire and Craig C. Mello, awarded the Nobel Prize in 2006, described RNA interference, where specific mRNA-molecules are inactivated by adding double-stranded RNA to cells.
Mutations in one of the proteins required for microRNA production result in the DICER1 syndrome, a rare but severe syndrome linked to cancer in various organs and tissues.
Tweets and Re-Tweets of Tweets by @pharma_BI@AVIVA1950 at 2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021
REAL TIME EVENT COVERAGE as PRESS by invitation from 2021 Virtual World Medical Innovation Forumat #WMIF2021 @MGBInnovation:
for sharing this screen capture of the impressive lineup of #GCT “Disruptive Dozen” panelists at #WMIF2021
Quote Tweet
Aviva Lev-Ari
@AVIVA1950
· May 21
@MGBInnovation #WMIF Best Global event on Gene Cell Therapy covered in real time @AVIVA1950 @pharma_BI Disruptive Dozen technologies four are based on Gene Editing, AAV and non viral vector for drug delivery are included
PART 1: ALL THE TWEETS PRODUCED by @AVIVA1950 on May 21, 2021
Bob Carter, MD, PhD Chairman, Department of Neurosurgery, MGH William and Elizabeth Sweet, Professor of Neurosurgery, HMS Neurogeneration REVERSAL or slowing down?
Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS efficacy Autologous cell therapy transplantation approach program T cells into dopamine genetating cells greater than Allogeneic cell transplantation
Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT Multi OMICS and academia originated innovations are the most attractive areas
Peter Kolchinsky, PhD Founder and Managing Partner, RA Capital Management Future proof for new comers disruptors Ex Vivo gene therapy to improve funding products what tool kit belongs to
Chairman, Department of Neurosurgery, MGH, Professor of Neurosurgery, HMS Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamine skin cell to become autologous cells reprogramed
Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH Off-th-shelf one time treatment becoming cure Intact tissue in a dish is fragile to maintain metabolism to become like semiconductors
Ole Isacson, MD, PhD Director, Neuroregeneration Research Institute, McLean Professor, Neurology and Neuroscience, MGH, HMS Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all
Erin Kimbrel, PhD Executive Director, Regenerative Medicine, Astellas In the ocular space immunogenecity regulatory communication use gene editing for immunogenecity Cas1 and Cas2 autologous cells
Nabiha Saklayen, PhD CEO and Co-Founder, Cellino scale production of autologous cells foundry using semiconductor process in building cassettes by optic physicists
Joe Burns, PhD VP, Head of Biology, Decibel Therapeutics Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation control by genomics
Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH first drug required to establish the process for that innovations design of animal studies not done before
Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization
David Berry, MD, PhD CEO, Valo Health GP, Flagship Pioneering Bring disruptive frontier platform reliable delivery CGT double knockout disease cure all change efficiency scope human centric vs mice centered right scale acceleration
Kush Parmar, MD, PhD Managing Partner, 5AM Ventures build it yourself, benefit for patients FIrst Look at MGB shows MEE innovation on inner ear worthy investment
Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Frustration with supply chain during the Pandemic, GMC anticipation in advance CGT rapidly prototype rethink and invest proactive investor .edu and Pharma
The # of US patients with Parkinson’s Disease is expected to double over next 30 years. Penelope Hallett PhD, Co-Director of the Neuroregeneration Research Inst
Marcela Maus, MD PhD, are working to expand the reach of this transformative technology. #WMIF2021
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· 3h
Disruptive Dozen: 12 Technologies that Will Reinvent GCT #9. Building the Next Wave of CAR-T-cell Therapies #WMIF2021 #GCT #GeneAndCellTherapy #CellTherapy #CarT #DisruptiveDozen
and global colleagues at #WMIF2021. On Thursday, May 20, my colleagues and I will discuss the advantages of RNA-targeted medicines and how they might shape the future of medicine for patients.
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· May 10
Are you part of the @MassGenBrigham network and interested in #GeneAndCellTherapy? Join us at the World Medical Innovation Forum on 5/19-5/21. Register today! https://worldmedicalinnovation.org/register/ #WMIF2021
Incredible opportunity to get up to speed with the most innovative technologies in medicine ! Gene and cell therapy are revolutionizing healthcare ! #WMIF2021#MedTwitter
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· May 11
#WMIF2021 is an opportunity for innovators from around the globe to meet, explore, challenge, and reflect on the issues influencing the adoption of novel technologies in #healthcare. Register now to join the conversation: https://worldmedicalinnovation.org/register/
Currently, the only cure for some common blood disorders is a bone marrow transplant, which can be risky. Now, gene therapies are also in the works, including a CRISPR-based #genetherapy being tested in clinical trials with encouraging early results. #WMIF2021
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· 3h
Disruptive Dozen: 12 Technologies that Will Reinvent GCT #2. A Genetic Fix for Two Common Blood Disorders #WMIF2021 #GCT #GeneAndCellTherapy #BloodDisorders #DisruptiveDozen
Researchers have pinpointed key genes involved in cholesterol and lipid metabolism that represent promising targets for new cholesterol-lowering treatments. #WMIF2021
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· 3h
Disruptive Dozen: 12 Technologies that Will Reinvent GCT #1. A New Generation of Cholesterol-Loweing Therapies #WMIF2021 #GCT #GeneAndCellTherapy #DisruptiveDozen
I really enjoyed this remarkable panel #WMIF2021. Thank you Meredith Fisher for moderating and thank you David, Bob and Kush for openly sharing your big picture view
Variability, delays, manufacturing as an afterthought make #GCT challenging from an investment POV — need to rethink the ecosystem and drive efficiency, invest in tech innovation says Bob Nelson ARCH Venture Partners
We need to change the scale and scope of how #GCT is advancing from discovery to development — systematization critical. Can’t have thousands of one-off therapies say early-stage investors. Major mis-match between where things are now and what could be.
Today I moderated a panel on Gene and Cell Therapy Delivery, Perfecting the Technology. We highlighted non-viral delivery technologies as key enablers of gene therapy and editing. Learn more: https://lnkd.in/d-Xqzqh#WMIF2021
Congratulations to the 2021 Innovation Discovery Grants winners: @lynchielydia, Peter Sage, @GrishchukL, Benjamin Kleinstiver, Petr Baranov, announced at the #WMIF2021. It’s exciting to see the range of breakthrough research in #geneticdisease at @MassGenBrigham…
for sharing this screen capture of the impressive lineup of #GCT “Disruptive Dozen” panelists at #WMIF2021
Quote Tweet
Aviva Lev-Ari
@AVIVA1950
· May 21
@MGBInnovation #WMIF Best Global event on Gene Cell Therapy covered in real time @AVIVA1950 @pharma_BI Disruptive Dozen technologies four are based on Gene Editing, AAV and non viral vector for drug delivery are included
PART 1: ALL THE TWEETS PRODUCED by @AVIVA1950 on May 20, 2021
Bob Brown, PhD CSO, EVP of R&D, Dicerna small molecule vs capacity of nanoparticles to deliver therapeutics quantity for more molecule is much larger CNS delivery most difficult
Jeannie Lee, MD, PhD Molecular Biologist, MGH Prof Genetics, HMS 200 disease X chromosome unlock for neurological genetic diseases: Rett Syndrome, autism spectrum disorders female model vs male mice model restore own protein
Suneet Varma Global President of Rare Disease, Pfizer review of protocols and CGT for Hemophilia Pfizer: You can’t buy Time With MIT Pfizer is developing a model for Hemophilia CGT treatment
Gallia Levy, MD, PhD CMO, Spark Therapeutics Hemophilia CGT is the highest potential for Global access logistics in underdev countries working with NGOs practicality of the Tx Roche reached 120 Counties great to be part of the Roche
Theresa Heggie CEO, Freeline Therapeutics Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered
Suneet Varma Global President of Rare Disease, Pfizer Gene therapy at Pfizer small, large molecule and CGT – spectrum of choice allowing Hemophilia patients to marry 1/3 internal 1/3 partnership 1/3 acquisitions review of protocols
Ron Renaud CEO, Translate Bio What strain of Flu vaccine will come back in the future when people do not use masks. AAV vectors small transcript size fit reach cytoplasm more development coming
Melissa Moore Chief Scientific Officer, Moderna Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna
Lindsey Baden, MD Director, Clinical Research, Division of Infectious Diseases, BWH Associate Professor, HMS In vivo delivery process regulatory for new opportunities for same platform new indication using multi valence vaccines
Melissa Moore Chief Scientific Officer, Moderna Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna
Ron Renaud CEO, Translate Bio 1.6 Billion doses produced rare disease monogenic correct mRNA like CF multiple mutation infection disease and oncology applications
Melissa Moore CSO, Moderna mRNA vaccine 98% efficacy for Pfizer and Moderna more then 10 years 2015 mRNA was ready (ZIKA, RSV), as the proteine is identify manufacturing temp less of downside in the future ability to store at Ref
Richard Wang, PhD CEO, Fosun Kite Biotechnology Co. Ltd Possibilities to be creative and capitalize the new technologies for new drug Support of the ecosystem by funding new companies Autologous in patients differences cost challenge
Tian Xu, PhD Vice President, Westlake University ICH Chinese FDA -r regulation similar to the US Difference is the population recruitment, in China patients are active participants Dev of transposome non-viral methods, price
Alvin Luk, PhD CEO, Neuropath Therapeutics Monogenic rare disease with clear genomic target Increase of 30% in patient enrollment Regulatory reform approval is 60 days no delay
We’re excited to attend this week’s #WMIF2021 to talk all things cell and genetic therapies. Join our Chief of VCGT Bastiano Sanna tomorrow at 9:50am EDT for a discussion on the promise of cell therapies for type 1 diabetes. Register now! https://bit.ly/3otngYd
John Fish, Board Chair, Brigham Health, Chairman & CEO, Suffolk on the Novartis Main Stage to introduce the “Collaboration is Key: GCT R&D of the Future” fireside chat with Jay Bradner, MD, President, NIBR
Thomas VanCott, PhD, Chief Technology & Strategy Officer, Catalent Cell & Gene Therapy, says that time, improvements and scaling up in manufacturing will lead to allogeneic cell therapies. He recognizes that upfront costs are high, but will decrease in the long term #WMIF2021
Today Lisa Michaels, Editas CMO, will participate in the panel “Gene Editing – Achieving Therapeutic Mainstream” at the World Medical Innovation Forum #WMIF2021 in Boston. For those attending, be sure to tune in!
, views GCT as the ultimate precision medicine. AI, machine learning, and data science comprise one of the big disruptive forces that will address misdiagnosis, smooth out workflow, reduce cost and enhance recovery. #WMIF2021
CSO Laura Sepp-Lorenzino, PhD, in our “GCT Delivery | Perfecting the Technology” panel this afternoon! #WMIF2021
Quote Tweet
Intellia Therapeutics
@intelliatweets
· 6h
Today, Intellia CSO, @LauraSeppLore will be participating in the World Medical Innovation Forum’s panel on Gene and Cell Therapy Delivery, Perfecting the Technology. #WMIF2021 @MGBInnovation. Click here to learn more: https://worldmedicalinnovation.org
is back with us this afternoon sharing a First Look at “Versatile Polymer-Based Nanocarriers for Targeted Therapy and Immunomodulation.” #WMIF2021#GCT#geneandcelltherapy
VP of Clinical Development, Manasi Jaiman, during the “Diabetes | Grand Challenge” panel today. #WMIF2021
Quote Tweet
ViaCyte
@ViaCyte
· 8h
Join us at #WMIF2021 today! Our own Manasi Jaiman, VP, Clinical Development, will participate in the Diabetes: Grand Challenge panel to discuss regenerative medicine approaches for T1D utilizing stem-cell derived islet cell replacement therapy.
, discusses how GCT is in the embryonic phase. Bayer is ready to treat its first Parkinson’s patient, and is exploring therapeutic technologies to treat diseases with single gene defects #WMIF2021
Today Lisa Michaels, Editas CMO, will participate in the panel “Gene Editing – Achieving Therapeutic Mainstream” at the World Medical Innovation Forum #WMIF2021 in Boston. For those attending, be sure to tune in! @MassGenBrigham https://bit.ly/3hx1XTV #geneediting #biotechnology
to discuss the current state of CAR-T and its future prospects. These conversations are important for the development of potential #CART therapies. #WMIF2021
‘s #WMIF2021 — Thanks to the MGB team for facilitating a great discussion!
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· 7h
Overview of our #mRNA Vaccines panel today, highlighting improved manufacturing capabilities & potential for #personalizedmedicine. Thank you to Lindsey Baden @bwh_id & panelists Kate Bingham, SV Health Investors, Melissa Moore @moderna_tx and Ron Renaud @TranslateBio #WMIF2021
investigators are ready to give you an early preview of their #GCT research in the First Look sessions at #WMIF2021. Exciting opportunities to dramatically change how disease is treated!
Our “Rare and Ultra Rare Diseases | GCT Breaks Through” panelists on the role of family organizations & patient advocacy groups in moving us forward on the regulatory side – “It’s absolutely essential” #WMIF2021
Congratulations! Lydia Lynch PhD, Brigham and Women’s Hospital receives an Innovation Discovery Grant for “Generating Superior ‘Killers’ for Adoptive Cell Therapy in Cancer” at #WMIF2021.
Looking forward to the Diabetes Grand Challenge and how #GCT could help millions of people. Read about what facing this disease and how cell therapies could lessen the burden from Manasi Jaiman, MD, VP, Clinical Development
Today is Day 2 of the World Medical Innovation Forum. Which panel you are most excited to see today? Reply and let us know! #WMIF2021 https://worldmedicalinnovation.org/agenda/
Cell and gene therapies hold promising potential for rare disease, blood cancers, and viral diseases. Register for #WMIF21 to hear about our work to pioneer cutting-edge science across our pipeline to advance breakthroughs that change patients’ lives: https://on.pfizer.com/3f3CGzj
Congratulations! Peter Sage PhD, Brigham and Women’s Hospital receives an Innovation Discovery Grant for “Novel Strategies to Enhance Tfr Treatment of Autoimmunity” at #WMIF2021
Congratulations! Yulia Grishchuk PhD, Massachusetts General Hospital, receives an Innovation Discovery Grant for “AAV-Based Gene Replacement Therapy Improves Targeting and Clinical Outcomes in a Childhood CNS Disorder” at #WMIF2021
Congratulations! Jinjun Shi, PhD, Brigham and Women’s Hospital, receives an Innovation Discovery Grant for “Long-Lasting mRNA Therapy for Genetic Disorders” at #WMIF2021
Final thoughts from “Benign Blood Disorders” panelists on academic/industry collaboration — the pace of #innovation is incredibly exciting, and I think it will be even faster together. #WMIF2021
Congratulations! Benjamin Kleinstiver PhD, Massachusetts General Hospital, receives an Innovation Discovery Grant for “Towards a Permanent Genetic Cure for Spinal Muscular Atrophy” at #WMIF2021
FDA’s Peter Marks, at #WMIF2021, notes # of INDs for gene therapies was flat in 2020 vs. 2019. But the fact IND submissions didn’t decline, he said, is a sign of how strong the gene therapy field is, given pandemic’s disruption.
Melissa Moore/Moderna- one advantage of mRNA is ability to do multivalent vaccines she said. She said they are already testing multivalent covid vaccines in clinical trials & testing flu vaccines. #wmif2021
Kate Bingham/SV Health & former head of UK Vaccine Taskforce: they haven’t seen escape variants in UK yet she said. mRNA is quickest platform to address escape variants probably. Needle delivery w/ supply cold chain has been the challenge. Deploying 3 vaccines in UK #WMIF2021
, notes that the science behind gene cell therapies is converging with technological development. How therapies are brought to market is still the question, as there is no roadmap when reimagining medicine #WMIF2021
Melissa Moore/Moderna: clear advantage of mRNA vaccine is how quickly we can manufacture the vaccines. Downsides- need 2store at low temperatures & limited shelflife 4storage in refrigerator. I know that both companies [Moderna, Pfizer/BioNTech] r working 2change this #wmif2021
We’re committed to addressing the unmet needs of people living with rare genetic diseases. Our SVP, External Innovation and Strategic Alliances, Leah Bloom, discusses the promise #genetherapy holds for communities impacted by rare diseases during #WMIF2021.
