Healthcare analytics, AI solutions for biological big data, providing an AI platform for the biotech, life sciences, medical and pharmaceutical industries, as well as for related technological approaches, i.e., curation and text analysis with machine learning and other activities related to AI applications to these industries.
Specific Aim: The main goal of this study is to determine how the addition of thrombin alters the proliferative response of vascular tissue leading to early anastomotic failure through G protein coupled receptor signaling.
Methods and Results: Porcine external jugular veins were harvested at 24h and 1 week after exposed to 5,000 units of topical bovine thrombin during surgery. Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK, were analyzed by immunocytochemistry and immunoblotting. Expression of PAR (PAR1, PAR2, PAR3, PAR4) was evaluated using RT-PCR. All thrombin treated vessels showed increased expression of MAPKs, and PAR receptors compared to control veins, which were not treated with topical thrombin. These data suggest that proliferation of vascular tissues following thrombin exposure is at least in part due to elevated levels of pERK. Elevated levels of p38 and pJNK may also be associated with an inflammatory on stress response of the tissue follow thrombin exposure.
Conclusion: Bovine thrombin is a mitogen, which may significantly increase vascular smooth muscle cell proliferation following surgery and repair. Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered.
Topical thrombin preparations have been used as haemostatic agents during cardiovascular surgery for over 60 years [1-3] and may be applied as a spray, paste, or as a component of fibrin glue [4]. It is currently estimated that over 500,000 patients per year are exposed to topical bovine thrombin (TBT) or commercially known as JMI during various surgical procedures. Thrombin is used in an extensive array of procedures including, but not limited to, neuro, orthopedic, general, cardiac, thoracic, vascular, gynecologic, head and neck, and dental surgeries [5, 6]. Furthermore, its use in the treatment of pseudoaneurysms in vascular radiology [7, 8] and topical applications on bleeding cannulation sites of vascular access grafts in dialysis units is widespread [6].
Thrombin is part of a superfamily of serine protease enzymes that perform limited proteolysis on a number of plasma and cell bound proteins and has been extensively characterized regarding its proteolytic cleavage of fibrinogen to fibrin. It is this process that underlies the therapeutic use of thrombin as a hemostatic agent. However, thrombin also leads to the activation of natural anticoagulant pathways via the activation of protein C when bound to thrombomodulin and also alters fibrinolytic pathways via its cleavage of thrombin- activateable fibrinolytic inhibitor (TAFI) [9]. Furthermore, thrombin is also a potent platelet activator, mitogen, chemoattractant, and vasoconstrictor [10]. Regulatory mechanisms controlling the proliferation, differentiation, or apoptosis of cells involve intracellular protein kinases that can transduce signals detected on the cell’s surface into changes in gene expression.
Through the activation of protease-activated receptors (PARs, a family of G-protein-coupled receptors), thrombin acts as a hormone, eliciting a variety of cellular responses [11, 12]. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. This cleavage produces a new N-terminus that serves as a tethered ligand which binds to the body of the receptor to effect transmembrane signaling. Synthetic peptides that mimic the tethered ligand of PAR activate the receptor independent of PAR1 cleavage. The diversity of PAR’s effects can be attributed to the ability of activated PAR1 to couple to G12/13, Gq or Gi [13]. Importantly, thrombin can elicit at least some cellular responses even after proteolytic inactivation, indicating possible action through receptors other than PARs. Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells [12, 14-21].
Most prominent amongst the known signal transduction pathways that control these events are the mitogen-activated protein kinase (MAPK) cascades, whose components are evolutionarily highly conserved in structure and organization. Each consisting of a module of three cytoplasmic kinases: a mitogen-activated protein (MAP) kinase kinase kinase (MAPKKK), an MAP kinase kinase (MAPKK), and the MAP kinase (MAPK) itself. There are three welldefined MAPK pathways: extracellular signal-protein regulated protein kinase (ERK1/ERK2, or p42/p44MAPKs) the p38 kinases [22, 23]; and the c-JunNH2-terminal kinases/stress-activated protein kinases (JNK/SAPKs) [24-27].
Though thrombin is most often considered as a haemostatic protein, its roles as mitogen and chemoattractant are well described [29-33]. To date, no evidence has been presented demonstrating a possible direct and long-term effect that thrombin preparations may have on anastomotic patency and vein graft failure. We had tested the impact of topical bovine thrombin affect at the anastomosis.
Materials and Methods:
Surgical Procedure: We have developed a porcine arteriovenous (AV) graft model that used to investigate the proliferative response and aid in the development of new therapies to prevent intimal-medial hyperplasia and improve graft patency. Left carotid artery to right external jugular vein fistulas were made using standard 6mm PTFE (Atrium Medical) in the necks of swine. Immediately following completion of the vascular anastomosis, flow rate were recorded in the venous outflow tract and again after 7 days. In one group of animals (n=4), the venous outflow tract was developed a significant proliferative response. For each set of test groups 5,000 units of thrombin JMI versus saline control on the vascular anastomosis at the completion of the surgical procedure used. Porcine external jugular veins were harvested at 24h and 1 week to characterize the molecular nature of signaling process at the anastomosis.
Ki67 Immunostaining: The harvested vein grafts were fixed in formalin for 24h at 25C before transferred into 70%ETOH if necessary, then the samples were cut and placed in paraffin blocks. The veins were dewaxed, blocked the endogenous peroxidase activity in 3% hydrogen peroxide in methanol, and followed by the antigen retrieval in 1M-citrate buffer (pH 6.0). The samples were cooled, rinsed with PBS before blocking the sections with 5% goat serum. The sections were immunoblotted for Ki67 clone MSB-1 (DakoCode# M7240) in one to fifty dilution for an hour at room temperature, visualized through biotinylated secondary antibody conjugation (Zymed, Cat # 85-8943) to the tertiary HRP-Streptavidin enzyme conjugate, colored by the enzyme substrate, DAB (dinitro amino benzamidine) as a chromogen, and counterstained with nuclear fast. As a result, positive tissues became brown and negatives were red.
MAPKs Immunostaining: The staining of MAPKs differs at the antigen retrieval, completed with Ficin from Zymed and rinsed. The immunoblotting, primary antibody incubation, done at 4 C overnight with total and activated forms of each MAPKs, which are being rabbit polyclonal antibodies used at 1/100 dilution (Cell Signaling) ERK, pERK, JNK, pJNK, p38, and except pp38 which was a mouse monoclonal antibody. The chromogen exposure accomplished by Vectastain ABC system (Vector Laboratories) and completed with DAB/Ni.
Immunoblotting: Protein extracts were homogenized in 1g/10ml (w/v) tissue to RIPA (50mM Tris-Cl (pH 8.0), 5 mM EDTA, 150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS). Before running the samples on the 4-20% SDS-PAGE, protein concentration were measured by Bradford Assay (BioRad) and adjusted. Following the transfer onto 0.45mM nitrocellulose membrane, blocked in 5% skim milk phosphate buffered saline at 4oC for 4h. Immunoblotted for activated MAPKs and washed the membranes in 0.1% Tween-20 in PBS. The pERK (42/44 kDA), pp38 (43kDA), and pJNK (46, 54 kDa) protein visualized with the polyclonal antibody roused against each in rabbit (1:5000 dilution from 200mg/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG conjugated with horseradish peroxidase (ECL, Amersham Corp).
RNA isolation and RT-PCR:The harvested vessels were kept in RNAlater (Ambion, Austin, TX). The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol, using proteinase K as recommended.
The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166). At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification. At the second step, hot start PCR reaction had been designed. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min in robotic arm thermocycler. The gene specific primers were for PAR1 5’CTG ACG CTC TTC ATG CCC TCC GTG 3’(forward), 5’GAC AGG AAC AAA GCC CGC GAC TTC 3’ (reverse); PAR2 5’GGT CTT TCT TCC GGT CGT CTA CAT 3’ (forward), 5’CCA TAG CAG AAG AGC GGA GCG TCT 3’ (reverse);PAR3 5’ GAG TCC CTG CCC ACA CAG TC 3’ (forward), 5’ TCG CCA AAT ACC CAG TTG TT 3’(reverse), PAR4 5’ GAG CCG AAG TCC TCA GAC AA 3’ (forward), 5’ AGG CCA AAC AGA GTC CA 3’ (reverse).
CTGF and Cyr61:The same method we used for the early expression genes cysteine rich gene (Cyr61) and CTGF by use of the gene specific primers. For CTGF the primers were forward and reverse respectively The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward) GGAAGCCTTGCT CATTCTTGA and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR. The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by extension cycle for 10 minutes at 68C.
RESULTS:
First we had shown the presence of PAR receptors, PAR1, PAR2, PAR3, and PAR4, on the cell membrane by RT-PCR (Figure 1, Figure 1- PAR expression on veins after 24hr) on the vein tissues treated or not treated with thrombin. Figure 1 illustrates RT-PCR analysis of harvested control and thrombin treated veins 24hr after AV graft placement using primers for PARs. We had showed that (Figure 1) there was an increased expression of PAR receptors after the thrombin treatment. These data demonstrate that all the PAR mRNA can be detected in test veins with the elevation of expression after 24 hr treatment with BT. This data the hypothesis for the function of PAR receptors in vascular tissues that they serve not only as sensors to protease activity in the local environment towards coagulation but also reactivity to protease reagents may increase due to inflammatory or proliferative stimuli.
TBT cause elevation of DNA synthesis at the anastomosis observed by Ki67 immunostaining:
Next question was to make linear correlation between the expressions of PARs to elevation of DNA synthesis. We analyzed the cell proliferation mechanism by cell cycle specific antibody, Ki67, and displayed its presence on gross histology sections of vein tissues. Ki67 proteins with some other proteins form a layer around the chromosomes during mitosis, except for the centromers and telemores where there are no genes. Further, Ki67 functions to protect the DNA of the genes from abnormal activation by cytoplasmic activators during the period of mitosis when the nuclear membrane has disappeared. If a cell leaves the cell cycle, all the Ki67 proteins disappear within about 20min. Therefore, measurement of the Ki67 is a very sensitive method to determine the state of the cell behavior after thrombin stimuli. The expressions of Ki67 on the tissues were highly discrete in thrombin applied veins compare to in saline controls. Hence, we concluded that the elevation of DNA synthesis was increased due to TBT activity (Figure 2- Ki67 Proliferation, Fig. 2) and there was a defined cellular proliferation not the enlargement of the cells if TBT used.
Proliferation of the tissue depends on pERK
PARs are GPCRs activate downstream MAPKs, and thrombin was a mitogen. Changes in mitogen activated protein kinases (MAPK), pERK, p-p38, pJNK through both immunocytochemistry and western Immunoblotting were measured. As a result, we had processed the treated veins and controls with total and activated MAPKs to detect presumed change in their activities due to thrombin application.
