Feeds:
Posts
Comments

Posts Tagged ‘Demet Sag’

Natural Drug Target Discovery and Translational Medicine in Human Microbiome

Author and Curator: Demet Sag, PhD

 

Remember Ecology 101, simple description of ecosystem includes both living, biotic, and non-living, abiotic, that response to differentiation based on external and internal factors.  Hence, biodiversity changes since living systems are open systems and always try to reach stability. Both soil and human body are rich in microbial life against ever changing conditions. Previously, discovery of marine microorganisms for treatment of complex diseases especially cancer and drug discovery for pharmaceutical applications was discussed. (http://pharmaceuticalintelligence.com/2014/03/20/without-the-past-no-future-but-learn-and-move-genomics-of-microorganisms-to-translational-medicine/)

Here, the focus will be given to clinical drug discovery based on how lactose intolerance and human microbiome related to treat cancer patients or other diseases. In sum, creating clinical relevance with human microbiome require knowledge of both of the worlds to make best of it to solve complex diseases naturally.

The huge undertake as a roadmap to biomedical research originated by NIH under The Human Microbiome Project (HMP) (http://nihroadmap.nih.gov) with 250 healthy individuals as a starting point.  Recent developments opened the doors to pursue us to understand how human microbiome reflects on metabolism, drug interactions and numerous diseases.  Finally, association between clinical states and microbiome are improving with advanced algorithms, bioinformatics and genomics. In classical reading tests questions finding the simile between two groups of words can well relate how microbiome- human and soil-earth relates.  Both are rich in microbial life with quite changing characters to survive through commensal living.

Thus, it is also good to talk about how we can synthesize existing info on interactions between soil microorganisms and decomposers for human diseases and human microbiome. Epidemiology of living organisms is diverse but they all share common interest. In soil, for example, radioactively contaminated soil can’t support plant growth well so Nitrosomonas may support to bring the life to soil through supplying nitrogen. And others can be added to bring a favorable enriched soil.

In human microbiome nutrition-diseases interacts in such a harmony with genetic make up (the information received at time of birth germline- or acquired later in life due to mutations by various reasons). For example, the simplest example is lactose intolerance and the other is development of diabetes.  Generally, it is described as If person is missing a gene to metabolize lactose (sugar) this person become Lactose intolerant yet this can be gained before birth or after. The fix is easy since avoiding certain food groups i.e. milk products.

Yet, this is not that simple!

In human microbiome, the rich gastrointestinal (GI) tract contains many organisms and one of the most important ones is Enterococci that are often simply described as lactic-acid–producing bacteria—by under- appreciation of their power of microbial physiology and outcomes as well as their ubiquitous nature of enterococci.  Schleifer & Kilpper-Bälz, 1984 also reported that the Group D streptococci, such as Streptococcus faecalis and Streptococcus faecium, were included in the new genus called Enterococcus.

The importance of this genius, consists of 37 species, coming from their spectrum of  habitats that include the gastrointestinal microbiota of nearly every animal phylum and flexibility with ability to widely colonize, intrinsic resistance to many inhabitable conditions even though they don’t have spores but they can survive against desiccation and can persist for months on dried surfaces.  Furthermore, they can tolerate extreme conditions such as pH changes, ionizing radiation, osmotic and oxidative stresses, high heavy metal concentrations, and antibiotics.

There is a double sword application as these organisms used as probiotics to improve immune system of the host.  If it is human to prevent contaminated food related diseases or in animals prevent transmitting them to the consumers. Thus, E. faecium and E. faecalis strains are used as probiotics and are ingested in high numbers, generally in the form of pharmaceutical preparations to treat diarrhea, antibiotic-associated diarrhea or irritable bowel syndrome, to lower cholesterol levels or to improve host immunity.

When it comes to human body within each system specific organs may create distinct values.  For example the pH values of GI tract vary and during diseases since pH levels are not at at correct levels.  As a result, due to mal-absorption of nutrients and elements such as food, vitamins and minerals body can’t heal itself. This changing microbial genomics on the surface of GI reflects on general health.  Entrococcus family among the other GI’s natural flora has the microbial physiology adopt these various pH conditions well. 

 

Our body has its own standards to function, such as  pH, temperature, oxygen etc these are basics so that enzymatic reactions may happen to metabolize,synthesizing (making) or catalyzing (breaking) what we eat.  The pH is the measure of hydrogen-ion concentration  in solution.  For example, human blood has a narrow pH (7.35 – 7.45 ) and below or above this range means symptoms and disease yet if blood pH moves to much below 6.8 or above 7.8, cells stop functioning and the patient dies since the ideal pH for blood is 7.4.  This value is unified.  On the other hand, the pH in the human digestive tract or GI changes tremendously to adopt and carry on its function, the pH of saliva (6.5 – 7.5), upper portion of the stomach (4.0 – 6.5) where “predigestion” occurs, the lower portion of the stomach is secreting hydrochloric acid (HCI) and pepsin until it reaches a pH between 1.5 – 4.0; duodenum, small intestine, (7.0 – 8.5) where 90% of the absorption of nutrients is taken in by the body while the waste products are passed out through the colon (pH 4.0 – 7.0).

 

Why is pH important and how related to anything?

Development and presence of cancer always require an acid pH and lack of oxygen.  Thus, prevention of these two factors may be the key for treatment of cancer as it progress the acidity increases such that the level raises even up to 1000 more than normal levels.

Mainly, due to Warburg effect body opt to get its energy from fermentation of glucose and produce lactic acid that decreases the body pH from 7.3 down to 7 then to 6.5 in advanced stages of cancer.  Furthermore, during metastases this level even reaches to 6.0 and even 5.7 where body can’t fight back with the disease. (Warburg effect is well explained previously by Dr. Larry Berstein (www.linkedin.com/pub/larry-bernstein/38/94b/3aa).

How to bypass the lack of oxygen naturally?

One of the many solution can be a natural solution. The nature made the hemoglobin carrying bacteria, Vitreoscilla hemoglobin (VHb), which is first described by Dale Webster in 1966. The gram negative and obligate aerobic bacterium, Vitreoscilla synthesizes elevated quantities of a homodimeric hemoglobin (VHb) under hypoxic growth conditions.   The main role is likely the binding of oxygen at low concentrations and its direct delivery to the terminal respiratory oxidase(s) such as cytochrome o.  Then, after 1986 with detailed description of the molecule other hemoglobins and flavohemoglobins were identified in a variety of microbes, indicating the widespread occurrence of Hb-like proteins.   Currently, it is the most studied bacterial hemoglobin with application potentials in biotechnology.

It is a plausible solution to integrate Vitroscilla and Enterobacter powers for cancer detection and treatment naturally with body’s own microbiome.

However, there are many microbial organisms and differ person to person based on gender, age, background, genetic make-up, food intake, habits, location etc.  The huge undertake as a roadmap to biomedical research originated by NIH under The Human Microbiome Project (HMP) (http://nihroadmap.nih.gov) with 250 healthy individuals as a starting point.

There were three goals in the agenda of The Human Microbiome Project (HMP) simply:

 1. Utilize advanced high throughput technology,

2. Identify any association between microbiome and disease/health stages,

3. Initiate scientific studies to collect more data.

In sum, creating clinical relevance with human microbiome require knowledge of both of the worlds to make best of it to solve complex diseases naturally.

Previously  Discussed:

AMPK Is a Negative Regulator of the Warburg Effect and Suppresses Tumor Growth In Vivo
Reporter-Curator: Stephen J. Williams, Ph.D.
http://pharmaceuticalintelligence.com/2013/03/12/ampk-is-a-negative-regulator-of-the-warburg-effect-and-suppresses-tumor-growth-in-vivo/

Is the Warburg Effect the Cause or the Effect of Cancer: A 21st Century View?
Author: Larry H. Bernstein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/10/17/is-the-warburg-effect-the-cause-or-the-effect-of-cancer-a-21st-century-view/

Otto Warburg, A Giant of Modern Cellular Biology
Reporter: Larry H Bernstein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/11/02/otto-warburg-a-giant-of-modern-cellular-biology/

Targeting Mitochondrial-bound Hexokinase for Cancer Therapy
Author: Ziv Raviv, PhD
http://pharmaceuticalintelligence.com/2013/04/06/targeting-mito…cancer-therapy

Nitric Oxide has a ubiquitous role in the regulation of glycolysis -with a concomitant influence on mitochondrial function
Curator, Larry H. Bernstein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/09/16/nitric-oxide-has-a-ubiquitous-role-in-the-regulation-of-glycolysis-with-a-concomitant-influence-on-mitochondrial-function/

Potential Drug Target: Glucolysis Regulation – Oxidative stress-responsive microRNA-320
Reporter: Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2012/07/25/potential-drug-target-glucolysis-regulation-oxidative-stress-responsive-microrna-320/

Differentiation Therapy – Epigenetics Tackles Solid Tumors
Author-Writer: Stephen J. Williams, Ph.D.
http://pharmaceuticalintelligence.com/2013/01/03/differentiation-therapy-epigenetics-tackles-solid-tumors/

Prostate Cancer Cells: Histone Deacetylase Inhibitors Induce Epithelial-to-Mesenchymal Transition
Reporter-Curator: Stephen J. Williams, Ph.D.
http://pharmaceuticalintelligence.com/2012/11/30/histone-deacetylase-inhibitors-induce-epithelial-to-mesenchymal-transition-in-prostate-cancer-cells/

Mitochondrial Damage and Repair under Oxidative Stress
Curator: Larry H Bernstein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/10/28/mitochondrial-damage-and-repair-under-oxidative-stress/

Mitochondria: Origin from oxygen free environment, role in aerobic glycolysis, metabolic adaptation
Curator: Larry H Bernsatein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/09/26/mitochondria-origin-from-oxygen-free-environment-role-in-aerobic-glycolysis-metabolic-adaptation/

Expanding the Genetic Alphabet and Linking the Genome to the Metabolome
Reporter& Curator: Larry Bernstein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/09/24/expanding-the-genetic-alphabet-and-linking-the-genome-to-the-metabolome/

What can we expect of tumor therapeutic response?
Author: Larry H. Bernstein, MD, FCAP
http://pharmaceuticalintelligence.com/2012/12/05/what-can-we-expect-of-tumor-therapeutic-response/

A Second Look at the Transthyretin Nutrition Inflammatory Conundrum
Larry H. Bernstein, MD, FACP
http://pharmaceuticalintelligence.com/2012/12/03/a-second-look-at-the-transthyretin-nutrition-inflammatory-conundrum/

 

Further  Readings and References:

Palmer KL, van Schaik W, Willems RJL, Gilmore MS. “Enterococcal Genomics Enterococci: From Commensals to Leading Causes of Drug Resistant Infection.” 2014-.2014 Feb 8

Franz CM, Holzapfel WH, Stiles ME. Enterococci at the crossroads of food safety?

Int J Food Microbiol.” 1999 Mar 1; 47(1-2):1-24.

Franz CM, Huch M, Abriouel H, Holzapfel W, Gálvez A.Int J Food Microbiol. “Enterococci as probiotics and their implications in food safety.” 2011 Dec 2; 151(2):125-40. Epub 2011 Sep 8.

Kayser FH.”Safety aspects of enterococci from the medical point of view.” Int J Food Microbiol. 2003 Dec 1; 88(2-3):255-62.

Webster DA, Hackett DP (1966). “The purification and properties of cytochrome o fromVitreoscilla“. J Biol Chem 241 (14): 3308–3315

Stark BC, Dikshit KL, Pagilla KR (2011). “Recent advances in understanding the structure, function, and biotechnological usefulness of the hemoglobin from the bacterium Vitreoscilla“. Biotechnol Lett 33 (9): 1705–1714

Stark BC, Dikshit KL, Pagilla KR (2012). “The Biochemistry  of Vitreoscillahemoglobin“. Computational and Structural Biotechnology Journal 3 (4): e201210002.

Brenner K, You L, Arnold F. (2008). “Engineering microbial consortia: A new frontier in synthetic biology.” Trends in Biotechnology 26: 483489.

Dunbar J, White S, Forney L. (1997). “Genetic diversity through the looking glass: Effect of enrichment bias.Applied and Environmental Microbiology 63: 13261331.

Foster J. (2001). “Evolutionary computation Nature Reviews Genetics 2: 428436.

Dinsdale EA, et al. 2008. “Functional metagenomic profiling of nine biomes.” Nature452: 629632.

Gudelj I, Beardmore RE, Arkin SS, MacLean RC. (2007). “Constraints on microbial metabolism drive evolutionary diversification in homogeneous environments.” Journal of Evolutionary Biology 20: 1882–1889.

Haack SK, Garchow H, Klug MJ, Forney L. (1995). “Analysis of factors affecting the accuracy, reproducibility, and interpretation of microbial community carbon source utilization patterns.” Applied and Environmental Microbiology 61: 14581468.

Lozupone C, Knight R. (2007). “Global patterns in bacterial diversity.” Proceedings of the National Academy of Sciences 104: 1143611440.

Thurnheer T, Gmr R, Guggenheim B,  (2004). “Multiplex FISH analysis of a six-species bacterial biofilm. “Journal of Microbiological Methods 56: 3747.

VijayKumar M, Aitken JD, Carvalho FA, Cullender TC, Mwangi S, Srinivasan S,Sitaraman S, Knight R, Ley RE, Gewirtz AT. (2010). “Metabolic syndrome and altered gut microbiota in mice lacking Toll-like receptor 5.” Science 328: 228231

Williams HTP, Lenton TM. (2007). “Artificial selection of simulated microbial ecosystems.” Proceedings of the National Academy of Sciences 104: 89188923.

 

 

Read Full Post »

 What is the key method to harness Inflammation to close the doors for many complex diseases?

 

Author and Curator: Larry H Bernstein, MD, FCAP

 

The main goal is to  have a quality of a healthy life.

When we look at the picture 90% of main fluid of life, blood, carried by cardiovascular system with two main pumping mechanisms, lung with gas exchange and systemic with complex scavenger actions, collection of waste, distribution of nutrition and clean gases etc.  Yet without lymphatic system body can’t make up the 100% fluid.  Therefore, 10% balance is completed by lymphatic system as a counter clockwise direction so that not only the fluid balance but also mass balance is  maintained. Finally, the immune system patches the  remaining mechanism by providing cellular support to protect the body because it contains 99% of white cells to fight against any kinds of invasion, attack, trauma.

These three musketeers, ccardiovascular, lyphatic and immune systems, create the core mechanism of survival during human life.

However, there is a cellular balance between immune and cardiovascular system since blood that made up off 99% red cells and 1% white blood cells that are used to scavenger hunt circulating foreign materials.   These three systems are acting with a harmony not only defend the body but provide basic needs of life.  Thus, controlling angiogenesis and working mechanisms in blood not only helps to develop new diagnostic tools but more importantly establishes long lasting treatments that can harness Immunomodulation.

The word inflammation comes from the Latin “inflammo”, meaning “I set alight, I ignite”.

Medical Dictionary description is:

“A fundamental pathologic process consisting of a dynamic complex of histologically apparent cytologic changes, cellular infiltration, and mediator release that occurs in the affected blood vessels and adjacent tissues in response to an injury or abnormal stimulation caused by a physical, chemical, or biologic agent, including the local reactions and resulting morphologic changes; the destruction or removal of the injurious material; and the responses that lead to repair and healing.”

The five elements makes up the signature of  inflammation:  rubor, redness; calor, heat (or warmth); tumor swelling; and dolor, pain; a fifth sign, functio laesa, inhibited or lost function.   However, these indications may not be present at once.

Please click on to the following link for genetic association of autoimmune diseases (Cho Et al selected major association signals in autoimmune diseases) from Cho JH, Gregersen PK. N Engl J Med 2011;365:1612-1623.

Inflammatory diseases grouped under two classification: the immune system related due to  inflammatory disorders, such as both allergic reactions  and some myopathies, with many immune system disorders.  The examples of inflammatory disorders  include Acne vulgaris, asthma, autoimmune disorders, celiac disease, chronic prostatitis, glomerulonepritis, hypersensitivities, inflammatory bowel diseases, pelvic inflammatory diseases, reperfusion diseases, rheumatoid arthritis, sarcoidosis, transplant rejection, vasculitis, interstitial cyctitis, The second kind of inflammation are related to  non-immune diseases such as cancer, atherosclerosis, and ischaemic heart disease.

This seems simple yet at molecular physiology and gene activation levels this is a complex response as an innate immune response from body.  There can be acute lasting few days after exposure to bacterial pathogens, injured tissues or chronic inflammation continuing few months to years after unresolved acute responses such as non-degradable pathogens, viral infection, antigens or any  foreignmaterials, or autoimmune responses.

As the system responses arise from plasma fluid, blood vessels, blood plasma through vasciular changes, differentiation in plasma cascade systems like coagulation system, fibrinolysis, complement system and kinin system.  Some of the various mediators include bradykinin produced by kinin system, C3, C5, membrane attack system (endothelial cell activation or endothelial coagulation activation mechanism) created by the complement system; factor XII that can activate kinin, fibrinolysys and coagulation systems at the same time produced in liver; plasmin from fibrinolysis system to inactivate factor Xii and C3 formation, and thrombin of coagulation system with a reaction through protein activated receptor 1 (PAR1), which is a seven spanning membrane protein-GPCR.   This system is quite fragile and well regulated.  For example activation of inactive Factor XII by collagen, platelets, trauma such as cut, wound, surgery that results in basement membrane changes since it usually circulate in inactive form in plasma automatically initiates and alerts kinin, fibrinolysis and coagulation systems.

Furthermore, the changes reflected through receptors and create gene activation by cellular mediators to establish system wide unified mechanisms. These factors (such as IFN-gamma, IL-1, IL-8, prostaglandins, leukotrene B4,  nitric oxide, histamines,TNFa) target immune cells and redesign their responses, mast cells, macrophages, granulocytes, leukocytes, B cells, T cells) platelets, some neuron cells and endothelial cells.  Therefore, immune system can react with non-specific or specific mechanisms either for a short or a long term.

As a result, controlling of mechanisms in blood and prevention of angiogenesis answer to cure/treat many diseases  Description of angiogenesis is simply formation of new blood vessels without using or changing pre-existing capillaries.  This involves serial numbers of events play a central role during physiologic and pathologic processes such as normal tissue growth, such as in embryonic development, wound healing, and the menstrual cycle.  However this system requires three main elements:  oxygen, nutrients and getting rid of waste or end products.

Genome Wide Gene Association Studies, Genomics and Metabolomics, on the other hand, development of new technologies for diagnostics and non-invasive technologies provided better targeting systems.

In this token recent genomewide association studies showed a clear view on a disease mechanism, or that suggest a new diagnostic or therapeutic approach particularly these disorders are related to  genes within the major histocompatibility complex (MHC) that predisposes the most significant genetic effect.  Presumably, these genes are reflecting the immunoregulatory effects of the HLA molecules themselves. As a result, the working mechanism of pathological conditions are revisited or created new assumptions to develop new targets for diagnosis and treatments.

Even though B and T cells are reactive to initiate responses there are several level of mechanisms control the cell differentiation for designing rules during health or diseases. These regulators are in check for both T and B cells.  For example, during Type 1 diabetes there are presence of more limited defects in selection against reactivity with self-antigens like insulin, thus, T cell differentiation is in jeopardy.  In addition, B cells have many active checkpoints to modulate the immune responses like  pre-B cells in the bone marrow are highly autoreactive yet they prefer to stay  in naïve-B cell forms in the periphery through tyrosine phosphatase nonreceptor type 22 (PTPN22) along with many genes play a role in autoimmunity.  In a nut shell this is just peeling the first layer of the onion at the level of Mendelian Genetics.

There is a great work to be done but if one can harness the blood and immune responses many complex diseases patients may have a big relief and have a quality of life.  When we look at the picture 90% of main fluid of life, blood, carried by cardiovascular system with two main pumping mechanisms, lung with gas exchange and systemic with complex scavenger actions, collection of waste, distribution of nutrition and clean gases.  Yet, without lymphatic system body can’t make up the 100% fluid.  Therefore, 10% balance is completed by lymphatic system as a counter clockwise direction so that not only the fluid balance but also mass balance is  maintained. Finally, the immune system patches the  remaining mechanism by providing cellular support to protect the body because it contains 99% of white cells to fight against any kinds of invasion, attack, trauma.

FURTHER READINGS AND REFERENCES:

Arap W, Pasqualini R, Ruoslahti E (1998) Cancer treatment by targeted drug delivery to tumor vasculature in a mouse model. Science (Wash DC)279:377380.

 Brouty BD, Zetter BR (1980) Inhibition of cell motility by interferon.Science (Wash DC) 208:516518.

Ferrara N, Alitalo K (1999) Clinical Applications of angiogenic growth factors and their inhibitorsNat Med 5:13591364.

 

Ferrara N (1999) Role of vascular endothelial growth factor in the regulation of angiogenesisKidney Int 56:794814.

 

Ferrara N (1995) Leukocyte adhesion: Missing link in angiogenesisNature (Lond) 376:467.

 

Kohn EC, Alessandro R, Spoonster J, Wersto RP, Liotta LA (1995) Angiogenesis: Role of calcium-mediated signal transduction. Proc Natl Acad Sci U S A 92:13071311

Meijer DKF, Molema G (1995) Targeting of drugs to the liverSemin Liver Dis 15:202256.

Sidky YA, Borden EC (1987) Inhibition of angiogenesis by interferons: Effects on tumor- and lymphocyte-induced vascular responsesCancer Res47:51555161.

Anonymous (1999a) Genentech takes VEGF back to lab. SCRIP 2493:24.