Speed of vaccination is critical to prevent escape variants says Kate Bingham, SV Health Investors, UK, at #WMIF2021, exploring what’s next for the technology w panel led by Lindsey Baden MD,
for sharing this screen capture of the impressive lineup of #GCT “Disruptive Dozen” panelists at #WMIF2021
Quote Tweet
Aviva Lev-Ari
@AVIVA1950
· May 21
@MGBInnovation #WMIF Best Global event on Gene Cell Therapy covered in real time @AVIVA1950 @pharma_BI Disruptive Dozen technologies four are based on Gene Editing, AAV and non viral vector for drug delivery are included
PART 1: ALL THE TWEETS PRODUCED by @AVIVA1950 on May 19, 2021
Thomas VanCott, PhD Global Head of Product Dev, Gene & Cell Therapy, Catalent 2/3 autologous 1/3 allogeneic CAR-T high doses scale up is not done today logistics issues centralized vs decentralized allogeneic are health donors
Ropa Pike, Director, Enterprise Science & Partnerships, Thermo FIsher Scientific Centralized biopharma industry is moving to decentralized models site specific license
Rahul Singhvi, ScD CEO and Co-Founder, National Resilience, Inc. Investment company in platforms to be shared by start ups in CGT. Production cost of allogeneic: cost of quality 30% reagents 30% cell 30% Test is very expensive
Oladapo Yeku, MD, PhD Clinical Assistant in Medicine, MGH Outstanding moderator and most gifted panel on solid tumor success window of opportunities studies
Knut Niss, PhD CTO, Mustang Bio tumor hot start in 12 month clinical trial solid tumors Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance
Barbra Sasu, PhD CSO, Allogene T cell response at prostate cancer tumor specific cytokine tumor specific signals move from solid to metastatic cell type for easier infiltration
Jennifer Brogdon Executive Director, Head of Cell Therapy Research, Exploratory Immuno-Oncology, NIBR 2017 CAR-T first approval M&A and research collaborations TCR tumor specific antigens avoid tissue toxicity
Jay Short, PhD Chairman, CEO, Cofounder, BioAlta, Inc. Tumor type is not enough for R&D therapeutics other organs are involved in periphery difficult to penetrate solid tumors biologics activated in the tumor only, positive changes
Stefan Hendriks Global Head, Cell & Gene, Novartis Confirmation the effectiveness of CAR-T therapies, 1 year response to 5 years 26 months Patient not responding a lot to learn Patient after 8 months of chemo can be helped by CAR-T
Jeffrey Infante, MD , Oncology, Janssen R&D Direct effect with intra-tumor single injection with right payload Platform approach Prime with 1 and Boost with 2 – not yet experimented with Do not have the data at trial
Nino Chiocca, MD, PhD Neurosurgeon-in-Chief BWH, HMS Oncolytic therapy DID NOT WORK Pancreatic Cancer and Glioblastoma Intra-tumoral heterogeniety hinders success Oncolytic VIRUSES – “coldness” GADD-34 20,000 GBM 40,000 pancreatic
Loic Vincent, PhD Head of Oncology Drug Discovery Unit, Takeda Classification of Patients by prospective response type id UNKNOWN yet, population of patients require stratification
Loic Vincent, PhD Head of Oncology Drug Discovery Unit, Takeda R&D in collaboration with Academic Vaccine platform to explore different payload IV administration may not bring sufficient concentration to the tumor is administer IV
Nino Chiocca, MD, PhD Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH Harvey W. Cushing Professor of Neurosurgery, HMS Challenges of manufacturing at Amgen what are they?
David Reese, MD Executive Vice President, R&D , Amgen Inter lesion injection of agent vs systemic therapeutics cold tumors immune resistant render them immune susptible Oncolytic virus is a Mono therapy addressing the unknown
David Reese, MD Executive Vice President, Research and Development, Amgen Inter lesion injection of agent vs systemic therapeutics cold tumors immune resistant render them immune suseptible Oncolytic virus is a Mono therapy
Robert Coffin, PhD Chief R&D Officer, Replimune 2002 in UK promise in oncolytic therapy GNCSF Phase III melanoma 2015 M&A with Amgen oncolytic therapy remains non effecting on immune response data is key for commercialization
Ann Silk, MD Physician, Dana Farber-Brigham and Women’s Cancer Center, HMS Which person gets oncolytics virus if patient has immune supression due to other indications Safety of oncolytic virus greater than Systemic treatment
Marianne De Backer/Bayer on post M&A & company culture: They acquired AskBio & thought about how to preserve their freedom so they could continue to operate. Bayer decided to keep them independent & so they can operate at arm’s length. #wmif2021
Merit Cudkowicz, MD Chief of Neurology, MGH ALS – Man 1in 300, Women 1 in 400, next decade increase 7% 10% ALS is heredity 160 pharma in ALS space diagnosis is late 1/3 of people are not diagnosed active community for clinical trials @pharma_BI@AVIVA1950
Adam Koppel, MD, PhD Managing Director, Bain Capital Life Sciences What acquirers are looking for?? What is the next generation vs what is real where is the industry going?
Debby Baron, Worldwide Business Development, Pfizer Scalability and manufacturing regulatory conversations, clinical programs safety in parallel to planning getting drug to patients
Marianne De Backer, PhD Head of Strategy, BD & Licensing, Bayer Absolute Leadership: Gene editing, gene therapy, via acquisition and alliances Operating model of the acquired company discussed acquired continue independence
Sean Nolan Board Chairman, Encoded Therapeutics & Affinia Executive Chairman Jaguar Gene Therapy Istari Oncology As acquiree multiple M&A acquirer looks at integration and cultures companies Traditional integration vs acquisition
Debby Baron, Worldwide Business Development, Pfizer CGT is an important area Pfizer is active looking for innovators, advancing forward programs of innovation with the experience Pfizer has internally
Marianne De Backer, PhD Head of Strategy, Business Development & Licensing, and Member of the Executive Committee, Bayer Absolute Leadership in Gene editing, gene therapy, via acquisition and strategic alliance
Manny Simons, PhD CEO, Akouos Biology across species nerve ending in the cochlea engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones
Mathew Pletcher, PhD SVP, Head of Gene Therapy Research and Technical Operations, Astellas Continue to explore large animal guinea pig not the mice, not primates (ethical issues) for understanding immunogenicity and immune response
Mathew Pletcher, PhD SVP, Head of Gene Therapy Research and Technical Operations, Astellas Work with diseases poorly understood, collaborations needs example of existing: DMD is a great example explain dystrophin share placedo data
Rick Modi CEO, Affinia Therapeutics Speed R&D Speed better gene construct get to clinic with better design vs ASAP Data sharing clinical experience patients selection, vector selection, mitigation, patient type specific
Dave Lennon, PhD President, Novartis Gene Therapies big pharma therapeutics not one drug across Tx areas: cell, gene iodine therapy collective learning infrastructure development Acquisitions growth # applications for scaling
Rick Modi CEO, Affinia Therapeutics Copy, paste EDIT from product A to B novel vectors variant of vector coder optimization choice of indication is critical exploration on larger populations Speed to R&D to better gene construct get
Louise Rodino-Klapac, PhD EVP, Chief Scientific Officer, Sarepta Therapeutics AV based platform 15 years in development 1 disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years
Katherine High, MD President, Therapeutics, AskBio Three drugs approved in Europe in the CGT Regulatory Infrastructure CGT drug approval – as new class of therapeutics Participants investigators, regulators, patients i.e., MDM
Peter Marks, MD, PhD Director, Center for Biologics Evaluation and Research, FDA Immune modulators Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation 50% more staff
Peter Marks, MD, PhD Director, Center for Biologics Evaluation and Research, FDA Recover Work load for the pandemic Gene Therapies IND application remained flat Rare diseases urgency remains Guidance T-Cell therapy vs Regulation
Peter Marks, MD, PhD Director, Center for Biologics Evaluation and Research, FDA June 2020 belief that vaccine challenge manufacture scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work
Jim Holland CEO, http://Backcountry.com Parkinson patient Constraints by regulatory on participation in clinical trial wish to take Information dissemination is critical
Patricia Musolino, MD, PhD Co-Director Pediatric Stroke and Cerebrovascular Program What is the Power of One – the impact that a patient can have on their own destiny connecting with other participants in same trial can be beneficial
Barbara Lavery Chief Program Officer, ACGT Foundation Patient has the knowledge of the symptoms and recording all input needed for diagnosis by multiple clinicians Early application for CGT
Jack Hogan Patient, MEE Constraints by regulatory on participation in #clinicaltrials advance stage is approved participation Patients to determine the level of #risk they wish to take
Barbara Lavery Chief Program Officer, ACGT Foundation Advocacy agency beginning of work Global Genes educational content and out reach to access the information
Dave Lennon, PhD President, Novartis Gene Therapies Modality one time intervention, long duration of impart, reimbursement, ecosystem FDA works by indications and risks involved, Standards manufacturing payments over time payers
Dave Lennon, PhD President, Novartis Gene Therapies Promise of CGT realized, what part? #FDA role and interaction in CGT #Manufacturing aspects which is critical
Julian Harris, MD Partner, Deerfield Hope that CGT emerging, how therapies work, #neuro, #muscular, #ocular, #genetic diseases of #liver and of #heart revolution for the industry 900 #IND application 25 approvals #Economic driver
Luk Vandenberghe, PhD Grousbeck Family Chair, Gene Therapy, MEE Associate Professor, Ophthalmology, HMS #Pharmacology#Gene-Drug, Interface academic centers and industry many CGT drugs emerged in Academic center
Ravi Thadhani, MD CAO, Mass General Brigham Professor, Medicine and Faculty Dean, HMS Role of #academia special to spear head the #Polygenic#therapy – multiple #genes involved, #plug-play #delivery
The field of #genetherapy is growing. New therapies will come to market for rare and chronic diseases, and new therapies will drive scientific innovation and economic growth. #WMIF2021 (2/6)
In our First Look sessions clinicians/researchers from Harvard-affiliated hospitals highlight the potential of their research & new technologies. Next we’ll hear from Khalid Shah PhD, Vice Chair of Research
Tomorrow is Day 1 of #WMIF2021! Hear from the world-renowned CEOs, investors, clinicians and scientists bringing game-changing discoveries and insights to #GCT. Register to attend today: https://worldmedicalinnovation.org/register/
‘s World Medical Innovation Forum this week, discussing the future of #genetherapy. Here are our five predictions for where the industry is headed. #WMIF2021 (1/6)
explains at #WMIF2021 why the first FDA-approved gene therapy for inherited disease was for an inherited retinal degeneration, and what lessons have been learned from the success of that treatment.
Together with @BayerPharma, we are pleased to be part of #WMIF2021, organized by @MassGenBrigham. This year’s event focuses on the transformative potential of #cellandgene therapy (#GCT).
“We are more committed to our mission than ever before – laser-focused on realizing the transformative potential of #genetherapy for patients.” – Dave Lennon, President, during #WMIF2021
Patricia Musolino, MD PhD, Co-Director Pediatric Stroke and Cerebrovascular Program at MGH, discusses her work developing #genetherapy treatments for cerebral genetic vasculopathies #GCT #geneandcelltherapy #WMIF2021
chair Dr. Joan Miller moderates a panel on AAV gene therapy featuring director of Inherited Retinal Disorders Service and Ocular Genomics Institute, Dr. Eric Pierce.
Quote Tweet
Mass General Brigham Innovation
@MGBInnovation
· 23h
Our “AAV Success Studies | Retinal Dystrophy | Spinal Muscular Atrophy” panelists have taken the stage. #WMIF2021 @MassEyeAndEar @REGENXBIO @spark_tx @NovartisGene
We are proud sponsors of the Virtual World Medical Innovation Forum (#WMIF2021). This year’s program will focus on the impact of gene and cell therapy as a way to potentially advance quality patient care, reduce cost and improve outcomes. Learn more:
Jonathan Kraft introducing #wmif2021 session with Pfizer CSO & president of R&D Mikael Dolsten and MGH oncologist & chair of MGH Cancer Center Daniel Haber.
president Dave Lennon & Deerfield partner Julian Harris having a “fireside chat.” Dave/Novartis: sees gene therapy as driver for economy generating need for highly skilled workers Incl manufacturing
Kite Pharma CEO (Gilead subsidiary) Christi Shaw said there are 120 biopharma companies working on CAR-T cell therapy & they are continuing to look for new partnerships. She also mentioned logistical challenges currently getting to Israel & helping patients there. #WMIF2021
FDA’s Dir of Center for Biologics Evaluation & Research Peter Marks interviewed by Vicki Sato- chairwoman of Vir Biotechnology, ex Vertex president & ex Biogen VP Research. Around June ’20, started 2c progress in covid vaccines w/ enough candidates moving forward #WMIF2021 1/n
“Once you work on cell and gene therapy, its really hard to go back and work on anything else” says moderator Marcela Maus, MD PhD in our “CAR-T | Lessons Learned | What’s Next” panel #WMIF2021#GCT#geneandcelltherapy
Ex Merck president R&D Roger Perlmutter is now Eikon Therapeutics CEO & is on #WMIF2021 oncolytic virus in cancer panel w/Amgen EVP R&D David Reese, ex BioVex CTO (T-VEC inventor
, join our leaders for panels and presentations discussing what’s next for #genetherapy and the key trends shaping the industry as it evolves. #WMIF2021https://bit.ly/3eYYls4
Dolsten/Pfizer discussed covid vaccines and real world evidence study in Israel. Was sole provider of vaccines in Israel. 95%-98% efficacy replicated in real world. Well above 90% efficacy in asymptomatic disease. #wmif2021
ICYMI: An illustration depicting the “AAV Delivery” panel discussion about advances in the area of #AAVGeneTherapy delivery. Thank you to the panelists from
Casey Maguire PhD, Associate Professor of Neurology, at the podium to present his work developing improved #genetherapy vectors. #WMIF2021 “First Look: Enhanced Gene Delivery and Immunoevasion of AAV Vectors without Capsid Modification”
Casey Maguire PhD, Associate Professor of Neurology, at the podium to present his work developing improved #genetherapy vectors. #WMIF2021 “First Look: Enhanced Gene Delivery and Immunoevasion of AAV Vectors without Capsid Modification”
Mikael Dolsten, MD PhD, CSO & President, Worldwide Research, Development and Medical @pfizer takes the stage for a Fireside Chat, moderated by @MGHCancerCenter Daniel Haber, MD, PhD. “Pfizer’s Future in Cell and Gene Therapy” #WMIF2021
Dave Lennon/Novartis: manufacturing has been a roadblock for many cell & gene therapy companies. Expects to see more investments earlier. Engineering advances will unlock scale & address bigger & bigger patient populations. Oppty to ID patients early #WMIF2021
Marianne De Backer/Bayer on post M&A & company culture: They acquired AskBio & thought about how to preserve their freedom so they could continue to operate. Bayer decided to keep them independent & so they can operate at arm’s length. #wmif2021
Ken Custer/Eli Lilly-said they’re relatively new in cell & gene therapy. They invested in 1 of Sean Nolan’s (ex AveXis CEO) new companies,Jaguar Gene Therapy. Lilly’s legacy in neuroscience is noted & bought Prevail last yr. Clinical trial w/ Parkinson’s w/GBA1 mutation #wmif2021
, was the first in the U.S. to be approved for FDA gene therapy surgery. In 2018 he underwent therapy to treat retinitis pigmentosa by having a synthetic gene inserted into his retina. With improved eyesight he can now play sports #WMIF2021
The acquisition market in #GCT: looking for breakthroughs for patients, technologies for intractable diseases, manufacturing expertise, pioneering companies with deep experience — all for “the modality of the future”. M&A panel at #WMIF2021
Christi Shaw/Kite Pharma: Only 4 out of 10 patients eligible for CAR-T are being referred for CAR-T cell therapy by oncologists. The other 6 out of 10, referred to palliative care only. Consistency of manufacturing is also very important. #wmif2021 1/n
Marianne De Backer/Bayer on post M&A & company culture: They acquired AskBio & thought about how to preserve their freedom so they could continue to operate. Bayer decided to keep them independent & so they can operate at arm’s length. #wmif2021
2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021
The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy. Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.