First, ERK was examined in these tissues (in Figure 3, Figure 3-The expression of ERK after thrombin treatment in the tissues). We found that there was a phosphorylation of ERK (Figure3A) compared to paired staining of total protein expression in the experimental column whereas there was no difference between the total and activated staining of control veins. The western blots showed that the activation of pERK in the TBT treated samples 76% T higher than the controls. This data suggest that the proliferation of the vein gained by activation of ERK, which detects proliferation, differentiation and development response to extracellular signals as its role in MAPK pathway.
The next target was JNK that plays a role in the inflammation, stress, and differentiation. In figure 4, Figure 4-The expression of JNK after thrombin treatment in the tissues, there was an activation of JNK when its pair expression was compared suggesting that there should be an inflammatory response after the thrombin application. This piece supports the previous studies done in Lawson lab for autoimmune response mechanism due to ectopical thrombin use in the patients. The application of thrombin elevated the activation of JNK almost two fold compare to without TBT in western blots. Among the other MAPKs we had tested it has the weakest expression towards thrombin treatment.
Finally, we had tested p38 as shown in Figure 5,Figure5-The expression of p38 after thrombin treatment in the tissues. The expression of p38 was higher than JNK but much lower than ERK. Unlike JNK it was not showed pockets of expression around the tissue but it was dispersed. If TBT used on the veins the expression of activated p-p38 was almost twice more than the without ectopic thrombin vein tissues.
In general, all MAPKs showed increased in their phosphorylation level. The level of activated MAPK expression was increased 200% in the tested animal. The order of expression from high to low would be ERK, JNK, and p38.
The genetic expression change
The application of thrombin during surgeries may seem helping to place the graft but later even it may even affect to change the genetic expression towards angiogenesis, as a result occluding the vein for replacement. Overall data about vascularization and angiogenesis show that the cystein rich family genes take place during normal development of the blood vessels as well as during the attack towards the system for protection. The application of thrombin to stop bleeding ignite the expression of the connective tissue growth factor (CTGF) and cystein rich protein (Cyr61), which are two of the CCN family genes, as we shown in Figure 6, Figure 6- The Expression of CTGF and Cyr61 after Thrombin Treatment. Cyr61 was expressed at after 24h and 7 days, but CTGF had started to expressed after 7 days of thrombin application on the extrajugular vein.
DISCUSSION:
The ectopical application of thrombin during surgeries should be revised before it used, since according to our data, the application would trigger the expression of PARs in access that leads to the cell proliferation and inflammation through MAPKs as well as downstream gene activation, such as CGTF and Cyr61 towards angiogenesis. As a result, there would be a very fast occlusion in the replaced vessels that will require another transplant in very short time.
From cell membrane to the nucleus we had checked the affects of thrombin application on the vein tissues. We had determined that the thrombin is also mitogenic if it is used during surgeries to stop bleeding. This activity results in elevating the expression of PARs that tip the balance of the cells due to following cellular events.
It has been established by previous studies that, the thrombin regulates coagulation, platelet aggregation, endothelial cell activation, proliferation of smooth muscle cells, inflammation, wound healing, and other important biological functions. In concert with the coagulation cascade, PARs provide an elegant mechanism that links mechanical information in the form of tissue injury, change of environmental condition, or vascular leak to the cellular responses as if it is a hormonal element function related to time and dose dependent. Consequently, the protein with so many roles needs to be used with cautions if it is really necessary.
The first line of evidence was visual since we had observed the thickening of the vessel shortly after TBT used. The histological was established from the evidence of DNA synthesis at S phase by the elevated expression of the Ki67 proteins. These proteins accumulate in cells during cell cycle but their distribution varies within the nucleus at different stages of the cycle. In the daughter cells following mitosis, the Ki67 proteins are present in the perinuclear bodies, which then fuse to give the early nucleoli, so that their number decreases during the growth1 (G1) phase up to the G1-S transition, giving 1-3 large-round-nucleoli in synthesis (S) phase. During the S phase, the nucleoli increase in size up to the S-G2 transition, when the nucleoli assume an irregular outline.
Next, level of evidence was the signaling pathway analysis from membrane to the nucleus. As a result of the application the PAR receptors were increased to respond thrombin, therefore, the MAPKs protein expression was increased (fig 3,4,5). Even though PAR2 does not directly response to thrombin, it is activated indirectly. The elevated levels of MAPKs, pERK, pJNK and p-p38 in bovine thrombin treated vessels suggested the change of gene expression. These MAPKKs and MAPKs can create independent signaling modules that may function in parallel. Each module contains three kinases (MAPKKK, MAP kinase kinase, MAPKK, MAPK kinase, and MAPK). The Raf (MAPKKK) -> Mek (MAPKK) -> Erk (MAPK) pathway is activated by mitotic stimuli, and regulates cell proliferation. In our data we had detected the elvation of ERK more than the other MAPKs. In contrast, the JNK and p-38 pathways are activated by cellular stress including telomere shortening, oncogenic activation, environmental stress, reactive oxygen species, UV light, X-rays, and inflammatory cytokines, and regulate cellular processes such as apoptosis.
Finally, the stimuli received from MAPKs cause differentiation of the downstream gene expression, this results in the activation of development mechanism toward angiogenesis. The hemostasis of the cells needs to be protected very well to preserve the continuity of actions in the adult life.
Conclusion: Bovine thrombin is a mitogen, which may significantly increased vascular smooth muscle cell proliferation following surgery and repair. Therefore, we suggest that bovine thrombin use on vascular tissues seriously reconsidered thinking that there is a diverse response mechanism developed and possibly triggers many other target resulting in a disease according to the condition of the person who receives the care. In long term, understanding these mechanisms will be our future direction to elucidate the function of thrombin from diverse responses such as in transplantation, development and arterosclorosis. In our immediate step, we will elucidate the specific cell type and its cellular response against JMI compared to purified human, purified bovine and topical human thrombin, since veins are made of two kinds of cell populations, endothelial and smooth muscle cells.
REFERENCES:
1. Seegers, W.H., et al., The use of purified thrombin as a hemostatic agent. Science, 1939. 89: p. 86.
2. Warner ED, B.K., Seegers WH, Smith HP, Further experience with the use of thrombin as a hemostatic agent. Proceedings of the Society for Experimental Biology, 1939. 41: p. 655-77.
3. TidrickRT, S.W., Warner ED, Clinical experience with thrombin as an Hemostatic Agent. Surgery, 1943. 14: p. 191-16.
4. Alving, B.M., et al., Fibrin sealant: summary of a conference on characteristics and clinical uses [see comments]. Transfusion, 1995. 35(9): p. 783-90.
5. Machovich, R., Clinical use of thrombin., in In the thrombin, R. Machovich, Editor. 1984, CRC Press: Boca Raton, FL. p. 105-106.
6. Vaziri, N.D., Topical thrombin and control of bleeding from the fistula puncture sites in dialyzed patients. Nephron., 1979. 24(5): p. 254-6.
7. Reeder, S.B., D.M. Widlus, and M. Lazinger, Low-dose thrombin injection to treat iatrogenic femoral artery pseudoaneurysms. AJR. American Journal of Roentgenology., 2001. 177(3): p. 595-8.
8. Ferguson, J.D., et al., Ultrasound guided percutaneous thrombin injection of iatrogenic femoral artery pseudoaneurysms after coronary angiography and intervention. Heart (British Cardiac Society)., 2001. 85(4): p. E5.
9. Dahlback, B., Blood coagulation. Lancet, 2000. 355(9215): p. 1627-32.
10. Bar-Shavit, R., et al., Thrombin chemotactic stimulation of HL-60 cells: studies on thrombin responsiveness as a function of differentiation. Journal of Cellular Physiology., 1987. 131(2): p. 255-61.
11. Coughlin, S.R., Thrombin receptor structure and function. Thrombosis & Haemostasis, 1993. 70(1): p. 184-7.
12. Coughlin, S.R., Thrombin Signaling and Protease-Activated-Receptors. Nature, 2000. 407: p. 258-264.
13. Coughlin, S.R., How the protease thrombin talks to cells. Proceedings of the National Academy of Sciences of the United States of America, 1999. 96(20): p. 11023-7.
14. Apostolidis, A. and R.H. Weiss, Divergence in the G-protein-coupled receptor mitogenic signalling pathway at the level of Raf kinase. Cellular Signalling, 1997. 9(6): p. 439-45.
15. Capers, Q.t., et al., Vascular thrombin receptor regulation in hypertensive rats. Circulation Research, 1997. 80(6): p. 838-44.
16. Nerem, R.M., Alexander, R.W., Chappell, D.C., Medford, R.M., Varner, S.E., Taylor, W.R., The study of the influence of flow on vascular endothelial biology. American Journal of the Medical Sciences, 1998. 316: p. 169-175.
17. Maulon, L., et al., T-Cell receptor signaling pathway exerts a negative control on thrombin-mediated increase in [Ca2+]i and p38 MAPK activation in Jurkat T cells: implication of the tyrosine kinase p56Lck. Blood, 1998. 91(11): p. 4232-41.
18. Rudroff, C., et al., Characterization of functional thrombin receptors in human pancreatic tumor cells (MIA PACA-2). Pancreas, 1998. 16(2): p. 189-94.
19. Hirschi, K.K., Rohovsky, S.A., Beck, L.H., D’Amore, P.A., Endothelial cells modulate the proliferation of mural cell precursors via PDGF-BB and heterotypic cell contact. Circulation Research (in press), 1999.
20. Lockwood, C.J., Heritable coagulopathies in pregnancy. Obstetrical & Gynecological Survey, 1999. 54(12): p. 754-65.
21. Tsopanoglou, N.E. and M.E. Maragoudakis, On the mechanism of thrombin-induced angiogenesis. Potentiation of vascular endothelial growth factor activity on endothelial cells by up-regulation of its receptors. Journal of Biological Chemistry, 1999. 274(34): p. 23969-76.
22. Hadcock, J.R. and C.C. Malbon, Agonist regulation of gene expression of adrenergic receptors and G proteins. Journal of Neurochemistry, 1993. 60(1): p. 1-9.
23. Hadcock, J.R., et al., Cross-talk between tyrosine kinase and G-protein-linked receptors. Phosphorylation of beta 2-adrenergic receptors in response to insulin. Journal of Biological Chemistry, 1992. 267(36): p. 26017-22.
24. Sanchez, I., et al., Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature, 1994. 372(6508): p. 794-8.
25. Derijard, B., et al., JNK1: a protein kinase stimulated by UV light and Ha-Ras that binds and phosphorylates the c-Jun activation domain. Cell, 1994. 76(6): p. 1025-37.
26. Kallunki, T., et al., JNK2 contains a specificity-determining region responsible for efficient c-Jun binding and phosphorylation. Genes & Development, 1994. 8(24): p. 2996-3007.