Ziche M, Morbidelli L, Choudhuri R, Zhang HT, Donnini S, Granger HJ,Bicknell R (1997) Nitric oxide synthase lies downstream from vascular endothelial growth factor-induced but not basic fibroblast growth factor-induced angiogenesis. J Clin Invest 99:26252634.

 

Yoshida S, Ono M, Shono T, Izumi H, Ishibashi T, Suzuki H, Kuwano M(1997) Involvement of interleukin-8, vascular endothelial growth factor, and basic fibroblast growth factor in tumor necrosis factor α-dependent angiogenesis. Mol Cell Biol 17:40154023.

 

Vittet D, Prandini MH, Berthier R, Schweitzer A, Martin SH, Uzan G,Dejana E (1996) Embryonic stem cells differentiate in vitro to endothelial cells through successive maturation stepsBlood 88:34243431.

 

Ruegg C, Yilmaz A, Bieler G, Bamat J, Chaubert P, Lejeune FJ (1998) Evidence for the involvement of endothelial cell integrin αvβ3 in the disruption of the tumor vasculature induced by TNF and IFNNat Med4:408414

Patey N, Vazeux R, Canioni D, Potter T, Gallatin WM, Brousse N (1996) Intercellular adhesion molecule-3 on endothelial cells. Expression in tumors but not in inflammatory responses. Am J Pathol 148:465472.

Oliver SJ, Banquerigo ML, Brahn E (1994) Supression of collagen-induced arthritis using an angiogenesis inhibitor AGM-1470 and microtubule stabilizer taxol. Cell Immunol 157:291299

Molema G, Griffioen AW (1998) Rocking the foundations of solid tumor growth by attacking the tumor’s blood supplyImmunol Today 19:392394.

 

Losordo DW, Vale PR, Symes JF, Dunnington CH, Esakof DD, Maysky M,Ashare AB, Lathi K, Isner JM (1998) Gene therapy for myocardial angiogenesis: Initial clinical results with direct myocardial injection of PhVEGF165 as sole therapy for myocardial ischemiaCirculation98:28002804.

Jain RK, Schlenger K, Hockel M, Yuan F  (1997) Quantitative angiogenesis assays: Progress and problemsNat Med 3:12031208.

Jain RK (1996) 1995 Whitaker Lecture: Delivery of molecules, particles and cells to solid tumors. Ann Biomed Eng 24:457473.

 

Giraudo E, Primo L, Audero E, Gerber H, Koolwijk P, Soker S,Klagsbrun M, Ferrara N, Bussolino F (1998) Tumor necrosis factor-alpha regulates expression of vascular endothelial growth factor receptor-2 and of its co-receptor neuropilin-1 in human vascular endothelial cells. J Biol Chem273:2212822135.

Inflammation Genomics

Kocarnik JM, Pendergrass SA, Carty CL, Pankow JS, Schumacher FR, Cheng I, Durda P, Ambite JL, Deelman E, Cook NR, Liu S, Wactawski-Wende J, Hutter C, Brown-Gentry K, Wilson S, Best LG, Pankratz N, Hong CP, Cole SA, Voruganti VS, Bůžkova P, Jorgensen NW, Jenny NS, Wilkens LR, Haiman CA, Kolonel LN, Lacroix A, North K, Jackson R, Le Marchand L, Hindorff LA, Crawford DC, Gross M, Peters U. Multi-Ancestral Analysis of Inflammation-Related Genetic Variants and C-Reactive Protein in the Population Architecture using Genomics and Epidemiology (PAGE) Study. Circ Cardiovasc Genet. 2014 Mar 12

Ellis J, Lange EM, Li J, Dupuis J, Baumert J, Walston JD, Keating BJ, Durda P, Fox ER, Palmer CD, Meng YA, Young T, Farlow DN, Schnabel RB, Marzi CS, Larkin E, Martin LW, Bis JC, Auer P, Ramachandran VS, Gabriel SB, Willis MS, Pankow JS, Papanicolaou GJ, Rotter JI, Ballantyne CM, Gross MD, Lettre G, Wilson JG, Peters U, Koenig W, Tracy RP, Redline S, Reiner AP, Benjamin EJ, Lange LA. Large multiethnic Candidate Gene Study for C-reactive protein levels: identification of a novelassociation at CD36 in African Americans. Hum Genet. 2014 Mar 19.

Ricaño-Ponce I, Wijmenga C. Mapping of immune-mediated disease genes. Annu Rev Genomics Hum Genet. 2013;14:325-53. doi: 10.1146/annurev-genom-091212-153450. Epub 2013 Jul 3. Review.

McKillop AM, Flatt PR. Emerging applications of metabolomic and genomic profiling in diabetic clinical medicine. Diabetes Care. 2011 Dec;34(12):2624-30. doi: 10.2337/dc11-0837. Review.

Ricaño-Ponce I, Wijmenga C. Mapping of immune-mediated disease genes. Annu Rev Genomics Hum Genet. 2013;14:325-53. doi: 10.1146/annurev-genom-091212-153450. Epub 2013 Jul 3.Review.

Chen YB, Cutler CS. Biomarkers for acute GVHD: can we predict the unpredictable? Bone Marrow Transplant. 2013 Jun;48(6):755-60. doi: 10.1038/bmt.2012.143. Epub 2012 Aug 6. Review.

Cho JH, Gregersen PK. Genomics and the multifactorial nature of human autoimmune disease. N Engl J Med. 2011 Oct 27;365(17):1612-23. doi: 10.1056/NEJMra1100030. Review.

Shikama N, Nusspaumer G, Hollander GA. Clearing the AIRE: on the pathophysiological basis of the autoimmune polyendocrinopathy syndrome type-1. Endocrinol Metab Clin North Am2009;38:273-288

Concannon P, Rich SS, Nepom GT. Genetics of type 1A diabetes. N Engl J Med 2009;360:1646-1654

Read Full Post »

The Delicate Connection:  IDO (Indolamine 2, 3 dehydrogenase) and Cancer Immunology

Author and Curator: Demet Sag, PhD, CRA, GCP      

Table of Contents:

  1. Abstract
  2. Dual role for IDO
  3. Immune System and IDO
  4. Autoimmune disorders and IDO
  5. Cancer and Ido
  6. Clinical Interventions
  7. Clinical Trials
  8. Future Actions for Molecular Dx and Targeted Therapies:
  9. Conclusion
  10. References

TABLE 1- IDO Clinical Trials

TABLE 2- Kyn induced Genes

TABLE 3 Possible biomarkers and molecular diagnostics targets

TABLE 4: Current Interventions ______________________________________________________________________________________________________________

ABSTRACT:

Overall purpose is to find a method to manipulate IDO for clinical applications, mainly the focus of this review is is cancer prevention and treatment.  The first study proving the connection between IDO and immune response came from, a very natural event, a protection of pregnancy in human. This led to discover that high IDO expression is a common factor in cancer tumors. Thus, attention promoted investigations on IDO’s role in various disease states, immune disorders, transplantation, inflammation, women health, mood disorders.
Many approaches, vaccines and adjuvants are underway to find new immunotherapies by combining the power of DCs in immune response regulation and specific direction of siRNA.  As a result, with this unique qualities of IDO, DCs and siRNA, we orchestrated a novel intervention for immunomodulation of IDO by inhibiting with small interference RNA, called siRNA-IDO-DCvax.  Proven that our DCvax created a delay and regression of tumor growth without changing the natural structure and characterization of DCs in melanoma and breast cancers in vivo. (** The shRNA IDO- DCvax is developed by Regen BioPhrama, San Diego, CA ,  Thomas Ichim, Ph.D, CSO. and David Koos, CEO)

______________________________________________________________________________________________________________

Double-Edged Sword of IDO: The Good and The Bad for Clinical intervention and Developments

IDO almost has a dual role. There is a positive side of high expression of IDO during pregnancy (29; 28; 114), transplants (115; 116; 117; 118; 119), infectious diseases (96) and but this tolerance is negative during autoimmune-disorders (120; 121; 122), tumors of cancer (123; 124; 117; 121; 125; 126; 127) (127), and mood disorders (46). The increased IDO expression has a double-edged sword in human physiology provides a positive role during protection of fetus and grafts after transplantations but becomes a negative factor during autoimmune disorders, cancer, sepsis and mood disorders.

Prevention of allogeneic fetal rejection is possible by tryptophan metabolism (26) rejecting with lack of IDO but allocating if IDO present (29; 28; 114). These studies lead to find “the natural regulation mechanism” for protecting the transplants from graft versus host disease GVHD (128) and getting rid of tumors.

The plasticity of  mammary and uterus during reproduction may hold some more answers to prevent GVHD and tumors of cancer with good understanding of IDO and tryptophan mechanism (129; 130). After allogeneic bone marrow transplants the risk of solid tumor development increased about 80% among 19,229 patients even with a greater risk among patients under 18 years old (117).  The adaptation of tolerance against host mechanism is connected to the IDO expression (131). During implantation and early pregnancy IDO has a role by making CD4+CD25+Foxp3+ regulatory T cells (Tregs) and expressing in DCs and  MQs  (114; 132; 133).

Clonal deletion mechanism prevents mother to react with paternal products since female mice accepted the paternal MHC antigen-expressing tumor graft during pregnancy and rejected three weeks after delivery (134). CTLA-4Ig gene therapy alleviates abortion through regulation of apoptosis and inhibition of spleen lymphocytes (135).  

 Immune System and IDO DCs are the orchestrator of the immune response (56; 57; 58) with list of functions in uptake, processing, and presentation of antigens; activation of effector cells, such as T-cells and NK-cells; and secretion of cytokines and other immune-modulating molecules to direct the immune response. The differential regulation of IDO in distinct DC subsets is widely studied to delineate and correct immune homeostasis during autoimmunity, infection and cancer and the associated immunological outcomes. Genesis of antigen presenting cells (APCs), eventually the immune system, require migration of monocytes (MOs), which is originated in bone marrow. Then, these MOs move from bloodstream to other tissues to become macrophages and DCs (59; 60).

Initiation of immune response requires APCs to link resting helper T-cell with the matching antigen to protect body. DCs are superior to MQs and MOs in their immune action model. When DCs are first described (61) and classified, their role is determined as a highly potent antigen-presenting cell (APC) subset with 100 to 1000-times more effective than macrophages and B-cells in priming T-cells. Both MQs and monocytes phagocytize the pathogen, and their cell structure contains very large nucleus and many internal vesicles. However, there is a nuance between MQ and DCs, since DCs has a wider capacity of stimulation, because MQs activates only memory T cells, yet DCs can activate both naïve and memory T cells.

DCs are potent activators of T cells and they also have well controlled regulatory roles. DC properties determine the regulation regardless of their origin or the subset of the DCs. DCs reacts after identification of the signals or influencers for their inhibitory, stimulatory or regulatory roles, before they express a complex repertoire of positive and negative cytokines, transmembrane proteins and other molecules. Thus, “two signal theory” gains support with a defined rule.  The combination of two signals, their interaction with types of cells and time are critical.

In short, specificity and time are matter for a proper response. When IDO mRNA expression is activated with CTL40 ligand and IFNgamma, IDO results inhibition of T cell production (4).  However, if DCs are inhibited by 1MT, an inhibitor of IDO, the response stop but IgG has no affect (10).  In addition, if the stimulation is started by a tryptophan metabolite, which is downstream of IDO, such as 3-hydroxyantranilic or quinolinic acids, it only inhibits Th1 but not Th2 subset of T cells (62).

Furthermore, inclusion of signal molecules, such as Fas Ligand, cytochrome c, and pathways also differ in the T cell differentiation mechanisms due to combination, time and specificity of two-signals.  The co-culture experiments are great tool to identify specific stimuli in disease specific microenvironment (63; 12; 64) for discovering the mechanism and interactions between molecules in gene regulation, biochemical mechanism and physiological function during cell differentiation.

As a result, the simplest differential cell development from the early development of DCs impact the outcome of the data. For example, collection of MOs from peripheral blood mononuclear cells (PBMCs) with IL4 and GM-CSF leads to immature DCs (iDCs). On next step, treatment of iDCs with tumor necrosis factor (TNF) or other plausible cytokines (TGFb1, IFNgamma, IFNalpha,  IFNbeta, IL6 etc.) based on the desired outcome differentiate iDCs  into mature DCs (mDCs). DCs live only up to a week but MOs and generated MQs can live up to a month in the given tissue. B cells inhibit T cell dependent immune responses in tumors (65).

AutoImmune Disorders:

The Circadian Clock Circuitry and the AHR

The balance of IDO expression becomes necessary to prevent overactive immune response self-destruction, so modulation in tryptophan and NDA metabolisms maybe essential.  When splenic IDO-expressing CD11b (+) DCs from tolerized animals applied, they suppressed the development of arthritis, increased the Treg/Th17 cell ratio, and decreased the production of inflammatory cytokines in the spleen (136).

The role of Nicotinamide prevention on type 1 diabetes and ameliorates multiple sclerosis in animal model presented with activities of  NDAs stimulating GPCR109a to produce prostaglandins to induce IDO expression, then these PGEs and PGDs converted to the anti-inflammatory prostaglandin, 15d-PGJ(2) (137; 138; 139).  Thus, these events promotes endogenous signaling mechanisms involving the GPCRs EP2, EP4, and DP1 along with PPARgamma. (137).

Modulating the immune response at non-canonical at canonocal pathway while keeping the non-canonical Nf-KB intact may help to mend immune disorders. As a result, the targeted blocking in canonical at associated kinase IKKβ and leaving non-canonocal Nf-kB pathway intact, DCs tips the balance towards immune supression. Hence, noncanonical NF-κB pathway for regulatory functions in DCs required effective IDO induction, directly or indirectly by endogenous ligand Kyn and negative regulation of proinflammatory cytokine production. As a result, this may help to treat autoimmune diseases such as rheumatoid arthritis, type 1 diabetes, inflammatory bowel disease, and multiple sclerosis, or allergy or transplant rejection.

While the opposite action needs to be taken during prevention of tumors, that is inhibition of non-canonical pathway.  Inflammation induces not only relaxation of veins and lowering blood pressure but also stimulate coagulopathies that worsen the microenvironment and decrease survival rate of patients after radio or chemotherapies.Cancer Generating tumor vaccines and using adjuvants underway (140).

Clinical correlation and genetic responses also compared in several studies to diagnose and target the system for cancer therapies (127; 141; 131).  The recent surveys on IDO expression and human cancers showed that IDO targeting is a candidate for cancer therapy since IDO expression recruiting Tregs, downregulates MHC class I and creating negative immune microenvironment for protection of development of tumors (125; 27; 142).  Inhibition of IDO expression can make advances in immunotherapy and chemotherapy fields (143; 125; 131; 144).

IDO has a great importance on prevention of cancer development (126). There are many approaches to create the homeostasis of immune response by Immunotherapy.  However, given the complexity of immune regulations, immunomodulation is a better approach to correct and relieve the system from the disease.  Some of the current IDO targeted immunotherapy or immmunomodulations with RNA technology for cancer prevention (145; 146; 147; 148; 149; 150) or applied on human or animals  (75; 151; 12; 115; 152; 9; 125) or chemical, (153; 154) or  radiological (155).  The targeted cell type in immune system generally DCs, monocytes (94)T cells (110; 156)and neutrophils (146; 157). On this paper, we will concentrate on DCvax on cancer treatments.

 T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

T-reg, regulatory T cells; Th, T helper; CTLA-4, cytotoxic T lymphocyte-associated antigen 4; TCR, T cell receptor; IDO, indoleamine 2,3-dioxygenase. (refernece: http://www.pnas.org/content/101/28/10398/suppl/DC)

IDO and the downstream enzymes in tryptophan pathway produce a series of immunosuppressive tryptophan metabolites that may lead into Tregs proliferation or increase in T cell apoptosis (62; 16; 27; 158), and some can affect NK cell function (159).

The interesting part of the mechanism is even without presence of IDO itself, downstream enzymes of IDO in the kynurenine tryptophan degradation still show immunosuppressive outcome (160; 73) due to not only Kyn but also TGFbeta stimulated long term responses. DC vaccination with IDO plausible (161) due to its power in immune response changes and longevity in the bloodstream for reversing the system for Th17 production (162).

Clinical Interventions are taking advantage of the DC’s central role and combining with enhancing molecules for induction of immunity may overcome tolerogenic DCs in tumors of cancers (163; 164).

The first successful application of DC vaccine used against advanced melanoma after loading DCs with tumor peptides or autologous cell lysate in presence of adjuvants keyhole limpet hematocyanin (KLH) (165).  Previous animal and clinical studies show use of DCs against tumors created success (165; 166; 167) as well as some problems due to heterogeneity of DC populations in one study supporting tumor growth rather than diminishing (168).

DC vaccination applied onto over four thousand clinical trial but none of them used siRNA-IDO DC vaccination method. Clinical trials evaluating DCs loaded ex vivo with purified TAAs as an anticancer immunotherapeutic interventions also did not include IDO (Table from (169). This table presented the data from 30 clinical trials, 3 of which discontinued, evaluating DCs loaded ex vivo with TAAs as an anticancer immunotherapy for 12 types of cancer [(AML(1), Breast cancer (4), glioblastoma (1), glioma (2), hepatocellular carcinoma (1), hematological malignancies (1), melanoma (6), neuroblastoma sarcoma (2), NSCLC (1), ovarian cancer (3), pancreatic cancer (3), prostate cancer (10)] at phase I, II or I/II.

Tipping the balance between Treg and Th17 ratio has a therapeutic advantage for restoring the health that is also shown in ovarian cancer by DC vaccination with adjuvants (161).  This rebalancing of the immune system towards immunogenicity may restore Treg/Th17 ratio (162; 170) but it is complicated. The stimulation of IL10 and IL12 induce Treg produce less Th17 and inhibiting CTL activation and its function (76; 171; 172) while animals treated with anti-TGFb before vaccination increase the plasma levels of IL-15 for tumor specific T cell survival in vivo (173; 174) ovarian cancer studies after human papilloma virus infection present an increase of IL12 (175).

Opposing signal mechanism downregulates the TGFb to activate CTL and Th1 population with IL12 and IL15 expression (162; 173).  The effects of IL17 on antitumor properties observed by unique subset of CD4+ T cells (176) called also CD8+ T cells secrete even more IL17 (177).

Using cytokines as adjuvants during vaccination may improve the efficacy of vaccination since cancer vaccines unlike infections vaccines applied after the infection or disease started against the established adoptive immune response.  Adjuvants are used to improve the responses of the given therapies commonly in immunotherapy applications as a combination therapy (178).

Enhancing cancer vaccine efficacy via modulation of the microenvironment is a plausible solution if only know who are the players.  Several molecules can be used to initiate and lengthen the activity of intervention to stimulate IDO expression without compromising the mechanism (179).  The system is complicated so generally induction is completed ex-vivo stimulation of DCs in cell lysates, whole tumor lysates, to create the microenvironment and natural stimulatory agents. Introduction of molecules as an adjuvants on genetic regulation on modulation of DCs are critical, because order and time of the signals, specific location/ tissue, and heterogeneity of personal needs (174; 138; 180). These studies demonstrated that IL15 with low TGFb stimulates CTL and Th1, whereas elevated TGFb with IL10 increases Th17 and Tregs in cancer microenvironments.

IDO and signaling gene regulation

For example Ret-peptide antitumor vaccine contains an extracellular fragment of Ret protein and Th1 polarized immunoregulator CpG oligonucleotide (1826), with 1MT, a potent inhibitor of IDO, brought a powerful as well as specific cellular and humoral immune responses in mice (152).

The main idea of choosing Ret to produce vaccine in ret related carcinomas fall in two criterion, first choosing patients self-antigens for cancer therapy with a non-mutated gene, second, there is no evidence of genetic mutations in Ret amino acids 64-269. Demonstration of proliferating hemangiomas, benign endothelial tumors and often referred as hemangiomas of infancy appearing at head or neck, express IDO and slowly regressed as a result of immune mediated process.

After large scale of genomic analysis show insulin like growth factor 2 as the key regulator of hematoma growth (Ritter et al. 2003). We set out to develop new technology with our previous expertise in immunotherapy and immunomodulation (181; 182; 183; 184), correcting Th17/Th1 ratio (185), and siRNA technology (186; 187).  We developed siRNA-IDO-DCvax. Patented two technologies “Immunomodulation using Altered DCs (Patent No: US2006/0165665 A1) and Method of Cancer Treatments using siRNA Silencing (Patent No: US2009/0220582 A1).

In melanoma cancer DCs were preconditioned with whole tumor lysate but in breast cancer model pretreatment completed with tumor cell lysate before siRNA-IDO-DCvax applied. Both of these studies was a success without modifying the autanticity of DCs but decreasing the IDO expression to restore immunegenity by delaying tumor growth in breast cancer (147) and in melanoma (188).  Thus, our DCvax specifically interfere with Ido without disturbing natural structure and content of the DCs in vivo showed that it is possible to carry on this technology to clinical applications.

Furthermore, our method of intervention is more sophisticated since it has a direct interaction mechanism with ex-vivo DC modulation without creating long term metabolism imbalance in Trp/Kyn metabolite mechanisms since the action is corrective and non-invasive.

There were several reasons.

First, prevention of tumor development studies targeting non-enzymatic pathway initiated by pDCs conditioned with TGFbeta is specific to IDO1 (189).

Second, IDO upregulation in antigen presenting cells allowing metastasis show that most human tumors express IDO at high levels (123; 124).

Third, tolerogenic DCs secretes several molecules some of them are transforming growth factor beta (TGFb), interleukin IL10), human leukocyte antigen G (HLA-G), and leukemia inhibitory factor (LIF), and non-secreted program cell death ligand 1 (PD-1 L) and IDO, indolamine 2.3-dioxygenase, which promote tumor tolerance. Thus, we took advantage of DCs properties and Ido specificity to prevent the tolerogenicity with siRNA-IDO DC vaccine in both melanoma and breast cancer.