About the World Medical Innovation Forum
Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation
Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next
Co-Chairs identify the key themes of the Forum – set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future. Moderator: Susan Hockfield, PhD
President Emerita and Professor of Neuroscience, MIT
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations Moderator: Julian Harris, MD
Partner, Deerfield
Promise of CGT realized, what part?
FDA role and interaction in CGT
Manufacturing aspects which is critical Speaker: Dave Lennon, PhD
President, Novartis Gene Therapies
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates. Moderator: Patricia Musolino, MD, PhD
Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
Assistant Professor of Neurology, HMS
What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial Speakers: Jack Hogan
Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical Barbara Lavery
Chief Program Officer, ACGT Foundation
Advocacy agency beginning of work Global Genes educational content and out reach to access the information
Patient has the knowledge of the symptoms and recording all input needed for diagnosis by multiple clinicians Early application for CGTDan Tesler
Clinical Trial Patient, BWH/DFCC
Experimental Drug clinical trial patient participation in clinical trial is very important to advance the state of scienceSarah Beth Thomas, RN
Professional Development Manager, BWH
Outcome is unknown, hope for good, support with resources all advocacy groups,
Process at FDA generalize from 1st entry to rules more generalizable Speaker: Peter Marks, MD, PhD
Director, Center for Biologics Evaluation and Research, FDA
Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work
Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance
Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation
big pharma has portfolios of therapeutics not one drug across Tx areas: cell, gene iodine therapy
collective learning infrastructure features manufacturing at scale early in development Acquisitions strategy for growth # applications for scaling Rick Modi
CEO, Affinia Therapeutics
Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP
Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific Louise Rodino-Klapac, PhD
AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years
Safety to clinic vs speed to clinic, difference of vectors to trust
Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.
The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.
Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
Lessons learned from these first-in-class approvals.
Challenges to broaden this modality to similar indications.
Reflections on safety signals in the clinical studies?
Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years
Laxterna success to be replicated platform, paradigms measurement visual improved
More science is needed to continue develop vectors reduce toxicity,
AAV can deliver different cargos reduce adverse events improve vectorsRon Philip
Chief Operating Officer, Spark Therapeutics
The first retinal gene therapy, voretigene neparvovec-rzyl (Luxturna, Spark Therapeutics), was approved by the FDA in 2017.Meredith Schultz, MD
Executive Medical Director, Lead TME, Novartis Gene Therapies
Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise
Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information
AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,
This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed? Moderators: Xandra Breakefield, PhD
Ataxia requires therapy targeting multiple organ with one therapy, brain, spinal cord, heart several IND, clinical trials in 2022Mathew Pletcher, PhD
SVP, Head of Gene Therapy Research and Technical Operations, Astellas
Work with diseases poorly understood, collaborations needs example of existing: DMD is a great example explain dystrophin share placedo data
Continue to explore large animal guinea pig not the mice, not primates (ethical issues) for understanding immunogenicity and immune response Manny Simons, PhD
CEO, Akouos
AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model
Biology across species nerve ending in the cochlea
engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones
The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up? Moderator: Adam Koppel, MD, PhD
Managing Director, Bain Capital Life Sciences
What acquirers are looking for??
What is the next generation vs what is real where is the industry going? Speakers:
Debby Baron,
Worldwide Business Development, Pfizer
CGT is an important area Pfizer is active looking for innovators, advancing forward programs of innovation with the experience Pfizer has internally
Scalability and manufacturing regulatory conversations, clinical programs safety in parallel to planning getting drug to patients
ALS – Man 1in 300, Women 1 in 400, next decade increase 7%
10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters
Cell therapy for ACTA2 Vasculopathy in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis
Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story. They will explore why and how Imlygic became approved and its path to commercialization. Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers. Why? Is there a limitation to what and which cancers can target? Is the mode of administration a problem?
No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why? Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?
The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses. It will also assess the extent pre-clinical development challenges have slowed the development of OVs. Moderator: Nino Chiocca, MD, PhD
Neurosurgeon-in-Chief and Chairman, Neurosurgery, BWH
Harvey W. Cushing Professor of Neurosurgery, HMS
Challenges of manufacturing at Amgen what are they? Speakers: Robert Coffin, PhD
Chief Research & Development Officer, Replimune
2002 in UK promise in oncolytic therapy GNCSF
Phase III melanoma 2015 M&A with Amgen
oncolytic therapy remains non effecting on immune response
data is key for commercialization
do not belief in systemic therapy achieve maximum immune response possible from a tumor by localized injection Roger Perlmutter, MD, PhD
Chairman, Merck & Co.
response rates systemic therapy like PD1, Keytruda, OPTIVA well tolerated combination of Oncolytic with systemic
Physician, Dana Farber-Brigham and Women’s Cancer Center
Assistant Professor of Medicine, HMS
Which person gets oncolytics virus if patient has immune suppression due to other indications
Safety of oncolytic virus greater than Systemic treatment
series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential
There are currently two oncolytic virus products on the market, one in the USA and one in China. As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II. Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:
What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?
Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
Why are these companies pursuing OVs while several others are taking a pass?
In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:
How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space? Would they bring any real advantages?
Systemic delivery Oncolytic Virus IV delivery woman in remission
Collaboration with Regeneron
Data collection: Imageable reporter secretable reporter, gene expression
Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors
Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:
Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:
How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
Executive Director, Head of Cell Therapy Research, Exploratory Immuno-Oncology, NIBR
2017 CAR-T first approval
M&A and research collaborations
TCR tumor specific antigens avoid tissue toxicity Knut Niss, PhD
CTO, Mustang Bio
tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor Barbra Sasu, PhD
CSO, Allogene
T cell response at prostate cancer
tumor specific
cytokine tumor specific signals move from solid to metastatic cell type for easier infiltration
Where we might go: safety autologous and allogeneic Jay Short, PhD
Chairman, CEO, Cofounder, BioAlta, Inc.
Tumor type is not enough for development of therapeutics other organs are involved in the periphery
difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside
The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027, groups of products are emerging. Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:
Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Global Head of Product Development, Gene & Cell Therapy, Catalent
2/3 autologous 1/3 allogeneic CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized allogeneic are health donors innovations in cell types in use improvements in manufacturing
China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer. Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents. It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.
In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment. In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.
The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.
This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market. Moderator: Min Wu, PhD
Managing Director, Fosun Health Fund
What are the area of CGT in China, regulatory similar to the US Speakers: Alvin Luk, PhD
CEO, Neuropath Therapeutics
Monogenic rare disease with clear genomic target
Increase of 30% in patient enrollment
Regulatory reform approval is 60 days no delayPin Wang, PhD
CSO, Jiangsu Simcere Pharmaceutical Co., Ltd.
Similar starting point in CGT as the rest of the World unlike a later starting point in other biologicalRichard Wang, PhD
CEO, Fosun Kite Biotechnology Co., Ltd
Possibilities to be creative and capitalize the new technologies for innovating drug
Support of the ecosystem by funding new companie allowing the industry to be developed in China
Autologous in patients differences cost challengeTian Xu, PhD
Vice President, Westlake University
ICH committee and Chinese FDA -r regulation similar to the US
Difference is the population recruitment, in China patients are active participants in skin disease
Active in development of transposome
Development of non-viral methods, CRISPR still in D and transposome
In China price of drugs regulatory are sensitive Shunfei Yan, PhD
The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?
How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
Will cost-of-goods be reduced as the industry matures?
How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna
How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy
45 days for Personalized cancer vaccine one per patient
Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market? Moderator: Nancy Berliner, MD
Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered
Potency and quality less quantity drug and greater potency
risk of delivery unwanted DNA, capsules are critical
analytics is critical regulator involvement in potency definition
Director, Center for Rare Neurological Diseases, MGH
Associate Professor, Neurology, HMS
Single gene disorder NGS enable diagnosis, DIagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology
crosswalk from bone marrow matter
New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers
The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.
Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression
Volume to have of-the-shelf inventory oxegenation in location lymphatic and vascularization conrol the whole process modular platform learning from others
Keep eyes open, waiting the Pandemic to end and enable working back on all the indications
Portfolio of MET, Mimi Emerging Therapies
Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis
Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy
Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic
Protein degradation organization constraint valuation by parties in a partnership
Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate
Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter
The Voice of Dr. Seidman – Her abstract is cited below
The ultimate opportunity presented by discovering the genetic basis of human disease is accurate prediction and disease prevention. To enable this achievement, genetic insights must enable the identification of at-risk
individuals prior to end-stage disease manifestations and strategies that delay or prevent clinical expression. Genetic cardiomyopathies provide a paradigm for fulfilling these opportunities. Hypertrophic cardiomyopathy (HCM) is characterized by left ventricular hypertrophy, diastolic dysfunction with normal or enhanced systolic performance and a unique histopathology: myocyte hypertrophy, disarray and fibrosis. Dilated cardiomyopathy (DCM) exhibits enlarged ventricular volumes with depressed systolic performance and nonspecific histopathology. Both HCM and DCM are prevalent clinical conditions that increase risk for arrhythmias, sudden death, and heart failure. Today treatments for HCM and DCM focus on symptoms, but none prevent disease progression. Human molecular genetic studies demonstrated that these pathologies often result from dominant mutations in genes that encode protein components of the sarcomere, the contractile unit in striated muscles. These data combined with the emergence of molecular strategies to specifically modulate gene expression provide unparalleled opportunities to silence or correct mutant genes and to boost healthy gene expression in patients with genetic HCM and DCM. Many challenges remain, but the active and vital efforts of physicians, researchers, and patients are poised to ensure success.
Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech
One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.
What is driving the interest in rare diseases?
What are the biggest barriers to making breakthroughs ‘routine and affordable?’
What is the role of retrospective and prospective natural history studies in rare disease? When does the expected value of retrospective disease history studies justify the cost?
Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases? How does this impact the collection of natural history data?
The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated. Moderator: Meg Tirrell
Senior Health and Science Reporter, CNBC
CGT becoming staple therapy what are the disruptors emerging Speakers: Lisa Dechamps
SVP & Chief Business Officer, Novartis Gene Therapies
Reimagine medicine with collaboration at MGH, MDM condition in children
The Science is there, sustainable processes and systems impact is transformational
Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect
Head, Pharmaceuticals Research & Development, Bayer AG
CGT – 2016 and in 2020 new leadership and capability
Disease Biology and therapeutics
Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular
During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions
GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements? Moderator:
EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG
CGT will bring treatment to cure, delivery of therapies
Be a Leader repair, regenerate, cure
Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products
Bayer strategy: build platform for use by four domains
Gener augmentation
Autologeneic therapy, analytics
Gene editing
Oncology Cell therapy tumor treatment: What kind of cells – the jury is out
Of 23 product launch at Bayer no prediction is possible some high some lows
Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities. Moderator: Natalie Artzi, PhD
Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.
Today’s panel is made up of pioneers who represent foundational aspects of gene editing. They will discuss the movement of the technology into the therapeutic mainstream.
Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
When to use what editing tool – pros and cons of traditional gene-editing v. base editing. Is prime editing the future? Specific use cases for epigenetic editing.
When we reach widespread clinical use – role of off-target editing – is the risk real? How will we mitigate? How practical is patient-specific off-target evaluation?
There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:
What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:
How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?
Will oligonucleotides improve as a class that will make them even more effective? Are further advancements in backbone chemistry anticipated, for example.
Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
Are small molecules a threat to oligonucleotide-based therapies?
Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides? Is there a place for multiple mechanism oligonucleotide medicines?
Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly? Moderator: Meredith Fisher, PhD
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated? Moderator: Roger Kitterman
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care. 11:35 AM – 11:45 AM
Computer connection to the iCloud of WordPress.com FROZE completely at 10:30AM EST and no file update was possible. COVERAGE OF MAY 21, 2021 IS RECORDED BELOW FOLLOWING THE AGENDA BY COPY AN DPASTE OF ALL THE TWEETS I PRODUCED ON MAY 21, 2021 8:30 AM – 8:55 AM
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly? Moderator: Meredith Fisher, PhD
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated? Moderator: Roger Kitterman
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care. 11:35 AM – 11:45 AM
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.Christine Seidman, MD
Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech
One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.
What is driving the interest in rare diseases?
What are the biggest barriers to making breakthroughs ‘routine and affordable?’
What is the role of retrospective and prospective natural history studies in rare disease? When does the expected value of retrospective disease history studies justify the cost?
Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases? How does this impact the collection of natural history data?
The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated. Moderator: Meg Tirrell
Senior Health and Science Reporter, CNBC
CGT becoming staple therapy what are the disruptors emerging Speakers: Lisa Dechamps
SVP & Chief Business Officer, Novartis Gene Therapies
Reimagine medicine with collaboration at MGH, MDM condition in children
The Science is there, sustainable processes and systems impact is transformational
Value based pricing, risk sharing Payers and Pharma for one time therapy with life span effect
Head, Pharmaceuticals Research & Development, Bayer AG
CGT – 2016 and in 2020 new leadership and capability
Disease Biology and therapeutics
Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular
During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions
GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements? Moderator:
EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG
CGT will bring treatment to cure, delivery of therapies
Be a Leader repair, regenerate, cure
Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products
Bayer strategy: build platform for use by four domains
Gener augmentation
Autologeneic therapy, analytics
Gene editing
Oncology Cell therapy tumor treatment: What kind of cells – the jury is out
Of 23 product launch at Bayer no prediction is possible some high some lows
Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities. Moderator: Natalie Artzi, PhD
Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.
Today’s panel is made up of pioneers who represent foundational aspects of gene editing. They will discuss the movement of the technology into the therapeutic mainstream.
Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
When to use what editing tool – pros and cons of traditional gene-editing v. base editing. Is prime editing the future? Specific use cases for epigenetic editing.
When we reach widespread clinical use – role of off-target editing – is the risk real? How will we mitigate? How practical is patient-specific off-target evaluation?
There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:
What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:
How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?
Will oligonucleotides improve as a class that will make them even more effective? Are further advancements in backbone chemistry anticipated, for example.
Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
Are small molecules a threat to oligonucleotide-based therapies?
Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides? Is there a place for multiple mechanism oligonucleotide medicines?
Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
Computer connection to the iCloud of WordPress.com FROZE completely at 10:30AM EST and no file update was possible. COVERAGE OF MAY 21, 2021 IS RECORDED BELOW FOLLOWING THE AGENDA BY COPY AN DPASTE OF ALL THE TWEETS I PRODUCED ON MAY 21, 2021
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly? Moderator: Meredith Fisher, PhD
Partner, Mass General Brigham Innovation Fund
Strategies, success what changes are needed in the drug discovery process Speakers:
Bring disruptive frontier as a platform with reliable delivery CGT double knock out disease cure all change efficiency and scope human centric vs mice centered right scale of data converted into therapeutics acceleratetion
Innovation in drugs 60% fails in trial because of Toxicology system of the future deal with big diseases
Moderna is an example in unlocking what is inside us Microbiome and beyond discover new drugs epigenetics
Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization How to systematically scaling up systematize the discovery and the production regulatory innovations
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
Director, Neuroregeneration Research Institute, McLean
Professor, Neurology and Neuroscience, MGH, HMS
Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all Translational medicine funding stem cells enormous opportunities
Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated? Moderator: Roger Kitterman
VP, Venture, Mass General Brigham
Saturation reached or more investment is coming in CGT
Pharmacologic agent in existing cause another disorders locomo-movement related
efficacy Autologous cell therapy transplantation approach program T cells into dopamine generating neurons greater than Allogeneic cell transplantation
Current market does not have delivery mechanism that a drug-delivery is the solution Trials would fail on DELIVERY
Immune suppressed patients during one year to avoid graft rejection Autologous approach of Parkinson patient genetically mutated reprogramed as dopamine generating neuron – unknowns are present
Circuitry restoration
Microenvironment disease ameliorate symptoms – education of patients on the treatment
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care. 11:35 AM – 11:45 AM
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.