27. Kyriakis, J.M., et al., The stress-activated protein kinase subfamily of c-Jun kinases. Nature, 1994. 369(6476): p. 156-60.
28. Gerwins, P., J.L. Blank, and G.L. Johnson, Cloning of a novel mitogen-activated protein kinase kinase kinase, MEKK4, that selectively regulates the c-Jun amino terminal kinase pathway. Journal of Biological Chemistry, 1997. 272(13): p. 8288-95.
29. Weiss, R.H. and R. Nuccitelli, Inhibition of tyrosine phosphorylation prevents thrombin-induced mitogenesis, but not intracellular free calcium release, in vascular smooth muscle cells. Journal of Biological Chemistry., 1992. 267(8): p. 5608-13.
30. Naldini, A., et al., Thrombin enhances T cell proliferative responses and cytokine production. Cellular Immunology., 1993. 147(2): p. 367-77.
31. Clohisy, D.R., J.M. Erdmann, and G.D. Wilner, Thrombin binds to murine bone marrow-derived macrophages and enhances colony-stimulating factor-1-driven mitogenesis. Journal of Biological Chemistry., 1990. 265(14): p. 7729-32.
32. Herbert, J.M., I. Lamarche, and F. Dol, Induction of vascular smooth muscle cell growth by selective activation of the thrombin receptor. Effect of heparin. FEBS Letters, 1992. 301(2): p. 155-8.
33. McNamara, C.A., et al., Thrombin stimulates proliferation of cultured rat aortic smooth muscle cells by a proteolytically activated receptor [see comments]. Journal of Clinical Investigation, 1993. 91(1): p. 94-8.
34. Bardwell, L. and J. Thorner, A conserved motif at the amino termini of MEKs might mediate high-affinity interaction with the cognate MAPKs. Trends in Biochemical Sciences, 1996. 21(10): p. 373-4.
35. Enslen, H. and R.J. Davis, Regulation of MAP kinases by docking domains. Biology of the Cell, 2001. 93(1-2): p. 5-14.
36. Kyriakis, J.M. and J. Avruch, Mammalian mitogen-activated protein kinase signal transduction pathways activated by stress and inflammation. Physiological Reviews, 2001. 81(2): p. 807-69.
37. Grandaliano, G., et al., Mitogenic signaling of thrombin in mesangial cells: role of tyrosine phosphorylation. American Journal of Physiology, 1994. 267(4 Pt 2): p. F528-36.
38. Grandaliano, G., A.J. Valente, and H.E. Abboud, A novel biologic activity of thrombin: stimulation of monocyte chemotactic protein production. Journal of Experimental Medicine, 1994. 179(5): p. 1737-41.
39. Stouffer, G.A. and M.S. Runge, The role of secondary growth factor production in thrombin-induced proliferation of vascular smooth muscle cells. Seminars in Thrombosis & Hemostasis, 1998. 24(2): p. 145-50.
40. Weiss, R.H. and M. Maduri, The mitogenic effect of thrombin in vascular smooth muscle cells is largely due to basic fibroblast growth factor. Journal of Biological Chemistry, 1993. 268(8): p. 5724-7.
41. Alexandropoulos, K., et al., Evidence that a G-protein transduces signals initiated by the protein-tyrosine kinase v-Fps. Journal of Biological Chemistry, 1991. 266(24): p. 15583-6.
Figure Legends:
Figure 1: The mRNA level expression of PARs have been shown by sensitive RT-PCR. PAR1 (lanes 1, 5), PAR2 (lanes 2, 6), PAR3 (lanes 3, 7), and PAR4 (Lanes 4, 8) from veins treated with BT for 7 days or control veins. Figure 1- PAR expression on veins after 24hr
Figure 2: The proliferation of the veins shown by Ki67 immunocytochemistry. Treated panel A, and B, untreated Panel C and D, at 4X and 20X magnification respectively.Figure 2- Ki67 Proliferation
Figure 3 : The activity of ERK. (A) Immunostaining of total and activated ERK, Panel A and C for activated ERK, panel B and D for total ERK experiment vs. control respectively; (B)Western immunoblot of pERK, treated vs. untreated veins, (C) Scaled Graph for western immunoblot (C) treated and un-treated with TBT veins.Figure 3-The expression of ERK after thrombin treatment in the tissues
Figure 4: The activity of JNK. (A) Immunostaining of total and activated JNK, Panel A and C for activated JNK, panel B and D for total JNK experiment vs. control respectively; (B)Western immunoblot of pJNK; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure 4-The expression of JNK after thrombin treatment in the tissues
Figure 5: The activity of p38. (A) Immunostaining of total and activated p38. Panel A and C for pp38, panel B and D for p38 experiment vs. control respectively; (B) Western immunoblot of p38 treated vs. untreated veins; (C) Scaled Graph for western immunoblot treated and un-treated with TBT veins.Figure5-The expression of p38 after thrombin treatment in the tissues
… mechanisms. Part II. Summary: This is the second of a coagulation series on PharmaceuticalIntelligence(wordpress.com) treating the diverse effects of NO on
… Nitric Oxide: Platelets, Circulatory Disorders, and Coagulation Effects. (Part I) Larry H. Bernstein, MD, FCAP, … is the first of a two part treatment of platelets,
… mechanisms. Part II. Summary: This is the second of a coagulation series on PharmaceuticalIntelligence(wordpress.com) treating the diverse effects of NO on pla
crystal structure of thrombin. (Photo credit: Wikipedia)
Review Profs and correspondence should be addressed to:
Dr. Jeffrey Lawson
Duke University Medical Center
Room 481 MSRB/ Boxes 2622
Research Drive
Durham, NC 27710
Phone (919) 681-6432
Fax (919) 681-1094
Email: lawso717@duke.edu, demet.sag@gmail.com
*Current Address: TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130
Abstract:
Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation. In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells. Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2. We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin. These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies. Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.
WORD COUNT OF ABSTRACT: 221
The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells
Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2). Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).
Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14). First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation. PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation. Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain. PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.
Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways. Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1. PAR couples with at least three G protein families Gq, Gi, and G12/13. With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling. Gi dependent signaling activates Ras, p42/44, Src/Fak, p42. Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin. These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).
Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription. The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel. Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36). Currently the most common topical products approved by FDA are bovine originated. Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.
In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs). We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue. Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.
MATERIALS AND METHODS:
Thrombins: Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).
Cell Culture: The pooled cells were received from Clonetics. Human endothelial cells (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF). The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5. Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.
RNA isolation and RT-PCR: The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol. The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166). At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification. At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min. The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.
The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward) GGAAGCCTTGCT CATTCTTGA and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR. The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.
Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism. This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product. HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h. The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa. The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.
BrDu incorporation:This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA. The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA. The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche). Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody. The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.
Nuclear Extract Preparation: The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD). For each treatment one 100mm plate were used per cell line.
EMSA: The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C. The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.
Immunoblotting: The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs. The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue). The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations. The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).
RESULTS:
The expression of PARs differs for the types of vascular cells.
Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not. The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs. We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).
The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated more on AoSMC than HUVECs (Figure 2 and Figure 3).
In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period. The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC.
In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable. Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11. This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.
Next, the proliferation through MAPK signaling had been tested by ERK activation. Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern. Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr. AoSMCs get phosphorylated at least 5 times more than HUVECs. This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).
Activation of DNA synthesis in AoSMCs.As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.
DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu. All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).
DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours. The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown).
DNA synthesis at AoSMCs With BrDu:We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5. The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h. At 3h time interval no difference between non-stimulated and stimulated by topical bovine thrombin AoSMC. At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown). This predicts that as well as the origin of the product the purity of the preparation is important.
Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs
Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression. PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes. HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins. As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs. PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%. PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%. These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when. This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)
The effects of thrombins on the transcription factors.Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs topical bovine thrombin causes elevation of ATF2 activation by 50% and c-Rel by 30%. Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs. As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.
Gene Interaction changes after the thrombin treatment both in vivo and in vitro: Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006). These genes have a predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61). In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression. The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin. The expression of beta actin is at least two-three times abundant in HUVECs than that of AoSMC. The CTGF is higher in AoSMCs than HUVEC. Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC. In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs. However, the Cyr61 expression adds up to the equal level of cDNA expression.
Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation. As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.
DISCUSSION:
In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells. We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin. For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs. Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.
Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin. As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.
Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most. As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel. Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.
The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45). Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2. Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg. However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin. In this report with the highlights of our data it seems that it is possibly an indirect response.
The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein. Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells. Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs. These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos. In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB but also T cell activation by ATF-2 observed.
CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I. Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11. The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP. Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk. NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.
The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations. It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.
In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs.The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation. Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression. In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought. Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin. The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).
Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.
All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.
References:
1. Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.
2. Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.
3. Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.
4. Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.
5. Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.
6. Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.
7. Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.
8. Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.
9. Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.
10. Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.
11. Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.
12. Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.
13. Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.
14. Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.
15. Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.
16. Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.
17. Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.
18. Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.
19. Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.
20. Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.
21. Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.
22. Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.
23. McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.
24. Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.
25. Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.
26. Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.
27. De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.
28. De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.
29. De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.
30. Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.
31. Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.
32. O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.
33. Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.
34. Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.
35. Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.
36. Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.
37. Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.
38. Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.
39. Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.
40. Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.
41. Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.
42. Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.
43. Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.
44. Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.
45. Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.
46. Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.
47. O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.
Figure Legends:
Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1
Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2
Figure 3: The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11 Figure 3
Figure 4: The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4
Figure 5: AoSMC proliferation after BrDu treatment. Figure 5
Figure 6: Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6
Figure 7: The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs. Figure 7
Figure 8: Gene interactions differ after ectopic IIa. (A) in the AoSMC, (B) In the HUVEC. Figure 8
Vascular Surgery: International, Multispecialty Position Statement on Carotid Stenting, 2013 and Contributions of a Vascular Surgeon at Peak Career – Richard Paul Cambria, MD
Author and Curator: Aviva Lev-Ari, PhD, RN
Article ID #66: Vascular Surgery: International, Multispecialty Position Statement on Carotid Stenting, 2013 and Contributions of a Vascular Surgeon at Peak Career – Richard Paul Cambria, MD. Published on 7/14/2013
WordCloud Image Produced by Adam Tubman
Part One:
Vascular Surgery International, Multispecialty Position Statement on Carotid Stenting, 2013
Part Two:
Contributions of a Vascular Surgeon at Peak Career – Richard Paul Cambria, MD, Chief, Division of Vascular and Endovascular Surgery Co-Director, Thoracic Aortic Center @ MGH
I. Recollection of a visit at Dr. Cambria’s Office, 2004
II. Shadowing Dr. Cambria in OR @MGH
III. Dr. Cambria: Selection of Contributions to Scientific Research on Vascular Surgery
IV. Cardiovascular Clinical Observational Experience – Aviva Lev-Ari, PhD, RN
V. Cases with Complications: CEA and CAS
Part Three:
On 8/1/2013, Cleveland Clinic Reports Equivalence between carotid endarterectomy (CEA) and open-heart surgery (OHS) and carotid artery stenting (CAS) followed by coronary artery bypass graft (CABG) surgery or non-CABG cardiac surgery
Part One:
Vascular Surgery International, Multispecialty Position Statement on Carotid Stenting, 2013 Part
No other invasive intervention procedure in the history of Vascular Surgery has stormed the profession more than the two treatment options for carotid artery partial to complete blockage than Carotid endarterectomy (CEA) and Carotid angioplasty and stenting (CAS).