Fourth, IDO expression in DCs make them even more potent against tumor antigens and create more T cells against tumors. IDOs are expressed at different levels by both in broad range of tumor cells and many subtypes of DCs including monocyte-derived DCs (10), plasmacytoid DCs (142), CD8a+ DCs (190), IDO compotent DCs (17), IFNgamma-activated DCs used in DC vaccination.  These DCs suppress immune responses through several mechanisms for induction of apoptosis towards activated T cells (156) to mediate antigen-specific T cell anergy in vivo (142) and for enhancement of Treg cells production at sites of vaccination with IDO-positive DCs+ in human patients (142; 191; 192; 168; 193; 194). If DCs are preconditioned with tumor lysate with 1MT vaccination they increase DCvax effectiveness unlike DCs originated from “normal”, healthy lysate with 1MT in pancreatic cancer (195).  As a result, we concluded that the immunesupressive effect of IDO can be reversed by siRNA because Treg cells enhances DC vaccine-mediated anti-tumor-immunity in cancer patients.

Gene silencing is a promising technology regardless of advantages simplicity for finding gene interaction mechanisms in vitro and disadvantages of the technology is utilizing the system with specificity in vivo (186; 196).  siRNA technology is one of the newest solution for the treatment of diseases as human genomics is only producing about 25,000 genes by representing 1% of its genome. Thus, utilizing the RNA open the doors for more comprehensive and less invasive effects on interventions. Thus this technology is still improving and using adjuvants. Silencing of K-Ras inhibit the growth of tumors in human pancreatic cancers (197), silencing of beta-catenin in colon cancers causes tumor regression in mouse models (198), silencing of vascular endothelial growth factor (VGEF) decreased angiogenesis and inhibit tumor growth (199).

Combining siRNA IDO and DCvax from adult stem cell is a novel technology for regression of tumors in melanoma and breast cancers in vivo. Our data showed that IDO-siRNA reduced tumor derived T cell apoptosis and tumor derived inhibition of T cell proliferation.  In addition, silencing IDO made DCs more potent against tumors since treated or pretreated animals showed a delay or decreased the tumor growth (188; 147)

 

Clinical Trials:

First FDA approved DC-based cancer therapies for treatment of hormone-refractory prostate cancer as autologous cellular immunotherapy (163; 164).  However, there are many probabilities to iron out for a predictive outcome in patients.

Table 2 demonstrates the current summary of clinical trials report.  This table shows 38 total studies specifically Ido related function on cancer (16), eye (3), surgery (2), women health (4), obesity (1), Cardiovascular (2), brain (1), kidney (1), bladder (1), sepsis shock (1), transplant (1),  nervous system and behavioral studies (4), HIV (1) (Table 4).  Among these only 22 of which active, recruiting or not yet started to recruit, and 17 completed and one terminated.

Most of these studies concentrated on cancer by the industry, Teva GTC ( Phase I traumatic brain injury) Astra Zeneca (Phase IV on efficacy of CRESTOR 5mg for cardiovascular health concern), Incyte corporation (Phase II ovarian cancer) NewLink Genetics Corporation Phase I breast/lung/melanoma/pancreatic solid tumors that is terminated; Phase II malignant melanoma recruiting, Phase II active, not recruiting metastatic breast cancer, Phase I/II metastatic melanoma, Phase I advanced malignancies) , HIV (Phase IV enrolling by invitation supported by Salix Corp-UC, San Francisco and HIV/AIDS Research Programs).

Many studies based on chemotherapy but there are few that use biological methods completed study with  IDO vaccine peptide vaccination for Stage III-IV non-small-cell lung cancer patients (NCT01219348), observational study on effect of biological therapy on biomarkers in patients with untreated hepatitis C, metastasis melanoma, or Crohn disease by IFNalpha and chemical (ribavirin, ticilimumab (NCT00897312), polymorphisms of patients after 1MT drug application in treating patients with metastatic or unmovable refractory solid tumors by surgery (NCT00758537), IDO expression analysis on MSCs (NCT01668576), and not yet recruiting intervention with adenovirus-p53 transduced dendric cell vaccine , 1MT , radiation, Carbon C 11 aplha-methyltryptophan- (NCT01302821).

Among the registered clinical trials some of them are not interventional but  observational and evaluation studies on Trp/Kyn ratio (NCT01042847), Kyn/Trp ratio (NCT01219348), Kyn levels (NCT00897312, NCT00573300),  RT-PCR analysis for Kyn metabolism (NCT00573300, NCT00684736, NCT00758537), and intrinsic IDO expression of mesenchymal stem cells in lung transplant with percent inhibition of CD4+ and CD8+ T cell proliferation toward donor cells (NCT01668576), determining polymorphisms (NCT00426894). These clinical trials/studies are immensely valuable to understand the mechanism and route of intervention development with the data collected from human populations   

Future Actions for Molecular Dx and Targeted Therapies:

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors.  (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Viable tumor environment. Tumor survival is dependent upon an exquisite interplay between the critical functions of stromal development and angiogenesis, local immune suppression and tumor tolerance, and paradoxical inflammation. TEMs: TIE-2 expressing monocytes; “M2” TAMs: tolerogenic tumor-associated macrophages; MDSCs: myeloid-derived suppressor cells; pDCs: plasmacytoid dendritic cells; co-stim.: co-stimulation; IDO: indoleamine 2,3-dioxygenase; VEGF: vascular endothelial growth factor; EGF: epidermal growth factor; MMP: matrix metaloprotease; IL: interleukin; TGF-β: transforming growth factor-beta; TLRs: toll-like receptors. (reference: http://www.hindawi.com/journals/cdi/2012/937253/fig1/)

Current survival or response rate is around 40 to 50 % range.  By using specific cell type, selected inhibition/activation sequence based on patient’s genomic profile may improve the efficacy of clinical interventions on cancer treatments. Targeted therapies for specific gene regulation through signal transduction is necessary but there are few studies with genomics based approach.

On the other hand, there are surveys, observational or evaluations (listed in clinical trials section) registered with www.clinicaltrials.gov that will provide a valuable short-list of molecules.  Preventing stimulation of Ido1 as well as Tgfb-1gene expression by modulating receptor mediated phosphorylation between TGFb/SMAD either at Mad-Homology 1 (MH1) or Mad-Homology 1 (MH2) domains maybe possible (79; 82; 80). Within Smads are the conserved Mad-Homology 1 (MH1) domain, which is a DNA binding module contains tightly bound Zinc atom.

Smad MH2 domain is well conserved and one the most diverse protein-signal interacting molecule during signal transduction due to two important Serine residues located extreme distal C-termini at Ser-Val-Ser in Smad 2 or at pSer-X-PSer in RSmads (80). Kyn activated orphan G protein–coupled receptor, GPR35 with unknown function with a distinct expression pattern that collides with IDO sites since its expression at high levels of the immune system and the gut (63) (200; 63).  

The first study to connect IDO with cancer shows that group (75).  The directly targeting to regulate IDO expression is another method through modulating ISREs in its promoter with RNA-peptide combination technology. Indirectly, IDO can be regulated through Bin1 gene expression control over IDO since Bin1 is a negative regulator of IDO and prevents IDO expression.  IDO is under negative genetic control of Bin1, BAR adapter–encoding gene Bin1 (also known as Amphiphysin2). Bin1 functions in cancer suppression since attenuation of Bin1 observed in many human malignancies (141; 201; 202; 203; 204; 205; 206) .  Null Bin-/- mice showed that when there is lack of Bin1, upregulation of IDO through STAT1- and NF-kB-dependent expression of IDO makes tumor cells to escape from T cell–dependent antitumor immunity.

This pathway lies in non-enzymatic signal transducer function of IDO after stimulation of DCs by TGFb1.  The detail study on Bin1 gene by alternative spicing also provided that Bin1 is a tumor suppressor.  Its activities also depends on these spliced outcome, such as  Exon 10, in muscle, in turn Exon 13 in mice has importance in role for regulating growth when Bin1 is deleted or mutated C2C12 myoblasts interrupted due to its missing Myc, cyclinD1, or growth factor inhibiting genes like p21WAF1 (207; 208).

On the other hand alternative spliced Exon12A contributing brain cell differentiation (209; 210). Myc as a target at the junction between IDO gene interaction and Trp metabolism.  Bin1 interacts with Myc either early-dependent on Myc or late-independent on Myc, when Myc is not present. This gene regulation also interfered by the long term signaling mechanism related to Kynurenine (Kyn) acting as an endogenous ligand to AHR in Trp metabolite and TGFb1 and/or IFNalpha and IFNbeta up regulation of DCs to induce IDO in noncanonical pathway for NF-kB and myc gene activations (73; 74).  Hence, Trp/Kyn, Kyn/Trp, Th1/Th17 ratios are important to be observed in patients peripheral blood. These direct and indirect gene interactions place Bin1 to function in cell differentiation (211; 212; 205).

Regulatory T-cel generation via reverse and non-canonical signaliing to pDCs

Table 3 contains the microarray analysis for Kyn affect showed that there are 25 genes affected by Kyn, two of which are upregulated and 23 of them downregulated (100). This list of genes and additional knowledge based on studies creating the diagnostics panel with these genes as a biomarker may help to analyze the outcomes of given interventions and therapies. Some of these molecules are great candidate to seek as an adjuvant or co-stimulation agents.  These are myc, NfKB at IKKA, C2CD2, CREB3L2, GPR115, IL2, IL8, IL6, and IL1B, mir-376 RNA, NFKB3, TGFb, RelA, and SH3RF1. In addition, Lip, Fox3P, CTLA-4, Bin1, and IMPACT should be monitored.

In addition, Table 4 presents the other possible mechanisms. The highlights of possible target/biomarkers are specific TLRs, conserved sequences of IDO across its homologous structures, CCR6, CCR5, RORgammat, ISREs of IDO, Jak, STAT, IRFs, MH1 and MH2 domains of Smads. Endothelial cell coagulation activation mechanism and pDC maturation or immigration from lymph nodes to bloodstream should marry to control not only IDO expression but also genesis of preferred DC subsets. Stromal mesenchymal cells are also activated by these modulation at vascular system and interferes with metastasis of cancer. First, thrombin (human factor II) is a well regulated protein in coagulation hemostasis has a role in cell differentiation and angiogenesis.

Protein kinase activated receptors (PARs), type of GPCRs, moderate the actions. Second, during hematopoietic response endothelial cells produce hematopoietic growth factors (213; 214). Third, components of bone marrow stroma cells include monocytes, adipocytes, and mesenchymal stem cells (215). As a result, addressing this issue will prevent occurrence of coagulapathologies, namely DIC, bleeding, thrombosis, so that patients may also improve response rate towards therapies. Personal genomic profiles are powerful tool to improve efficacy in immunotherapies since there is an influence of age (young vs. adult), state of immune system (innate vs. adopted or acquired immunity). Table 5 includes some of the current studies directly with IDO and indirectly effecting its mechanisms via gene therapy, DNA vaccine, gene silencing and adjuvant applications as an intervention method to prevent various cancer types.

CONCLUSION

IDO has a confined function in immune system through complex interactions to maintain hemostasis of immune responses. The genesis of IDO stem from duplication of bacterial IDO-like genes.  Inhibition of microbial infection and invasion by depleting tryptophan limits and kills the invader but during starvation of trp the host may pass the twilight zone since trp required by host’s T cells.  Thus, the host cells in these small pockets adopt to new microenvironment with depleted trp and oxygen poor conditions. Hence, the cell metabolism differentiate to generate new cellular structure like nodules and tumors under the protection of constitutively expressed IDO in tumors, DCs and inhibited T cell proliferation.

On the other hand, having a dichotomy in IDO function can be a potential limiting factor that means is that IDOs impact on biological system could be variable based on several issues such as target cells, IDO’s capacity, pathologic state of the disease and conditions of the microenvironment. Thus, close monitoring is necessary to analyze the outcome to prevent conspiracies since previous studies generated paradoxical results.

Current therapies through chemotherapies, radiotherapies are costly and effectiveness shown that the clinical interventions require immunotherapies as well as coagulation and vascular biology manipulations for a higher efficacy and survival rate in cancer patients. Our siRNA and DC technologies based on stem cell modulation will provide at least prevention of cancer development and hopefully prevention in cancer.

11.       References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. Induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA.  Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (http://dx.doi.org:/10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197. 33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223, http://dx.doi.org:/10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp. http://dx.doi.org:/10.1038/nature10491.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878. 78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40.
http://dx.doi.org:/10.1016/S0092-8674(00)81696-7.  PMID 9865691.

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810.
http://dx.doi.org:/10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.   http://dx.doi.org:/10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132–     http://dx.doi.org:/10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271,  http://dx.doi.org:/10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31.

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. http://dx.doi.org:/10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606.  http://dx.doi.org:/10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11.  http://dx.doi.org:/10.1126/scisignal.2002963.

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii: S0006-291X(13)00779-1. http://dx.doi.org:/10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

114. What is the role of regulatory T cells in the success of implantation and early pregnancy? Saito, S., Shima, T., Nakashima, A., Shiozaki, A., Ito, M., Sasaki, Y. 2007, J Assist Reprod Genet, pp. 24: 379-386.

115. Sleeping Beauty-based gene therapy with indoleamine 2,3-dioxygenase inhibits lung allograft fibrosis. Liu H, Liu L, Fletcher BS, Visner GA. 2006, FASEB J, pp. 20:2384-2386.

116. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

117. Solid Cancers after Bone Marrow Transplantatioin. Curtis, R.E., Rowlings, P.A., Deeg, J., Schirer, D.A. et al. 1997, The New England Journal of Medicine., pp. 336, No: 13: 897-904.

118. More ADO about IDO; GVHD (commentary). Curti, A., Trabanelli, S., Lemoli, M. 2008, Blood, p. 2950.

119. Jasperson, et al, . 2008, Blood, p. 3257.

120. Tolerance, DCs and tryptophan: much ado about IDO. Grohmann U, Fallarino F, Puccetti P. 2003, Trends Immunol, pp. 24:242-248.

121. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med , pp. 9:1269–74.

122. Indoleamine 2,3-dioxygenase is a critical regulator of acute graft-versus-host disease lethality. Lisa K. Jasperson, Christoph Bucher, Angela Panoskaltsis-Mortari, Patricia A. Taylor, Andrew L. Mellor, David H. Munn, and Bruce R. Blazar. 2008., Blood., pp. 111:3257-3265.

123. The metabolism of tryptophan. 2. The metabolism of tryptophan in patients suffering from cancer of the bladder. . Boyland, E. & Willliams, D.C. 1956, Biochem. J., pp. 64, 578−582 .

124. Tryptophan metabolism in carcinoma of the breast. . Rose, D. 1967, Lancet , pp. 1, 239−241. 

125. Inhibitors of indoleamine-2,3-dioxygenase for cancer therapy: can we see the wood for the trees? . Löb S, Königsrainer A, Rammensee HG, Opelz G, Terness P. 2009;, Nat Rev Cancer , pp. 9:445–52.  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

126. The hallmarks of cancer. . Hanahan, D. & Weinberg, R.A. 2000., Cell., pp. 100, 57−70.

127. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Godin-Ethier, J., Hanafi,L.A., Piccirillo,C.A. and Lapointe, R. 2011, Clin Cancer Res, pp. 17; 6985,  http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

128. Dendritic cell modification as a route to inhibiting corneal graft rejection by the indirect pathway of allorecognition. Khan A, Fu H, Tan LA, Harper JE, Beutelspacher SC, Larkin DF, Lombardi G, McClure MO, George AJ. 2013, Eur J Immunol., pp. 43(3):734-46. http://dx.doi.org:/10.1002/eji.201242914. Epub 2013 Jan 18.

129. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. . Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int., pp. 37(2):105-8.  http://dx.doi.org:/10.1002/cbin.10023. Epub 2013 Jan 2.

130. Implication of indolamine 2,3 dioxygenase in the tolerance toward fetuses, tumors, and allografts. . Dürr S, Kindler V. 2013, J Leukoc Biol. , pp. 93(5):681-7.
http://dx.doi.org:/10.1189/jlb.0712347. Epub 2013 Jan 16.

131. Evidence for a tumoral immune resistance mechanism based on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove C, Pilotte L, Théate I, Stroobant V, Colau D, Parmentier N, et al. 2003, Nat Med, pp. 9:1269–74.

132. NAturally arising CD4+ regulatory T cells for immunologic self-tolerance and negative control of immune responses. Sagaguchi, S. 2004, Annu. Rev. of Immunol., pp. 22: 531-562.

133. Regulatory T cells in transplantation tolerance. Wood, K.J., zZSakaguchi, S.,. 2003, Nat. Rev. Immunol., pp. 3; 199-210.

134. The cell awareness of paternal alloantigens during pregnancy. Tafuri, A., Alferink, J., Hammerling, G.J., Arnold, B. 1995, Science, pp. 270; 630-3.

135. Adenovirus mediated CTLA4Ig transgene therapy alleviates abortion by inhibiting spleen lymphocyte proliferation and regulating apoptosis in the feto-placental unit. Li W, Li B, Li S. 2013, J Reprod Immunol. , pp. 97(2):167-74.

136. A distinct tolerogenic subset of splenic IDO(+)CD11b(+) dendritic cells from orally tolerized mice is responsible for induction of systemic immune tolerance and suppression of collagen-induced arthritis. Park MJ, Park KS, Park HS, Cho ML, Hwang SY, Min SY, Park MK, Park SH, Kim HY. 2012, Cell Immunol. , pp. 278(1-2):45-54. http://dx.doi.org:/10.1016/j.cellimm.2012.06.009. Epub 2012 Jul 10.

137. Pharmacological targeting of IDO-mediated tolerance for treating autoimmune disease. Penberthy, W.T. 2007, Curr. Drug Metab., pp. 8:(3):245-266.

138. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

139. Heme oxygenase-1 plays an important protective role in experimental autoimmune encephalomyelitis. . Liu Y, Zhu B, Luo L, Li P, Paty DW, Cynader MS. 2001., NeuroReport. , pp. 12(9):1841–1845.

140. Tumor vaccines in 2010: need for integration. Koos, D., Josephs, SF, Alexandrescu, DT et al. 2010, Cell Immunol, pp. 263: 138-147.

141. BIN1 is a novel MYC-interacting protein with features of a tumor suppressor. . Sakamuro, D., Elliott, K., Wechsler-Reya, R. & Prendergast, G.C. 1996, Nat. Genet. , pp. 14, 69−77.

142. Expression of Indolamine 2,3-dioxygenase by plasmacytoid dendritic cells in tumor draining nodes. Munn, S.H., Sharma, M.D., Hou, D., Baban, B. et al. 2004, J. Clin. Invest. , pp. 114: 280-290.

143. Indoleamine 2,3-Dioxygenase Expression in Human Cancers: Clinical and Immunologic Perspectives. Jessica Godin-Ethier, Laïla-Aïcha Hanafi, Ciriaco A. Piccirillo, and Réjean Lapointe. 2011 , Clin Cancer Res, pp. 17; 6985, http://dx.doi.org:/10.1158/1078-0432.CCR-11-1331.

144. Potential regulatory function of human dendritic cells expressing indoleamine 2,3-dioxygenase. . Munn, D.H. et al. 2002, Science 297, 1867−1870, pp. 297, 1867−1870 .

145. An HDAC inhibitor enhances cancer therapeutic efficiency of RNA polymerase III promoter-driven IDO shRNA. Yen MC, Weng TY, Chen YL, Lin CC, Chen CY, Wang CY, Chao HL, Chen CS, Lai MD. 2013, Cancer Gene Ther. , p. http://dx.doi.org:/10.1038/cgt.2013.27. [Epub ahead of print].

146. Systemic delivery of Salmonella typhimurium transformed with IDO shRNA enhances intratumoral vector colonization and suppresses tumor growth. Blache CA, Manuel ER, Kaltcheva TI, Wong AN, Ellenhorn JD, Blazar BR, Diamond DJ. 2012, Cancer Res. , pp. 72(24):6447-56.
http://dx.doi.org:/ZZ1158/0008-5472.CAN-12-0193. Epub 2012 Oct 22.

147. Silencing IDO in dendritic cells: a novel approach to enhance cancer immunotherapy in a murine breast cancer model. Zheng X, Koropatnick J, Chen D, Velenosi T, Ling H, Zhang X, Jiang N, Navarro B, Ichim TE, Urquhart B, Min W. 2013, Int J Cancer., pp.132(4):967-77. http://dx.doi.org:/10.1002/ijc.27710. Epub 2012 Jul 20.

148. Immunosuppressive CD14+HLA-DRlow/neg IDO+ myeloid cells in patients following allogeneic hematopoietic stem cell transplantation. Mougiakakos D, Jitschin R, von Bahr L, Poschke I, Gary R, Sundberg B, Gerbitz A, Ljungman P, Le Blanc K. 2013, Leukemia. , pp. 27(2):377-88.
http://dx.doi.org:/10.1038/leu.2012.215. Epub 2012 Jul 25.

149. Upregulated expression of indoleamine 2, 3-dioxygenase in primary breast cancer correlates with increase of infiltrated regulatory T cells in situ and lymph node metastasis. Yu J, Sun J, Wang SE, Li H, Cao S, Cong Y, Liu J, Ren X. 2011, Clin Dev Immunol. , p. 11:469135.
http://dx.doi.org:/10.1155/2011/469135. Epub 2011 Oct 24.