ALL THE TWEETS PRODUCED ON MAY 21, 2021 INCLUDE THE FOLLOWING:
Bob Carter, MD, PhD Chairman, Department of Neurosurgery, MGH William and Elizabeth Sweet, Professor of Neurosurgery, HMS Neurogeneration REVERSAL or slowing down?
Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS efficacy Autologous cell therapy transplantation approach program T cells into dopamine genetating cells greater than Allogeneic cell transplantation
Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT Multi OMICS and academia originated innovations are the most attractive areas
Peter Kolchinsky, PhD Founder and Managing Partner, RA Capital Management Future proof for new comers disruptors Ex Vivo gene therapy to improve funding products what tool kit belongs to
Chairman, Department of Neurosurgery, MGH, Professor of Neurosurgery, HMS Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamine skin cell to become autologous cells reprogramed
Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH Off-th-shelf one time treatment becoming cure Intact tissue in a dish is fragile to maintain metabolism to become like semiconductors
Ole Isacson, MD, PhD Director, Neuroregeneration Research Institute, McLean Professor, Neurology and Neuroscience, MGH, HMS Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all
Erin Kimbrel, PhD Executive Director, Regenerative Medicine, Astellas In the ocular space immunogenecity regulatory communication use gene editing for immunogenecity Cas1 and Cas2 autologous cells
Nabiha Saklayen, PhD CEO and Co-Founder, Cellino scale production of autologous cells foundry using semiconductor process in building cassettes by optic physicists
Joe Burns, PhD VP, Head of Biology, Decibel Therapeutics Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation control by genomics
Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH first drug required to establish the process for that innovations design of animal studies not done before
Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization
David Berry, MD, PhD CEO, Valo Health GP, Flagship Pioneering Bring disruptive frontier platform reliable delivery CGT double knockout disease cure all change efficiency scope human centric vs mice centered right scale acceleration
Kush Parmar, MD, PhD Managing Partner, 5AM Ventures build it yourself, benefit for patients FIrst Look at MGB shows MEE innovation on inner ear worthy investment
Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Frustration with supply chain during the Pandemic, GMC anticipation in advance CGT rapidly prototype rethink and invest proactive investor .edu and Pharma
2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021
The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy.
Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.
About the World Medical Innovation Forum
Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation
Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next
Co-Chairs identify the key themes of the Forum – set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future.
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates.
Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
Assistant Professor of Neurology, HMS
What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial
Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical
Director, Center for Biologics Evaluation and Research, FDA
Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work
Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance
Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation
Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP
Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific
AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years
Safety to clinic vs speed to clinic, difference of vectors to trust
Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.
The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.
Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
Lessons learned from these first-in-class approvals.
Challenges to broaden this modality to similar indications.
Reflections on safety signals in the clinical studies?
Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years
Cell therapy vs transplant therapy no immunosuppression
Executive Medical Director, Lead TME, Novartis Gene Therapies
Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise
Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information
AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,
This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed?
AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model
Biology across species nerve ending in the cochlea
engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones
The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up?
ALS – Man 1in 300, Women 1 in 400, next decade increase 7%
10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters
Cell therapy for ACTA2 Vasculopathy in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis
Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story. They will explore why and how Imlygic became approved and its path to commercialization. Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers. Why? Is there a limitation to what and which cancers can target? Is the mode of administration a problem?
No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why? Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?
The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses. It will also assess the extent pre-clinical development challenges have slowed the development of OVs.
Physician, Dana Farber-Brigham and Women’s Cancer Center
Assistant Professor of Medicine, HMS
Which person gets oncolytics virus if patient has immune suppression due to other indications
Safety of oncolytic virus greater than Systemic treatment
series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential
There are currently two oncolytic virus products on the market, one in the USA and one in China. As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II. Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:
What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?
Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
Why are these companies pursuing OVs while several others are taking a pass?
In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:
How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space? Would they bring any real advantages?
Systemic delivery Oncolytic Virus IV delivery woman in remission
Collaboration with Regeneron
Data collection: Imageable reporter secretable reporter, gene expression
Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors
Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:
Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:
How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor
Tumor type is not enough for development of therapeutics other organs are involved in the periphery
difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside
The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027, groups of products are emerging. Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:
Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Global Head of Product Development, Gene & Cell Therapy, Catalent
2/3 autologous 1/3 allogeneic CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized allogeneic are health donors innovations in cell types in use improvements in manufacturing
China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer. Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents. It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.
In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment. In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.
The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.
This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market.
The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?
How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
Will cost-of-goods be reduced as the industry matures?
How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna
How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy
45 days for Personalized cancer vaccine one per patient
Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market?
Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered
Potency and quality less quantity drug and greater potency
risk of delivery unwanted DNA, capsules are critical
analytics is critical regulator involvement in potency definition
Director, Center for Rare Neurological Diseases, MGH
Associate Professor, Neurology, HMS
Single gene disorder NGS enable diagnosis, DIagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology
crosswalk from bone marrow matter
New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers
The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.
Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression
Volume to have of-the-shelf inventory oxegenation in location lymphatic and vascularization conrol the whole process modular platform learning from others
Keep eyes open, waiting the Pandemic to end and enable working back on all the indications
Portfolio of MET, Mimi Emerging Therapies
Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis
Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy
Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic
Protein degradation organization constraint valuation by parties in a partnership
Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate
Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter
2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021
The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy.
Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.
About the World Medical Innovation Forum
Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation
Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next
Co-Chairs identify the key themes of the Forum – set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future.
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates.
Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
Assistant Professor of Neurology, HMS
What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial
Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical
Director, Center for Biologics Evaluation and Research, FDA
Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work
Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance
Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation
Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP
Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific
AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years
Safety to clinic vs speed to clinic, difference of vectors to trust
Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.
The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.
Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
Lessons learned from these first-in-class approvals.
Challenges to broaden this modality to similar indications.
Reflections on safety signals in the clinical studies?
Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years
Cell therapy vs transplant therapy no immunosuppression
Executive Medical Director, Lead TME, Novartis Gene Therapies
Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise
Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information
AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,
This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed?
AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model
Biology across species nerve ending in the cochlea
engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones
The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up?
ALS – Man 1in 300, Women 1 in 400, next decade increase 7%
10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters
Cell therapy for ACTA2 Vasculopathy in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis
Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story. They will explore why and how Imlygic became approved and its path to commercialization. Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers. Why? Is there a limitation to what and which cancers can target? Is the mode of administration a problem?
No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why? Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?
The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses. It will also assess the extent pre-clinical development challenges have slowed the development of OVs.
Physician, Dana Farber-Brigham and Women’s Cancer Center
Assistant Professor of Medicine, HMS
Which person gets oncolytics virus if patient has immune suppression due to other indications
Safety of oncolytic virus greater than Systemic treatment
series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential
There are currently two oncolytic virus products on the market, one in the USA and one in China. As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II. Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:
What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?
Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
Why are these companies pursuing OVs while several others are taking a pass?
In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:
How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space? Would they bring any real advantages?
Systemic delivery Oncolytic Virus IV delivery woman in remission
Collaboration with Regeneron
Data collection: Imageable reporter secretable reporter, gene expression
Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors
Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:
Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:
How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor
Tumor type is not enough for development of therapeutics other organs are involved in the periphery
difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside
The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027, groups of products are emerging. Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:
Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Global Head of Product Development, Gene & Cell Therapy, Catalent
2/3 autologous 1/3 allogeneic CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized allogeneic are health donors innovations in cell types in use improvements in manufacturing
China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer. Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents. It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.
In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment. In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.
The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.
This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market.
The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?
How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
Will cost-of-goods be reduced as the industry matures?
How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Many years of mRNA pivoting for new diseases, DARPA, nucleic Acids global deployment of a manufacturing unit on site where the need arise Elan Musk funds new directions at Moderna
How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy
45 days for Personalized cancer vaccine one per patient
Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market?
Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered
Potency and quality less quantity drug and greater potency
risk of delivery unwanted DNA, capsules are critical
analytics is critical regulator involvement in potency definition
Director, Center for Rare Neurological Diseases, MGH
Associate Professor, Neurology, HMS
Single gene disorder NGS enable diagnosis, DIagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology
crosswalk from bone marrow matter
New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers
The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.
Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression
Volume to have of-the-shelf inventory oxegenation in location lymphatic and vascularization conrol the whole process modular platform learning from others
Keep eyes open, waiting the Pandemic to end and enable working back on all the indications
Portfolio of MET, Mimi Emerging Therapies
Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis
Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy
Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic
Protein degradation organization constraint valuation by parties in a partnership
Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate
Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter
Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech
One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.
What is driving the interest in rare diseases?
What are the biggest barriers to making breakthroughs ‘routine and affordable?’
What is the role of retrospective and prospective natural history studies in rare disease? When does the expected value of retrospective disease history studies justify the cost?
Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases? How does this impact the collection of natural history data?
The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated.
Head, Pharmaceuticals Research & Development, Bayer AG
CGT – 2016 and in 2020 new leadership and capability
Disease Biology and therapeutics
Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular
During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions
GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements?
EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG
CGT will bring treatment to cure, delivery of therapies
Be a Leader repair, regenerate, cure
Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products
Bayer strategy: build platform for use by four domains
Gener augmentation
Autologeneic therapy, analytics
Gene editing
Oncology Cell therapy tumor treatment: What kind of cells – the jury is out
Of 23 product launch at Bayer no prediction is possible some high some lows
Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities.
Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.
Today’s panel is made up of pioneers who represent foundational aspects of gene editing. They will discuss the movement of the technology into the therapeutic mainstream.
Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
When to use what editing tool – pros and cons of traditional gene-editing v. base editing. Is prime editing the future? Specific use cases for epigenetic editing.
When we reach widespread clinical use – role of off-target editing – is the risk real? How will we mitigate? How practical is patient-specific off-target evaluation?
There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:
What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:
How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?
Will oligonucleotides improve as a class that will make them even more effective? Are further advancements in backbone chemistry anticipated, for example.
Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
Are small molecules a threat to oligonucleotide-based therapies?
Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides? Is there a place for multiple mechanism oligonucleotide medicines?
Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
2021 Virtual World Medical Innovation Forum, Mass General Brigham, Gene and Cell Therapy, VIRTUAL May 19–21, 2021
The 2021 Virtual World Medical Innovation Forum will focus on the growing impact of gene and cell therapy.
Senior healthcare leaders from all over look to shape and debate the area of gene and cell therapy. Our shared belief: no matter the magnitude of change, responsible healthcare is centered on a shared commitment to collaborative innovation–industry, academia, and practitioners working together to improve patients’ lives.
About the World Medical Innovation Forum
Mass General Brigham is pleased to present the World Medical Innovation Forum (WMIF) virtual event Wednesday, May 19 – Friday, May 21. This interactive web event features expert discussions of gene and cell therapy (GCT) and its potential to change the future of medicine through its disease-treating and potentially curative properties. The agenda features 150+ executive speakers from the healthcare industry, venture, startups, life sciences manufacturing, consumer health and the front lines of care, including many Harvard Medical School-affiliated researchers and clinicians. The annual in-person Forum will resume live in Boston in 2022. The World Medical Innovation Forum is presented by Mass General Brigham Innovation, the global business development unit supporting the research requirements of 7,200 Harvard Medical School faculty and research hospitals including Massachusetts General, Brigham and Women’s, Massachusetts Eye and Ear, Spaulding Rehab and McLean Hospital. Follow us on Twitter: twitter.com/@MGBInnovation
Accelerating the Future of Medicine with Gene and Cell Therapy What Comes Next
Co-Chairs identify the key themes of the Forum – set the stage for top GCT opportunities, challenges, and where the field might take medicine in the future.
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
Hope that CGT emerging, how the therapies work, neuro, muscular, ocular, genetic diseases of liver and of heart revolution for the industry 900 IND application 25 approvals Economic driver Skilled works, VC disease. Modality one time intervention, long duration of impart, reimbursement, ecosystem to be built around CGT
FDA works by indications and risks involved, Standards and expectations for streamlining manufacturing, understanding of process and products
payments over time payers and Innovators relations
GCT development for rare diseases is driven by patient and patient-advocate communities. Understanding their needs and perspectives enables biomarker research, the development of value-driving clinical trial endpoints and successful clinical trials. Industry works with patient communities that help identify unmet needs and collaborate with researchers to conduct disease natural history studies that inform the development of biomarkers and trial endpoints. This panel includes patients who have received cutting-edge GCT therapy as well as caregivers and patient advocates.
Co-Director Pediatric Stroke and Cerebrovascular Program, MGH
Assistant Professor of Neurology, HMS
What is the Power of One – the impact that a patient can have on their own destiny by participating in Clinical Trials Contacting other participants in same trial can be beneficial
Parkinson patient Constraints by regulatory on participation in clinical trial advance stage is approved participation Patients to determine the level of risk they wish to take Information dissemination is critical
Director, Center for Biologics Evaluation and Research, FDA
Last Spring it became clear that something will work a vaccine by June 2020 belief that enough candidates the challenge manufacture enough and scaling up FDA did not predicted the efficacy of mRNA vaccine vs other approaches expected to work
Recover Work load for the pandemic will wean & clear, Gene Therapies IND application remained flat in the face of the pandemic Rare diseases urgency remains Consensus with industry advisory to get input gene therapy Guidance T-Cell therapy vs Regulation best thinking CGT evolve speedily flexible gained by Guidance
Immune modulators, Immunotherapy Genome editing can make use of viral vectors future technologies nanoparticles and liposome encapsulation
Copy, paste EDIT from product A to B novel vectors leverage knowledge varient of vector, coder optimization choice of indication is critical exploration on larger populations Speed to R&D and Speed to better gene construct get to clinic with better design vs ASAP
Data sharing clinical experience with vectors strategies patients selection, vector selection, mitigation, patient type specific
AAV based platform 15 years in development same disease indication vs more than one indication stereotype, analytics as hurdle 1st was 10 years 2nd was 3 years
Safety to clinic vs speed to clinic, difference of vectors to trust
Recent AAV gene therapy product approvals have catalyzed the field. This new class of therapies has shown the potential to bring transformative benefit to patients. With dozens of AAV treatments in clinical studies, all eyes are on the field to gauge its disruptive impact.
The panel assesses the largest challenges of the first two products, the lessons learned for the broader CGT field, and the extent to which they serve as a precedent to broaden the AAV modality.
Is AAV gene therapy restricted to genetically defined disorders, or will it be able to address common diseases in the near term?
Lessons learned from these first-in-class approvals.
Challenges to broaden this modality to similar indications.
Reflections on safety signals in the clinical studies?
Tissue types additional administrations, tech and science, address additional diseases, more science for photoreceptors a different tissue type underlying pathology novelties in last 10 years
Cell therapy vs transplant therapy no immunosuppression
Executive Medical Director, Lead TME, Novartis Gene Therapies
Impact of cell therapy beyond muscular dystrophy, translational medicine, each indication, each disease, each group of patients build platform unlock the promise
Monitoring for Safety signals real world evidence remote markers, home visits, clinical trial made safer, better communication of information
AAV a complex driver in Pharmacology durable, vector of choice, administer in vitro, gene editing tissue specificity, pharmacokinetics side effects and adverse events manufacturability site variation diversify portfolios,
This panel will address the advances in the area of AAV gene therapy delivery looking out the next five years. Questions that loom large are: How can biodistribution of AAV be improved? What solutions are in the wings to address immunogenicity of AAV? Will patients be able to receive systemic redosing of AAV-based gene therapies in the future? What technical advances are there for payload size? Will the cost of manufacturing ever become affordable for ultra-rare conditions? Will non-viral delivery completely supplant viral delivery within the next five years?What are the safety concerns and how will they be addressed?
AAV Therapy for the fluid of the inner ear, CGT for the ear vector accessible to surgeons translational work on the inner ear for gene therapy right animal model
Biology across species nerve ending in the cochlea
engineer out of the caspid, lowest dose possible, get desired effect by vector use, 2022 new milestones
The GCT M&A market is booming – many large pharmas have made at least one significant acquisition. How should we view the current GCT M&A market? What is its impact of the current M&A market on technology development? Are these M&A trends new are just another cycle? Has pharma strategy shifted and, if so, what does it mean for GCT companies? What does it mean for patients? What are the long-term prospects – can valuations hold up?