The debate required evidence based resolution for the two treatment options in terms of patient outcomes and adverse events. As the title of the Position statement explained below, the verdict is non equivocal: Routine Carotid Stenting is inferior to Carotid endarterectomy (CEA) from a patient safety and outcomes.
In conclusion, current global evidence shows that, even in the best academic centers, CAS is less effective (causing more strokes) and more expensive than CEA. It is premature that some guidelines have recently added support for routine practice CAS as an alternative to CEA for
asymptomatic43,44 and
low/ average surgical risk symptomatic patients43–45
because CAS may easily be misinterpreted by readers as being equivalent for
stroke prevention46 and
historical procedural standards were cited.
CAS, for these patients, should still only be performed and paid for within well‐designed, adequately powered trials. The US Center for Medicare and Medicaid Services is doing its job and setting an excellent global example. It is protecting Medicare beneficiaries from routine practice procedures, which are currently more likely to harm them and waste finite resources47 that could be used for their advantage. Meanwhile, we need to reassess the current routine practice role of CEA and deliver optimal current medical treatment to all who need it.
Clinical Trials Results
To avoid misguidance from calls for more routine practice (nontrial) carotid angioplasty/stenting (CAS), we need to distinguish relevant facts and patients’ best interests from all else (distractions). A recent editorial by White and Jaff1 is one publication which illustrates this need particularly well. First, these authors are correct in reminding us that the responsibility of physicians is to provide best patient care, putting aside personal interest. This is inherent in any profession.2 However, misconception, bias, and conflict of interest exist. Therefore, healthcare payment organizations, such as the US Center for Medicare and Medicaid Services are important gatekeepers to facilitate patient access to interventions that are likely to help them, as opposed to all others.
It is also true that CAS and carotid endarterectomy (CEA) result in better outcomes when patients are carefully selected and skilled operators perform the procedures in experienced centers.1 We would add that key indicators (such as 30‐day periprocedural stroke/death rates) must be accurately measured in routine (real‐world) practice, particularly as stroke and death rates here may be unacceptably higher than in trials. 3–5 Therefore, it is most appropriate, as suggested by White and Jaff,1 that coverage for carotid procedures be dependent on facility accreditation and audited measurement of key standards indicators in all practices performing these procedures.
This is a priority issue. White and Jaff1 also correctly state “a major change in evidence based stroke prevention strategies will require clinical trial data.,7,8 meta‐analyses, and routine practice.9–14 Most of these data relate to low/average risk symptomatic patients and demonstrate that, for these patients, even in the best academic centers, CAS is consistently associated with significantly higher rates of stroke or death (during or after the periprocedural period) compared with CEA.
It is incorrect that CREST “failed to show a difference in overall stroke rate between CAS and CEA” as stated by White and Jaff.1 In CREST, for average surgical risk symptomatic patients, the periprocedural stroke and death rates were 6.0% for CAS versus 3.2% for CEA (hazard ratio, 1.89; 95% confidence interval, 1.11–3.21; P=0.02).8
The higher periprocedural risk of stroke or death with CAS is particularly evident in the most senior patients (>68–70 years),13,15,16 those undergoing the procedure <7 days of incident cerebral or retinal ischemic symptoms17 (when CEA has the highest stroke prevention potential),18 those undergoing CAS outside clinical trials,19 and those with certain anatomic features.20 No study has shown that CAS is more effective than CEA in preventing stroke. Further, most analyses show that CAS costs considerably more,21–24 despite calculations derived from CREST results.25 No randomized trial has been adequately powered to compare the procedural and longer term risk of CAS on stroke or death in low/average risk asymptomatic patients. However, in CREST, the direction of effect was toward nearly twice the risk (periprocedural stroke/death rate was 2.5% for CAS versus 1.4% for CEA; hazard ratio, 1.88; 95% confidence interval, 0.79–4.42; P=0.15).8 This was consistent with the significantly higher periprocedural stroke rates seen in CREST CAS‐treated symptomatic patients8 and nontrial CAS‐treated asymptomatic patients.9,26
Meanwhile, medical treatment for asymptomatic carotid disease has improved significantly since past randomized trials of medical treatment alone versus additional CEA.27–32 Medical treatment consists of identification of risk factors for heart and vascular disease and risk reduction using healthy lifestyles and appropriate drugs. Improvement in medical treatment is clear from robust analyses of all published comparable, quality stroke rate calculations (including from, and within, randomized surgical trials) of patients with 50% to 99% asymptomatic carotid stenosis. This knowledge is not, as claimed by White and Jaff,1 derived from short‐cut extrapolation from coronary artery trials. Using the same standardized rate calculations, we are now seeing an average annual rate of ipsilateral stroke of ≈0.5% with medical treatment alone.30,33,34 This is about 3X— lower than that of asymptomatic CREST CAS‐treated patients and about half the rate of asymptomatic CREST CEA‐treated patients.7,9 This low rate with medical treatment is likely to fall further with improvements in efficacy, definition, and implementation.
However, recently published rate calculations indicate that, at most, only ≈2.5% of low/average CEA risk patients with 50% to 99% asymptomatic carotid stenosis will receive a stroke prevention benefit from CEA or CAS during their remaining average 10‐year lifetime if they receive good, current medical treatment (assuming the procedural risk of stroke/death is always zero).35 This indicates that a one‐size‐fits‐all procedural approach for these asymptomatic patients is now unlikely to be beneficial overall. We need to be much more selective. Research is required to determine which asymptomatic subgroups now benefit from carotid procedures in addition to current optimal medical treatment.
We have found no direct information about the influence of current medical treatment in patients with low/average CEA risk symptomatic carotid stenosis. However, improving results for medically treated asymptomatic patients27–32 and procedural trial asymptomatic and symptomatic patients8 indicate that a 6% periprocedural risk of
stroke or
death (the current standard) is now too high.
New randomized and risk stratification studies are required using current optimal medical treatment and procedural methods.36 For example,
improved plaque37 and
thrombus identification38 or
embolic signal detection39 above and below the stenosis
may help better identify carotid plaques responsible for carotid territory ischemic symptoms. Further, the best approach for patients with high surgical risk carotid stenosis remains uncertain because risk of stroke or death has not been measured with any standard of medical treatment or adequate procedural trials. However, some registries show significantly higher risks of stroke/death with CAS compared with CEA in asymptomatic and symptomatic high surgical risk patients.40
Incidence of MI
Calls from other authors for more routine CAS on the grounds of lower periprocedural myocardial infarction (MI) rates compared with CEA are distracting.41 MI is not a measure of stroke prevention efficacy, even though it is an important procedural complication. The inclusion of periprocedural MI with stroke and death in the primary outcome measure in CREST resulted in primary outcome equivalence between CAS and CEA. However, it did not result in efficacy equivalence. In CREST, 1.1% (14/1262) of CAS patients had periprocedural clinical MI (biomarkers plus chest pain/ECG evidence) compared with 2.3% (28/1240) of CEA patients7 (P=0.03). However, periprocedural stroke was nearly twice as common (81/2502; 3.2%)7 as periprocedural clinical MI (42/2502; 1.7%) and, as mentioned above, CAS caused almost twice as many of these strokes as CEA.Further, in CREST, the mortality rate up to 4 years was equally poor for CREST patients with periprocedural stroke (20%),42 periprocedural clinical MI (19%),41 or periprocedural biomarker‐positive only MI (25%).41 Finally, nonfatal stroke was associated with a poorer quality of life at 1 year than nonfatal MI.7 Therefore, MI is a measure of carotid procedural risk (not benefit) and must be considered separately from stroke risk. Moreover, in CREST, CAS‐associated stroke was more troublesome for patients than CEA‐associated MI.
Conclusion
Calls for More Routine Carotid Stenting Are Currently Inappropriate, 3/2013
Carotid artery disease, also called carotid artery stenosis, occurs when the carotid arteries, the main blood vessels that carry oxygenated blood to the brain, become narrowed. The narrowing of the carotid arteries is most commonly related to atherosclerosis (a buildup of plaque, which is a deposit of fatty substances, cholesterol, cellular waste products, calcium, and fibrin in the inner lining of an artery). Atherosclerosis, or “hardening of the arteries,” is a vascular disease (disease of the arteries and veins). Carotid artery disease is similar to coronary artery disease, in which blockages occur in the arteries of the heart, and may cause a heart attack.
Click Image to Enlarge
To better understand how carotid artery disease affects the brain, a basic review of the anatomy of the circulation system of the brain follows.
What are the carotid arteries?
The main supply of blood to the brain is carried by the carotid arteries. The carotid arteries branch off from the aorta (the largest artery in the body) a short distance from the heart, and extend upward through the neck carrying oxygen-rich blood to the brain.
There are four carotid arteries: the right and left internal carotid arteries and the right and left external carotid arteries. One pair (external and internal) is located on each side of the neck. Just as a pulse can be felt in the wrists, a pulse can also be felt on either side of the neck over the carotid arteries.
Click to Enlarge
Why are the carotid arteries important?
Because the carotid arteries deliver blood to the brain, carotid artery disease can have serious implications by reducing the flow of oxygen to the brain. The brain needs a constant supply of oxygen in order to function. Even a brief interruption in blood supply can cause problems. Brain cells begin to die after just a few minutes without blood or oxygen. If the narrowing of the carotid arteries becomes severe enough to block blood flow, or a piece of atherosclerotic plaque breaks off and obstructs blood flow to the brain, a stroke may occur.
What causes carotid artery disease?
Atherosclerosis is the most common cause of carotid artery disease. It is unknown exactly how atherosclerosis begins or what causes it. Atherosclerosis is a slow, progressive, vascular disease that starts as early as childhood. However, the disease has the potential to progress rapidly. It is generally characterized by the accumulation of fatty deposits along the innermost layer of the arteries. If the disease process progresses, plaque formation may take place. Plaque is made up of deposits of smooth muscle cells, fatty substances, cholesterol, calcium, and cellular waste products. This thickening narrows the arteries and can decrease blood flow or completely block the flow of blood to the brain.