150. Skin delivery of short hairpin RNA of indoleamine 2,3 dioxygenase induces antitumor immunity against orthotopic and metastatic liver cancer. Huang TT, Yen MC, Lin CC, Weng TY, Chen YL, Lin CM, Lai MD. 2011, Cancer Sci. , pp. 102(12):2214-20. http://dx.doi.org:/10.1111/j.1349-7006.2011.02094.x.

151. Indoleamine 2,3-dioxygenase expression in transplanted NOD Islets prolongs graft survival after adoptive transfer of diabetogenic splenocytes. . Alexander AM, Crawford M, Bertera S, et al. 2002, Diabetes. , pp. 51(2):356–365.

152. Prevention of Spontaneous Tumor Development in a ret Transgenic Mouse Model by Ret Peptide Vaccination with Indoleamine 2,3-Dioxygenase Inhibitor 1-Methyl Tryptophan. Zeng, J., Cai, S., Yi, Y., et al. 2009, Cancer Res., pp. 69: 3963-3970,  http://dx.doi.org:/10.1158/0008-5472.CAN-08-2476.

153. Medicinal electronomics bricolage design of hypoxia-targeting antineoplastic drugs and invention of boron tracedrugs as innovative future-architectural drugs. Hori H, Uto Y, Nakata E. 2010, Anticancer Res. , pp. 30(9):3233-42.

154. Synthesis of 4-cyano and 4-nitrophenyl 1,6-dithio-D-manno-, L-ido- and D-glucoseptanosides possessing antithrombotic activity. Bozó E, Gáti T, Demeter A, Kuszmann J. 2002, Carbohydr Res. , pp. 3;337(15):1351-65.

155. Radiopharmaceuticals XXVII. 18F-labeled 2-deoxy-2-fluoro-d-glucose as a radiopharmaceutical for measuring regional myocardial glucose metabolism in vivo: tissue distribution and imaging studies in animals. Gallagher BM, Ansari A, Atkins H, Casella V, Christman DR, Fowler JS, Ido T, MacGregor RR, Som P, Wan CN, Wolf AP, Kuhl DE, Reivich M. 1977, J Nucl Med. , pp. 18(10):990-6.

156. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology, pp. 107:452–460.

157. Induction of indoleamine 2,3-dioxygenase by uropathogenic bacteria attenuates innate responses to epithelial infection. Loughman JA, Hunstad DA. 2012 , J Infect Dis. , pp. 205(12):1830-9.  http://dx.doi.org:/10.1093/infdis/jis280.

158. Inhibition of allogeneic T cell proliferation by indoleamine 2,3-dioxygenase-expressing dendritic cells: mediation of suppression by tryptophan metabolites. . Terness, P., et al. 2002, J. Exp. Med.196:447–457., pp. 196:447–457.

159. The tryptophan catabolite L-kynurenine inhibits the surface expression of NKp46- and NKG2D-activating receptors and regulates NK-cell function. . Chiesa, M.D., et al. 2006, Blood. , pp. 108:4118–4125.38.

160. Differential effects of the tryptophan metabolite 3-hydroxyanthranilic acid on the proliferation of human CD8+ T cells induced by TCR triggering or homeostatic cytokines. Weber, W.P., et al. 2006, Eur. J. Immunol. , pp. 36:296-304.

161. Dendritic cell vaccination against ovarian cancer–tipping the Treg/TH17 balance to therapeutic advantage? Cannon MJ, Goyne H, Stone PJ, Chiriva-Internati M. 2011, Expert Opin Biol Ther. , pp. 11(4):441-5. http://dx.doi.org:/10.1517/14712598.2011.554812.

162. Phenotype, distribution, generation, and functional and clinical relevance of Th17 cells in the human tumor environments. . Kryczek I, Banerjee M, Cheng P, et al. 2009, Blood., pp. 114:1141–1149.

163. The use of dendritic cells in cancer immunitherapy. Schuler, G., Schuker-Turner, B., Steinman, RM, 2003, Curr. Opin. Immunol., pp. 15: 138-147.

164. Clinical applications of dentritic cell vaccines. Morse, MA, Lyerly, HK. 2000, Curr. Opin. Mol Ther., pp. 2:20-28.

165. Vaccination of melanoma patients with peptide or tumor lysate-pulsed dendritic cells. Nestle, FO, Alijagic, S., Gillet, M. et al. 1998, Nat. Med., pp. 4: 328-332.

166. Dentritic cell based tumor vaccination in prostate and renal cell cancer: a systamatic review. Draube, A., Klein-Gonzales, Matheus, S et al. 2011, Plos One, p. 6:e1881.

167. [Online] http://www.fda.gov/BiologicsBloodVaccines/CellularGeneTherapy-Products/ApprovedProducts/ucm210215.htm.

168. Dendritic cell based antitumor vaccination: impact of functional indolamine 2,3-dioxygenase expression. Wobster, m., Voigt, H., Houben, R. et al. 2007, Cancer Immunol Immunother, pp. 56:1017-1024. 169. [Online] oncoimmunology.2012 October1; 1(17):1111-1134,  http://dx.doi.org:/10.4161/onci.21494.

170. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells. Acosta-Rodriguez EV, Napolitani G, Lanzavecchia A, Sallusto F. 2007 , Nat Immunol. , pp. 8(9):942-9.

171. IFNgamma promotes generationof Il-10 secreting CD4+ T cells that suppress generationof CD8responses in an antigen-experienced host. Liu, X.S., Leerberg, J., MacDonald, K., Leggatt, G.R., Frazer, I.H. 2009, J. Immunol., pp. 183: 51-58.

172. Antigen, in the presence of TGF-beta, induces up-regulationof FoxP3gfp+ in CD4+ TCR transgenic T cells that mediate linked supressionof CD8+ T cell responses. . Kapp, J.A., Honjo, K., Kapp, L.M., Goldsmith, K., Bucy, R.P. 2007, J. Immunol., pp. 179: 2105-2114.

173. Opposing effects of TGF-beta and IL-15 cytokines control the number of short lived effecctor CD8+ T cells. Sanjabi, S, Mosaheb, M.M., Flavell, R.A. 2009, Immunity., pp. 31; 131-144.

174. Synergestic enhancement of CD8+ T cell mediated tumor vaccines efficacy by an anti-tumor forming growth factor-beta monoclonal antibody. . Terabe, M., Ambrosino, E., Takaku, S. et al. 2009, Clin. Cancer Res., pp. 15; 6560-9.

175. IL-12 enhances CTL synapse formationand induces self-reactivity. Markinewicz, MA, Wise, EL, Buchwald, ZS et al. 2009, J. Immunol., pp. 182: 1351-1362.

176. Tumor specific Th17-polarized cells eradicate large established melanoma. Muranski, P., Boni, A., Antony, PA, et al. 2008, Blood, pp. 112; 362-373.

177. Type17 CD8+ T cells dispplay enhanced antitumor immunity. Hinrichs, C.S., Kaiser, A., Paulos, C.M., et al. 2008, Blood., pp. 112:362-373.

178. Marying Immunotherapy with Chemotherapy: Why Say IDO? Muller, AJ, and Prendergrast, GC. 2005, Cancer Research, pp. 65: 8065-8068.

179. Enhancing Cancer Vaccine efficacy via Modulationof the Tumor Environment. Disis, ML. 2009, Clin Cancer Res, pp. 15: 6476-6478.

180. Systemic inhibition of transforming growth factor beta 1 in glioma bearing mice improves the therapeutic efficacy of glioma-associated antigen peptide vaccines. Ueda, R., Fujita, M., Zhu, X., et al. 2009, Clin. Cancer res., pp. 15: 6551-9.

181. Immune modulation by silencing IL-12 productionin dendritic cells using smal interfering RNA. Hill, JA, Ichim, TE, Kusznieruk, KP, et al. 2003, J. Immunol, pp. 171:809-813.

182. Immune modulation and tolerance induction by RelB-silenced dentritic cells through RNA interference. Li, M. Zang, X, Zheng, X, et al. 2007, J. Immunol, pp. 178: 5480-7.

183. RNAi mediated CD40-CD54 interruption promotes tolerance in autoimmune arthritis. . Zheng, X., Suzuki, M., Zhang, X., et al. 2010, Arthritis Res. Ther., p. 12:R13.

184. Dendritic cells genetically engineered to express Fas ligand induce donor-specific hyporesponsiveness and prolong allograft survival. Min, WP. Gorczynki, R., huang, XY et al. 2000, J. Immunol., pp. 164:161-167.

185. LF15-0195 generates tolerogenic dendritic cells by supressionof NF-kappaB signaling through inhibitionof IKK activity. . Yang, J., Bernier, SM, Ichim, TE, et al. 2003, J Leukoc. Biol., pp. 74: 438-447.

186. RNA interfrence: A potent tool for gene specific therapeutics. . Ichim, TE, Li, M., Qian, H., Popov, HI, Rycerz, K., Zheng, X., White, D., Zhong, R., and Min, WP. 2004, Am. J. Transplant, pp. 4:1227-1236.

187. A novel in vivo siRNA delivery system specifically targeting dendritic cells and silencing CD40 genes for immunomodulation. Zheng, X., Vladau, C., Zhang, X. et al. 2009, Blood, pp. 113:2646-2654.

188. Reinstalling Antitumor Immunity by Inhibiting Tumor derived ImmunoSupressive Molecule IDO through RNA interference. Zheng, X et al. 2006, Int. Journal of Immunology., pp. 177:5639-5646.

189. Roles of TGFbeta in metastasis. Padua, D., Massague, J. 2009, Cell Res., pp. 19;89-102.

190. Functional expression of indolamine2,3-dioxygenase by murine CDalpha+dendritic cells. Fallarino, F., Vacca, C, Orabona, C et al. 2002, Int Immunol., pp. 14:65-8.

191. Indolamine2,3-dioxygenase controls conversion of Fox3+ Tregs to TH17-like cells in tumor draining lymph nodes. Sharma, MD, Hou, DY, Liu, Y et al. 2009, Blood, pp.113: 6102-11.

192. IDO upregulates regulatory T cells via tryptoophan catabolite and supresses encephalitogenic T cell responses in experimental autoimmune encephalomyelitis. Yan, Y, Zhang, GX, Gran, B et al. 2010, J Immunol, pp. 185; 5953-61.

193. IDO activates regulatory T cells and blocks their conversion into Th-17-like T cells. Baban, B, Chandler, PR, Sharma, MD et al. 2009, J Immunol, pp. 183; 2475-83.

194. Enhancement of vaccine-mediated antitumor immunity in cancer patients after depletionof regulatory T cells. Dannull, J., Farrand, KJ, Mathews, SA, et al. 2005, J Clin Invest, pp. 115: 3623-33.

195. 1-MT enhances potency of tumor cell lysate pulled dentritic cells against pancreatic adenocarcinoma by downregulating percentage of Tregs. Li, Y, Xu, J, Zhou, H. et al. 2010, J Huazhong Univ Sci Technol Med Sci , pp. 30: 344-8.

196. siRNA mediated antitumorigenesis for drug target validation and therapeutics. Lu, PY, Xie, FY and Woodle, MC. 2003, Curr Opin Mol. Ther., pp. 5:225-234.

197. Stable supression of tumorigenicity by virus-mediated RNA interference. Brumellkamp, TR, Bernards, R, Agami, R. 2002, Cancer Cell, pp. 2; 243-247.

198. Small interferring RNAs directed against beta-catenin inhibit the in vitro and in vivo growth of colon cancer cells. Verma, UN, Surabhi, RM, Schmaltieg, A., Becerra, C., Gaynor, RB. 2003, Clin. Cancer. Res., pp. 9:1291-1300.

199. siRNA mediated inhibition of vascular endothelial growth factor severely limits tumor resistance to antiangiogeneic thromboposdin-1 and slows tumor vascularization and growth. Filleur, S., Courtin, A, Ait-Si-Ali, S., Guglielmi, J., Merel, C., Harel-Bellan, A., CLezardin, P., and Cabon, F. 2003, Cancer Res, pp. 63; 3919-3922.

200. Kynurenic acid as a ligand for orphan G protein-coupled receptor GPR35. . Wang, J., et al. 2006, J. Biol.Chem. , pp. 281:22021–22028. 201. Bin1 functionally interacts with Myc in cells and inhibits cell proliferation by multiple mechanisms. Elliott, K. et al. 1999, Oncogene , pp. 18, 3564−3573 .

202. Mechanism for elimination of a tumor suppressor: aberrant splicing of a brain-specific exon causes loss of function of Bin1 in melanoma. . Ge, K. et al. 1999, Proc. Natl. Acad. Sci. USA, pp. 96, 9689−9694. 

203. Losses of the tumor suppressor Bin1 in breast carcinoma are frequent and reflect deficits in a programmed cell death capacity. Ge, K. et al. 2000, Int. J. Cancer , pp. 85, 376−383.

204. Loss of heterozygosity and tumor suppressor activity of Bin1 in prostate carcinoma. Ge, K. et al. 2000, Int. J. Cancer , pp. 86, 155−161.

205. Expression of a MYCN-interacting isoform of the tumor suppressor BIN1 is reduced in neuroblastomas with unfavorable biological features. . Tajiri, T. et al. 2003, Clin. Cancer Res., pp. 9, 3345−3355.

206. Targeted deletion of the suppressor gene Bin1/Amphiphysin2 enhances the malignant character of transformed cells. Muller, A.J., DuHadaway, J.B., Donover, P.S., Sutanto-Ward, E. & Prendergast, G.C. 2004, Cancer Biol. Ther. , p. 3.

207. Interactions of myogenic factors and the retinoblastoma protein mediates muscle commitment and cell differentiation. Gu, WJ., Scheniider,W., Condrolli,G., Kaushal,, S, Mahdavi,V., Nadal-Gnard, B. 1993, Cell, pp. 72; 309-324.

208. Structural analysis of the human BIN1 gene: evidence of tissue-specific transcriptional regualtion and alternate splicing. Wechsler-Reya, R, Sakamuro, J., Zhang, J., DuHadaway, J., and Predengast. 1998, J of Biol Chem.

209. A role for th ePutative Tuimor Supressor Bin1 in Muscle Differentiation. Wechsler-Reya, R., Elliott, KJ, Prendergast, GC. 1998, Molecular and Cellular Biology, p. 18 (1) :566.

210. The putative tumor repressor BIN1 is a short lived nuclear phosphoprotein whose localization is altered in malignant cells. Wechsler-Reya, R., Elliot, K., Herlyn, M., Prendergast, GC. 1997, Cancer Res, pp. 57: 3258-3263.

211. Transformation selective apoptosis by farnesyltransferase inhibitors requires Bin1. DuHadaway, J.B. et al. 2003, Oncogene, pp. 22, 3578−3588 (2003).

212. The c-Myc-interacting adapter protein Bin1 activates a caspase-independent cell death program. Elliott, K., Ge, K., Du, W. & Prendergast, G.C. 2000., Oncogene , pp. 19, 4669−4684.

213. Growth stimulation of human bone marrow cells in agar culture by vascular cells. Knudtzon, S., and Mortensen, BT. 1975, Blood, pp. 46 (6) 937-943.

214. Exogenous endothelial cells as accelerators of hematopoietic reconstitution. Mizer, C., Ichim, TE, Alexandrescu, DT, DAsanu, CA, Ramos, F., Turner, A., Woods, EJ, Bogon, V., Murphy, MP, Koos, D., and Patel, A. 2013, J. Translational Medicine, p. 10: 231.

215. Dissecting the bone marrow microenvironment . Torok-Storb, B. et al. 1999, Annals of New York Academy of Science, pp. 872: 164-170. 217. Yuasa, XX and Ball YY. 2011.

218. Possible role of the ‘IDO-AhR axis’ in maternal-foetal tolerance. Hao K, Zhou Q, Chen W, Jia W, Zheng J, Kang J, Wang K, Duan T. 2013, Cell Biol Int. , pp. 37(2):105-8. http://dx.doi.org:/10.1002/cbin.10023.

219. Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

220. Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

Read Full Post »

 

Abstract:

The immune response mechanism is the holy grail of the human defense system for health.   IDO, indolamine 2, 3-dioxygenase, is a key gene for homeostasis of immune responses and producing an enzyme catabolizing the first rate-limiting step in tryptophan degradation metabolism. The hemostasis of immune system is complicated.  In this review, the  properties of IDO such as basic molecular genetics, biochemistry and genesis will be discussed.

IDO belongs to globin gene family to carry oxygen and heme.  The main function and genesis of IDO comes from the immune responses during host-microbial invasion and choice between tolerance and immunegenity.  In human there are three kinds of IDOs, which are IDO1, IDO2, and TDO, with distinguished mechanisms and expression profiles. , IDO mechanism includes three distinguished pathways: enzymatic acts through IFNgamma, non-enzymatic acts through TGFbeta-IFNalpha/IFNbeta and moonlighting acts through AhR/Kyn.

The well understood functional genomics and mechanisms is important to translate basic science for clinical interventions of human health needs. In conclusion, overall purpose is to find a method to manipulate IDO to correct/fix/modulate immune responses for clinical applications.

The first part of the review concerns the basic science information gained overall several years that lay the foundation where translational research scientist should familiar to develop a new technology for clinic. The first connection of IDO and human health came from a very natural event that is protection of pregnancy in human. The focus of the translational medicine is treatment of cancer or prevention/delay cancer by stem cell based Dendritic Cell Vaccine (DCvax) development.

Table of Contents:

  • Abstract

1         Introduction: IDO gene encodes a heme enzyme

2        Location, location, location

3        Molecular genetics

4        Types of IDO:

4.1       IDO1,

4.2       IDO2,

4.3       IDO-like proteins

5        Working mechanisms of IDO

6        Infection Diseases and IDO

7. Conclusion

  1. 1.     Indoleamine 2, 3-dioxygenase (IDO) gene encodes a heme enzyme

IDO is a key homeostatic regulator and confined in immune system mechanism for the balance between tolerance and immunity.  This gene encodes indoleamine 2, 3-dioxygenase (IDO) – a heme enzyme (EC=1.13.11.52) that catalyzes the first rate-limiting step in tryptophan catabolism to N-formyl-kynurenine and acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin.

The basic genetic information describes indoleamine 2, 3-dioxygenase 1 (IDO1, IDO, INDO) as an enzyme located at Chromosome 8p12-p11 (5; 6) that active at the first step of the Tryptophan catabolism.    The cloned gene structure showed that IDO contains 10 exons ad 9 introns (7; 8) producing 9 transcripts.

After alternative splicing only five of the transcripts encode a protein but the other four does not make protein products, three of transcripts retain intron and one of them create a nonsense code (7).  Based on IDO related studies 15 phenotypes of IDO is identified, of which, twelve in cancer tumor models of lung, kidney, endometrium, intestine, two in nervous system, and one HGMD- deletion.

  1. 2.     Location, Location and Location

The specific cellular location of IDO is in cytosol, smooth muscle contractile fibers and stereocilium bundle. The expression specificity shows that IDO is present very widely in all cell types but there is an elevation of expression in placenta, pancreas, pancreas islets, including dendritic cells (DCs) according to gene atlas of transcriptome (9).  Expression of IDO is common in antigen presenting cells (APCs), monocytes (MO), macrophages (MQs), DCs, T-cells, and some B-cells. IDO present in APCs (10; 11), due to magnitude of role play hierarchy and level of expression DCs are the better choice but including MOs during establishment of three DC cell subset, CD14+CD25+, CD14++CD25+ and CD14+CD25++ may increase the longevity and efficacy of the interventions.

IDO is strictly regulated and confined to immune system with diverse functions based on either positive or negative stimulations. The positive stimulations are T cell tolerance induction, apoptotic process, and chronic inflammatory response, type 2 immune response, interleukin-12 production (12).  The negative stimulations are interleukin-10 production, activated T cell proliferation, T cell apoptotic process.  Furthermore, there are more functions allocating fetus during female pregnancy; changing behavior, responding to lipopolysaccharide or multicellular organismal response to stress possible due to degradation of tryptophan, kynurenic acid biosynthetic process, cellular nitrogen compound metabolic process, small molecule metabolic process, producing kynurenine process (13; 14; 15).

IDO plays a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity (16; 17; 18; 19).

 

 3.     Molecular Genetics of IDO:

A: Structure of human IDO2 gene and transcripts. Complete coding region is 1260 bps encoding a 420 aa polypeptide. Alternate splice isoforms lacking the exons indicated are noted. Hatch boxes represent a frameshift in the coding region to an alternate reading frame leading to termination. Black boxes represent 3' untranslated regions. Nucleotide numbers, intron sizes, and positioning are based on IDO sequence files NW_923907.1 and GI:89028628 in the Genbank database. (reference: http://atlasgeneticsoncology.org/Genes/IDO2ID44387ch8p11.html)

A: Structure of human IDO2 gene and transcripts. Complete coding region is 1260 bps encoding a 420 aa polypeptide. Alternate splice isoforms lacking the exons indicated are noted. Hatch boxes represent a frameshift in the coding region to an alternate reading frame leading to termination. Black boxes represent 3′ untranslated regions. Nucleotide numbers, intron sizes, and positioning are based on IDO sequence files NW_923907.1 and GI:89028628 in the Genbank database.
(reference: http://atlasgeneticsoncology.org/Genes/IDO2ID44387ch8p11.html)

Molecular genetics data from earlier findings based on reporter assay results showed that IDO promoter is regulated by ISRE-like elements and GAS-sequence at -1126 and -1083 region (20).  Two cis-acting elements are ISRE1 (interferon sequence response element 1) and interferon sequence response element 2 (ISRE2).

Analyses of site directed and deletion mutation with transfected cells demonstrated that introduction of point mutations at these elements decreases the IDO expression. Removing ISRE1 decreases the effects of IFNgamma induction 50 fold and deleting ISRE1 at -1126 reduced by 25 fold (3). Introducing point mutations in conserved t residues at -1124 and -1122 (from T to C or G) in ISRE consensus sequence NAGtttCA/tntttNCC of IFNa/b inducible gene ISG4 eliminates the promoter activity by 24 fold (21).