ALS – Man 1in 300, Women 1 in 400, next decade increase 7%
10% ALS is heredity 160 pharma in ALS space, diagnosis is late 1/3 of people are not diagnosed, active community for clinical trials Challenges: disease heterogeneity cases of 10 years late in diagnosis. Clinical Trials for ALS in Gene Therapy targeting ASO1 protein therapies FUS gene struck youngsters
Cell therapy for ACTA2 Vasculopathy in the brain and control the BP and stroke – smooth muscle intima proliferation. Viral vector deliver aiming to change platform to non-viral delivery rare disease , gene editing, other mutations of ACTA2 gene target other pathway for atherosclerosis
Oncolytic viruses represent a powerful new technology, but so far an FDA-approved oncolytic (Imlygic) has only occurred in one area – melanoma and that what is in 2015. This panel involves some of the protagonists of this early success story. They will explore why and how Imlygic became approved and its path to commercialization. Yet, no other cancer indications exist for Imlygic, unlike the expansion of FDA-approved indication for immune checkpoint inhibitors to multiple cancers. Why? Is there a limitation to what and which cancers can target? Is the mode of administration a problem?
No other oncolytic virus therapy has been approved since 2015. Where will the next success story come from and why? Will these therapies only be beneficial for skin cancers or other easily accessible cancers based on intratumoral delivery?
The panel will examine whether the preclinical models that have been developed for other cancer treatment modalities will be useful for oncolytic viruses. It will also assess the extent pre-clinical development challenges have slowed the development of OVs.
Physician, Dana Farber-Brigham and Women’s Cancer Center
Assistant Professor of Medicine, HMS
Which person gets oncolytics virus if patient has immune suppression due to other indications
Safety of oncolytic virus greater than Systemic treatment
series biopsies for injected and non injected tissue and compare Suspect of hot tumor and cold tumors likely to have sme response to agent unknown all potential
There are currently two oncolytic virus products on the market, one in the USA and one in China. As of late 2020, there were 86 clinical trials 60 of which were in phase I with just 2 in Phase III the rest in Phase I/II or Phase II. Although global sales of OVs are still in the ramp-up phase, some projections forecast OVs will be a $700 million market by 2026. This panel will address some of the major questions in this area:
What regulatory challenges will keep OVs from realizing their potential? Despite the promise of OVs for treating cancer only one has been approved in the US. Why has this been the case? Reasons such have viral tropism, viral species selection and delivery challenges have all been cited. However, these are also true of other modalities. Why then have oncolytic virus approaches not advanced faster and what are the primary challenges to be overcome?
Will these need to be combined with other agents to realize their full efficacy and how will that impact the market?
Why are these companies pursuing OVs while several others are taking a pass?
In 2020 there were a total of 60 phase I trials for Oncolytic Viruses. There are now dozens of companies pursuing some aspect of OV technology. This panel will address:
How are small companies equipped to address the challenges of developing OV therapies better than large pharma or biotech?
Will the success of COVID vaccines based on Adenovirus help the regulatory environment for small companies developing OV products in Europe and the USA?
Is there a place for non-viral delivery and other immunotherapy companies to engage in the OV space? Would they bring any real advantages?
Systemic delivery Oncolytic Virus IV delivery woman in remission
Collaboration with Regeneron
Data collection: Imageable reporter secretable reporter, gene expression
Field is intense systemic oncolytic delivery is exciting in mice and in human, response rates are encouraging combination immune stimulant, check inhibitors
Few areas of potential cancer therapy have had the attention and excitement of CAR-T. This panel of leading executives, developers, and clinician-scientists will explore the current state of CAR-T and its future prospects. Among the questions to be addressed are:
Is CAR-T still an industry priority – i.e. are new investments being made by large companies? Are new companies being financed? What are the trends?
What have we learned from first-generation products, what can we expect from CAR-T going forward in novel targets, combinations, armored CAR’s and allogeneic treatment adoption?
Early trials showed remarkable overall survival and progression-free survival. What has been observed regarding how enduring these responses are?
Most of the approvals to date have targeted CD19, and most recently BCMA. What are the most common forms of relapses that have been observed?
Is there a consensus about what comes after these CD19 and BCMA trials as to additional targets in liquid tumors? How have dual-targeted approaches fared?
The potential application of CAR-T in solid tumors will be a game-changer if it occurs. The panel explores the prospects of solid tumor success and what the barriers have been. Questions include:
How would industry and investor strategy for CAR-T and solid tumors be characterized? Has it changed in the last couple of years?
Does the lack of tumor antigen specificity in solid tumors mean that lessons from liquid tumor CAR-T constructs will not translate well and we have to start over?
Whether due to antigen heterogeneity, a hostile tumor micro-environment, or other factors are some specific solid tumors more attractive opportunities than others for CAR-T therapy development?
Given the many challenges that CAR-T faces in solid tumors, does the use of combination therapies from the start, for example, to mitigate TME effects, offer a more compelling opportunity.
tumor hot start in 12 month clinical trial solid tumors , theraties not ready yet. Combination therapy will be an experimental treatment long journey checkpoint inhibitors to be used in combination maintenance Lipid tumor
Tumor type is not enough for development of therapeutics other organs are involved in the periphery
difficult to penetrate solid tumors biologics activated in the tumor only, positive changes surrounding all charges, water molecules inside the tissue acidic environment target the cells inside the tumor and not outside
The modes of GCT manufacturing have the potential of fundamentally reordering long-established roles and pathways. While complexity goes up the distance from discovery to deployment shrinks. With the likelihood of a total market for cell therapies to be over $48 billion by 2027, groups of products are emerging. Stem cell therapies are projected to be $28 billion by 2027 and non-stem cell therapies such as CAR-T are projected be $20 billion by 2027. The manufacturing challenges for these two large buckets are very different. Within the CAR-T realm there are diverging trends of autologous and allogeneic therapies and the demands on manufacturing infrastructure are very different. Questions for the panelists are:
Help us all understand the different manufacturing challenges for cell therapies. What are the trade-offs among storage cost, batch size, line changes in terms of production cost and what is the current state of scaling naïve and stem cell therapy treatment vs engineered cell therapies?
For cell and gene therapy what is the cost of Quality Assurance/Quality Control vs. production and how do you think this will trend over time based on your perspective on learning curves today?
Will point of care production become a reality? How will that change product development strategy for pharma and venture investors? What would be the regulatory implications for such products?
How close are allogeneic CAR-T cell therapies? If successful what are the market implications of allogenic CAR-T? What are the cost implications and rewards for developing allogeneic cell therapy treatments?
Global Head of Product Development, Gene & Cell Therapy, Catalent
2/3 autologous 1/3 allogeneic CAR-T high doses and high populations scale up is not done today quality maintain required the timing logistics issues centralized vs decentralized allogeneic are health donors innovations in cell types in use improvements in manufacturing
China embraced gene and cell therapies early. The first China gene therapy clinical trial was in 1991. China approved the world’s first gene therapy product in 2003—Gendicine—an oncolytic adenovirus for the treatment of advanced head and neck cancer. Driven by broad national strategy, China has become a hotbed of GCT development, ranking second in the world with more than 1,000 clinical trials either conducted or underway and thousands of related patents. It has a booming GCT biotech sector, led by more than 45 local companies with growing IND pipelines.
In late 1990, a T cell-based immunotherapy, cytokine-induced killer (CIK) therapy became a popular modality in the clinic in China for tumor treatment. In early 2010, Chinese researchers started to carry out domestic CAR T trials inspired by several important reports suggested the great antitumor function of CAR T cells. Now, China became the country with the most registered CAR T trials, CAR T therapy is flourishing in China.
The Chinese GCT ecosystem has increasingly rich local innovation and growing complement of development and investment partnerships – and also many subtleties.
This panel, consisting of leaders from the China GCT corporate, investor, research and entrepreneurial communities, will consider strategic questions on the growth of the gene and cell therapy industry in China, areas of greatest strength, evolving regulatory framework, early successes and products expected to reach the US and world market.
The COVID vaccine race has propelled mRNA to the forefront of biomedicine. Long considered as a compelling modality for therapeutic gene transfer, the technology may have found its most impactful application as a vaccine platform. Given the transformative industrialization, the massive human experience, and the fast development that has taken place in this industry, where is the horizon? Does the success of the vaccine application, benefit or limit its use as a therapeutic for CGT?
How will the COVID success impact the rest of the industry both in therapeutic and prophylactic vaccines and broader mRNA lessons?
How will the COVID success impact the rest of the industry both on therapeutic and prophylactic vaccines and broader mRNA lessons?
Beyond from speed of development, what aspects make mRNA so well suited as a vaccine platform?
Will cost-of-goods be reduced as the industry matures?
How does mRNA technology seek to compete with AAV and other gene therapy approaches?
Many years of mRNA pivoting for new diseases, DARPA, Nucleic Acids global deployment of a manufacturing unit on site where the need arise. Elan Musk funds new directions at Moderna
How many mRNA can be put in one vaccine: Dose and tolerance to achieve efficacy
45 days for Personalized cancer vaccine one per patient
Hemophilia has been and remains a hallmark indication for the CGT. Given its well-defined biology, larger market, and limited need for gene transfer to provide therapeutic benefit, it has been at the forefront of clinical development for years, however, product approval remains elusive. What are the main hurdles to this success? Contrary to many indications that CGT pursues no therapeutic options are available to patients, hemophiliacs have an increasing number of highly efficacious treatment options. How does the competitive landscape impact this field differently than other CGT fields? With many different players pursuing a gene therapy option for hemophilia, what are the main differentiators? Gene therapy for hemophilia seems compelling for low and middle-income countries, given the cost of currently available treatments; does your company see opportunities in this market?
Safety concerns, high burden of treatment CGT has record of safety and risk/benefit adoption of Tx functional cure CGT is potent Tx relative small quantity of protein needs be delivered
Potency and quality less quantity drug and greater potency
risk of delivery unwanted DNA, capsules are critical
analytics is critical regulator involvement in potency definition
Director, Center for Rare Neurological Diseases, MGH
Associate Professor, Neurology, HMS
Single gene disorder NGS enable diagnosis, Diagnosis to Treatment How to know whar cell to target, make it available and scale up Address gap: missing components Biomarkers to cell types lipid chemistry cell animal biology
crosswalk from bone marrow matter
New gene discovered that causes neurodevelopment of stagnant genes Examining new Biology cell type specific biomarkers
The American Diabetes Association estimates 30 million Americans have diabetes and 1.5 million are diagnosed annually. GCT offers the prospect of long-sought treatment for this enormous cohort and their chronic requirements. The complexity of the disease and its management constitute a grand challenge and highlight both the potential of GCT and its current limitations.
Islet transplantation for type 1 diabetes has been attempted for decades. Problems like loss of transplanted islet cells due to autoimmunity and graft site factors have been difficult to address. Is there anything different on the horizon for gene and cell therapies to help this be successful?
How is the durability of response for gene or cell therapies for diabetes being addressed? For example, what would the profile of an acceptable (vs. optimal) cell therapy look like?
Advanced made, Patient of Type 1 Outer and Inner compartments of spheres (not capsule) no immune suppression continuous secretion of enzyme Insulin independence without immune suppression
Volume to have of-the-shelf inventory oxygenation in location lymphatic and vascularization control the whole process modular platform learning from others
Keep eyes open, waiting the Pandemic to end and enable working back on all the indications
Portfolio of MET, Mimi Emerging Therapies
Learning from the Pandemic – operationalize the practice science, R&D leaders, new collaboratives at NIH, FDA, Novartis
Pursue programs that will yield growth, tropic diseases with Gates Foundation, Rising Tide pods for access CGT within Novartis Partnership with UPenn in Cell Therapy
Cost to access to IP from Academia to a Biotech CRISPR accessing few translations to Clinic
Protein degradation organization constraint valuation by parties in a partnership
Novartis: nuclear protein lipid nuclear particles, tamplate for Biotech to collaborate
Game changing: 10% of the Portfolio, New frontiers human genetics in Ophthalmology, CAR-T, CRISPR, Gene Therapy Neurological and payloads of different matter
The Voice of Dr. Seidman – Her abstract is cited below
The ultimate opportunity presented by discovering the genetic basis of human disease is accurate prediction and disease prevention. To enable this achievement, genetic insights must enable the identification of at-risk
individuals prior to end-stage disease manifestations and strategies that delay or prevent clinical expression. Genetic cardiomyopathies provide a paradigm for fulfilling these opportunities. Hypertrophic cardiomyopathy (HCM) is characterized by left ventricular hypertrophy, diastolic dysfunction with normal or enhanced systolic performance and a unique histopathology: myocyte hypertrophy, disarray and fibrosis. Dilated cardiomyopathy (DCM) exhibits enlarged ventricular volumes with depressed systolic performance and nonspecific histopathology. Both HCM and DCM are prevalent clinical conditions that increase risk for arrhythmias, sudden death, and heart failure. Today treatments for HCM and DCM focus on symptoms, but none prevent disease progression. Human molecular genetic studies demonstrated that these pathologies often result from dominant mutations in genes that encode protein components of the sarcomere, the contractile unit in striated muscles. These data combined with the emergence of molecular strategies to specifically modulate gene expression provide unparalleled opportunities to silence or correct mutant genes and to boost healthy gene expression in patients with genetic HCM and DCM. Many challenges remain, but the active and vital efforts of physicians, researchers, and patients are poised to ensure success.
Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.
Today’s panel is made up of pioneers who represent foundational aspects of gene editing. They will discuss the movement of the technology into the therapeutic mainstream.
Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
When to use what editing tool – pros and cons of traditional gene-editing v. base editing. Is prime editing the future? Specific use cases for epigenetic editing.
When we reach widespread clinical use – role of off-target editing – is the risk real? How will we mitigate? How practical is patient-specific off-target evaluation?
There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:
What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:
How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?
Will oligonucleotides improve as a class that will make them even more effective? Are further advancements in backbone chemistry anticipated, for example.
Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
Are small molecules a threat to oligonucleotide-based therapies?
Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides? Is there a place for multiple mechanism oligonucleotide medicines?
Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.
Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech
One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.
What is driving the interest in rare diseases?
What are the biggest barriers to making breakthroughs ‘routine and affordable?’
What is the role of retrospective and prospective natural history studies in rare disease? When does the expected value of retrospective disease history studies justify the cost?
Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases? How does this impact the collection of natural history data?
The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated.
Head, Pharmaceuticals Research & Development, Bayer AG
CGT – 2016 and in 2020 new leadership and capability
Disease Biology and therapeutics
Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular
During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions
GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements?
EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG
CGT will bring treatment to cure, delivery of therapies
Be a Leader repair, regenerate, cure
Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products
Bayer strategy: build platform for use by four domains
Gener augmentation
Autologeneic therapy, analytics
Gene editing
Oncology Cell therapy tumor treatment: What kind of cells – the jury is out
Of 23 product launch at Bayer no prediction is possible some high some lows
Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities.
Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.
Today’s panel is made up of pioneers who represent foundational aspects of gene editing. They will discuss the movement of the technology into the therapeutic mainstream.
Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
When to use what editing tool – pros and cons of traditional gene-editing v. base editing. Is prime editing the future? Specific use cases for epigenetic editing.
When we reach widespread clinical use – role of off-target editing – is the risk real? How will we mitigate? How practical is patient-specific off-target evaluation?
There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:
What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:
How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?
Will oligonucleotides improve as a class that will make them even more effective? Are further advancements in backbone chemistry anticipated, for example.
Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
Are small molecules a threat to oligonucleotide-based therapies?
Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides? Is there a place for multiple mechanism oligonucleotide medicines?
Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?
Bring disruptive frontier as a platform with reliable delivery CGT double knock out disease cure all change efficiency and scope human centric vs mice centered right scale of data converted into therapeutics acceleratetion
Innovation in drugs 60% fails in trial because of Toxicology system of the future deal with big diseases
Moderna is an example in unlocking what is inside us Microbiome and beyond discover new drugs epigenetics
Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization How to systematically scaling up systematize the discovery and the production regulatory innovations
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
Director, Neuroregeneration Research Institute, McLean
Professor, Neurology and Neuroscience, MGH, HMS
Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all Translational medicine funding stem cells enormous opportunities
Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?