Risk factors associated with atherosclerosis include:
Older age
Male
Family history
Race or ethnicity
Genetic factors
Hyperlipidemia (elevated fats in the blood)
Hypertension (high blood pressure)
Smoking
Diabetes
Obesity
Diet high in saturated fat
Lack of exercise
A risk factor is anything that may directly increase or be associated with a person’s chance of developing a disease. It may be an activity, such as smoking, diet, family history, or many other things. Different diseases have different risk factors.
Although these risk factors increase a person’s risk, they do not necessarily cause the disease. Some people with one or more risk factors never develop the disease, while others develop disease and have no known risk factors. Knowing your risk factors to any disease can help to guide you into the appropriate actions, including changing behaviors and being clinically monitored for the disease.
What are the symptoms of carotid artery disease?
Carotid artery disease may be asymptomatic (without symptoms) or symptomatic (with symptoms). Asymptomatic carotid disease is the presence of a significant amount of atherosclerotic buildup without obstructing enough blood flow to cause symptoms. However, a sufficiently tight stenosis will not always cause symptoms. Symptomatic carotid artery disease may result in either a transient ischemic attack (TIA) and/or a stroke (brain attack).
A transient ischemic attack (TIA) is a sudden or temporary loss of blood flow to an area of the brain, usually lasting a few minutes to one hour. Symptoms go away entirely within 24 hours, with complete recovery. Symptoms of a TIA may include, but are not limited to, the following:
Sudden weakness or clumsiness of an arm and/or leg on one side of the body
Sudden paralysis (inability to move) of an arm and/or leg on one side of the body
Loss of coordination or movement
Confusion, decreased ability to concentrate, dizziness, fainting, and/or headache
Numbness or loss of sensation (feeling) in the face
Numbness or loss of sensation in an arm and/or leg
Temporary loss of vision or blurred vision
Inability to speak clearly or slurred speech
TIA may be related to severe narrowing or blockage or from small pieces of an atherosclerotic plaque breaking off, traveling through the bloodstream, and lodging in small blood vessels in the brain. With TIA, there is rarely permanent brain damage.
Call for medical help immediately if you suspect a person is having a TIA, as it may be a warning sign that a stroke is about to occur. Not all strokes, however, are preceded by TIAs.
Stroke is another indicator of carotid artery disease. The symptoms of a stroke are the same as for a TIA. A stroke is loss of blood flow (ischemia) to the brain that continues long enough to cause permanent brain damage. Brain cells begin to die after just a few minutes without oxygen. The area of dead cells in tissues is called an infarct.
The area of the brain that suffered the loss of blood flow will determine what the physical or mental disability may be. This may include impaired ability with movement, speech, thinking and memory, bowel and bladder function, eating, emotional control, and other vital body functions. Recovery from the specific ability affected depends on the size and location of the stroke. A stroke may result in problems, such as weakness in an arm or leg or may cause paralysis, loss of speech, or even death.
The symptoms of carotid artery disease may resemble other medical conditions or problems. Always consult your doctor for a diagnosis.
How is carotid artery disease diagnosed?
In addition to a complete medical history and physical examination, diagnostic procedures for carotid artery disease may include any, or a combination, of the following:
Auscultation (listening to) of carotid arteries. Placement of a stethoscope over the carotid artery to listen for a particular sound called a bruit (pronounced brew-ee). A bruit is an abnormal sound that is produced by blood passing through a narrowed artery. A bruit is generally considered a sign of an atherosclerotic artery; however, an artery may be diseased without producing this sound.
Carotid artery duplex scan. A type of vascular ultrasound study performed to assess the blood flow of the carotid arteries. A carotid artery duplex scan is a noninvasive (the skin is not pierced) procedure. A probe called a transducer sends out ultrasonic sound waves at a frequency too high to be heard. When the transducer (like a microphone) is placed on the carotid arteries at certain locations and angles, the ultrasonic sound waves move through the skin and other body tissues to the blood vessels, where the waves echo off of the blood cells. The transducer picks up the reflected waves and sends them to an amplifier, which makes the ultrasonic sound waves audible. Absence or faintness of these sounds may indicate an obstruction to the blood flow.
Magnetic resonance imaging (MRI). A diagnostic procedure that uses a combination of large magnets, radiofrequencies, and a computer to produce detailed images of organs and structures within the body. To have this test done, you lie inside a big tube while magnets pass around your body. It is very loud. Sometimes it is done with IV contrast injected into your veins and sometimes not.
Magnetic resonance angiography (MRA). A noninvasive diagnostic procedure that uses a combination of magnetic resonance technology (MRI) and intravenous (IV) contrast dye to visualize blood vessels. Contrast dye causes blood vessels to appear opaque on the MRI image, allowing the doctor to visualize the blood vessels being evaluated.
Computed tomography scan (also called a CT or CAT scan). A diagnostic imaging procedure that uses a combination of X-rays and computer technology to produce horizontal, or axial, images (often called slices) of the body. A CT scan shows detailed images of any part of the body, including the bones, muscles, fat, and organs. CT scans are more detailed than general X-rays. Like an MRI, it is sometimes done with IV contrast injected into your veins and sometimes not.
Angiography. An invasive procedure used to assess the degree of blockage or narrowing of the carotid arteries by taking X-ray images while a contrast dye in injected. The contrast dye helps to visualize the shape and flow of blood through the arteries as X-ray images are made.
Treatment for carotid artery disease
Specific treatment for carotid artery disease will be determined by your doctor based on:
Your age, overall health, and medical history
Extent of the disease
Your signs and symptoms
Your tolerance of specific medications, procedures, or therapies
Expectations for the course of the disease
Your opinion or preference
Carotid artery disease (asymptomatic or symptomatic) in which the narrowing of the carotid artery is less than 50 percent is most often treated medically. Asymptomatic disease with less than 70 percent narrowing may also be treated medically, depending on the individual situation.
Medical treatment for carotid artery disease may include:
Modification of risk factors. Risk factors that may be modified include smoking, elevated cholesterol levels, elevated blood glucose levels, lack of exercise, poor dietary habits, and elevated blood pressure.
Medications. Medications that may be used to treat carotid artery disease include:
Antiplatelet medications. Medications used to decrease the ability of platelets in the blood to stick together and cause clots. Aspirin, clopidogrel, and dipyridamole are examples of antiplatelet medications.
Antihyperlipidemics. Medications used to lower lipids (fats) in the blood, particularly cholesterol. Statins are a group of antihyperlipidemic medications, and include simvastatin, atorvastatin, and pravastatin, among others. Studies have shown that certain statins can decrease the thickness of the carotid artery wall and increase the size of the lumen (opening) of the artery.
Antihypertensives. Medications used to lower blood pressure. There are several different groups of medications which act in different ways to lower blood pressure.
In people with narrowing of the carotid artery greater than 50 to 69 percent, a more aggressive treatment may be recommended, particularly in people with symptoms. Surgical treatment decreases the risk for stroke after symptoms such as TIA or minor stroke, especially in people with an occlusion (blockage) of more than 70 percent who are good candidates for surgery.
Surgical treatment of carotid artery disease includes:
Carotid endarterectomy (CEA). Carotid endarterectomy is a procedure used to remove plaque and clots from the carotid arteries, located in the neck. Endarterectomy may help prevent a stroke from occurring in people with symptoms with a carotid artery narrowing of 70 percent of more.
Illustration of Carotid Endarterectomy (Click to Enlarge)
Carotid artery angioplasty with stenting (CAS). Carotid angioplasty with stenting is an option for patients who are high risk for carotid endarterectomy. This is a minimally invasive procedure in which a very small hollow tube, or catheter, is advanced from a blood vessel in the groin to the carotid arteries. Once the catheter is in place, a balloon may be inflated to open the artery and a stent is placed. A stent is a cylinder-like tube made of thin metal-mesh framework used to hold the artery open. Because there is a risk of stroke from bits of plaque breaking off during the procedure, an apparatus, called an embolic protection device, may be used. An embolic protection device is a filter (like a small basket) that is attached on a guidewire to catch any debris that may break off during the procedure.
Carotid Artery Angioplasty with Stenting (CAS) Click to Enlarge
Carotid Artery Disease and Stroke: Prevention and Treatment – John Hopkins
VIEW VIDEO –
Carotid Endarterectomy with Temporary Bypass – A Fifty year old procedure
Docteur Jean VALLA
Chirurgien Cardiovasculaire et Thoracique
AIHR/ACCA – Ancien Chirurgien des Hôpitaux Universitaires.
Membre de la Société de Chirurgie Thoracique et Cardiovasculaire de Langue Française Conventionné
Carotid artery stenosis is the narrowing of the carotid arteries. These are the main arteries in the neck that supply blood to the brain. Carotid artery stenosis, also called carotid artery disease, is a major risk factor for ischemic stroke.The narrowing is usually caused by plaque in a blood vessel. Plaque forms when cholesterol, fat and other substances build up in the inner lining of an artery.Depending on the degree of stenosis and the patient’s overall condition, carotid artery stenosis can usually be treated with surgery. The procedure is called carotid endarterectomy. It removes the plaque that caused the carotid artery to narrow. Carotid endarterectomy has proven to benefit patients with arteries stenosed (narrowed) by 70 percent or more. For people with arteries narrowed less than 50 percent, anti-clotting medicine is usually prescribed to reduce the risk of ischemic stroke.
VIEW VIDEO –
Carotid angioplasty and stenting (CAS) – Mayo Clinic
In carotid angioplasty and stenting, a long hollow tube called a catheter is inserted in the femoral artery in the groin area. The catheter is then maneuvered through the arteries until it reaches the narrowing in the carotid artery in the neck. An umbrella-shaped filter is inserted beyond the narrowing to catch any plaque or debris that may break off during the procedure. Then, a tiny balloon at the end of the catheter is inflated to push the plaque to the side and widen the vessel. A small metal coil called a stent is inserted into the vessel. The stent serves as a scaffold to help prevent the artery from narrowing again.
Contributions of a Vascular Surgeon at Peak Career – Richard Paul Cambria, MD, Chief, Division of Vascular and Endovascular Surgery Co-Director, Thoracic Aortic Center @ MGH
I. Recollection of a visit at Dr. Cambria’s Office @MGH, 2004
The author arrived for a 4PM appointment @ MGH with a referral from NWH for a Carotid artery duplex scan that in 2004 was not performed at NWH. The consultation appointment with Dr. Kwolek CJ, a vascular surgeon trained under Dr. RP Cambria, took place in Dr. Cambria’s Office. Few minutes into the patient Medical History interview, Dr. Kwolek was called for an emergency in the OR and asked me to wait for him till he comes back. I looked around and found myself in a 14’x22′ Room, the Office of Dr. Richard Cambria @ MGH, Chief Vascular Surgery and among the Top ten in the World. Except for the glass entrance door and the wide window to the right of the entrance – 3 1/2 walls from the ceiling to one yard above the floor where completely covered with framed Awards, licenses, renewed licenses, Pictures with graduating Medical Students, Pictures with Faculty, with Patients and in the OR. I waited for Dr. Kwolek’s return for the completion of my Medical History Interview about 30 minutes. I used that time to walk along the walls in Dr. Cambria’s Office and read the framed Exhibits. It was clear to me that this Office will need, one day, in the future, to become a Museum @MGH, for most significant milestones in Vascular Surgery, a branch of Cardiothoracic Surgery. Dr. Kwolek returned and completed the interview, scheduled my Lab appointment and the next appointment to discuss the duplex scan results.