ISRE2 have two boxes, X box (-114/1104) and Y Box 9-144/-135), which are essential part of the IFNgamma response region of major histocompatibility complex class II promoters (22; 23).  When these were removed from ISRE2 or introducing point mutations at two A residues of ISRE2 at -111 showed a sharp decrease after IFNgamma treatment by 4 fold (3).

The lack of responses related to truncated or deleted IRF-1 interactions whereas IRF-2, Jak2 and STAT91 levels were similar in the cells, HEPg2 and ME180 (3). Furthermore, 748 bp deleted between these elements did not affect the IDO expression, thus the distance between ISRE1 and ISRE2 elements have no function or influence on IDO (3; 24)

B: Amino acid alignment of IDO and IDO2. Amino acids determined by mutagenesis and the crystal structure of IDO that are critical for catalytic activity are positioned below the human IDO sequence. Two commonly occurring SNPs identified in the coding region of human IDO2 are shown above the sequence which alter a critical amino acid (R248W) or introduce a premature termination codon (Y359stop).

B: Amino acid alignment of IDO and IDO2. Amino acids determined by mutagenesis and the crystal structure of IDO that are critical for catalytic activity are positioned below the human IDO sequence. Two commonly occurring SNPs identified in the coding region of human IDO2 are shown above the sequence which alter a critical amino acid (R248W) or introduce a premature termination codon (Y359stop).

4.     There are three types of IDO in human genome:

IDO was originally discovered in 1967 in rabbit intestine (25). Later, in 1990 the human IDO gene is cloned and sequenced (7).  However, its importance and relevance in immunology was not created until prevention of allocation of fetal rejection and founding expression in wide range of human cancers (26; 27).

There are three types of IDO, pro-IDO like, IDO1, and IDO2.  In addition, another enzyme called TDO, tryptophan 2, 3, dehydrogenase solely degrade L-Trp at first-rate limiting mechanism in liver and brain.

4.1.  IDO1:

IDO1 mechanism is the target for immunotherapy applications. The initial discovery of IDO in human physiology is protection of pregnancy (1) since lack of IDO results in premature recurrent abortion (28; 26; 29).   The initial rate-limiting step of tryptophan metabolism is catalyzed by either IDO or tryptophan 2, 3-dioxygenase (TDO).

Structural studies of IDO versus TDO presenting active site environments, conserved Arg 117 and Tyr113, found both in TDO and IDO for the Tyr-Glu motif, but His55 in TDO replaced by Ser167b in IDO (30; 2). As a result, they are regulated with different mechanisms (1; 2) (30).  The short-lived TDO, about 2h, responds to level of tryptophan and its expression regulated by glucorticoids (31; 32).  Thus, it is a useful target for regulation and induced by tryptophan so that increasing tryptophan induces NAD biosynthesis. Whereas, IDO is not activated by the level of Trp presence but inflammatory agents with its interferon stimulated response elements (ISRE1 and ISRE2) in its (33; 34; 35; 36; 3; 10) promoter.

TDO promoter contains glucorticoid response elements (37; 38) and regulated by glucocorticoids and other available amino acids for gluconeogenesis. This is how IDO binds to only immune response cells and TDO relates to NAD biosynthesis mechanisms. Furthermore, TDO is express solely in liver and brain (36).  NAD synthesis (39) showed increased IDO ubiquitous and TDO in liver and causing NAD level increase in rat with neuronal degeneration (40; 41).  NAM has protective function in beta-cells could be used to cure Type1 diabetes (40; 42; 43). In addition, knowledge on NADH/NAD, Kyn/Trp or Trp/Kyn ratios as well as Th1/Th2, CD4/CD8 or Th17/Threg are equally important (44; 40).

Active site of IDO–PI complex. (A) Stereoview of the residues around the heme of IDO viewed from the side of heme plane. The proximal ligand H346 is H-bonded to wa1. The 6-propionate of the heme contacts with wa2 and R343 Nε. The wa2 is H-bonded to wa1, L388 O, and 6-propionate. Mutations of F226, F227, and R231 do not lose the substrate affinity but produce the inactive enzyme. Two CHES molecules are bound in the distal pocket. The cyclohexan ring of CHES-1 (green) contacts with F226 and R231. The 7-propionate of the heme interacts with the amino group of CHES-1 and side chain of Ser-263. The mutational analyses for these distal residues are shown in Table 1. (B) Top view of A by a rotation of 90°. The proximal residues are omitted. (http://www.pnas.org/content/103/8/2611/F3.expansion.html)

Active site of IDO–PI complex. (A) Stereoview of the residues around the heme of IDO viewed from the side of heme plane. The proximal ligand H346 is H-bonded to wa1. The 6-propionate of the heme contacts with wa2 and R343 Nε. The wa2 is H-bonded to wa1, L388 O, and 6-propionate. Mutations of F226, F227, and R231 do not lose the substrate affinity but produce the inactive enzyme. Two CHES molecules are bound in the distal pocket. The cyclohexan ring of CHES-1 (green) contacts with F226 and R231. The 7-propionate of the heme interacts with the amino group of CHES-1 and side chain of Ser-263. The mutational analyses for these distal residues are shown in Table 1. (B) Top view of A by a rotation of 90°. The proximal residues are omitted. (http://www.pnas.org/content/103/8/2611/F3.expansion.html)

4.2. IDO2:

The third type of IDO, called IDO2 exists in lower vertebrates like chicken, fish and frogs (45) and in human with differential expression properties. The expression of IDO2 is only in DCs, unlike IDO1 expresses on both tumors and DCs in human tissues.  Yet, in lower invertebrates IDO2 is not inhibited by general inhibitor of IDO, D-1-methyl-tryptophan (1MT) (46).   Recently, two structurally unusual natural inhibitors of IDO molecules, EXIGUAMINES A and B, are synthesized (47).  LIP mechanism cannot be switch back to activation after its induction in IDO2 (46).

Crucial cancer progression can continue with production of IL6, IL10 and TGF-beta1 to help invasion and metastasis.  Inclusion of two common SNPs affects the function of IDO2 in certain populations.  SNP1 reduces 90% of IDO2 catalytic activity in 50% of European and Asian descent and SNP2 produce premature protein through inclusion of stop-codon in 25% of African descent lack functional IDO2 (Uniport).

4.3. IDO-like proteins: The Origin of IDO:

Knowing the evolutionary steps will helps us to identify how we can manage the regulator function to protect human health in cancer, immune disorders, diabetes, and infectious diseases.

Bacterial IDO has two types of IDOs that are group I and group II IDO (48).  These are the earliest version of the IDO, pro-IDO like, proteins with a quite complicated function.  Each microorganism recognized by a specific set of receptors, called Toll-Like Receptors (TLR), to activate the IDO-like protein expression based on the origin of the bacteria or virus (49; 35).   Thus, the genesis of human IDO originates from gene duplication of these early bacterial versions of IDO-like proteins after their invasion interactions with human host.  IDO1 only exists in mammals and fungi.

Fungi also has three types of IDO; IDOa, IDO beta, and IDO gamma (50) with different properties than human IDOs, perhaps multiple IDO is necessary for the world’s decomposers.

All globins, haemoglobins and myoglobins are destined to evolve from a common ancestor, which  is only 14-16kDa (51) length. Binding of a heme and being oxygen carrier are central to the enzyme mechanism of this family.  Globins are classified under three distinct origins; a universal globin, a compact globin, and IDO-like globin (52) IDO like globin widely distributed among gastropodic mollusks (53; 51).  The indoleamine 2, 3-dioxygenase 1–like “myoglobin” (Myb) was discovered in 1989 in the buccal mass of the abalone Sulculus diversicolor (54).

The conserved region between Myb and IDO-like Myb existed for at least 600 million years (53) Even though the splice junction of seven introns was kept intact, the overall homolog region between Myb and IDO is only about 35%.

No significant evolutionary relationship is found between them after their amino acid sequence of each exon is compared to usual globin sequences. This led the hint that molluscan IDO-like protein must have other functions besides carrying oxygen, like myoglobin.   Alignment of S. cerevisiae cDNA, mollusk and vertebrate IDO–like globins show the key regions for controlling IDO or myoglobin function (55). These data suggest that there is an alternative pathways of myoglobin evolution.  In addition, understanding the diversity of globin may help to design better protocols for interventions of diseases.

Mechanisms of IDO:

The dichotomy of IDO mechanism lead the discovery that IDO is more than an enzyme as a versatile regulator of innate and adaptive immune responses in DCs (66; 67; 68). Meantime IDO also involve with Th2 response and B cell mediated autoimmunity showing that it has three paths, short term (acute) based on enzymatic actions, long term (chronic) based on non-enzymatic role, and moonlighting relies of downstream metabolites of tryptophan metabolism (69; 70).

IFNgamma produced by DC, MQ, NK, NKT, CD4+ T cells and CD8+ T cells, after stimulation with IL12 and IL8.  Inflammatory cytokine(s) expressed by DCs produce IFNgamma to stimulate IDO’s enzymatic reactions in acute response.  Then, TDO in liver and tryptophan catabolites act through Aryl hydrocarbon receptor induction for prevention of T cell proliferation. This mechanism is common among IDO, IDO2 (expresses in brain and liver) and TDO expresses in liver) provide an acute response for an innate immunity (30). When the pDCs are stimulated with IFNgamma, activation of IDO is go through Jak, STAT signaling pathway to degrade Trp to Kyn causing Trp depletion. The starvation of tryptophan in microenvironment inhibits generation of T cells by un-read t-RNAs and induce apoptosis through myc pathway.  In sum, lack of tryptophan halts T cell proliferation and put the T cells in apoptosis at S1 phase of cell division (71; 62).

The intermediary enzymes, functioning during Tryptophan degradation in Kynurenine (Kyn) pathway like kynurenine 3-hydroxylase and kynureninase, are also induced after stimulation with liposaccaride and proinflammatory cytokines (72). They exhibit their function in homeostasis through aryl-hydrocarbon receptor (AhR) induction by kynurenine as an endogenous signal (73; 74).  The endogenous tumor-promoting ligand of AhR are usually activated by environmental stress or xenobiotic toxic chemicals in several cellular processes like tumorigenesis, inflammation, transformation, and embryogenesis (Opitz ET. Al, 2011).

Human tumor cells constitutively produce TDO also contributes to production of Kyn as an endogenous ligand of the AhR (75; 27).  Degradation of tryptophan by IDO1/2 in tumors and tumor-draining lymph nodes occur. As a result, there are animal studies and Phase I/II clinical trials to inhibit the IDO1/2 to prevent cancer and poor prognosis (NewLink Genetics Corp. NCT00739609, 2007).

 IDO mechanism for immune response

Systemic inflammation (like in sepsis, cerebral malaria and brain tumor) creates hypotension and IDO expression has the central role on vascular tone control (63).  Moreover, inflammation activates the endothelial coagulation activation system causing coagulopathies on patients.  This reaction is namely endothelial cell activation of IDO by IFNgamma inducing Trp to Kyn conversion. After infection with malaria the blood vessel tone has decreases, inflammation induce IDO expression in endothelial cells producing Kyn causing decreased trp, lower arterial relaxation, and develop hypotension (Wang, Y. et. al 2010).  Furthermore, existing hypotension in knock out Ido mice point out a secondary mechanism driven by Kyn as an endogenous ligand to activate non-canonical NfKB pathway (63).

Another study also hints this “back –up” mechanism by a significant outcome with a differential response in pDCs against IMT treatment.  Unlike IFN gamma conditioned pDC blocks T cell proliferation and apoptosis, methyl tryptophan fails to inhibit IDO activity for activating naïve T cells to make Tregs at TGF-b1 conditioned pDCs (77; 78).

 Indoleamine-Pyrrole 2,3,-Dioxygenase; IDO dioxygenase; Indeolamine-2,3

The second role of the IDO relies on non-enzymatic action as being a signal molecule. Yet, IDO2 and TDO are devoid of this function. This role mainly for maintenance of microenvironment condition. DCs response to TGFbeta-1 exposure starts the kinase Fyn induce phosphorylation of IDO-associated immunoreceptor tyrosine–based inhibitory motifs (ITIMs) for propagation of the downstream signals involving non-canonical (anti-inflammatory) NF-kB pathway for a long term response. When the pDCs are conditioned with TGF-beta1 the signaling (68; 77; 78) Phospho Inositol Kinase3 (PIK-3)-dependent and Smad independent pathways (79; 80; 81; 82; 83) induce Fyn-dependent phosphorylation of IDO ITIMs.  A prototypic ITIM has the I/V/L/SxYxxL/V/F sequence (84), where x in place of an amino acid and Y is phosphorylation sites of tyrosines (85; 86).

Smad independent pathway stimulates SHP and PIK3 induce both SHP and IDO phosphorylation. Then, formed SHP-IDO complex can induce non-canonical (non-inflammatory) NF-kB pathway (64; 79; 80; 82) by phosphorylation of kinase IKKa to induce nuclear translocation of p52-Relb towards their targets.  Furthermore, the SHP-IDO complex also may inhibit IRAK1 (68). SHP-IDO complex activates genes through Nf-KB for production of Ido1 and Tgfb1 genes and secretion of IFNalpha/IFNbeta.  IFNa/IFNb establishes a second short positive feedback loop towards p52-RelB for continuous gene expression of IDO, TGFb1, IFNa and IFNb (87; 68).  However, SHP-IDO inhibited IRAK1 also activates p52-RelB.  Nf-KB induction at three path, one main and two positive feedback loops, is also critical.  Finally, based on TGF-beta1 induction (76) cellular differentiation occurs to stimulate naïve CD4+ T cell differentiation to regulatory T cells (Tregs).  In sum, TGF-b1 and IFNalpha/IFNbeta stimulate pDCs to keep inducing naïve T cells for generation of Treg cells at various stages, initiate, maintain, differentiate, infect, amplify, during long-term immune responses (67; 66).

Moonlighting function of Kyn/AhR is an adaptation mechanism after the catalytic (enzymatic) role of IDO depletes tryptophan and produce high concentration of Kyn induce Treg and Tr1 cell expansion leading Tregs to use TGFbeta for maintaining this environment (67; 76). In this role, Kyn pathway has positive-feedback-loop function to induce IDO expression.

In T cells, tryptophan starvation induces Gcn2-dependent stress signaling pathway, which initiates uncharged Trp-tRNA binding onto ribosomes. Elevated GCN2 expression stimulates elF2alfa phosphorylation to stop translation initiation (88). Therefore, most genes downregulated and LIP, an alternatively initiated isoform of the b/ZIP transcription factor NF-IL6/CEBP-beta (89).

This mechanism happens in tumor cells based on Prendergast group observations. As a result, not only IDO1 propagates itself while producing IFNalpha/IFNbeta, but also demonstrates homeostasis choosing between immunegenity by production of TH17or tolerance by Tregs. This mechanism acts like a see-saw. Yet, tolerance also can be broken by IL6 induction so reversal mechanism by SOC-3 dependent proteosomal degradation of the enzyme (90).  All proper responses require functional peripheral DCs to generate mature DCs for T cells to avoid autoimmunity (91).

Niacin (vitamin B3) is the final product of tryptophan catabolism and first molecule at Nicotinomic acid (NDA) Biosynthesis.  The function of IDO in tryptophan and NDA metabolism has a great importance to develop new clinical applications (40; 42; 41).  NAD+, biosynthesis and tryptophan metabolisms regulate several steps that can be utilize pharmacologically for reformation of healthy physiology (40).

IDO for protection in Microbial Infection with Toll-like Receptors

The mechanism of microbial response and infectious tolerance are complex and the origination of IDO based on duplication of microbial IDO (49).  During microbial responses, Toll-like receptors (TLRs) play a role to differentiate and determine the microbial structures as a ligand to initiate production of cytokines and pro-inflammatory agents to activate specific T helper cells (92; 93; 94; 95). Uniqueness of TLR comes from four major characteristics of each individual TLR by ligand specificity, signal transduction pathways, expression profiles and cellular localization (96). Thus, TLRs are important part of the immune response signaling mechanism to initiate and design adoptive responses from innate (naïve) immune system to defend the host.

TLRs are expressed cell type specific patterns and present themselves on APCs (DCs, MQs, monocytes) with a rich expression levels (96; 97; 98; 99; 93; 100; 101; 102; 87). Induction signals originate from microbial stimuli for the genesis of mature immune response cells.  Co-stimulation mechanisms stimulate immature DCs to travel from lymphoid organs to blood stream for proliferation of specific T cells (96).  After the induction of iDCs by microbial stimuli, they produce proinflammatory cytokines such as TNF and IL-12, which can activate differentiation of T cells into T helper cell, type one (Th1) cells. (103).

Utilizing specific TLR stimulation to link between innate and acquired responses can be possible through simple recognition of pathogen-associated molecular patterns (PAMPs) or co-stimulation of PAMPs with other TLR or non-TLR receptors, or even better with proinflammatory cytokines.   Some examples of ligand- TLR specificity shown in Table1, which are bacterial lipopeptides, Pam3Cys through TLR2 (92; 104; 105).  Double stranded (ds) RNAs through TLR3 (106; 107), Lipopolysaccharide (LPS) through TLR4, bacterial flagellin through TLR5 (108; 109), single stranded RNAs through TLR7/8 (97; 98), synthetic anti-viral compounds imiquinod through TLR 7 and resiquimod through TLR8, unmethylated CpG DNA motifs through TLR9 (Krieg, 2000).

IDO action

Then, the specificity is established by correct pairing of a TLR with its proinflammatory cytokines, so that these permutations influence creation and maintenance of cell differentiation. For example, leading the T cell response toward a preferred Th1 or Th2 response possible if the cytokines TLR-2 mediated signals induce a Th2 profile when combined with IL-2 but TLR4 mediated signals lean towards Th1 if it is combined with IL-10 or Il-12, (110; 111)  (112).

TLR ligand TLR Reference
Lipopolysaccharide, LPS TLR4 (96).  (112).
Lipopeptides, Pam3Cys TLR2 (92; 104; 105)
Double stranded (ds) RNAs TLR3 (106; 107)
Bacterial flagellin TLR5 (108; 109)
Single stranded RNAs TLR7/8 (97; 98)
Unmethylated CpG DNA motifs TLR9 (Krieg, 2000)
Synthetic anti-viral compounds imiquinod and resiquimod TLR7 and TLR8 (Lee J, 2003)

Furthermore, if the DCs are stimulated with IL-6, DCs relieve the suppression of effector T cells by regulatory T cells (113).

The modification of IDO+ monocytes manage towards specific subset of T cell activation with specific TLRs are significantly important (94).

The type of cell with correct TLR and stimuli improves or decreases the effectiveness of stimuli. Induction of IDO in monocytes by synthetic viral RNAs (isRNA) and CMV was possible, but not in monocyte derived DCs or TLR2 ligand lipopeptide Pam3Cys since single- stranded RNA ligands target TLR7/8 in monocytes derive DCs only (Lee J, 2003).  These data show that TLRs has ligand specificity, signal transduction pathways, expression profiles and cellular localization so design of experiments should follow these rules.

Conclusion:

Overall our purpose of this information is to find a method to manipulate IDO to correct/fix/modulate immune responses for clinical applications.  This first part of the review concerns the basic science information gained overall several years that lay the foundation that translational research scientist should familiar to develop a new technology for clinic. The first connection of IDO and human health came from a very natural event that is protection of pregnancy in human. The focus of the translational medicine is treatment of cancer or prevention/delay cancer by stem cell based Dendritic Cell Vaccine (DCvax) development.

References

1. Biochemistry of tryptophan in health and disease. BenderDA. 1983, Mol Aspects Med , pp. 6:101–197.

2. Molecular insights into substrate recognition and catalysis by indolamine 2,3-dioxygenase. Forouhar, F., Anderson, R., Mowat, C.F, et al. 2006, PNAS, pp. vol. 104, no:2, 473-478.

3. Importance of the Two Interferon-stimulated Response Element. Konan KV, Taylor, MW. 1996, J. Biol. Chem.-, pp. 19140-5.

4. induction of indolamine 2,3 dioxygenase: A mechanism of the anti-tumor activity of interferon gamma. Ozaki, Y., Edelstein, M.P., Duch, D.S. 1998, PNAS USA., pp. vol:85, 1242-1246.

5. Localization of the human indoleamine 2,3-dioxygenase (IDO) gene to the pericentromeric region of human chromosome 8. . Burkin, D. J., Kimbro, K. S., Barr, B. L., Jones, C., Taylor, M. W., Gupta, S. L. 1993, Genomics , pp. 17: 262-263.

6. Localization of indoleamine 2,3-dioxygenase gene (INDO) to chromosome 8p12-p11 by fluorescent in situ hybridization. Najfeld, V., Menninger, J., Muhleman, D., Comings, D. E., Gupta, S. L. 1993, Cytogenet. Cell Genet. , pp. 64: 231-232.

7. Molecular cloning, sequencing and expression of human interferon-gamma-inducible indoleamine 2,3-dioxygenase cDNA. . Dai, W., Gupta, S. L. 1990, Biochem. Biophys. Res. Commun. , pp. 168: 1-8.

8. Gene structure of human indoleamine 2,3-dioxygenase. Kadoya, A., Tone, S., Maeda, H., Minatogawa, Y., Kido, R. 1992, Biochem. Biophys. Res. Commun. , pp. 189: 530-536.