Pharmacologic agent in existing cause another disorders locomo-movement related
efficacy Autologous cell therapy transplantation approach program T cells into dopamine generating neurons greater than Allogeneic cell transplantation
Current market does not have delivery mechanism that a drug-delivery is the solution Trials would fail on DELIVERY
Immune suppressed patients during one year to avoid graft rejection Autologous approach of Parkinson patient genetically mutated reprogramed as dopamine generating neuron – unknowns are present
Circuitry restoration
Microenvironment disease ameliorate symptoms – education of patients on the treatment
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.
Cyprus Island, kidney disease by mutation causing MUC1 accumulation and death BRD4780 molecule that will clear the misfolding proteins from the kidney organoids: pleuripotent stem cells small molecule developed for applications in the other cell types in brain, eye, gene mutation build mechnism for therapy clinical models transition from Academia to biotech
One of the most innovative segments in all of healthcare is the development of GCT driven therapies for rare and ultra-rare diseases. Driven by a series of insights and tools and funded in part by disease focused foundations, philanthropists and abundant venture funding disease after disease is yielding to new GCT technology. These often become platforms to address more prevalent diseases. The goal of making these breakthroughs routine and affordable is challenged by a range of issues including clinical trial design and pricing.
What is driving the interest in rare diseases?
What are the biggest barriers to making breakthroughs ‘routine and affordable?’
What is the role of retrospective and prospective natural history studies in rare disease? When does the expected value of retrospective disease history studies justify the cost?
Related to the first question, what is the FDA expecting as far as controls in clinical trials for rare diseases? How does this impact the collection of natural history data?
The power of GCT to cure disease has the prospect of profoundly improving the lives of patients who respond. Planning for a disruption of this magnitude is complex and challenging as it will change care across the spectrum. Leading chief executives shares perspectives on how the industry will change and how this change should be anticipated.
Head, Pharmaceuticals Research & Development, Bayer AG
CGT – 2016 and in 2020 new leadership and capability
Disease Biology and therapeutics
Regenerative Medicine: CGT vs repair building pipeline in ophthalmology and cardiovascular
During Pandemic: Deliver Medicines like Moderna, Pfizer – collaborations between competitors with Government Bayer entered into Vaccines in 5 days, all processes had to change access innovations developed over decades for medical solutions
GCT represents a large and growing market for novel therapeutics that has several segments. These include Cardiovascular Disease, Cancer, Neurological Diseases, Infectious Disease, Ophthalmology, Benign Blood Disorders, and many others; Manufacturing and Supply Chain including CDMO’s and CMO’s; Stem Cells and Regenerative Medicine; Tools and Platforms (viral vectors, nano delivery, gene editing, etc.). Bayer’s pharma business participates in virtually all of these segments. How does a Company like Bayer approach the development of a portfolio in a space as large and as diverse as this one? How does Bayer approach the support of the production infrastructure with unique demands and significant differences from its historical requirements?
EVP, Pharmaceuticals, Head of Cell & Gene Therapy, Bayer AG
CGT will bring treatment to cure, delivery of therapies
Be a Leader repair, regenerate, cure
Technology and Science for CGT – building a portfolio vs single asset decision criteria development of IP market access patients access acceleration of new products
Bayer strategy: build platform for use by four domains
Gener augmentation
Autologeneic therapy, analytics
Gene editing
Oncology Cell therapy tumor treatment: What kind of cells – the jury is out
Of 23 product launch at Bayer no prediction is possible some high some lows
Gene delivery uses physical, chemical, or viral means to introduce genetic material into cells. As more genetically modified therapies move closer to the market, challenges involving safety, efficacy, and manufacturing have emerged. Optimizing lipidic and polymer nanoparticles and exosomal delivery is a short-term priority. This panel will examine how the short-term and long-term challenges are being tackled particularly for non-viral delivery modalities.
Gene editing was recognized by the Nobel Committee as “one of gene technology’s sharpest tools, having a revolutionary impact on life sciences.” Introduced in 2011, gene editing is used to modify DNA. It has applications across almost all categories of disease and is also being used in agriculture and public health.
Today’s panel is made up of pioneers who represent foundational aspects of gene editing. They will discuss the movement of the technology into the therapeutic mainstream.
Successes in gene editing – lessons learned from late-stage assets (sickle cell, ophthalmology)
When to use what editing tool – pros and cons of traditional gene-editing v. base editing. Is prime editing the future? Specific use cases for epigenetic editing.
When we reach widespread clinical use – role of off-target editing – is the risk real? How will we mitigate? How practical is patient-specific off-target evaluation?
There are several dozen companies working to develop gene or cell therapies for Sickle Cell Disease, Beta Thalassemia, and Fanconi Anemia. In some cases, there are enzyme replacement therapies that are deemed effective and safe. In other cases, the disease is only managed at best. This panel will address a number of questions that are particular to this class of genetic diseases:
What are the pros and cons of various strategies for treatment? There are AAV-based editing, non-viral delivery even oligonucleotide recruitment of endogenous editing/repair mechanisms. Which approaches are most appropriate for which disease?
How can companies increase the speed of recruitment for clinical trials when other treatments are available? What is the best approach to educate patients on a novel therapeutic?
How do we best address ethnic and socio-economic diversity to be more representative of the target patient population?
How long do we have to follow up with the patients from the scientific, patient’s community, and payer points of view? What are the current FDA and EMA guidelines for long-term follow-up?
Where are we with regards to surrogate endpoints and their application to clinically meaningful endpoints?
What are the emerging ethical dilemmas in pediatric gene therapy research? Are there challenges with informed consent and pediatric assent for trial participation?
Are there differences in reimbursement policies for these different blood disorders? Clearly durability of response is a big factor. Are there other considerations?
Oligonucleotide drugs have recently come into their own with approvals from companies such as Biogen, Alnylam, Novartis and others. This panel will address several questions:
How important is the delivery challenge for oligonucleotides? Are technological advancements emerging that will improve the delivery of oligonucleotides to the CNS or skeletal muscle after systemic administration?
Will oligonucleotides improve as a class that will make them even more effective? Are further advancements in backbone chemistry anticipated, for example.
Will oligonucleotide based therapies blaze trails for follow-on gene therapy products?
Are small molecules a threat to oligonucleotide-based therapies?
Beyond exon skipping and knock-down mechanisms, what other roles will oligonucleotide-based therapies take mechanistically — can genes be activating oligonucleotides? Is there a place for multiple mechanism oligonucleotide medicines?
Are there any advantages of RNAi-based oligonucleotides over ASOs, and if so for what use?
Computer connection to the iCloud of WordPress.com FROZE completely at 10:30AM EST and no file update was possible. COVERAGE OF MAY 21, 2021 IS RECORDED BELOW FOLLOWING THE AGENDA BY COPY AN DPASTE OF ALL THE TWEETS I PRODUCED ON MAY 21, 2021
What is occurring in the GCT venture capital segment? Which elements are seeing the most activity? Which areas have cooled? How is the investment market segmented between gene therapy, cell therapy and gene editing? What makes a hot GCT company? How long will the market stay frothy? Some review of demographics — # of investments, sizes, etc. Why is the market hot and how long do we expect it to stay that way? Rank the top 5 geographic markets for GCT company creation and investing? Are there academic centers that have been especially adept at accelerating GCT outcomes? Do the business models for the rapid development of coronavirus vaccine have any lessons for how GCT technology can be brought to market more quickly?
The promise of stem cells has been a highlight in the realm of regenerative medicine. Unfortunately, that promise remains largely in the future. Recent breakthroughs have accelerated these potential interventions in particular for treating neurological disease. Among the topics the panel will consider are:
Stem cell sourcing
Therapeutic indication growth
Genetic and other modification in cell production
Cell production to final product optimization and challenges
The dynamics of venture/PE investing and IPOs are fast evolving. What are the drivers – will the number of investors grow will the size of early rounds continue to grow? How is this reflected in GCT target areas, company design, and biotech overall? Do patients benefit from these trends? Is crossover investing a distinct class or a little of both? Why did it emerge and what are the characteristics of the players? Will SPACs play a role in the growth of the gene and cell therapy industry. What is the role of corporate investment arms eg NVS, Bayer, GV, etc. – has a category killer emerged? Are we nearing the limit of what the GCT market can absorb or will investment capital continue to grow unabated?
Nearly one hundred senior Mass General Brigham Harvard faculty contributed to the creation of this group of twelve GCT technologies that they believe will breakthrough in the next two years. The Disruptive Dozen identifies and ranks the GCT technologies that will be available on at least an experimental basis to have the chance of significantly improving health care.
The co-chairs convene to reflect on the insights shared over the three days. They will discuss what to expect at the in-person GCT focused May 2-4, 2022 World Medical Innovation Forum.
ALL THE TWEETS PRODUCED ON MAY 21, 2021 INCLUDE THE FOLLOWING:
Bob Carter, MD, PhD Chairman, Department of Neurosurgery, MGH William and Elizabeth Sweet, Professor of Neurosurgery, HMS Neurogeneration REVERSAL or slowing down?
Penelope Hallett, PhD NRL, McLean Assistant Professor Psychiatry, HMS efficacy Autologous cell therapy transplantation approach program T cells into dopamine genetating cells greater than Allogeneic cell transplantation
Roger Kitterman VP, Venture, Mass General Brigham Saturation reached or more investment is coming in CGT Multi OMICS and academia originated innovations are the most attractive areas
Peter Kolchinsky, PhD Founder and Managing Partner, RA Capital Management Future proof for new comers disruptors Ex Vivo gene therapy to improve funding products what tool kit belongs to
Chairman, Department of Neurosurgery, MGH, Professor of Neurosurgery, HMS Cell therapy for Parkinson to replace dopamine producing cells lost ability to produce dopamine skin cell to become autologous cells reprogramed
Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH Off-th-shelf one time treatment becoming cure Intact tissue in a dish is fragile to maintain metabolism to become like semiconductors
Ole Isacson, MD, PhD Director, Neuroregeneration Research Institute, McLean Professor, Neurology and Neuroscience, MGH, HMS Opportunities in the next generation of the tactical level Welcome the oprimism and energy level of all
Erin Kimbrel, PhD Executive Director, Regenerative Medicine, Astellas In the ocular space immunogenecity regulatory communication use gene editing for immunogenecity Cas1 and Cas2 autologous cells
Nabiha Saklayen, PhD CEO and Co-Founder, Cellino scale production of autologous cells foundry using semiconductor process in building cassettes by optic physicists
Joe Burns, PhD VP, Head of Biology, Decibel Therapeutics Ear inside the scall compartments and receptors responsible for hearing highly differentiated tall ask to identify cell for anticipated differentiation control by genomics
Kapil Bharti, PhD Senior Investigator, Ocular and Stem Cell Translational Research Section, NIH first drug required to establish the process for that innovations design of animal studies not done before
Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Manufacturing change is not a new clinical trial FDA need to be presented with new rethinking for big innovations Drug pricing cheaper requires systematization
David Berry, MD, PhD CEO, Valo Health GP, Flagship Pioneering Bring disruptive frontier platform reliable delivery CGT double knockout disease cure all change efficiency scope human centric vs mice centered right scale acceleration
Kush Parmar, MD, PhD Managing Partner, 5AM Ventures build it yourself, benefit for patients FIrst Look at MGB shows MEE innovation on inner ear worthy investment
Robert Nelsen Managing Director, Co-founder, ARCH Venture Partners Frustration with supply chain during the Pandemic, GMC anticipation in advance CGT rapidly prototype rethink and invest proactive investor .edu and Pharma
Inhibitory CD161 receptor recognized as a potential immunotherapy target in glioma-infiltrating T cells by single-cell analysis
Reporter: Dr. Premalata Pati, Ph.D., Postdoc
Brain tumors, especially the diffused Gliomas are of the most devastating forms of cancer and have so-far been resistant to immunotherapy. It is comprehended that T cells can penetrate the glioma cells, but it still remains unknown why infiltrating cells miscarry to mount a resistant reaction or stop the tumor development.
Gliomas are brain tumors that begin from neuroglial begetter cells. The conventional therapeutic methods including, surgery, chemotherapy, and radiotherapy, have accomplished restricted changes inside glioma patients. Immunotherapy, a compliance in cancer treatment, has introduced a promising strategy with the capacity to penetrate the blood-brain barrier. This has been recognized since the spearheading revelation of lymphatics within the central nervous system. Glioma is not generally carcinogenic. As observed in a number of cases, the tumor cells viably reproduce and assault the adjoining tissues, by and large, gliomas are malignant in nature and tend to metastasize. There are four grades in glioma, and each grade has distinctive cell features and different treatment strategies. Glioblastoma is a grade IV glioma, which is the crucial aggravated form. This infers that all glioblastomas are gliomas, however, not all gliomas are glioblastomas.
Decades of investigations on infiltrating gliomas still take off vital questions with respect to the etiology, cellular lineage, and function of various cell types inside glial malignancies. In spite of the available treatment options such as surgical resection, radiotherapy, and chemotherapy, the average survival rate for high-grade glioma patients remains 1–3 years (1).
A recent in vitro study performed by the researchers of Dana-Farber Cancer Institute, Massachusetts General Hospital, and the Broad Institute of MIT and Harvard, USA, has recognized that CD161 is identified as a potential new target for immunotherapy of malignant brain tumors. The scientific team depicted their work in the Cell Journal, in a paper entitled, “Inhibitory CD161 receptor recognized in glioma-infiltrating T cells by single-cell analysis.” on 15th February 2021.
To further expand their research and findings, Dr. Kai Wucherpfennig, MD, PhD, Chief of the Center for Cancer Immunotherapy, at Dana-Farber stated that their research is additionally important in a number of other major human cancer types such as
melanoma,
lung,
colon, and
liver cancer.
Dr. Wucherpfennig has praised the other authors of the report Mario Suva, MD, PhD, of Massachusetts Common Clinic; Aviv Regev, PhD, of the Klarman Cell Observatory at Broad Institute of MIT and Harvard, and David Reardon, MD, clinical executive of the Center for Neuro-Oncology at Dana-Farber.
Hence, this new study elaborates the effectiveness of the potential effectors of anti-tumor immunity in subsets of T cells that co-express cytotoxic programs and several natural killer (NK) cell genes.
The Study-
IMAGE SOURCE: Experimental Strategy (Mathewson et al., 2021)
The group utilized single-cell RNA sequencing (RNA-seq) to mull over gene expression and the clonal picture of tumor-infiltrating T cells. It involved the participation of 31 patients suffering from diffused gliomas and glioblastoma. Their work illustrated that the ligand molecule CLEC2D activates CD161, which is an immune cell surface receptor that restrains the development of cancer combating activity of immune T cells and tumor cells in the brain. The study reveals that the activation of CD161 weakens the T cell response against tumor cells.
Based on the study, the facts suggest that the analysis of clonally expanded tumor-infiltrating T cells further identifies the NK gene KLRB1 that codes for CD161 as a candidate inhibitory receptor. This was followed by the use of
CRISPR/Cas9 gene-editing technology to inactivate the KLRB1 gene in T cells and showed that CD161 inhibits the tumor cell-killing function of T cells. Accordingly,
genetic inactivation of KLRB1 or
antibody-mediated CD161 blockade
enhances T cell-mediated killing of glioma cells in vitro and their anti-tumor function in vivo. KLRB1 and its associated transcriptional program are also expressed by substantial T cell populations in other forms of human cancers. The work provides an atlas of T cells in gliomas and highlights CD161 and other NK cell receptors as immune checkpoint targets.
Further, it has been identified that many cancer patients are being treated with immunotherapy drugs that disable their “immune checkpoints” and their molecular brakes are exploited by the cancer cells to suppress the body’s defensive response induced by T cells against tumors. Disabling these checkpoints lead the immune system to attack the cancer cells. One of the most frequently targeted checkpoints is PD-1. However, recent trials of drugs that target PD-1 in glioblastomas have failed to benefit the patients.