II. Shadowing Dr. Cambria in OR @MGH
Per section IV, below which described the author’s Cardiovascular Clinical Observational Experience, I recorded my Shadowing experience at the OR @MGH, including Dr. Cambria performing a CEA on a 84 year old women under going aorta valve replacement (performed by Dr. Walker) priot to a CEA performed by Dr. Cambria. It was all captivating to watch his double gloved hands performing sutures on a >95% blocked carotid artery prior to incision.
The dexterity and the speed of Dr. Cambria’s fingers’ movement, could only have reminded me of World #1 Harp Player: Nicanor Zabaleta, which I met in person, in the presence of my prominent Harp teacher, on his US Tour in 11/1989. He was awarded the Premio Nacional de Música of Spain in 1982 and six years later, in 1988, he was elected to the Real Academia de Bellas Artes de San Fernando. Dr. Cambria’s and Mr. Zabaleta’s fingers dexterity and eye hand coordination, both are of the rarest endowments in fine motor precision and perfection with Worldly finest outcomes in art, Surgery is Art, the mastering of the Harp is Art, too.
The Author in the OR — Mass General Hospital, Boston
Cardiac Surgery – Operating Room
Supervisor: Dr. J. Walker, Cardiac Surgeon
Experience: Shadowing Open Heart Surgery at MGH
1/24/2005: Carotid Artery endarterectomy operation by Dr. Richard Cambria
1/24/2005: Mitral Valve Replacement by Dr. Jennifer Walker
1/26/2005: Aorta Valve Replacement and Coronary Artery Bypass Grafting by Dr. Jennifer Walker
[Saphenous vein harvested from the leg and Radial vein harvested from the right arm]
III. Dr. Cambria: Selection of Contributions to Scientific Research on Vascular Surgery
The Author covered In Part One, Dr. Cambria’s participation in and contribution to the International, Multispecialty Position Statement on Carotid Stenting, 2013.
In Part Two Section II, I share with the e-Reader watching Dr. Cambria in the Surgical Theater performing CEA
In Part Two Section III, I am carrying with me the heavy weight of my Recollections from a Visit to his Office in 2004, my experience shadowing Dr. Cambria in the OR @MGH on 1/24/2005. Now I am giving back.
I became aware that both events have impacted favorably my 7/2013, Editorial decision, for a forthcoming book on Cardiovascular Disease in 2013. The Editorial decision is two fold:
the selection and representation of a prominent Vascular Surgery Center in the US, @MGH, and
my personal decision to select a Vascular Surgeon at Peak Career – Richard Paul Cambria, MD @MGH.
The decision to focus on Peripheral Vascular Surgery @MGH as described in Dr. Richard P Cambria’s research had yielded one Sub-Chapter (5.5) in Chapter 5
Chapter 5
Invasive Procedures by Surgery versus Catheterization
in Volume Three in a forthcoming three volume Series of e-Books on Cardiovascular Diseases
This very Sub-Chapter, 5.5, represents milestones in Dr. Cambria as a Vascular Surgeon. His eminent profile as a Vascular Surgery Researcher, is now in:
IV. Cardiovascular Clinical Observational Experience – Aviva Lev-Ari, PhD, RN
Brigham and Women’s Hospital, Boston. MA
Cardiac ICU, Coronary Care Unit, Medical Rounds [100 hours] June 2006-November 2006
Brigham and Women’s Hospital, Boston. MA
CDIC – Cardiovascular Diagnostic and Interventional Center
Angiography & Interventional Radiology [100 hours] March 2006-August 2006
Experience shadowing the daily activities of three Physician Assistants
1. attended consultation appointments with patient candidate for procedures: fibroid embolization
2. patient candidate for intra-vertebral cement injection in fractured vertebrae in spinal column, L-9 – Kyphoplasty vertebral augmentation
3. drainage of bile leakage – biliary duct obstruction
4. attended invasive procedures in the Angiography Lab
5. attended 7:30AM department meeting on all cases scheduled for procedures in the Lab for the day
6. discussed procedure outcomes and patient follow ups with PAs
7. Shadowing PAs and Interventional Radiologists performing angiography.
– VENOUS ACCESS PROCEDURES – TUNNELED CATHETER AND PORT PLACEMENT
– DIALYSIS ACCESS MANAGEMENT – ARTERIOVENOUS FISTULA/GRAFT.
ANGIOGRAMS/ANGIOPLASTIES
Mass General Hospital, Boston
Cardiac Catheterization Lab
Supervisor: Dr. Igor Palacios, Director, Cath Lab
Experience Shadowing in the Cath Lab at MGH
1/19/2005: stenting – MI case, mitral valve opening with balloon
The cerebral hyperperfusion syndrome is a very rare complication after revascularization of the carotid artery and accompanied by postoperative or postinterventional hypertension in almost all patients. We report a case of a 77-year-old man who developed a complete aphasia and increased right-sided weakness following endovascular treatment of severe occlusive disease of the left internal carotid artery. We discuss the risk and management of cerebral hyperperfusion syndrome after carotid artery stenting.
Introduction
Neurological complications following carotid artery stenting (CAS) are usually ischemic in nature, due to embolization or occlusion of the carotid artery. However, in a small subset of patients, cerebral hyperperfusion causes postinterventional neurological dysfunction, characterized by ipsilateral headache, focal seizure activity, focal neurological deficit, and ipsilateral intracerebral edema or hemorrhage. A high clinical suspicion and early diagnosis will allow early initiation of therapy and preventing fatal brain swelling or bleeding in patients with peri- and postinterventional cerebral hyperperfusion syndrome (CHS).
Discussion
In 1981, Sundt et al. [1] described a triad of complications that included atypical migrainous phenomena, transient focal seizure activity, and intracerebral hemorrhage after CEA and used the term cerebral hyperperfusion syndrome (CHS). The first report on CHS after CAS was published by Schoser et al. [2]. They described a 59-year-old woman with ipsilateral putaminal hemorrhage that was diagnosed on the 3rd day after CAS of a high-grade stenosis of the left ICA. Outcome in this case was not fatal. The patient recovered with a mild upper limb paresis. McCabe et al. [3] were the first to report the occurrence of fatal ICH soon after CAS. Only a few hours after the procedure, neurological symptoms occurred without any prodromata (severe headache, nausea, and seizures) postulated by Sundt et al. [1] to be an obligate component of CHS. CT of the brain revealed extensive ICH and the patient died 18 days later. Abou-Chebl et al. [4] reported a retrospective single-center study on 450 patients who had been treated with CAS. Three patients (0.67%) developed ICH after the intervention. Further reports on results and complications after CAS have been published [5]. Nearly all reports on CHS after carotid revascularizations in general and CAS in particular have in common patients who had high-grade stenoses in the treated vessel.
CHS following surgical or endovascular treatment of severe carotid occlusive disease is thought to be the result of impaired cerebral autoregulation, hypertension, ischemia-reperfusion injury, oxygen-derived free radicals, baroreceptor-dysfunction, and intraprocedural ischemia [6]. Chronic cerebral hypoperfusion due to critical stenosis leads to production of vasodilatory substances. Autoregulatory failure results in the cerebral arterioles being maximally dilated over a long period of time, with subsequent loss of their ability to constrict when normal perfusion pressure is restored. The degree of microvascular dysautoregulation is proportional to the duration and severity of ischemia determined by the severity of ipsilateral stenosis and poor collateral flow.
Hypertension plays an important role in the development of CHS. In the absence of cerebral autoregulation, cerebral blood flow is directly dependent on the systemic blood pressure. The restoration of normal blood flow to chronically underperfused brain can result in edema, capillary breakthrough, and perivascular and macroscopic hemorrhages aggravated by peri- and postinterventional hypertension [6, 7]. The risk factors for CHS after CAS are summarized in Table 1.
The classic clinical presentation includes ipsilateral headache, seizures or focal neurological deficit, and ipsilateral intracerebral edema or hemorrhage. The diagnosis can be made readily with color Doppler ultrasound of the carotid artery and especially with transcranial Doppler (TCD) of the middle cerebral artery [9]. An increase in peak blood flow velocity of >100% is predictive of postinterventional hyperperfusion. Diffusion weighted MRI or single photon emission computed tomography (SPECT) could also be performed for diagnosis [10]. Angiography normally shows normal findings.
The prognosis of CHS depends on timely recognition of hyperperfusion and adequate treatment of hypertension before cerebral edema or hemorrhage develops. The prognosis following intracerebral bleeding is very poor, with mortality over 50% and significant morbidity of 80% in the survivors [4, 6]. The prognosis of CHS in patients without cerebral edema or hemorrhage is clearly better especially when they are identified and treated early. The most important aspects in preventing and treating this syndrome are early identification, careful monitoring, and control of blood pressure ideally in a high-dependency unit setting. In our special case, early diagnosis of CHS and immediate intensive medical treatment of blood pressure could prevent devastating cerebral edema or hemorrhage following CAS.
Conclusion
CHS, which is characterized by ipsilateral headache, hypertension, seizures, and focal neurological deficits, is a rare but devastating complication following carotid artery stenting. Hypertension is the most important risk factor. The diagnosis can be confirmed quickly by TCD, DWI, or SPECT. Especially peri- or postinterventional TCD monitoring should be available to identify patients with hyperperfusion who may benefit from intensive blood pressure management ideally in a specialized intensive care unit.
Abbreviations
CAS:
Carotid artery stenting
CCA:
Common carotid artery
CEA:
Carotid endarterectomy
CHS:
Cerebral hyperperfusion syndrome
CT:
Computed tomography
CVR:
Cerebrovascular reactivity
DWI:
Diffusion-weighted imaging
ICA:
Internal carotid artery
ICH:
Intracerebral haemorrhage
MRI:
Magnetic resonance imaging
SPECT:
Single photon emission computed tomography
TCD:
Transcranial Doppler.