9. A gene atlas of th emouse and human protein-encoding transcriptomes. Andrew I. Su, Tim Wiltshire, Serge Batalov , Hilmar Lapp , Keith A. Ching , David Block, Jie Zhang , Richard Soden , Mimi Hayakawa , Gabriel Kreiman , Michael P. Cooke , John R. Walker , and John B. Hogenesch. 2004, PNAS, pp. vol. 101, no. 166062-6067 (10.1073/pnas.0400782101).

10. Indoleamine 2,3-dioxygenase production by human dendritic cells results in the inhibition of T cell proliferation. Hwu P, Du MX, Lapointe R, Do M, Taylor MW, Young HA. 2000, J. Immunol, pp. 164:3596–3599.

11. Inhibition of T cell proliferation by acrophage tryptophan catabolism. Munn, D.H. et al. 1999, J. Exp. Med., p. 189:1363.

12. HeLa cells cocultured with peripheral blood lymphocytes acquire an immuno-inhibitory phenotype through up-regulation of indoleamine 2,3-dioxygenase activity. Logan, G. J., Smyth, C. M. F., Earl, J. W., Zaikina, I., Rowe, P. B., Smythe, J. A., Alexander, I. E. 2002, Immunology, pp. 105:478-487.

13. Indoleamine 2,3-Dioxygenase – Is It an Immun Suppressor? Soliman H, Mediaville-Varela M, Antonia S. 2010, Cancer J. , pp. 16:354-359.

14. Targeting the immunoregulatory indoleamine 2,3-dioxygenase pathway in immunotherapy. Johnson BA, III, Baban B, Mellor AL. 2009, Immunotherapy. , pp. 645–661.

15. Indoleamine 2,3-dioxygenase and regulation of T cell immunity. AL., Mellor. 2005, Biochem Biophys Res Commun. , pp. 338(1):20–24.

16. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C.Modulation of tryptophan catabolism by regulatory T cells. Fallarino, F., Grohmann, U., Hwang, K. W., Orabona, C., Vacca, C., Bianchi, R., Belladonna, M. L., Fioretti, M. C., Alegre, M.-L., Puccetti, P. 2003, Nature Immun., pp. 4: 1206-1212.

17. CTLA-4-Ig regulates tryptophan catabolism in vivo. Grohmann, U., Orabona, C., Fallarino, F., Vacca, C., Calcinaro, F., Falorni, A., Candeloro, P., Belladonna, M. L., Bianchi, R., Fioretti, M. C., Puccetti, P. 2002, Nature Immun. , pp. 3: 1097-1101.

18. Reverse signaling through GITR ligand enables dexamethasone to activate IDO in allergy. Grohmann, U., Volpi, C., Fallarino, F., Bozza, S., Bianchi, R., Vacca, C., Orabona, C., Belladonna, M. L., Ayroldi, E., Nocentini, G., Boon, L., Bistoni, F., Fioretti, M. C., Romani, L., Riccardi, C., Puccetti, P. 2007, Nature Med., pp. 13:579-586.

19. Cells expressing indoleamine 2,3-dioxygenase inhibit T cell responses. Mellor, A. L., Keskin, D. B., Johnson, T., Chandler, P., Munn, D. H. 2002, J. Immun. , pp. 168: 3771-3776.

20. Chon, SY, Hassanain, HH, Piine, R., and Gupta, SL. 1995, J. Interferon Cytokine Res. , pp. 15, 517-526.

21. Levy, ED, KEsler, DS, Pine, R., Reich, N, and Darnell, JE.Jr et al. 1988, Genes Dev, pp. 2,383-393.

22. Benoist, C. and Manthis, D. 1990, Annu. Rev of Immunol., pp. 8, 681-715.

23. Dorn, A, Durand, B., Marling, C., Meur, M.L., Beoist, C., and Mathis, D. 1987, PNAS USA, pp. 34, 6249-6253.

24. Konan, K.V. Ph.D. Thesis. Transcriptional Regulation of the Indolamine 2,3-oxygenase Gene. s.l. : Indiana University, Bloominigton, 1995.

25. Tryptophan pyrrolase of rabbit intestine: D- and L–tryptophan cleaving enzyme or enzymes. Yamamoto, S., and Hayashi, O. 1967, J Biol Chem, pp. 242: 5260-5266.

26. Prevention of allogeneic fetal rejection by tryptophan catabolism. Munn, DH, Zhou M, Attwood JT, Bondarev I, Conway SJ, Marshall B, Brown C, Mellor AL. 1998, Science, pp. 281:1191–3.

27. Evidence for a tumoral immune resistance mechanismbased on tryptophan degradation by indoleamine 2,3-dioxygenase. Uyttenhove, C. et al. 2003, Nature Med. 9,, pp. 1269–1274 .

28. Pregnancy: success and failure within the Th1/Th2/Th3 paradigm. Raghupathy, R. 2001., Seminars in Immunology, pp. Volume 13, Issue 4, Pages 219–227.

29. Why is the fetal allograft not rejected? Davies, C. J. March 2007 , J ANIM SCI , pp. vol. 85 no. 13 suppl E32-E35 .

30. Exploring the mechanism of tryptoophan 2,3-dioxygenase. Thackray, S., Mowat, C.G., Chapman, K. 2008, Biochem. Society Transaction., pp. 36, 1120-1123.

31. The new life of a centenarian: signalling functions of NAD(P). Berger F, Ramírez-Hernández MH, Ziegler M. 2004, Trends Biochem Sci , pp. 29:111–118 .

32. Biochemistry of tryptophan in health and disease. DA, Bender. 1983, Mol Aspects Med, pp. 6:101–197.

33. Poliovirus induces indoleamine-2,3-dioxygenase and quinolinic acid synthesis in macaque brain. Heyes MP, Saito K, Jacobowitz D, Markey SP, Takikawa O, Vickers JH. 1992, FASEB J., pp. 6:2977–2989.

34. Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH 1998Dramatic changes in oxidative tryptophan metabolism along the kynurenine pathway in experimental cerebral and noncerebral malaria. . Sanni LA, Thomas SR, Tattam BN, Moore DE, Chaudhri G, Stocker R, Hunt NH. 1998, Am J Pathol, pp. 152:611–619.

35. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. . Yoshida R, Hayaishi O. 1978, Proc Natl Acad Sci USA , pp. 75:3998–4000.

36. Induction of indoleamine 2,3-dioxygenase in mouse lung during virus infection. . Yoshida R, Urade Y, Tokuda M, Hayaishi O. 1979, Proc Natl Acad Sci USA , pp. 76:4084–4086.

37. Induction of pulmonary indoleamine 2,3-dioxygenase by intraperitoneal injection of bacterial lipopolysaccharide. Yoshida R, Hayaishi. 1978, PNAS USA, pp. 3998-4000.

38. Sequence of human 2,3-dioxygenase (TDO2): presence of a glucorticoid response-like element composed of a GTT repeat and intronic CCCCT repeat. Comings DE, Muhleman D, Dietz G, Sherman M, Forest. 1995, Genomics, pp. 29:390-396165.

39. Studies on the biosynthesis of Nicotinamide adenine inucleotide. II.Arole of picolinic carboxylase in the Biosynthesisofnicotinamideadeninedinucleotidefromtryptophan in mammals. Ikeda M, Tsuji H, Nakamura S, Ichiyama A, Nishizuka Y, HayaishiO. 1965, J. Biol. Chem. , pp. 240: 1395-1401.

40. The Secret Life of NAD+: An Old Metabolite Controlling New Metabolic Signaling Pathways. Houtkooper R.H., Carles Cantó C. , Wanders, R.J. and Auwerx, J. 2010, Endocrine Reviews , pp. vol. 31 no. 2 194-223, doi: 10.1210/er.2009-0026.

41. Stimulation of Nicotinamide adenine dinucleotide biosynthetic pathways delays axonal degeneration after axotomy. Sasaki Y, Araki T, Milbrandt J. 2006, J Neurosci , pp. 26: 8484–8491.

42. European Nicotinamide Diabetes Intervention Trial (ENDIT): a randomised controlled trial of intervention before the onset of type 1 diabetes. Gale EA, Bingley PJ, Emmett CL, CollierT. 2004, Lancet., pp. 363:925–931.

43. Safety of high-dose nicotinamide: a review. Knip M, Douek IF, Moore WP, Gillmor HA, McLean AE, Bingley PJ, Gale EA. 2000, Diabetologia, pp. 43:1337–1345.

44. Large supplements of nicotinic acid and nicotinamide increase tissue NAD and poly(ADP-ribose) levels but do not affect diethylnitrosamine-induced altered hepatic foci in Fischer-344 rats. JacksonTM, Rawling JM, Roebuck BD, Kirkland JB. 1995, J Nutr , p. 125:1455.

45. Characterization and evolution of vertebrate indelamine 2,3-dihydrogenases IDOs from monotremes and marsupials. Yuasa, HJ, Ball, HJ, Ho, YF, Austin, CJ, et al. 2009, Comp. Biochem. Physiol. B. Biochem.. Mol. Biol., pp. 153 (2): 137-144.

46. Novel tryptophan catabolic enzyme IDO2 is the preferred biochemical target of the antitumor indolamine 2,3-dihydrogenase inhibitor compound D-1 methyl-tryptophan. Metz, R., Duhadaway, JB, Kamasani, U, Laury-Kleintop, L., Muller, AJ, Prendergast, GC. 2007, Cancer Res., pp. 67 (15): 7082-7087.

47. Total synthesis of exiguamines A and B inspired by catechollamine chemistry. Sofiyev, V, Lumb, JP, Volgraf, M., Trauner, D. 2012, Chemistry., pp. 18 (16): 4999-5005.

48. Molecular evolution of bacterial indolamine 2,3-dioxygenase. Yuasa, H J, Ushigoe, A, Ball, HJ. 2011, Gene., pp. 484 (1) : 22-31.

49. Infectious tolerance and the long-term acceptance of transplant tissue. Waldman, H., Adams, E., Fairchild, P., and Cobbold, S. 2006, J. Immunol., pp. 212:301-313.

50. Molecular evolution and characterizationof fungal indolamine 2,3-dioxygenases. Yuasa, HJ and Ball, HJ. 2012, J. Mol. Eval., pp. 72 (2): 160-168.

51. convergent evolution. The gene structure of Sulculus 41 kDa myoglobin is homologous with tht of human indolamine dioxygenase. Suzuki, T, Imai, K. 1996, Biochim. Biophys. Acta., pp. 1308(1):41-48.

52. Evolutionof myoglobin. Suzuki, T., Imai, K. 1998, Cell Mol Life Sci, pp. 54(9):979-1004.

53. A myoglobin evolved from indolamine 2,3-dioxygenase, trtptophan-degrading enzyme. Suzuki, T., Kawamichi, H., Imai, K. 1998, Comp Biochem Phisiol. Mol. Biol., pp. 121(2):117-128.

54. Do molluscs possess indolamine 2,3-dioxygenase? Yuasa, HJ and Suzuki, T. 2005, Comp. Biochem. Physiol. B. Biochem. Mol. Biol. , pp. (3) 445-454.

55. Comparison studies of the indolamine dioxygenase-like myoglobin from the abalone Sulculus diversicolor. Suzuki, T., Imai, K. 1997, Comp. Biohem. Phsiol B Biochem Mol Biol, pp. 117 (4)599-604.

56. Orchestration of the immune response by dendritic cells. Buckwalter MR, Albert ML. 2009, Curr Biol., pp. 19(9):355–361.

57. Dendritic cells and the control of immunity. Banchereau J, Steinman RM. 1998, Nature., pp. 245–52.

58. IDO expression by dendritic cells: tolerance and tryptophan catabolism. . Munn DH, Mellor AL. 2004, Nat Rev Immunol. , pp. 762–74.

59. Monocyte and Macrophage. Gordon, S. and Taylor, P.R. 2005, NATURE REVIEWS | IMMUNOLOGY , pp. vol:5, 953-964.

60. Blood monocytes consist of two principal subsets with distinct migratory properties. Geissmann F, Jung S, Littman DR. 2003, Immunity. , pp. 19:71–82.

61. Identification of a novel cell type in peripheral lymphoid organs of mice. I Morphology, quantitation, tissue distribution. . Steinman RM, Cohn ZA. 1973, J Exp Med., pp. 137(5):1142–1162.

62. T cell apoptosis by tryptophan catabolism. Fallarino F, Grohmann U, Vacca C, Bianchi R, Orabona C, Spreca A, Fioretti MC, Puccetti P. 2002, Cell Death Differ , pp. 9:1069–1077.

63. Kynurenine is a novel endothelium derived relaxing factor produced during inflammation. Wang, et al. 2010, Nat. Med., pp. 16(3): 279-285.

64. Activation of the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

65. B cells inhibit induction of T cell-dependent tumor immunity. Qin, Z., Richter, G., Schuler, T., Ibe, S., Cao, X, Blakenstein, T. 1998, Nat. Med, p. 4:627.

66. Different partners, Opposite Outcmes: A new perspective of immunobiology of Indolamine 2,3 dioxygenase. Orabona, C., Pallotta, M.T., Grohman, U. 2012, Molecular Medicine., pp. 18:834-842.

67. Indolamine 2,3-dioxygenase: From catalyst to signaling function. Fallarino, F., Grohman, U., and Puccetti, P. 2012, Eurepean J. of Immunol. , pp. 42:1932-1937.

68. IDO: more than an enzyme. Chen, W. 2011, Nature Immonology, pp. 809-811.

69. Indolamine2,3-dehydrogenase in lung dendritic cells promotes Th2 responses and allergic inflammation. Xu, H., Oriss, T.B., Fei, M., Henry, A.C., Melgert, B.N., Chen, L., Mellor, A.L. 2008, PNAS USA, pp. 105: 6690-6695.

70. The immunoregulatory enzyme IDO paradoxically drives B-cellmediated autoimmunity. Scott, G.N., DuHadaway, J., Pigott, E., Ridge, N., Prendergast, G.C., Muller, A.J., Mandik-Nayak, L. 2009, J. Immunol., pp. 182:7509-7517.

71. Tryptophan deprivation sensitizes activated T cells to apoptosis prior to cell division. Lee GK, Park HJ, Macleod M, Chandler P, Munn DH, Mellor AL. 2002, Immunology , pp. 107:452–460.

72. Enzymology of NAD+ homeostasis in man. . Magni G, Amici A, Emanuelli M, Orsomando G, Raffaelli N, Ruggieri S. 2004, Cell Mol Life Sci , pp. 61:19–34.

73. Kynurenine pathway enzymes in dendritic cells initiate tolerogenesis in the absence of functional IDO. . Belladonna ML, Grohmann U, Guidetti P, Volpi C, Bianchi R, Fioretti MC, Schwarcz R, Fallarino F, Puccetti P. 2006, J Immunol. , pp. ;177:130–7.

74. An indogenous tumour promoting ligand of the human aryl hydrocarbon receptor. Opitz, et. al. 2011, pp. doi: 10.1038/nature10491,.

75. Inhibition of indoleamine 2,3-dioxygenase, animmunoregulatorytarget of the cancer suppression gene Bin1, potentiates cancer chemotherapy. Muller, A. J. et al. 2005, Nature Med. , pp. 11, 312–319 .

76. TGF-b; a master of all T cell trades. Li, M.O., Fravell, R.A. 2008, Cell. , pp. 134: 392-404.

77. Palotta, M.T. et al. 2011, Nat. Immunol., pp. 12:870-878.

78. Chen, W. et al. 2003, J. Exp. Immunol., p. 198: 1875.

79. Smads: transcriptional activators of TGF-beta responses. . Derynck R, Zhang Y, Feng XH. 1998, Cell , pp. 95 (6): 737–40. doi:10.1016/S0092-8674(00)81696-7.PMID 9865691. .

80. Smad transcription factors. Massagué J, Seoane J, Wotton D. 2005, Genes Dev, pp. 19 (23): 2783–810. doi:10.1101/gad.1350705. PMID .

81. A structural basis for mutational inactivation of the tumour suppressor Smad4. Shi Y, Hata A, Lo RS, Massagué J, Pavletich NP. 1997, Nature., pp. 388 (6637): 87–93.doi:10.1038/40431. PMID 9214508.

82. Promoting bone morphogenetic protein signaling through negative regulation of inhibitory Smads. Itoh F, Asao H, Sugamura K, Heldin CH, ten Dijke P, Itoh S. 2001, EMBO J., pp. 20 (15): 4132– doi:10.1093/emboj/20.15.4132. PMC 149146. PMID 11483516.

83. SMAD_Signaling_Network. http://www.sabiosciences.com. [Online] 2013. http://www.sabiosciences.com/pathway.php?sn=SMAD_Signaling_Network.

84. Immune inhibitory receptors. Revetch, J.V., and Lanier, L.L. 2000, Science., pp. 290:84-89.

85. Soc3 drives proteasomal degradation of indolamine 2,3-dioxygenase (IDO) and antagonizes IDO-dependent tolerogenesis. Orabona, C., Pallotta, M., Volpi, C., et al. 2008, PNAS USA, pp. 105: 20828-20833.

86. Cutting edge; silencing supressor of cytokine signaling3 expression in dendritic cells turns CD28-Ig from immune adjuvant to supressant. Orabona, C.,, Belladonna, M.L., et all. 2005, J. Immunol., pp. 174: 6582-6586.

87. Molecular signatures of T-cell inhibition in HIV-1 infection. Larsson, M., Shankar. E.M, Che, K.F., Ellegard, R., Barathan, M., Velu, V., and Kamarulzaman, A. 2013, Retrovirology, p. 10:31.

88. TGF-beta and CD4+CD25+ regulatory cells. Huber, S. and Schramn, C. 2006, Front. Bioscie., pp. 11:1014-1023.

89. Immune Escape as a fundemental trait of cancer; focus on IDO. Prendergast, G.C. 2008, Oncogene., pp. 27, 3889-3900.

90. Il-6 inhibits the tolerogenic functionof CD8+ dendritic cells expressing indolamine 2,3-dioxygenase. Grohman, U., Fallarino, F., et al. 2001, J. Immunol., pp. 167:708-714.

91. Avoiding horror autotoxicus: Th eimportance of dentritic cells in peripheral T cell tolerance. Steinman, R.M., and Nussenzweig, M.C. 2002, PNAS, pp. no:1, 351-358.

92. Dendritic-cell function in Toll-like receptor- and MyD88-knockout mice . Kaisho, T., Akira, S. 2001, Trends Immunol , pp. 22,78-83.

93. Innate sensing of self and non-self RNAs by Toll-like receptors. Sioud, M. 2006., Trends Mol Med., pp. 12:67–76.

94. Impaired expression of indoleamine 2, 3-dioxygenase in monocyte-derived dendritic cells in response to Toll-like receptor-7/8 ligands. Furset, G., Fløisand, Y. and Sioud, M. 2008, Immunology., pp. 123(2): 263–271, doi: 10.1111/j.1365-2567.2007.02695.x.

95. Toll-;ike receptor 9 mediated induction of the immunorepressor pathway of tryptophan metabolism. Fallarino, F., and Puccetti, P. 2006, Eur. J. of Imm., pp. 36:8-11.

96. Toll-like receptors and host defense against microbial pathogens: bringing specificity to the innate immune system. . Netea MG, der Graaf C, Van der Meer JWM, Kullberg BJ. 2004, J Leukoc Biol. , pp. 75:749–55.

97. Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8. . Heil F, Hemmi H, Hochrein H, et al. 2004, Science. , pp. 303:1526–9.

98. Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA. . Diebold SS, Kaisho T, Hemmi H, Akira S, Reis e Sousa C. 2004., Science. , pp. 303:1529–31. .

99. The role of CpG motifs in innate immunity. Krieg, A.M. 2000., Curr Opin Immunol., pp. 12:35–43.

100. Anendogenous tumour-promoting ligand of the human aryl hydrocarbon receptor. Opitz, C.A., Litzenburger, U.M., Sahm, F., Ott,M., Tritschler, I., Trump, S. 2011, Nature, pp. vol 478; 197-203.

101. Impaired impression of Indolamine 2,3-deoxygenase in monocyte derived DCs in response to TLR-7/8. Furset, G., Floisand, Y., Sioud, M. 2007, Immunology, pp. 263-271.

102. Activationof the noncanonical NF-kB pathway by HIV controls a Dendritic cell immunoregulatory phenotype. Manches, O. Fernandez, V.M.,, Plumas, J., Chaperot, L., and Bhardwaj, N. 2012, PNAS, pp. vol: 109, 14122-14127.

103. Regulation of dendritic cell numbers and maturation by lipopolysaccharide in vivo . de Smedt, T., Pajak, B., Muraille, E., Lespagnard, L., Heinen, E., De Baetselier, P., Urbain, J., Leo, O., Moser, M. 1996, J. Exp. Med., pp. 184,1413-1424.

104. Subsets of dendritic cell precursors express different Toll-like receptors and respond to different microbial antigens . Kadowaki, N., Ho, S., Antonenko, S., de Waal Malefyt, R., Kastelein, R. A., Bazan, F., Liu, Y-J. 2001, J. Exp. Med., pp. 194,863-869 .

105. TRAF6 is a critical factor for dendritic cell maturation and development . Kobayashi, T., Walsh, P. T., Walsh, M. C., Speirs, K. M., Chiffoleau, E., King, C. G., Hancock, W. W., Caamano, J. H., Hunter, C. A., Scott, P., Turka, L. A., Choi, Y. 2003, Immunity , pp. 19,353-363 .

106. Activation of interferon regulatory factor-3 via toll-like receptor 3 and immunomodulatory functions detected in A549 lung epithelial cells exposed to misplaced U1-snRNA. Sadik CD, Bachmann M, Pfeilschifter J, Mühl H. 2009, Nucleic Acids Res. , pp. 37(15):5041-56. doi: 10.1093/nar/gkp525. Epub 2009 Jun 18.