In the current study, the researchers found that fewer T cells from gliomas contained PD-1 than CD161. As a result, they said, “CD161 may represent an attractive target, as it is a cell surface molecule expressed by both CD8 and CD4 T cell subsets [the two types of T cells engaged in response against tumor cells] and a larger fraction of T cells express CD161 than the PD-1 protein.”
However, potential side effects of antibody-mediated blockade of the CLEC2D-CD161 pathway remain unknown and will need to be examined in a non-human primate model. The group hopes to use this finding in their future work by
utilizing their outline by expression of KLRB1 gene in tumor-infiltrating T cells in diffuse gliomas to make a remarkable contribution in therapeutics related to immunosuppression in brain tumors along with four other common human cancers ( Viz. melanoma, non-small cell lung cancer (NSCLC), hepatocellular carcinoma, and colorectal cancer) and how this may be manipulated for prevalent survival of the patients.
References
(1) Anders I. Persson, QiWen Fan, Joanna J. Phillips, William A. Weiss, 39 – Glioma, Editor(s): Sid Gilman, Neurobiology of Disease, Academic Press, 2007, Pages 433-444, ISBN 9780120885923, https://doi.org/10.1016/B978-012088592-3/50041-4.
4.1.3 Single-cell Genomics: Directions in Computational and Systems Biology – Contributions of Prof. Aviv Regev @Broad Institute of MIT and Harvard, Cochair, the Human Cell Atlas Organizing Committee with Sarah Teichmann of the Wellcome Trust Sanger Institute
4.1.7 Norwich Single-Cell Symposium 2019, Earlham Institute, single-cell genomics technologies and their application in microbial, plant, animal and human health and disease, October 16-17, 2019, 10AM-5PM
Positron Emission Tomography (PET) and Near-Infrared Fluorescence Imaging: Noninvasive Imaging of Cancer Stem Cells (CSCs) monitoring of AC133+ glioblastoma in subcutaneous and intracerebral xenograft tumors
Dysregulation of ncRNAs in association with Neurodegenerative Disorders
Curator: Amandeep Kaur
Research over the years has added evidences to the hypothesis of “RNA world” which explains the evolution of DNA and protein from a simple RNA molecule. Our understanding of RNA biology has dramatically changed over the last 50 years and rendered the scientists with the conclusion that apart from coding for protein synthesis, RNA also plays an important role in regulation of gene expression.
The universe of non-coding RNAs (ncRNAs) is transcending the margins of preconception and altered the traditional thought that the coding RNAs or messenger RNAs (mRNAs) are more prevalent in our cells. Research on the potential use of ncRNAs in therapeutic relevance increased greatly after the discovery of RNA interference (RNAi) and provided important insights into our further understanding of etiology of complex disorders.
Latest research on neurodegenerative disorders has shown the perturbed expression of ncRNAs which provides the functional association between neurodegeneration and ncRNAs dysfunction. Due to the diversity of functions and abundance of ncRNAs, they are classified into Housekeeping RNAs and Regulatory ncRNAs.
The best known classes of ncRNAs are the microRNAs (miRNAs) which are extensively studied and are of research focus. miRNAs are present in both intronic and exonic regions of matured RNA (mRNA) and are crucial for development of CNS. The reduction of Dicer-1, a miRNA biogenesis-related protein affects neural development and the elimination of Dicer in specifically dopaminergic neurons causes progressive degeneration of these neuronal cells in striatum of mice.
A new class of regulatory ncRNAs, tRNAs-derived fragments (tRFs) is superabundantly present in brain cells. tRFs are considered as risk factors in conditions of neural degeneration because of accumulation with aging. tRFs have heterogenous functions with regulation of gene expression at multiple layers including regulation of mRNA processing and translation, inducing the activity of silencing of target genes, controlling cell growth and differentiation processes.
The existence of long non-coding RNAs (lncRNAs) was comfirmed by the ENCODE project. Numerous studies reported that approximately 40% of lncRNAs are involved in gene expression, imprinting and pluripotency regulation in the CNS. lncRNA H19 is of paramount significance in neural viability and contribute in epilepsy condition by activating glial cells. Other lncRNAs are highly bountiful in neurons including Evf2 and MALAT1 which play important function in regulating neural differentiation and synapse formation and development of dendritic cells respectively.
Recently, a review article in Nature mentioned about the complex mechanisms of ncRNAs contributing to neurodegenerative conditions. The ncRNA-mediated mechanisms of regulation are as follows:
Epigenetic regulation: Various lncRNAs such as BDNF-AS, TUG1, MEG3, NEAT1 and TUNA are differentially expressed in brain tissue and act as epigenetic regulators.
RNAi: RNA interference includes post-transcriptional repression by small-interfering RNAs (siRNAs) and binding of miRNAs to target genes. In a wide spectrum of neurodegenerative diseases such as Alzheimer’s disease, Parkinson disease, Huntington’s disease, Amyotrophic lateral sclerosis, Fragile X syndrome, Frontotemporal dementia, and Spinocerebellar ataxia, have shown perturbed expression of miRNA.
Alternative splicing: Variation in splicing of transcripts of ncRNAs has shown adverse affects in neuropathology of degenerative diseases.
mRNA stability: The stability of mRNA may be affected by RNA-RNA duplex formation which leads to the degradation of sense mRNA or blocking the access to proteins involved in RNA turnover and modify the progression of neurodegenerative disorders.
Translational regulation: Numerous ncRNAs including BC200 directly control the translational process of transcripts of mRNAs and effect human brain of Alzheimer’s disease.
Molecular decoys: Non-coding RNAs (ncRNAs) dilute the expression of other RNAs by molecular trapping, also known as competing endogenous RNAs (ceRNAs) which hinder the normal functioning of RNAs. The ceRNAs proportion must be equivalent to the number of target miRNAs that can be sequestered by each ncRNAs in order to induce consequential de-repression of the target molecules.
The unknown functions of numerous annotated ncRNAs may explain the underlying complexity in neurodegenerative disorders. The profiling of ncRNAs of patients suffering from neurodevelopmental and neurodegenerative conditions are required to outline the changes in ncRNAs and their role in specific regions of brain and cells. Analysis of Large-scale gene expression and functional studies of ncRNAs may contribute to our understanding of these diseases and their remarkable connections. Therefore, targeting ncRNAs may provide effective therapeutic perspective for the treatment of neurodegenerative diseases.
Nanoparticles can turn off genes in bone marrow cells
Reporter : Irina Robu, PhD
MIT engineers developed an alternative to turn off specific genes which play a vital role in producing blood cells of the bone marrow using specialized nanoparticles. These nanoparticles can be made-to-order to treat heart disease or increase the yield of stem cells in patience who need stem cell transplants. The particles are coated with lipids that help stabilize them, and they can target organs such as the lungs, heart, and spleen, depending on the particles’ composition and molecular weight. This genetic therapy, also known as RNA interference is difficult to target organs other than the liver, where most of the nanoparticles tend to collect.
RNA interference is an approach that could theoretically be used to treat a variety of diseases by delivering short strands of RNA that block specific genes from being turned on in a cell. Yet, the main obstacle to this kind of therapy has been delivering it to the right part of the body. When injected into the bloodstream, nanoparticles carrying RNA tend to accrue in the liver, which various biotech companies have taken advantage of to develop new experimental treatments for liver disease.
In their recent study, scientists set out to adapt the nanoparticles so that they could reach the bone marrow which contains stem cells that produce different types of blood cells. Stimulating the process , they could enhance the yield of hematopoietic stem cells for stem cell transplantation and they created variants that have different arrangements of surface coating, polyethylene glycol. They were able to test 15 particles and determined one that was able to avoid being caught in the liver or the lungs, and that could effectively accumulate in endothelial cells of the bone marrow. They also showed that RNA carried by this particle could reduce the expression of a target gene by up to 80 percent.
The scientists then tested this approach with two genes. The first gene, SDF1 is a molecule that normally prevents hematopoietic stem cells from leaving the bone marrow. They realized that turning off the SDF1 gene could have the same effect as the drugs that are being used to induce hematopoietic stem cell release in patients who need undergo radiation treatments for blood cancers. These stem cells are later transplanted to repopulate the patient’s blood cells. By knocking down SDF1, they could boost the release of hematopoietic cells fivefold which is comparable to the levels achieved by the drugs that are now used to enhance stem cell release.
The second gene researchers use is MCP1, a molecule that plays a key role in heart disease. They realized that when MCP1 is released by bone marrow cells after a heart attack, it stimulates a flood of immune cells to leave the bone marrow and travel to the heart. Researchers realize that by delivering RNA that targets MCP1 reduced the number of immune cells that went to the heart after a heart attack.
Using these new particles, researchers hypothesized that they could further develop treatments for heart disease and other conditions.
RNA from the SARS-CoV-2 virus taking over the cells it infects: Virulence – Pathogen’s ability to infect a Resistant Host: The Imbalance between Controlling Virus Replication versus Activation of the Adaptive Immune Response
Curator: Aviva Lev-Ari, PhD, RN – I added colors and bold face
UPDATED on 9/8/2020
What bats can teach us about developing immunity to Covid-19 | Free to read
Another duality and paradox in the Treatment of COVID-19 Patients in ICUs was expressed by Mike Yoffe, MD, PhD, David H. Koch Professor of Biology and Biological Engineering, Massachusetts Institute of Technology. Dr. Yaffe has a joint appointment in Acute Care Surgery, Trauma, and Surgical Critical Care, and in Surgical Oncology @BIDMC
on 6/29 at SOLUTIONS with/in/sight at Koch Institute @MIT
How Are Cancer Researchers Fighting COVID-19? (Part II)”Jun 29, 2020 11:30 AM EST
In COVID-19 patients: two life threatening conditions are seen in ICUs:
Blood Clotting – Hypercoagulability or Thrombophilia
Cytokine Storm – immuno-inflammatory response
The coexistence of 1 and 2 – HINDERS the ability to use effectively tPA as an anti-clotting agent while the cytokine storm is present.
Mike Yoffe’s related domain of expertise:
Signaling pathways and networks that control cytokine responses and inflammation
Misregulation of cytokine feedback loops, along with inappropriate activation of the blood clotting cascade causes dysregulation of cell signaling pathways in innate immune cells (neutrophils and macrophages), resulting in tissue damage and multiple organ failure following trauma or sepsis. Our research is focused on understanding the role of the p38-MK2 pathway in cytokine control and innate immune function, and on cross-talk between cytokines, clotting factors, and neutrophil NADPH oxidase-derived ROS in tissue damage, coagulopathy, and inflammation, using biochemistry, cell biology, and mouse knock-out/knock-in models. We recently discovered a particularly important link between abnormal blood clotting and the complement pathway cytokine C5a which causes excessive production of extracellular ROS and organ damage by neutrophils after traumatic injury.
SARS-CoV-2 infection induces low IFN-I and -III levels with a moderate ISG response
Strong chemokine expression is consistent across in vitro, ex vivo, and in vivo models
Low innate antiviral defenses and high pro-inflammatory cues contribute to COVID-19
Summary
Viral pandemics, such as the one caused by SARS-CoV-2, pose an imminent threat to humanity. Because of its recent emergence, there is a paucity of information regarding viral behavior and host response following SARS-CoV-2 infection. Here we offer an in-depth analysis of the transcriptional response to SARS-CoV-2 compared with other respiratory viruses. Cell and animal models of SARS-CoV-2 infection, in addition to transcriptional and serum profiling of COVID-19 patients, consistently revealed a unique and inappropriate inflammatory response. This response is defined by low levels of type I and III interferons juxtaposed to elevated chemokines and high expression of IL-6. We propose that reduced innate antiviral defenses coupled with exuberant inflammatory cytokine production are the defining and driving features of COVID-19.
Defining the Transcriptional Response to SARS-CoV-2 Relative to Other Respiratory Viruses
To compare the transcriptional response of SARS-CoV-2 with other respiratory viruses, including MERS-CoV, SARS-CoV-1, human parainfluenza virus 3 (HPIV3), respiratory syncytial virus (RSV), and IAV, we first chose to focus on infection in a variety of respiratory cell lines (Figure 1). To this end, we collected poly(A) RNA from infected cells and performed RNA sequencing (RNA-seq) to estimate viral load. These data show that virus infection levels ranged from 0.1% to more than 50% of total RNA reads (Figure 1A).
Discussion
In the present study, we focus on defining the host response to SARS-CoV-2 and other human respiratory viruses in cell lines, primary cell cultures, ferrets, and COVID-19 patients. In general, our data show that the overall transcriptional footprint of SARS-CoV-2 infection was distinct in comparison with other highly pathogenic coronaviruses and common respiratory viruses such as IAV, HPIV3, and RSV. It is noteworthy that, despite a reduced IFN-I and -III response to SARS-CoV-2, we observed a consistent chemokine signature. One exception to this observation is the response to high-MOI infection in A549-ACE2 and Calu-3 cells, where replication was robust and an IFN-I and -III signature could be observed. In both of these examples, cells were infected at a rate to theoretically deliver two functional virions per cell in addition to any defective interfering particles within the virus stock that were not accounted for by plaque assays. Under these conditions, the threshold for PAMP may be achieved prior to the ability of the virus to evade detection through production of a viral antagonist. Alternatively, addition of multiple genomes to a single cell may disrupt the stoichiometry of viral components, which, in turn, may itself generate PAMPs that would not form otherwise. These ideas are supported by the fact that, at a low-MOI infection in A549-ACE2 cells, high levels of replication could also be achieved, but in the absence of IFN-I and -III induction. Taken together, these data suggest that, at low MOIs, the virus is not a strong inducer of the IFN-I and -III system, as opposed to conditions where the MOI is high.
Taken together, the data presented here suggest that the response to SARS-CoV-2 is imbalanced with regard to controlling virus replication versus activation of the adaptive immune response. Given this dynamic, treatments for COVID-19 have less to do with the IFN response and more to do with controlling inflammation. Because our data suggest that numerous chemokines and ILs are elevated in COVID-19 patients, future efforts should focus on U.S. Food and Drug Administration (FDA)-approved drugs that can be rapidly deployed and have immunomodulating properties.
One of the features distinguishing SARS-CoV-2 from its more pathogenic counterpart SARS-CoV is the presence of premature stop codons in its ORF3b gene. Here, we show that SARS-CoV-2 ORF3b is a potent interferon antagonist, suppressing the induction of type I interferon more efficiently than its SARS-CoV ortholog. Phylogenetic analyses and functional assays revealed that SARS-CoV-2-related viruses from bats and pangolins also encode truncated ORF3b gene products with strong anti-interferon activity. Furthermore, analyses of more than 15,000 SARS-CoV-2 sequences identified a natural variant, in which a longer ORF3b reading frame was reconstituted. This variant was isolated from two patients with severe disease and further increased theability of ORF3b to suppress interferon induction. Thus, our findings not only help to explain the poor interferon response in COVID-19 patients, but also describe a possibility of the emergence of natural SARS-CoV-2 quasi-species with extended ORF3b that may exacerbate COVID-19 symptoms.