REFERENCES
T. M. Sundt Jr., F. W. Sharbrough, and D. G. Piepgras, “Correlation of cerebral blood flow and electroencephalographic changes during carotid endarterectomy. With results of surgery and hemodynamics of cerebral ischemia,” Mayo Clinic Proceedings, vol. 56, no. 9, pp. 533–543, 1981.View at Scopus
B. G. H. Schoser, C. Heesen, B. Eckert, and A. Thie, “Cerebral hyperperfusion injury after percutaneous transluminal angioplasty of extracranial arteries,” Journal of Neurology, vol. 244, no. 2, pp. 101–104, 1997. View at Publisher · View at Google Scholar · View at Scopus
D. J. H. McCabe, M. M. Brown, and A. Clifton, “Fatal cerebral reperfusion hemorrhage after carotid stenting,” Stroke, vol. 30, no. 11, pp. 2483–2486, 1999. View at Scopus
A. Abou-Chebl, J. S. Yadav, J. P. Reginelli, C. Bajzer, D. Bhatt, and D. W. Krieger, “Intracranial hemorrhage and hyperperfusion syndrome following carotid artery stenting: risk factors, prevention, and treatment,” Journal of the American College of Cardiology, vol. 43, no. 9, pp. 1596–1601, 2004. View at Publisher · View at Google Scholar · View at Scopus
J.-H. Buhk, L. Cepek, and M. Knauth, “Hyperacute intracerebral hemorrhage complicating carotid stenting should be distinguished from hyperperfusion syndrome,” American Journal of Neuroradiology, vol. 27, no. 7, pp. 1508–1513, 2006. View at Scopus
W. F. Morrish, S. Grahovac, A. Douen et al., “Intracranial hemorrhage after stenting and angioplasty of extracranial carotid stenosis,” American Journal of Neuroradiology, vol. 21, no. 10, pp. 1911–1916, 2000. View at Scopus
R. Gupta, A. Abou-Chebl, C. T. Bajzer, H. C. Schumacher, and J. S. Yadav, “Rate, predictors, and consequences of hemodynamic depression after carotid artery stenting,” Journal of the American College of Cardiology, vol. 47, no. 8, pp. 1538–1543, 2006. View at Publisher · View at Google Scholar · View at Scopus
M. B. Sánchez-Arjona, G. Sanz-Fernández, E. Franco-Macias, and A. Gil-Peralta, “Cerebral hemodynamic changes after carotid angioplasty and stenting,” American Journal of Neuroradiology, vol. 28, pp. 640–644, 2007.
Y. Kaku, S. I. Yoshimura, and J. Kokuzawa, “Factors predictive of cerebral hyperperfusion after carotid angioplasty and stent placement,” American Journal of Neuroradiology, vol. 25, pp. 1403–1408, 2004.
Patient came to her appointment as part of a standard pre-operative evaluation for removal of a uterine myoma. She had a history of stroke with residual slurred speech, making it difficult to understand her. Accordingly, I assumed I would see some carotid stenosis, but her ultrasound showed a stunning 70-99% stenosis in her right internal carotid artery and full occlusion of her left internal carotid artery.
Flow in the common carotid arteries looked fine. The plaque itself in the internal carotid arteries was relatively hypoechoic and not easily visualized in brightness mode, so bidirectional color flow at the proximal internal carotid arteries was surprising. Adding power Doppler allowed me to conclude that there was presence of flow on the right, though minimal, and absolutely no flow in the left internal carotid artery.
Upon completion of the exam, I called the ER and spoke with the doctor, who asked me to bring Rose to the ER. Unfortunately, due to the location of the right internal carotid artery stenosis in the bony canal and total occlusion of the left internal carotid artery, surgery was not an option for clearing out the carotid plaque, but doctors believed she could continue functioning well with collateral vasculature carrying blood to her brain.
Thankfully, the patient passed her other pre-operative tests, consented to her surgery, and underwent general anesthesia with no complications. An 8-cm malignant mass was removed from her uterus and her prognosis is good.
opinion/26redberg.html. Last accessed Jan 8, 2013.
Part Three:
Cleveland Clinic Reports Equivalence between carotid endarterectomy (CEA) and open-heart surgery (OHS) and carotid artery stenting (CAS) followed by coronary artery bypass graft (CABG) surgery or non-CABG cardiac surgery
Stent first, then heart surgery, for patients with severe carotid/coronary disease
Cleveland, OH – With the absence of randomized, controlled clinical trials to address the optimal management of patients with severe carotid and coronary artery disease, a new retrospective study suggests the best tactic is a staged approach that sees the patient undergo carotid artery stenting (CAS) followed by coronary artery bypass graft (CABG) surgery or non-CABG cardiac surgery [1].
Investigators report that a combined approach that includes carotid endarterectomy (CEA) and open-heart surgery (OHS) is equivalent in terms of short-term outcomes with the staged CAS-OHS procedure. Beyond one year, however, the staged CAS-OHS approach resulted in the lowest risk of all-cause mortality, stroke, and MI when compared with a combined CEA-OHS procedure and staged CEA-OHS.
“The surgeons get very worried about doing operations on these patients because they don’t want to do a beautiful job on the bypass only to have the patient have a stroke,” lead investigator Dr Mehdi Shishehbor(Cleveland Clinic, OH) told heartwire.
Shishehbor said that when patients are undergoing open-heart surgery, whether it’s CABG or valve surgery, they are screened for carotid artery disease, given the heightened risk of stroke when undergoing heart surgery. As a result, various teams from neurology, vascular surgery, and interventional cardiology are called to address the safety of the surgery in the setting of severe carotid disease, said Shishehbor.
“These patients are the sickest of the sick in the sense that they have two conditions that are occurring concomitantly,” he said. “These are not patients who just have carotid disease. There are many patients who have moderate or mild carotid disease who undergo open-heart surgery with no problem. These are people with severe disease, those with more than 80% stenosis in one of their carotid arteries or maybe both. They also have severe coronary artery disease. These are people with left-main or three-vessel disease who are destined to undergo bypass.”
The whole point is to prevent stroke
In the study, published this week in the Journal of the American College Cardiology, the investigators reported data on 350 patients who underwent carotid revascularization and cardiac surgery. These included 45 patients who were treated with a staged CEA-OHS approach (OHS performed a median of 14 days after CEA), 110 who were treated with a staged CAS-OHS procedure (OHS performed a median of 47 days after CEA), and 195 patients treated with a combined CEA-OHS procedure. OHS is defined as CABG, CABG plus other cardiac procedures, or non-CABG cardiac surgery (isolated valve or aortic-repair surgery). In total, just 8% of procedures were non-CABG surgeries.
In a propensity-adjusted analysis analyzed by intention-to-treat, the 30-day risk of death, stroke, and MI was similar between the staged CAS-OHS and combined CEA-OHS procedures. The highest risk of the composite end point was observed in patients who underwent staged CEA-OHS.
At one year and beyond (median follow-up was 3.7 years), the staged CAS-OHS patients had the lowest risk of death, stroke, and MI. Compared with staged CEA-OHS, those treated with CAS-OHS had a 67% lower risk of death, stroke, and MI and a 65% lower risk compared with combined CEA-OHS.
Unadjusted comparison of primary/secondary end points
Event
Staged CEA-OHS,n=45 (%)
Combined CEA-OHS,n=195 (%)
Staged CAS-OHS,n=110 (%)
p
Overall 30-d risk post-OHS
31
10
10
0.003
Death
7
5
6
0.75
Stroke
2
7
2
0.11
MI
24
0.5
3
<0.001
Overall composite risk 1 y and beyond
27
39
12
<0.001
Death
38
39
11
<0.001
Stroke
2.2
1.5
0
0.37
MI
0
3.1
2.7
0.5
“In the long term, stenting [followed by OHS] definitely did better than the combined approach,” said Shishehbor. “What’s also important is that with the combined approach, the reason they didn’t do very well is because they had a higher rate of stroke in the perioperative period. . . . Remember the whole point of doing this is to prevent stroke. This is why we feel the combined approach is a little bit inferior to the staged CAS/open-heart-surgery approach. If you have a 7% risk of stroke in the 30-day perioperative period, that doesn’t appear to be the best option for the majority of patients.”
To heartwire, Shishehbor said that while the patients were well matched, the patients undergoing stenting tended to be sicker. For example, they were more likely to have symptomatic carotid stenosis and were more likely to have undergone a previous carotid revascularization. Shishehbor also said that clinical events occurring between the initial carotid artery revascularization procedure and OHS were included in the analysis. These deaths, strokes, and MIs were identified and accounted for in the data.
In an editorial accompanying the study [2], Drs Ehtisham Mahmud and Ryan Reeves (University of California, San Diego) say the work by the Cleveland Clinic group is strengthened by the propensity-adjusted analysis and long follow-up beyond the perioperative period. Most important, they say the study provides clarity for the management of patients with carotid and coronary disease.
“For patients presenting with an acute coronary syndrome requiring urgent coronary revascularization in whom waiting three to four weeks is not safe, combined CEA-OHS is the optimum revascularization strategy, though associated with higher neurological ischemic events,” write Mahmud and Reeves.
“However, for patients with a stable or an accelerating anginal syndrome who can wait three to four weeks to complete dual antiplatelet therapy [DAPT] after carotid stenting, staged CAS followed by OHS leads to superior early and long-term outcomes.”
Since completing the analysis, Shishehbor said there have been discussions with colleagues in vascular surgery, vascular medicine, cardiac surgery, and cardiology to establish the optimum way to treat patients with severe carotid and coronary disease. “The bottom line is that there will never be a randomized, clinical trial in this setting,” he told heartwire. “I hope there would be, but I doubt it. So I think papers like this are critical because we’re doing these procedures to prevent stroke. It’s important that we pick the right procedure for the right patient.”
Confounded by registry requirements
Shishehbor is also concerned about the scrutiny carotid stenting is under from the Centers for Medicare&Medicaid Services(CMS). Currently, the CMS reimburses procedures for asymptomatic patients only if they are included in one of the industry-funded and -maintained registries. He believes the scrutiny has led to a dwindling number of clinicians with the expertise capable of doing the procedure, and this is concerning, since the present analysis shows there are cohorts of asymptomatic patients who would benefit from the treatment.In addition, to be included in a registry, an asymptomatic patient must receive DAPT with aspirin andclopidogrel for four weeks. If the patient does not meet the DAPT requirements, they can’t be included in the registry. However, Shishehbor said, many of these patients have significant coronary disease and can’t wait four weeks. As a result, they are treated with a combined CEA-OHS approach, an approach that is associated with a higher risk of stroke.
Shishehbor reports serving as a speaker and consultant for Abbot Vascular, Medtronic, and Gore but waives all compensation for his work. Mahmud reports trial support from Boston Scientific and Abbott Vascular. In addition,he consults for Cordis andthe Medicines Companyand serves on the speaker‘s bureau for Medtronic. Disclosures for the coauthors are listed in the paper.
Sources
Shishehbor MH, Venkatachalam S, Sun Z, et al. A direct comparison of early and late outcomes with three approaches to carotid revascularization and open heart surgery. J Am Coll Cardiol 2013; available at: http://content.onlinejacc.org.