107. Triggering of the dsRNA sensors TLR3, MDA5, and RIG-I induces CD55 expression in synovial fibroblasts. Karpus ON, Heutinck KM, Wijnker PJ, Tak PP, Hamann J. 2012, PLoS One., p. 7(5):e35606. doi: 10.1371/journal.pone.0035606. Epub 2012 May 10.

108. The structure of the TLR5-flagellin complex: a new mode of pathogen detection, conserved receptor dimerization for signaling. Lu J, Sun PD. 2012, Sci Signal., p. 5(216):pe11. doi: 10.1126/scisignal.2002963. .

109. Flagellin/Toll-like receptor 5 response was specifically attenuated by keratan sulfate disaccharide via decreased EGFR phosphorylation in normal human bronchial epithelial cells. Shirato K, Gao C, Ota F, Angata T, Shogomori H, Ohtsubo K, Yoshida K, Lepenies B, Taniguchi N. 2013, Biochem Biophys Res Commun., pp. doi:pii: S0006-291X(13)00779-1. 10.1016/j.bbrc.2013.05.009. [Epub ahead of print].

110. Differential induction of interleukin-10 and interleukin-12 in dendritic cells by microbial Toll-like receptor activators and skewing of T-cell cytokine profiles Infect. Qi, H., Denning, T. L., Soong, L. 2003, Immun. , pp. 71,3337-3342 .

111. Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D.Activation of Toll-like receptor 2 on human dendritic cells triggers induction of IL-12, but not IL-10 . Thoma-Uszynski, S., Kiertscher, S. M., Ochoa, M. T., Bouis, D. A., Norgard, M. V., Miyake, K., Godowski, P. J., Roth, M. D., Modlin, R. L. 2000, J. Immunol. , pp. 165,3804-3810.

112. Toll-like receptor 2 (TLR2) and TLR4 differentially activate human dendritic cells . Re, F., Strominger, J. L. 2001, J. Biol. Chem. , pp. 276,37692-37699.

113. Pasare, C., Medzhitov, R. (2003) Toll pathway-dependent blockade of CD4+CD25+ T cell-mediated suppression by dendritic cells. Pasare, C., Medzhitov, R. 2003, Science , pp. 299,1033-1036 .

 

  

Read Full Post »

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Demet Sağ, Kamran Baig*, Steven Hanish*, Jeffrey Lawson

 

 

 

Running Foot:

Use of bovine thrombin induces the cell proliferation at anastomosis

Department of Surgery

Duke University Medical Center

Durham, NC 27710

United States of America

* Equally worked

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Box 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu

demet.sag@gmail.com

Topical Bovine Thrombin Induces Vascular Cell Proliferation

Abstract:

Specific Aim:  The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.

Methods and Results:  Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery.    Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting.  Expression of PAR  (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR.  All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin.  These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK.  Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.

Conclusion:  Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.

Abbreviations: ERK, extracellular regulated kinase; ES, embryonic stem cells; JIP, JNK-interacting protein; JNK, c-Jun NH2-terminal kinase; JNKK, JNK kinase; JNKBP, JNK binding protein; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; MAPKKK, MAPKK kinase; MEK, MAPK/ERK kinase; MEKK, MEK kinase; MKK, MAPK kinase.

Keywords: Hemostatics, Signal transduction; Thrombin, PTGF

————————————————————————————————————

Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4].  It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI  during various surgical procedures.  Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6].  Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].

Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin.  It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9].  Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10].  Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.

Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs.  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].

Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself.  There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs)   [24-27].

Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33].  To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure.  We had tested the impact of topical bovine thrombin affect at the anastomosis.

Materials and Methods:

Surgical Procedure:  We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency.  Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine.  Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days.  In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used.   Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.

Ki67 Immunostaining:  The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks.  The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0).  The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum.  The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast.  As a result, positive tissues became brown and negatives were red.

MAPKs Immunostaining:  The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody.  The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.

Immunoblotting:  Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h.  Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS.  The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).

RNA isolation and RT-PCR: The harvested vessels were kept in RNAlater (Ambion, Austin, TX).   The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.

The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler.  The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse); PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT  3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).

CTGF and Cyr61:  The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers.  For CTGF the primers were  forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.

RESULTS:

First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin.   Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs.   We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment.    These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr  treatment with BT.  This data  the hypothesis for the function of PAR receptors in vascular tissues that  they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.

 

TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:

Next question was to make linear correlation between the expressions of PARs  to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues.   Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes.  Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared.  If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min.  Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli.  The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls.    Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.

Proliferation of the tissue depends on pERK

PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen.   Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured.   As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.

First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues).  We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins.  The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls.  This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.

The next target was JNK that plays a role in the inflammation, stress, and differentiation.    In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application.  This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients.   The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots.  Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.

Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues.  The expression of p38 was higher than JNK but much lower than ERK.  Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.

In general, all MAPKs showed increased in their phosphorylation level.  The level of activated MAPK expression was increased 200% in the tested animal.  The order of expression from high to low would be  ERK, JNK, and p38.

The genetic expression change

The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement.   Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection.  The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment.  Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.

DISCUSSION:

The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access  that leads to the cell proliferation and inflammation  through MAPKs  as well as  downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.

From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues.  We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding.  This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.

It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions.  In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent.   Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.

The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used.  The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle.  In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase.  During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.

Next, level of evidence was the signaling pathway analysis from membrane to the nucleus.  As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK,  pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel.  Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK).  The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation.  In our data we had detected the elvation of ERK more than the other MAPKs.   In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.

Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis.  The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.  

Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair.  Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered  thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.

 

 

 

 

 

 

 

REFERENCES:

1.         Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.

2.         Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.

3.         TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.

4.         Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.

5.         Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.

6.         Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.

7.         Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.

8.         Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.

9.         Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.

10.       Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.

11.       Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.

12.       Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.

13.       Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.

14.       Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.

15.       Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.

16.       Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.

17.       Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.

18.       Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.

19.       Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.

20.       Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.

21.       Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.

22.       Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.

23.       Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.

24.       Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.

25.       Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.

26.       Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.

27.       Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.

28.       Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.

29.       Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.

30.       Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.

31.       Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.

32.       Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.

33.       McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.

34.       Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.

35.       Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.

36.       Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.

37.       Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.

38.       Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.

39.       Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.

40.       Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.

41.       Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.

Figure Legends:

Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR.        PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr

Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation

Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues

Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues

Figure 5: The activity of p38. (A) Immunostaining of total and activated p38.  Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues

Figure 6: The Expression of CTGF and Cyr61 after Thrombin Treatment. (A)CTGF            (B) Cyr61 expressions of treated and un-treated with TBT veins at 24h and 7 days.Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment

Read Full Post »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and PathologyDuke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »

aprotinin-sequence.Par.0001.Image.260

aprotinin-sequence.Par.0001.Image.260 (Photo credit: redondoself)

English: Protein folding: amino-acid sequence ...

Protein folding: amino-acid sequence of bovine BPTI (basic pancreatic trypsin inhibitor) in one-letter code, with its folded 3D structure represented by a stick model of the mainchain and sidechains (in gray), and the backbone and secondary structure by a ribbon colored blue to red from N- to C-terminus. 3D structure from PDB file 1BPI, visualized in Mage and rendered in Raster3D. (Photo credit: Wikipedia)

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Author: Demet Sag, PhD

 

 

 

 

 

 

 

 

 

 

 

 

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Demet Sag, PhD*†, Kamran Baig, MBBS, MRCS; James Jaggers, MD, Jeffrey H. Lawson, MD, PhD

Departments of Surgery and Pathology (J.H.L.) Duke University Medical Center Durham, NC  27710

Correspondence and Reprints:

                             Jeffrey H. Lawson, M.D., Ph.D.

                              Departments of Surgery & Pathology

                              DUMC Box 2622

                              Durham, NC  27710

                              (919) 681-6432 – voice

                              (919) 681-1094 – fax

                              lawso006@mc.duke.edu

*Current Address: Demet SAG, PhD

                          3830 Valley Centre Drive Suite 705-223, San Diego, CA 92130

Support:

Word Count: 4101 Journal Subject Heads:  CV surgery, endothelial cell activationAprotinin, Protease activated receptors,

Potential Conflict of Interest:         None

Abstract

Introduction:  Cardiopulmonary bypass is associated with a systemic inflammatory response syndrome, which is responsible for excessive bleeding and multisystem dysfunction. Endothelial cell activation is a key pathophysiological process that underlies this response. Aprotinin, a serine protease inhibitor has been shown to be anti-inflammatory and also have significant hemostatic effects in patients undergoing CPB. We sought to investigate the effects of aprotinin at the endothelial cell level in terms of cytokine release (IL-6), tPA release, tissue factor expression, PAR1 + PAR2 expression and calcium mobilization. Methods:  Cultured Human Umbilical Vein Endothelial Cells (HUVECS) were stimulated with TNFa for 24 hours and treated with and without aprotinin (200KIU/ml + 1600KIU/ml). IL-6 and tPA production was measured using ELISA. Cellular expression of Tissue Factor, PAR1 and PAR2 was measured using flow cytometry. Intracellular calcium mobilization following stimulation with PAR specific peptides and agonists (trypsin, thrombin, Human Factor VIIa, factor Xa) was measured using fluorometry with Fluo-3AM. Results: Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNFa stimulated HUVECS (p=0.043). Aprotinin treatment of TNFa activated endothelial cells significantly reduce the amount of tPA released in a dose dependent manner (A200 p=0.0018, A1600 p=0.033). Aprotinin resulted in a significant downregulation of TF expression to baseline levels. At 24 hours, we found that aprotinin treatment of TNFa stimulated cells resulted in a significant downregulation of PAR-1 expression. Aprotinin significantly inhibited the effects of the protease thrombin upon PAR1 mediated calcium release. The effects of PAR2 stimulatory proteases such as human factor Xa, human factor VIIa and trypsin on calcium release was also inhibited by aprotinin. Conclusion:  We have shown that aprotinin has direct anti-inflammatory effects on endothelial cell activation and these effects may be mediated through inhibition of proteolytic activation of PAR1 and PAR2. Abstract word count: 297

INTRODUCTION   Each year it is estimated that 350,000 patients in the United States, and 650,000 worldwide undergo cardiopulmonary bypass (CPB). Despite advances in surgical techniques and perioperative management the morbidity and mortality of cardiac surgery related to the systemic inflammatory response syndrome(SIRS), especially in neonates is devastatingly significant. Cardiopulmonary bypass exerts an extreme challenge upon the haemostatic system as part of the systemic inflammatory syndrome predisposing to excessive bleeding as well as other multisystem dysfunction (1). Over the past decade major strides have been made in the understanding of the pathophysiology of the inflammatory response following CPB and the role of the vascular endothelium has emerged as critical in maintaining cardiovascular homeostasis (2).

CPB results in endothelial cell activation and initiation of coagulation via the Tissue Factor dependent pathway and consumption of important clotting factors. The major stimulus for thrombin generation during CPB has been shown to be through the tissue factor dependent pathway. As well as its effects on the fibrin and platelets thrombin has been found to play a role in a host of inflammatory responses in the vascular endothelium. The recent discovery of the Protease-Activated Receptors (PAR), one of which through which thrombin acts (PAR-1) has stimulated interest that they may provide a vital link between inflammation and coagulation (3).

Aprotinin is a nonspecific serine protease inhibitor that has been used for its ability to reduce blood loss and preserve platelet function during cardiac surgery procedures requiring cardiopulmonary bypass and thus the need for subsequent blood and blood product transfusions. However there have been concerns that aprotinin may be pro-thrombotic, especially in the context of coronary artery bypass grafting, which has limited its clinical use. These reservations are underlined by the fact that the mechanism of action of aprotinin has not been fully understood. Recently aprotinin has been shown to exert anti-thrombotic effects mediated by blocking the PAR-1 (4). Much less is known about its effects on endothelial cell activation, especially in terms of Tissue Factor but it has been proposed that aprotinin may also exert protective effects at the endothelial level via protease-activated receptors (PAR1 and PAR2). In this study we simulated in vitro the effects of endothelial cell activation during CPB by stimulating Human Umbilical Vein Endothelial Cells (HUVECs) with a proinflammatory cytokine released during CPB, Tumor Necrosis Factor (TNF-a) and characterize the effects of aprotinin treatment on TF expression, PAR1 and PAR2 expression, cytokine release IL-6 and tPA secretion.  In order to investigate the mechanism of action of aprotinin we studied its effects on PAR activation by various agonists and ligands.

These experiments provide insight into the effects of aprotinin on endothelial related coagulation mechanisms in terms of Tissue Factor expression and indicate it effects are mediated through Protease-Activated Receptors (PAR), which are seven membrane spanning proteins called G-protein coupled receptors (GPCR), that link coagulant and inflammatory pathways. Therefore, in this study we examine the effects of aprotinin on the human endothelial cell coagulation biology by different-dose aprotinin, 200 and 1600units.  The data demonstrates that aprotinin appears to directly alter endothelial expression of inflammatory cytokines, tPA and PAR receptor expression following treatment with TNF.  The direct mechanism of action is unknown but may act via local protease inhibition directly on endothelial cells.  It is hoped that with improved understanding of the mechanisms of action of aprotinin, especially an antithrombotic effect at the endothelial level the fears of prothrombotic tendency may be lessened and its use will become more routine.  

METHODS Human Umbilical Vein Endothelial Cells (HUVECS) used as our model to study the effects of endothelial cell activation on coagulant biology. In order to simulate the effects of cardiopulmonary bypass at the endothelial cell interface we stimulated the cells with the proinflammatory cytokine TNFa. In the study group the HUVECs were pretreated with low (200kIU/mL) and high (1600kIU/mL) dosages of aprotinin prior to stimulation with TNFa and complement activation fragments. The effects of TNFa stimulation upon endothelial Tissue Factor expression, PAR1 and PAR2 expression, and tPA and IL6 secretion were determined and compared between control and aprotinin treated cells. In order to delineate whether aprotinin blocks PAR activation via its protease inhibition properties we directly activated PAR1 and PAR2 using specific agonist ligands such thrombin (PAR1), trypsin, Factor VIIa, Factor Xa (PAR2) in the absence and presence of aprotinin.

Endothelial Cell Culture HUVECs were supplied from Clonetics. The cells were grown in EBM-2 containing 2MV bullet kit, including 5% FBS, 100-IU/ml penicillin, 0.1mg/mL streptomycin, 2mmol/L L-glutamine, 10 U/ml heparin, 30µg/mL EC growth supplement (ECGS). Before the stimulation cells were starved in 0.1%BSA depleted with FBS and growth factors for 24 hours. Cells were sedimented at 210g for 10 minutes at 4C and then resuspended in culture media. The HUVECs to be used will be between 3 and 5 passages.

Assay of IL-6 and tPA production Levels of IL-6 were measured with an ELISA based kit (RDI, MN) according to the manufacturers instructions. tPA was measured using a similar kit (American Diagnostica).

  Flow Cytometry The expression of transmembrane proteins PAR1, PAR2 and tissue factor were measured by single color assay as FITC labeling agent. Prepared suspension of cells disassociated trypsin free cell disassociation solution (Gibco) to be labeled. First well washed, and resuspended into “labeling buffer”, phosphate buffered saline (PBS) containing 0.5% BSA plus 0.1% NaN3, and 5% fetal bovine serum to block Fc and non-specific Ig binding sites. Followed by addition of 5mcl of antibody to approx. 1 million cells in 100µl labeling buffer and incubate at 4C for 1 hour. After washing the cells with 200µl with wash buffer, PBS + 0.1% BSA + 0.1% NaN3, the cells were pelletted at 1000rpm for 2 mins. Since the PAR1 and PAR2 were directly labeled with FITC these cells were fixed for later analysis by flow cytometry in 500µl PBS containing 1%BSA + 0.1% NaN3, then add equal volume of 4% formalin in PBS. For tissue factor raised in mouse as monoclonal primary antibody, the pellet resuspended and washed twice more as before, and incubated at 4C for 1 hour addition of 5µl donkey anti-mouse conjugated with FITC secondary antibody directly to the cell pellets at appropriate dilution in labeling buffer. After the final wash three times, the cell pellets were resuspended thoroughly in fixing solution. These fixed and labeled cells were then stored in the dark at 4C until there were analyzed. On analysis, scatter gating was used to avoid collecting data from debris and any dead cells. Logarithmic amplifiers for the fluorescence signal were used as this minimizes the effects of different sensitivities between machines for this type of data collection.  

Intracellular Calcium Measurement

Measured the intracellular calcium mobilization by Fluo-3AM. HUVECs were grown in calcium and phenol free EBM basal media containing 2MV bullet kit. Then the cell cultures were starved with the same media by 0.1% BSA without FBS for 24 hour with or without TNFa stimulation presence or absence of aprotinin (200 and 1600KIU/ml). Next the cells were loaded with Fluo-3AM 5µg/ml containing agonists, PAR1 specific peptide SFLLRN-PAR1 inhibitor, PAR2 specific peptide SLIGKV-PAR2 inhibitor, human alpha thrombin, trypsin, factor VIIa, factor Xa for an hour at 37C in the incubation chamber. Finally the media was replaced by Flou-3AM free media and incubated for another 30 minutes in the incubation chamber. The readings were taken at fluoromatic bioplate reader. For comparison purposes readings were taken before and during Fluo-3AM loading as well.  

RESULTS Aprotinin reduces IL-6 production from activated/stimulated HUVECS The effects of aprotinin analyzed on HUVEC for the anti-inflammatory effects of aprotinin at cultured HUVECS with high and low doses.  Figure 1 shows that TNF-a stimulated a considerable increase in IL-6 production, 370.95 ± 109.9 mg/mL.   If the drug is used alone the decrease of IL-6 at the low dose is 50% that is 183.95 ng/ml and with the high dose of 20% that is 338.92 from 370.95ng/ml being compared value.  TNFa-aprotinin results in reduction of the IL-6 expression from 370.95ng/ml to 58.6 (6.4fold) fro A200 and 75.85 (4.9 fold) ng/ml, for A1600.  After the treatment the cells reach to the below baseline limit of IL-6 expression. Aprotinin at the high dose (1600kIU/mL), 183.95 ± 13.06mg/mL but not low dose (200kIU/mL) significantly reduced IL-6 production from TNF-a stimulated HUVECS (p=0.043).  Therefore, the aprotinin prevents inflammation as well as loss of blood.  

Aprotinin reduces tPA production from stimulated HUVECS Whether aprotinin exerted part of its fibrinolytic effects through inhibition of tPA mediated plasmin generation examined by the effects on TNFa stimulated HUVECS. Figure 2 also demonstrates that the amount of tPA released from HUVECS under resting, non-stimulated conditions incubated with aprotinin are significantly different. Figure 2 represents that the resting level of tPA released from non-stimulated cells significantly, by 100%, increase following TNF-a stimulation for 24 hours.  After application of aprotinin alone at two doses the tPA level goes down 25% of TNFa stimulated cells.  However, aprotinin treatment of TNF-a activated endothelial cells significantly lower the amount of tPA release in a dose dependent manner that is low dose decreased 25 but high dose causes 50% decrease of tPA expression (A200 p=0.0018, A1600 p=0.033) This finding suggests that aprotinin exerts a direct inhibitory effect on endothelial cell tPA production.

Aprotinin and receptor expression on activated HUVECS

TF is expressed when the cell in under stress such as TNFa treatments. The stimulated HUVECs with TNF-a tested for the expression of PAR1, PAR2, and tissue factor by single color flow cytometry through FITC labeled detection antibodies at 1, 3, and 24hs.

 

Tissue Factor expression is reduced:

Figure 3 demonstrates that there is a fluctuation of TF expression from 1 h to 24h that the TF decreases at first hour after aprotinin application 50% and 25%, A1600 and A200 respectively.  Then at 3 h the expression come back up 50% more than the baseline.  Finally, at 24h the expression of TF becomes almost as same as baseline.  Moreover, TNFa stimulated cells remains 45% higher than baseline after at 3h as well as at 24h.

PAR1 decreased:
Figure 4 demonstrates that aprotinin reduces the PAR1 expression 80% at 24h but there is no affect at 1 and 3 h intervals for both doses.

During the treatment with aprotinin only high dose at 1 hour time interval decreases the PAR1 expression on the cells. This data explains that ECCB is affected due to the expression of PAR1 is lowered by the high dose of aprotinin.

PAR2 is decreased by aprotinin:

  Figure 5 shows the high dose of aprotinin reduces the PAR2 expression close to 25% at 1h, 50% at 3h and none at 24h.  This pattern is exact opposite of PAR1 expression.  Figure 5 demonstrates the 50% decrease at 3h interval only.  Does that mean aprotinin affecting the inflammation first and then coagulation?

This suggests that aprotinin may affect the PAR2 expression at early and switched to PAR1 reduction later time intervals.  This fluctuation can be normal because aprotinin is not a specific inhibitor for proteases.  This approach make the aprotinin work better the control bleeding and preventing the inflammation causing cytokine such as IL-6.

Aprotinin inhibits Calcium fluxes induced by PAR1/2 specific agonists

  The specificity of aprotinin’s actions upon PAR studied the effects of the agent on calcium release following proteolytic and non-proteolytic stimulation of PAR1 and PAR2. Figure 6A (Figure 6) shows the stimulation of the cells with the PAR1 specific peptide (SFLLRN) results in release of calcium from the cells. Pretreatment of the cells with aprotinin has no significant effect on PAR1 peptide stimulated calcium release. This suggests that aprotinin has no effect upon the non-proteolytic direct activation of the PAR 1 receptor. Yet, Figure 6B (Figure 6) demonstrates human alpha thrombin does interact with the drug as a result the calcium release drops below base line after high dose (A1600) aprotinin used to zero but low dose does not show significant effect on calcium influx. Figure 7 demonstrates the direct PAR2 and indirect PAR2 stimulation by hFVIIa, hFXa, and trypsin of cells.  Similarly, at Figure 7A aprotinin has no effect upon PAR2 peptide stimulated calcium release, however, at figures 7B, C, and D shows that PAR2 stimulatory proteases Human Factor Xa, Human Factor VIIa and Trypsin decreases calcium release. These findings indicate that aprotinin’s mechanism of action is directed towards inhibiting proteolytic cleavage and hence subsequent activation of the PAR1 and PAR2 receptor complexes.  The binding site of the aprotinin on thrombin possibly is not the peptide sequence interacting with receptors.