Highlights
ORF3b of SARS-CoV-2 and related bat and pangolin viruses is a potent IFN antagonist
SARS-CoV-2 ORF3b suppresses IFN induction more efficiently than SARS-CoV ortholog
The anti-IFN activity of ORF3b depends on the length of its C-terminus
An ORF3b with increased IFN antagonism was isolated from two severe COVID-19 cases
RNA (in green) from the SARS-CoV-2 virus is shown taking over the cells it infects.ICAHN SCHOOL OF MEDICINE AT MOUNT SINAI
A deep dive into how the new coronavirus infects cells has found that it orchestrates a hostile takeover of their genes unlike any other known viruses do, producing what one leading scientist calls “unique” and “aberrant” changes.Recent studies show that in seizing control of genes in the human cells it invades, the virus changes how segments of DNA are read, doing so in a way that might explain why the elderly are more likely to die of Covid-19 and why antiviral drugs might not only save sick patients’ lives but also prevent severe disease if taken before infection.“It’s something I have never seen in my 20 years of” studying viruses, said virologist Benjamin tenOever of the Icahn School of Medicine at Mount Sinai, referring to how SARS-CoV-2, the virus that causes Covid-19, hijacks cells’ genomes.The “something” he and his colleagues saw is how SARS-CoV-2 blocks one virus-fighting set of genes but allows another set to launch, a pattern never seen with other viruses. Influenza and the original SARS virus (in the early 2000s), for instance, interfere with both arms of the body’s immune response — what tenOever dubs “call to arms” genes and “call for reinforcement” genes.The first group of genes produces interferons. These proteins, which infected cells release, are biological semaphores, signaling to neighboring cells to activate some 500 of their own genes that will slow down the virus’ ability to make millions of copies of itself if it invades them. This lasts seven to 10 days, tenOever said, controlling virus replication and thereby buying time for the second group of genes to act.This second set of genes produce their own secreted proteins, called chemokines, that emit a biochemical “come here!” alarm. When far-flung antibody-making B cells and virus-killing T cells sense the alarm, they race to its source. If all goes well, the first set of genes holds the virus at bay long enough for the lethal professional killers to arrive and start eradicating viruses.
“Most other viruses interfere with some aspect of both the call to arms and the call for reinforcements,” tenOever said. “If they didn’t, no one would ever get a viral illness”: The one-two punch would pummel any incipient infection into submission.
SARS-CoV-2, however, uniquely blocks one cellular defense but activates the other, he and his colleagues reported in a study published last week in Cell. They studied healthy human lung cells growing in lab dishes, ferrets (which the virus infects easily), and lung cells from Covid-19 patients. In all three, they found that within three days of infection, the virus induces cells’ call-for-reinforcement genes to produce cytokines. But it blocks their call-to-arms genes — the interferons that dampen the virus’ replication.
The result is essentially no brakes on the virus’s replication, but a storm of inflammatory molecules in the lungs, which is what tenOever calls an “unique” and “aberrant” consequence of how SARS-CoV-2 manipulates the genome of its target.
In another new study, scientists in Japan last week identified how SARS-CoV-2 accomplishes that genetic manipulation. Its ORF3b gene produces a protein called a transcription factor that has “strong anti-interferon activity,” Kei Sato of the University of Tokyo and colleagues found — stronger than the original SARS virus or influenza viruses. The protein basically blocks the cell from recognizing that a virus is present, in a way that prevents interferon genes from being expressed.
In fact, the Icahn School team found no interferons in the lung cells of Covid-19 patients. Without interferons, tenOever said, “there is nothing to stop the virus from replicating and festering in the lungs forever.”
That causes lung cells to emit even more “call-for-reinforcement” genes, summoning more and more immune cells. Now the lungs have macrophages and neutrophils and other immune cells “everywhere,” tenOever said, causing such runaway inflammation “that you start having inflammation that induces more inflammation.”
At the same time, unchecked viral replication kills lung cells involved in oxygen exchange. “And suddenly you’re in the hospital in severe respiratory distress,” he said.
In elderly people, as well as those with diabetes, heart disease, and other underlying conditions, the call-to-arms part of the immune system is weaker than in younger, healthier people, even before the coronavirus arrives. That reduces even further the cells’ ability to knock down virus replication with interferons, and imbalances the immune system toward the dangerous inflammatory response.
The discovery that SARS-CoV-2 strongly suppresses infected cells’ production of interferons has raised an intriguing possibility: that taking interferons might prevent severe Covid-19 or even prevent it in the first place, said Vineet Menachery of the University of Texas Medical Branch.
In a study of human cells growing in lab dishes, described in a preprint (not peer-reviewed or published in a journal yet), he and his colleagues also found that SARS-CoV-2 “prevents the vast amount” of interferon genes from turning on. But when cells growing in lab dishes received the interferon IFN-1 before exposure to the coronavirus, “the virus has a difficult time replicating.”
After a few days, the amount of virus in infected but interferon-treated cells was 1,000- to 10,000-fold lower than in infected cells not pre-treated with interferon. (The original SARS virus, in contrast, is insensitive to interferon.)
Ending the pandemic and preventing its return is assumed to require an effective vaccine to prevent infectionand antiviral drugs such as remdesivir to treat the very sick, but the genetic studies suggest a third strategy: preventive drugs.
It’s possible that treatment with so-called type-1 interferon “could stop the virus before it could get established,” Menachery said.
Giving drugs to healthy people is always a dicey proposition, since all drugs have side effects — something considered less acceptable than when a drug is used to treat an illness. “Interferon treatment is rife with complications,” Menachery warned. The various interferons, which are prescribed for hepatitis, cancers, and many other diseases, can cause flu-like symptoms.
But the risk-benefit equation might shift, both for individuals and for society, if interferons or antivirals or other medications are shown to reduce the risk of developing serious Covid-19 or even make any infection nearly asymptomatic.
Interferon “would be warning the cells the virus is coming,” Menachery said, so such pretreatment might “allow treated cells to fend off the virus better and limit its spread.” Determining that will of course require clinical trials, which are underway.
Other related articles in this Open Access Online Scientific Journal include the following:
Structure-guided Drug Discovery: (1) The Coronavirus 3CL hydrolase (Mpro) enzyme (main protease) essential for proteolytic maturation of the virus and (2) viral protease, the RNA polymerase, the viral spike protein, a viral RNA as promising two targets for discovery of cleavage inhibitors of the viral spike polyprotein preventing the Coronavirus Virion the spread of infection
Predicting the Protein Structure of Coronavirus: Inhibition of Nsp15 can slow viral replication and Cryo-EM – Spike protein structure (experimentally verified) vs AI-predicted protein structures (not experimentally verified) of DeepMind (Parent: Google) aka AlphaFold
Curators: Stephen J. Williams, PhD and Aviva Lev-Ari, PhD, RN
Glycobiology vs Proteomics: Glycobiologists Prespective in the effort to explain the origin, etiology and potential therapeutics for the Coronavirus Pandemic (COVID-19).
Actemra, immunosuppressive which was designed to treat rheumatoid arthritis but also approved in 2017 to treat cytokine storms in cancer patients SAVED the sickest of all COVID-19 patients
The Accelerating COVID-19 Therapeutic Interventions and Vaccines (ACTIV) Partnership on May 18, 2020: Leadership of AbbVie, Amgen, AstraZeneca, Bristol Myers Squibb, Eisai, Eli Lilly, Evotec, Gilead, GlaxoSmithKline, Johnson & Johnson, KSQ Therapeutics, Merck, Novartis, Pfizer, Roche, Sanofi, Takeda, and Vir. We also thank multiple NIH institutes (especially NIAID), the FDA, BARDA, CDC, the European Medicines Agency, the Department of Defense, the VA, and the Foundation for NIH
Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET
$The authors would like to note that the first eight authors are listed alphabetically.
Abstract
During its first month, the recently emerged 2019 Wuhan novel coronavirus (2019-nCoV) has already infected many thousands of people in mainland China and worldwide and took hundreds of lives. However, the swiftly spreading virus also caused an unprecedentedly rapid response from the research community facing the unknown health challenge of potentially enormous proportions. Unfortunately, the experimental research to understand the molecular mechanisms behind the viral infection and to design a vaccine or antivirals is costly and takes months to develop. To expedite the advancement of our knowledge we leverage the data about the related coronaviruses that is readily available in public databases, and integrate these data into a single computational pipeline. As a result, we provide a comprehensive structural genomics and interactomics road-maps of 2019-nCoV and use these information to infer the possible functional differences and similarities with the related SARS coronavirus. All data are made publicly available to the research community at http://korkinlab.org/wuhan
Figure 2. Structurally characterized non-structural proteins of 2019-nCoV. Highlighted in pink are mutations found when aligning the proteins against their homologs from the closest related coronaviruses: 2019-nCoV and human SARS, bat coronavirus, and another bat betacoronavirus BtRf-BetaCoV. The structurally resolved part of wNsp7 is sequentially identical to its homolog.
Figure 3. Structurally characterized structural proteins and an ORF of 2019-nCoV. Highlighted in pink are mutations found when aligning the proteins against their homologs from the closest related coronaviruses: 2019-nCoV and human SARS, bat coronavirus, and another bat betacoronavirus BtRf-BetaCoV. Highlighted in yellow are novel protein inserts found in wS.
Figure 4. Structurally characterized intra-viral and host-viral protein-protein interaction complexes of 2019-nCoV. Human proteins (colored in orange) are identified through their gene names. For each intra-viral structure, the number of subunits involved in the interaction is specified.
Figure 5. Evolutionary conservation of functional sites in 2019-nCoV proteins. A. Fully conserved protein binding sites (PBS, light orange) of wNsp12 in its interaction with wNsp7 and wNsp8 while other parts of the protein surface shows mutations (magenta); B. Both major monoclonal antibody binding site (light orange) and ACE2 receptor binding site (dark green) of wS are heavily mutated (binding site mutations are shown in red) compared to the same binding sites in other coronaviruses; mutations not located on the two binding sites are shown in magenta; C. Nearly intact protein binding site (light orange) of wNsp (papain-like protease PLpro domain) for its putative interaction with human ubiquitin-aldehyde (binding site mutations for the only two residues are shown in red, non-binding site mutations are shown in magenta); D. Fully conserved inhibitor ligand binding site (LBS, green) for wNsp5; non-binding site mutations are shown in magenta.
A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.
In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.
Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.
A String of RNA
Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.
The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.
This sequence recruits machinery inside the infected cell to read the RNA letters — a, c, g and u — and translate them into coronavirus proteins.
The full coronavirus genome and the proteins it encodes are shown below.
A Chain of Proteins · ORF1ab
The first viral protein created inside the infected cell is actually a chain of 16 proteins joined together. Two of these proteins act like scissors, snipping the links between the different proteins and freeing them to do their jobs.
Research on other coronaviruses has given scientists a good understanding of what some of the SARS-CoV-2 proteins do. But other proteins are far more mysterious, and some might do nothing at all.
Cellular Saboteur · NSP1
This protein slows down the infected cell’s production of its own proteins. This sabotage forces the cell to make more virus proteins and prevents it from assembling antiviral proteins that could stop the virus.
Scientists aren’t sure what NSP2 does. The other proteins it attaches to may offer some clues. Two of them help move molecule-filled bubbles called endosomes around the cell.
NSP3 is a large protein that has two important jobs. One is cutting loose other viral proteins so they can do their own tasks. It also alters many of the infected cell’s proteins.
Normally, a healthy cell tags old proteins for destruction. But the coronavirus can remove those tags, changing the balance of proteins and possibly reducing the cell’s ability to fight the virus.
Combining with other proteins, NSP4 helps build fluid-filled bubbles within infected cells. Inside these bubbles, parts for new copies of the virus are constructed.
This protein infiltrates tiny channels in the infected cell’s nucleus, which holds our own genome. It may be able to influence the movement of molecules in and out of the nucleus — but for what purpose, no one knows.
Human cells have antiviral proteins that find viral RNA and shred it. This protein works with NSP16 to camouflage the virus’s genes so that they don’t get attacked.
This protein assembles genetic letters into new virus genomes. Researchers have found that the antiviral remdesivir interferes with NSP12 in other coronaviruses, and trials are now underway to see if the drug can treat Covid-19.
The infected cell begins reading the RNA sequence for NSP12:
ucagcugaugcacaaucguuuuuaaac…
Then it backtracks and reads c again, continuing as:
Another sequence, NSP11, overlaps part of the same stretch of RNA. But it’s not clear if the tiny protein encoded by this gene has any function at all.
Unwinding RNA · NSP13
Normally, virus RNA is wound into intricate twists and turns. Scientists suspect that NSP13 unwinds it so that other proteins can read its sequence and make new copies.
As NSP12 duplicates the coronavirus genome, it sometimes adds a wrong letter to the new copy. NSP14 cuts out these errors, so that the correct letter can be added instead.
The spike protein is one of four structural proteins — S, E, M and N — that form the outer layer of the coronavirus and protect the RNA inside. Structural proteins also help assemble and release new copies of the virus.
The S proteins form prominent spikes on the surface of the virus by arranging themselves in groups of three. These crownlike spikes give coronaviruses their name.
Part of the spike can extend and attach to a protein called ACE2 (in yellow below), which appears on particular cells in the human airway. The virus can then invade the cell.
The gene for the spike protein in SARS-CoV-2 has an insertion of 12 genetic letters: ccucggcgggca. This mutation may help the spikes bind tightly to human cells — a crucial step in its evolution from a virus that infected bats and other species.
A number of scientific teams are now designing vaccines that could prevent the spikes from attaching to human cells.
The SARS-CoV-2 genome also encodes a group of so-called “accessory proteins.” They help change the environment inside the infected cell to make it easier for the virus to replicate.
The ORF3a protein pokes a hole in the membrane of an infected cell, making it easier for new viruses to escape. It also triggers inflammation, one of the most dangerous symptoms of Covid-19.
ORF3b overlaps the same RNA, but scientists aren’t sure if SARS-CoV-2 uses this gene to make proteins.
Envelope Protein · E
The envelope protein is a structural protein that helps form the oily bubble of the virus. It may also have jobs to do once the virus is inside the cell. Researchers have found that it latches onto proteins that help turn our own genes on and off. It’s possible that pattern changes when the E protein interferes.
This accessory protein blocks signals that the infected cell would send out to the immune system. It also blocks some of the cell’s own virus-fighting proteins, the same ones targeted by other viruses such as polio and influenza.
When new viruses try to escape a cell, the cell can snare them with proteins called tetherin. Some research suggests that ORF7a cuts down an infected cell’s supply of tetherin, allowing more of the viruses to escape. Researchers have also found that the protein can trigger infected cells to commit suicide — which contributes to the damage Covid-19 causes to the lungs.
The N protein protects the virus RNA, keeping it stable inside the virus. Many N proteins link together in a long spiral, wrapping and coiling the RNA:
The accessory proteins ORF9b and ORF9c overlap this same stretch of RNA. ORF9b blocks interferon, a key molecule in the defense against viruses, but it’s not clear if ORF9c is used at all.
Mystery Protein · ORF10
Close relatives of the SARS-CoV-2 virus don’t have the gene for this tiny accessory protein, so it’s hard to know what it’s for yet — or even if the virus makes proteins from it.
The coronavirus genome ends with a snippet of RNA that stops the cell’s protein-making machinery. It then trails away as a repeating sequence of aaaaaaaaaaaaa
Other related articles in this Open Access Online Scientific Journal include the following:
Structure-guided Drug Discovery: (1) The Coronavirus 3CL hydrolase (Mpro) enzyme (main protease) essential for proteolytic maturation of the virus and (2) viral protease, the RNA polymerase, the viral spike protein, a viral RNA as promising two targets for discovery of cleavage inhibitors of the viral spike polyprotein preventing the Coronavirus Virion the spread of infection
Predicting the Protein Structure of Coronavirus: Inhibition of Nsp15 can slow viral replication and Cryo-EM – Spike protein structure (experimentally verified) vs AI-predicted protein structures (not experimentally verified) of DeepMind (Parent: Google) aka AlphaFold
Curators: Stephen J. Williams, PhD and Aviva Lev-Ari, PhD, RN
Glycobiology vs Proteomics: Glycobiologists Prespective in the effort to explain the origin, etiology and potential therapeutics for the Coronavirus Pandemic (COVID-19).
Actemra, immunosuppressive which was designed to treat rheumatoid arthritis but also approved in 2017 to treat cytokine storms in cancer patients SAVED the sickest of all COVID-19 patients
2012pharmaceutical
sjwilliamspa30489-X&id=fx1.jpg){kind=link}
This year’s Nobel Prize laureates in chemistry Demis Hassabis and John Jumper have developed an AI model to solve a 50-year-old problem: predicting proteins’ complex structures.
In 2020, Hassabis and Jumper presented an AI model called AlphaFold2. With its help, they have been able to predict the structure of virtually all the 200 million proteins that researchers have identified. Since their breakthrough, AlphaFold2 has been used by more than two million people from 190 countries. Among a myriad of scientific applications, researchers can now better understand antibiotic resistance and create images of enzymes that can decompose plastic.
Read more about their story: https://bit.ly/4diKiJ2