Measurement of calcium concentration is essential to understand the mechanism of aprotinin on endothelial cell coagulation and inflammation because these mechanisms are tightly controlled by presence of calcium.  For example, activation of PAR receptors cause activation of G protein q subunit that leads to phosphoinositol to secrete calcium from endoplasmic reticulum into cytoplasm or activation of DAG to affect Phospho Lipase C (PLC). In turn, certain calcium concentration will start the serial formation of chain reaction for coagulation.  Therefore, treatment of the cells with specific factors, thrombin receptor activating peptides (TRAPs), human alpha thrombin, trypsin, human factor VIIa, and human factor Xa, would shed light into the effect of aprotinin on the formation of complexes for pro-coagulant activity.    DISCUSSION   There are two fold of outcomes to be overcome during cardiopulmonary bypass (CPB):  mechanical stress and the contact of blood with artificial surfaces results in the activation of pro- and anticoagulant systems as well as the immune response leading to inflammation and systemic organ failure.  This phenomenon causes the “postperfusion-syndrome”, with leukocytosis, increased capillary permeability, accumulation of interstitial fluid, and organ dysfunction.  CPB is also associated with a significant inflammatory reaction, which has been related to complement activation, and release of various inflammatory mediators and proteolytic enzymes. CPB induces an inflammatory state characterized by tumor necrosis factor-alpha release. Aprotinin, a low molecular-weight peptide inhibitor of trypsin, kallikrein and plasmin has been proposed to influence whole body inflammatory response inhibiting kallikrein formation, complement activation and neutrophil activation (5, 6). But shown that aprotinin has no significant influence on the inflammatory reaction to CPB in men.  Understanding the endothelial cell responses to injury is therefore central to appreciating the role that dysfunction plays in the preoperative, operative, and postoperative course of nearly all cardiovascular surgery patients.  Whether aprotinin increases the risk of thrombotic complications remains controversial.   The anti-inflammatory properties of aprotinin in attenuating the clinical manifestations of the systemic inflammatory response following cardiopulmonary bypass are well known(15) 16)  However its mechanisms and targets of action are not fully understood. In this study we have investigated the actions of aprotinin at the endothelial cell level. Our experiments showed that aprotinin reduced TNF-a induced IL-6 release from cultured HUVECS. Thrombin mediates its effects through PAR-1 receptor and we found that aprotinin reduced the expression of PAR-1 on the surface of HUVECS after 24 hours incubation. We then demonstrated that aprotinin inhibited endothelial cell PAR proteolytic activation by thrombin (PAR-1), trypsin, factor VII and factor X (PAR-2) in terms of less release of Ca preventing the activation of coagulation.  So aprotinin made cells produce less receptor, PAR1, PAR2, and TF as a result there would be less Ca++ release.    Our findings provide evidence for anti-inflammatory as well as anti-coagulant properties of aprotinin at the endothelial cell level, which may be mediated through its inhibitory effects on proteolytic activation of PARs.   IL6   Elevated levels of IL-6 have been shown to correlate with adverse outcomes following cardiac surgery in terms of cardiac dysfunction and impaired lung function(Hennein et al 1992). Cardiopulmonary bypass is associated with the release of the pro-inflammatory cytokines IL-6, IL-8 and TNF-a.  IL-6 is produced by T-cells, endothelial cells as a result monocytes and plasma levels of this cytokine tend to increase during CPB (21, 22). In some studies aprotinin has been shown to reduce levels of IL-6 post CPB(23) Hill(5). Others have failed to demonstrate an inhibitory effect of aprotinin upon pro-inflammatory cytokines following CPB(24) (25).  Our experiments showed that aprotinin significantly reduced the release of IL-6 from TNF-a stimulated endothelial cells, which may represent an important target of its anti-inflammatory properties. Its has been shown recently that activation of HUVEC by PAR-1 and PAR-2 agonists stimulates the production of IL-6(26). Hence it is possible that the effects of aprotinin in reducing IL-6 may be through targeting activation of such receptors.   TPA   Tissue Plasminogen activator is stored, ready made, in endothelial cells and it is released at its highest levels just after commencing CPB and again after protamine administration. The increased fibrinolytic activity associated with the release of tPA can be correlated to the excessive bleeding postoperatively. Thrombin is thought to be the major stimulus for release of t-PA from endothelial cells. Aprotinin’s haemostatic properties are due to direct inhibition of plasmin, thereby reducing fibrinolytic activity as well as inhibiting fibrin degradation.  Aprotinin has not been shown to have any significant effect upon t-PA levels in patients post CPB(27), which would suggest that aprotinin reduced fibrinolytic effects are not the result of inhibition of t-PA mediated plasmin generation. Our study, however demonstrates that aprotinin inhibits the release of t-PA from activated endothelial cells, which may represent a further haemostatic mechanism at the endothelial cell level.   TF   Resting endothelial cells do not normally express tissue factor on their cell surface. Inflammatory mediators released during CPB such as complement (C5a), lipopolysaccharide, IL-6, IL-1, TNF-a, mitogens, adhesion molecules and hypoxia may induce the expression of tissue factor on endothelial cells and monocytes. The expression of TF on activated endothelial cells activates the extrinsic pathway of coagulation, ultimately resulting in the generation of thrombin and fibrin. Aprotinin has been shown to reduce the expression of TF on monocytes in a simulated cardiopulmonary bypass circuit (28).

We found that treatment of activated endothelial cells with aprotinin significantly reduced the expression of TF after 24 hours. This would be expected to result in reduced thrombin generation and represent an additional possible anticoagulant effect of aprotinin. In a previous study from our laboratory we demonstrated that there were two peaks of inducible TF activity on endothelial cells, one immediately post CPB and the second at 24 hours (29). The latter peak is thought to be responsible for a shift from the initial fibrinolytic state into a procoagulant state.  In addition to its established early haemostatic and coagulant effect, aprotinin may also have a delayed anti-coagulant effect through its inhibition of TF mediated coagulation pathway. Hence its effects may counterbalance the haemostatic derangements, i.e. first bleeding then thrombosis caused by CPB. The anti-inflammatory effects of aprotinin may also be related to inhibition of TF and thrombin generation. PARs  

It has been suggested that aprotinin may target PAR on other cells types, especially endothelial cells. We investigated the role of PARs in endothelial cell activation and whether they can be the targets for aprotinin.  In recent study by Day group(30) demonstrated that endothelial cell activation by thrombin and downstream inflammatory responses can be inhibited by aprotinin in vitro through blockade of protease-activated receptor 1. Our results provide a new molecular basis to help explain the anti-inflammatory properties of aprotinin reported clinically.    The finding that PAR-2 can also be activated by the coagulation enzymes factor VII and factor X indicates that PAR may represent the link between inflammation and coagulation.  PAR-2 is believed to play an important role in inflammatory response. PAR-2 are widely expressed in the gastrointestinal tract, pancreas, kidney, liver, airway, prostrate, ovary, eye of endothelial, epithelial, smooth muscle cells, T-cells and neutrophils. Activation of PAR-2 in vivo has been shown to be involved in early inflammatory processes of leucocyte recruitment, rolling, and adherence, possibly through a mechanism involving platelet-activating factor (PAF)   We investigated the effects of TNFa stimulation on PAR-1 and PAR-2 expression on endothelial cells. Through functional analysis of PAR-1 and PAR-2 by measuring intracellular calcium influx we have demonstrated that aprotinin blocks proteolytic cleavage of PAR-1 by thrombin and activation of PAR-2 by the proteases trypsin, factor VII and factor X.  This confirms the previous findings on platelets of an endothelial anti-thrombotic effect through inhibition of proteolysis of PAR-1. In addition, part of aprotinin’s anti-inflammatory effects may be mediated by the inhibition of serine proteases that activate PAR-2. There have been conflicting reports regarding the regulation of PAR-1 expression by inflammatory mediators in cultured human endothelial cells. Poullis et al first showed that thrombin induced platelet aggregation was mediated by via the PAR-1(4) and demonstrated that aprotinin inhibited the serine protease thrombin and trypsin induced platelet aggregation. Aprotinin did not block PAR-1 activation by the non-proteolytic agonist peptide, SFLLRN indicating that the mechanism of action was directed towards inhibiting proteolytic cleavage of the receptor. Nysted et al showed that TNF did not affect mRNA and cell surface protein expression of PAR-1 (35), whereas Yan et al showed downregulation of PAR-1 mRNA levels (36). Once activated PAR1 and PAR2 are rapidly internalized and then transferred to lysosomes for degradation.

Endothelial cells contain large intracellular pools of preformed receptors that can replace the cleaved receptors over a period of approximately 2 hours, thus restoring the capacity of the cells to respond to thrombin. In this study we found that after 1-hour stimulation with TNF there was a significant upregulation in PAR-1 expression. However after 3 hours and 24 hours there was no significant change in PAR-1 expression suggesting that cleaved receptors had been internalized and replenished. Aprotinin was interestingly shown to downregulate PAR-1 expression on endothelial cells at 1 hour and increasingly more so after 24 hours TNF stimulation. These findings may suggest an effect of aprotinin on inhibiting intracellular cycling and synthesis of PAR-1.    

Conclusions   Our study has identified the anti-inflammatory and coagulant effects of aprotinin at the endothelial cell level. All together aprotinin affects the ECCB by reducing the t-PA, IL-6, PAR1, PAR 2, TF expressions. Our data correlates with the previous foundlings in production of tPA (7, (8) 9) 10), and  decreased IL-6 levels (11) during coronary artery bypass graft surgery (12-14). We have importantly demonstrated that aprotinin may target proteolytic activation of endothelial cell associated PAR-1 to exert a possible anti-inflammatory effect. This evidence should lessen the concerns of a possible prothrombotic effect and increased incidence of graft occlusion in coronary artery bypass patients treated with aprotinin. Aprotinin may also inhibit PAR-2 proteolytic activation, which may represent a key mechanism for attenuating the inflammatory response at the critical endothelial cell level. Although aprotinin has always been known as a non-specific protease inhibitor we would suggest that there is growing evidence for a PAR-ticular mechanism of action.  

REFERENCES

1.         Levy, J. H., and Tanaka, K. A. Inflammatory response to cardiopulmonary bypass. Ann Thorac Surg. 75: S715-720, 2003.

2.         Verrier, E. D., and Morgan, E. N. Endothelial response to cardiopulmonary bypass surgery. Ann Thorac Surg. 66: S17-19; discussion S25-18, 1998.

3.         Cirino, G., Napoli, C., Bucci, M., and Cicala, C. Inflammation-coagulation network: are serine protease receptors the knot? Trends Pharmacol Sci. 21: 170-172, 2000. 4.         Poullis, M., Manning, R., Laffan, M., Haskard, D. O., Taylor, K. M., and Landis, R. C. The antithrombotic effect of aprotinin: actions mediated via the proteaseactivated receptor 1. J Thorac Cardiovasc Surg. 120: 370-378, 2000.

5.         Hill, G. E., Alonso, A., Spurzem, J. R., Stammers, A. H., and Robbins, R. A. Aprotinin and methylprednisolone equally blunt cardiopulmonary bypass-induced inflammation in humans. J Thorac Cardiovasc Surg. 110: 1658-1662, 1995.

6.         Hill, G. E., Pohorecki, R., Alonso, A., Rennard, S. I., and Robbins, R. A. Aprotinin reduces interleukin-8 production and lung neutrophil accumulation after cardiopulmonary bypass. Anesth Analg. 83: 696-700, 1996. 7.         Lu, H., Du Buit, C., Soria, J., Touchot, B., Chollet, B., Commin, P. L., Conseiller, C., Echter, E., and Soria, C. Postoperative hemostasis and fibrinolysis in patients undergoing cardiopulmonary bypass with or without aprotinin therapy. Thromb Haemost. 72: 438-443, 1994.

8.         de Haan, J., and van Oeveren, W. Platelets and soluble fibrin promote plasminogen activation causing downregulation of platelet glycoprotein Ib/IX complexes: protection by aprotinin. Thromb Res. 92: 171-179, 1998.

9.         Erhardtsen, E., Bregengaard, C., Hedner, U., Diness, V., Halkjaer, E., and Petersen, L. C. The effect of recombinant aprotinin on t-PA-induced bleeding in rats. Blood Coagul Fibrinolysis. 5: 707-712, 1994.

10.       Orchard, M. A., Goodchild, C. S., Prentice, C. R., Davies, J. A., Benoit, S. E., Creighton-Kemsford, L. J., Gaffney, P. J., and Michelson, A. D. Aprotinin reduces cardiopulmonary bypass-induced blood loss and inhibits fibrinolysis without influencing platelets. Br J Haematol. 85: 533-541, 1993.

11.       Tassani, P., Augustin, N., Barankay, A., Braun, S. L., Zaccaria, F., and Richter, J. A. High-dose aprotinin modulates the balance between proinflammatory and anti-inflammatory responses during coronary artery bypass graft surgery. J Cardiothorac Vasc Anesth.14: 682-686, 2000.

12.       Asehnoune, K., Dehoux, M., Lecon-Malas, V., Toueg, M. L., Gonieaux, M. H., Omnes, L., Desmonts, J. M., Durand, G., and Philip, I. Differential effects of aprotinin and tranexamic acid on endotoxin desensitization of blood cells induced by circulation through an isolated extracorporeal circuit. J Cardiothorac Vasc Anesth. 16: 447-451, 2002.

13.       Dehoux, M. S., Hernot, S., Asehnoune, K., Boutten, A., Paquin, S., Lecon-Malas, V., Toueg, M. L., Desmonts, J. M., Durand, G., and Philip, I. Cardiopulmonary bypass decreases cytokine production in lipopolysaccharide-stimulated whole blood cells: roles of interleukin-10 and the extracorporeal circuit. Crit Care Med. 28: 1721-1727, 2000.

14.       Greilich, P. E., Brouse, C. F., Rinder, C. S., Smith, B. R., Sandoval, B. A., Rinder, H. M., Eberhart, R. C., and Jessen, M. E. Effects of epsilon-aminocaproic acid and aprotinin on leukocyte-platelet adhesion in patients undergoing cardiac surgery. Anesthesiology. 100: 225-233, 2004.

15.       Mojcik, C. F., and Levy, J. H. Aprotinin and the systemic inflammatory response after cardiopulmonary bypass. Ann Thorac Surg. 71: 745-754, 2001.

16.       Landis, R. C., Asimakopoulos, G., Poullis, M., Haskard, D. O., and Taylor, K. M. The antithrombotic and antiinflammatory mechanisms of action of aprotinin. Ann Thorac Surg. 72: 2169-2175, 2001.

17.       Asimakopoulos, G., Kohn, A., Stefanou, D. C., Haskard, D. O., Landis, R. C., and Taylor, K. M. Leukocyte integrin expression in patients undergoing cardiopulmonary bypass. Ann Thorac Surg. 69: 1192-1197, 2000.

18.       Landis, R. C., Asimakopoulos, G., Poullis, M., Thompson, R., Nourshargh, S., Haskard, D. O., and Taylor, K. M. Effect of aprotinin (trasylol) on the inflammatory and thrombotic complications of conventional cardiopulmonary bypass surgery. Heart Surg Forum. 4 Suppl 1: S35-39, 2001.

19.       Asimakopoulos, G., Thompson, R., Nourshargh, S., Lidington, E. A., Mason, J. C., Ratnatunga, C. P., Haskard, D. O., Taylor, K. M., and Landis, R. C. An anti-inflammatory property of aprotinin detected at the level of leukocyte extravasation. J Thorac Cardiovasc Surg. 120: 361-369, 2000.

20.       Asimakopoulos, G., Lidington, E. A., Mason, J., Haskard, D. O., Taylor, K. M., and Landis, R. C. Effect of aprotinin on endothelial cell activation. J Thorac Cardiovasc Surg. 122: 123-128, 2001.

21.       Butler, J., Chong, G. L., Baigrie, R. J., Pillai, R., Westaby, S., and Rocker, G. M. Cytokine responses to cardiopulmonary bypass with membrane and bubble oxygenation. Ann Thorac Surg. 53: 833-838, 1992.

22.       Hennein, H. A., Ebba, H., Rodriguez, J. L., Merrick, S. H., Keith, F. M., Bronstein, M. H., Leung, J. M., Mangano, D. T., Greenfield, L. J., and Rankin, J. S. Relationship of the proinflammatory cytokines to myocardial ischemia and dysfunction after uncomplicated coronary revascularization. J Thorac Cardiovasc Surg. 108: 626-635, 1994.

23.       Diego, R. P., Mihalakakos, P. J., Hexum, T. D., and Hill, G. E. Methylprednisolone and full-dose aprotinin reduce reperfusion injury after cardiopulmonary bypass. J Cardiothorac Vasc Anesth. 11: 29-31, 1997.

24.       Ashraf, S., Tian, Y., Cowan, D., Nair, U., Chatrath, R., Saunders, N. R., Watterson, K. G., and Martin, P. G. “Low-dose” aprotinin modifies hemostasis but not proinflammatory cytokine release. Ann Thorac Surg. 63: 68-73, 1997.

25.       Schmartz, D., Tabardel, Y., Preiser, J. C., Barvais, L., d’Hollander, A., Duchateau, J., and Vincent, J. L. Does aprotinin influence the inflammatory response to cardiopulmonary bypass in patients? J Thorac Cardiovasc Surg. 125: 184-190, 2003.

26.       Chi, L., Li, Y., Stehno-Bittel, L., Gao, J., Morrison, D. C., Stechschulte, D. J., and Dileepan, K. N. Interleukin-6 production by endothelial cells via stimulation of protease-activated receptors is amplified by endotoxin and tumor necrosis factor-alpha. J Interferon Cytokine Res. 21: 231-240, 2001.

27.       Ray, M. J., and Marsh, N. A. Aprotinin reduces blood loss after cardiopulmonary bypass by direct inhibition of plasmin. Thromb Haemost. 78: 1021-1026, 1997.

28.       Khan, M. M., Gikakis, N., Miyamoto, S., Rao, A. K., Cooper, S. L., Edmunds, L. H., Jr., and Colman, R. W. Aprotinin inhibits thrombin formation and monocyte tissue factor in simulated cardiopulmonary bypass. Ann Thorac Surg. 68: 473-478, 1999.

29.       Jaggers, J. J., Neal, M. C., Smith, P. K., Ungerleider, R. M., and Lawson, J. H. Infant cardiopulmonary bypass: a procoagulant state. Ann Thorac Surg. 68: 513-520, 1999.

30.       Day, J. R., Taylor, K. M., Lidington, E. A., Mason, J. C., Haskard, D. O., Randi, A. M., and Landis, R. C. Aprotinin inhibits proinflammatory activation of endothelial cells by thrombin through the protease-activated receptor 1. J Thorac Cardiovasc Surg. 131: 21-27, 2006.

31.       Vergnolle, N. Proteinase-activated receptor-2-activating peptides induce leukocyte rolling, adhesion, and extravasation in vivo. J Immunol. 163: 5064-5069, 1999.

32.       Vergnolle, N., Hollenberg, M. D., Sharkey, K. A., and Wallace, J. L. Characterization of the inflammatory response to proteinase-activated receptor-2 (PAR2)-activating peptides in the rat paw. Br J Pharmacol. 127: 1083-1090, 1999.

33.       McLean, P. G., Aston, D., Sarkar, D., and Ahluwalia, A. Protease-activated receptor-2 activation causes EDHF-like coronary vasodilation: selective preservation in ischemia/reperfusion injury: involvement of lipoxygenase products, VR1 receptors, and C-fibers. Circ Res. 90: 465-472, 2002.

34.       Maree, A., and Fitzgerald, D. PAR2 is partout and now in the heart. Circ Res. 90: 366-368, 2002.

35.       Nystedt, S., Ramakrishnan, V., and Sundelin, J. The proteinase-activated receptor 2 is induced by inflammatory mediators in human endothelial cells. Comparison with the thrombin receptor. J Biol Chem. 271: 14910-14915, 1996.

36.       Yan, W., Tiruppathi, C., Lum, H., Qiao, R., and Malik, A. B. Protein kinase C beta regulates heterologous desensitization of thrombin receptor (PAR-1) in endothelial cells. Am J Physiol. 274: C387-395, 1998.

37.       Shinohara, T., Suzuki, K., Takada, K., Okada, M., and Ohsuzu, F. Regulation of proteinase-activated receptor 1 by inflammatory mediators in human vascular endothelial cells. Cytokine. 19: 66-75, 2002.

FIGURES

Figure 1: IL-6 production following TNF-a stimulation Figure 1

Figure 2:  tPA production following TNF-a stimulation Figure 2

Figure 3:  Tissue Factor Expression on TNF-a stimulated HUVECS Figure 3

Figure 4:  PAR-1 Expression on TNF-a stimulated HUVECS Figure 4

Figure 5:  PAR-2 Expression on TNF-a stimulated HUVECS Figure 5

Figure 6:  Calcium Fluxes following PAR1 Activation Figure 6

Figure 7:  Calcium Fluxes following PAR2 Activation Figure 7

 

Read Full Post »

« Newer Posts