Mahmud E, Reeves R. Carotid revascularization prior to open heart surgery: The data driven treatment strategy. J Am Coll Cardiol 2013; available at: http://content.onlinejacc.org.
2013 ACCF/AHA Guideline for the Management of Heart FailureA Report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines
Clyde W. Yancy, MD, MSc, FACC, FAHA; Mariell Jessup, MD, FACC, FAHA; Biykem Bozkurt, MD, PhD, FACC, FAHA; Javed Butler, MBBS, FACC, FAHA; Donald E. Casey, MD, MPH, MBA, FACP, FAHA; Mark H. Drazner, MD, MSc, FACC, FAHA; Gregg C. Fonarow, MD, FACC, FAHA; Stephen A. Geraci, MD, FACC, FAHA, FCCP; Tamara Horwich, MD, FACC; James L. Januzzi, MD, FACC; Maryl R. Johnson, MD, FACC, FAHA; Edward K. Kasper, MD, FACC, FAHA; Wayne C. Levy, MD, FACC; Frederick A. Masoudi, MD, MSPH, FACC, FAHA; Patrick E. McBride, MD, MPH, FACC; John J.V. McMurray, MD, FACC; Judith E. Mitchell, MD, FACC, FAHA; Pamela N. Peterson, MD, MSPH, FACC, FAHA; Barbara Riegel, DNSc, RN, FAHA; Flora Sam, MD, FACC, FAHA; Lynne W. Stevenson, MD, FACC; W.H. Wilson Tang, MD, FACC; Emily J. Tsai, MD, FACC; Bruce L. Wilkoff, MD, FACC, FHRS
We present below four National institutions with pubic mandate to promote all Healthcare aspects of Cardiovascular Diseases.
A. 2020 Vision of the Heart Failure Society of America (HFSA)
Special Communication: The Heart Failure Society of America in 2020: A Vision for the Future
Journal of Cardiac Failure Vol. 18 No. 2 2012 written by BARRY H. GREENBERG, MD,1,3 INDER S. ANAND, MD, PhD,2 JOHN C. BURNETT JR, MD,2,3 JOHN CHIN, MD,2,3 KATHLEEN A. DRACUP, RN, DNSc,3 ARTHUR M. FELDMAN, MD, PhD,3 THOMAS FORCE, MD,2,3 GARY S. FRANCIS, MD,3 STEVEN R. HOUSER, PhD,2 SHARON A. HUNT, MD,2 MARVIN A. KONSTAM, MD,3 JOANN LINDENFELD, MD,2,3 DOUGLAS L. MANN, MD,2,3 MANDEEP R. MEHRA, MD,2,3 SARA C. PAUL, RN, DNP, FNP,2,3 MARIANN R. PIANO, RN, PhD,2 HEATHER J. ROSS, MD,2 HANI N. SABBAH, PhD,2 RANDALL C. STARLING, MD, MPH,2 JAMES E. UDELSON, MD,2 CLYDE W. YANCY, MD, MSc,3 MICHAEL R. ZILE, MD,2 AND BARRY M. MASSIE, MD2,3
From the 1Chair, ad hoc Committee for Strategic Development, Heart Failure Society of America; 2Member of Executive Council, Heart Failure Society of America and 3Member, ad hoc Committee for Strategic Development, Heart Failure Society of America.
They write:
The preceding 2 decades had been marked by unprecedented insights into the underlying pathophysiology of cardiac dysfunction that were paralleled by therapeutic advances that, for the first time, were shown to clearly improve outcomes in heart failure patients. At the same time, heart failure prevalence was rapidly increasing throughout the world because of the aging of the population, improved survival of patients with myocardial infarction and other cardiac conditions, and inadequate treatment of common risk factors such as hypertension.
More recently the Heart Failure Society successfully promoted establishment of Advanced Heart Failure and Transplant Cardiology as an American Board of Internal Medicine recognized secondary subspecialty of cardiology developed a board review course to help physicians prepare for the certification examination for the new subspecialty and created a national heart failure review course.
The Society has Advocacy goals, membership goals – to increase by 10% per year for 3 years from all disciplines of Heart Failure.
Education Goals:
The Heart Failure Society of America will be recognized for its innovative approaches to educating and content dissemination on heart failure targeting
healthcare professionals and patients
Grow and enhance the annual meeting through innovative approaches
Continue board review course
Increase web-based programs for patients and health care providers
Enhance the website as a portal for information dissemination for health care professionals and patients
Grow and enhance the relevance and value of the Journal of Cardiac Failure
Conceptual analysis of projection done by the AHA regarding the increase in the Cost of Care for the the American Patient in Heart Failure were developed in the following two articles:
National Heart, Lung, And Blood Institute Working Group identified the most urgent knowledge gaps in Heart Transplantation Research. These gaps require to address the following 4 specific research directions:
enhanced phenotypic characterization of the pre-transplant population
donor-recipient optimization strategies
individualized immunosuppression therapy, and
investigations of immune and non-immune factors affecting late cardiac allograft outcomes.
D. Donor-Recipient Optimization Strategies – 33,640 Cases in the United Network for Organ Sharing database – Organ Donor’s Age is BEST predictor for survival after Heart Transplant
IF the donor age is in the 0- to 19-year-old group the median survival of 11.4 years follows the Heart Transplant.
The effect of ischemic time on survival after heart transplantation varies by donor age: An analysis of the United Network for Organ Sharing database
The Journal of Thoracic and Cardiovascular Surgery ● February 2007
Mark J. Russo, MD, MS,a,b Jonathan M. Chen, MD,a Robert A. Sorabella, BA,a Timothy P. Martens, MD,a
Mauricio Garrido, MD,a Ryan R. Davies, MD,a Isaac George, MD,a Faisal H. Cheema, MD,a Ralph S. Mosca, MD,a Seema Mital, MD,c Deborah D. Ascheim, MD,b,d Michael Argenziano, MD,a Allan S. Stewart, MD,a Mehmet C. Oz, MD,a and Yoshifumi Naka, MD, PhDa
Objectives:
(1) To examine the interaction of donor age with ischemic time and their effect on survival and
(2) to define ranges of ischemic time associated with differences in survival.
Methods: The United Network for Organ Sharing provided de-identified patientlevel data. The study population included 33,640 recipients undergoing heart transplantation between October 1, 1987, and December 31, 2004. Recipients were divided by donor age into terciles: 0 to 19 years (n 10,814; 32.1%), 20 to 33 years (11,410, 33.9%), and 34 years or more (11,416, 33.9%). Kaplan-Meier survival functions and Cox regression were used for time-to-event analysis. Receiver operating characteristic curves and stratum-specific likelihood ratios were generated to compare 5-year survival at various thresholds for ischemic time.
Results: In univariate Cox proportional hazards regression, the effect of ischemic time on survival varied by donor age tercile: 0 to 19 years (P .141), 20 to 33 years (P .001), and 34 years or more (P .001). These relationships persisted in multivariable regression. Threshold analysis generated a single stratum (0.37-12.00 hours) in the 0- to 19-year-old group with a median survival of 11.4 years. However, in the 20- to 33-year-old-group, 3 strata were generated: 0.00 to 3.49 hours (limited), 3.50 to 6.24 hours (prolonged), and 6.25 hours or more (extended), with median survivals of 10.6, 9.9, and 7.3 years, respectively. Likewise, 3 strata were generated in the group aged 34 years or more: 0.00 to 3.49 (limited), 3.50 to 5.49 (prolonged), and 5.50 or more (extended), with median survivals of 9.1, 8.5, and 6.3 years, respectively.
Conclusions: The effect of ischemic time on survival after heart transplantation is dependent on donor age, with greater tolerance for prolonged ischemic times among grafts from younger donors. Both donor age and anticipated ischemic time must be considered when assessing a potential donor.
Procedures Outcomes of Heart Transplant (HT) Indication for Heart Failure (HF)
Center for Heart Failure @Cleveland Clinic, and
Transplant Center @Mayo Clinic
Center for Heart Failure @Cleveland Clinic: Institution Profile
Heart failure (sometimes called congestive heart failure or ventricular dysfunction) means your heart muscle is not functioning as well as it should. Either the left ventricle (lower chamber of the heart) is not contracting with enough force (systolic heart failure), or the ventricles are stiff and do not relax and fill properly (diastolic heart failure). The treatment of heart failure requires a specialized multidisciplinary approach to manage the overall patient care plan.
The George M and Linda H Kaufman Center for Heart Failure is one of the premier facilities in the United States for the care of people with heart failure.
The Kaufman Center Heart Failure Intensive Care was the recipient of the Beacon Award of Excellence for continuing improvements in providing the highest quality of care for patients. With over 6,000 ICUs in the Unites States, the Center joins a distinguished group of just 300 to receive this honor that recognizes the highest level of standards in patient safety and quality in acute and critical care.
In 2011, Cleveland Clinic received the American Heart Association’s Get With The Guidelines Heart Failure GOLD Plus Certification for improving the quality of care for heart failure patients. Gold Plus distinction recognizes hospitals for their success in using Get With The Guidelines treatment interventions. This quality improvement program provides tools that follow proven, evidence-based guidelines and procedures in caring for heart failure patients to prevent future hospitalizations.
The Kaufman Center for Heart Failure Team brings together clinicians that specialize in cardiomyopathies and ischemic heart failure. The team includes physicians and nurses from Cardiovascular Medicine, Cardiothoracic Surgery, Radiology, Infectious Disease, Immunology, Pathology, Pharmacy, Biothetics and Social Work with expertise in diagnostic testing, medical and lifestyle management, surgical procedures, and psychosocial support for patients with:
Patients at Cleveland Clinic Kaufman Center for Heart Failure have available to them the full array of diagnostic testing, treatments and specialized programs.
Outcomes of Heart Failure and Heart Transplant @Cleveland Clinic
1,570 Number of heart transplants performed at Cleveland Clinic since inception of the Cardiac Transplant Program in 1984.
The survival rates among patients who have heart transplants at Cleveland Clinic exceeds the expected rates. Of the 150 transplant centers in the United States, Cleveland Clinic is one of only three that had better-than-expected one-year survival rates in 2011.
Ventricular Assist Device Volume 2007 – 2011
2007 – N = 23
2008 – N = 48
2009 – N = 76
2010 – N = 51
2011 – N = 56
Mechanical circulatory support (MCS) devices are used in patients with heart failure to preserve heart function until transplantation (bridge-to-transplant) or as a final treatment option (destination therapy). Cleveland Clinic has more than 20 years of experience with MCS devices for both types of therapy.
LVAD In-Hospital Mortality 2007 – 2011
Cleveland Clinic continues to make improvements to reduce mortality rates among patients who are placed on mechanical circulatory support. The mortality rate among patients who have a left ventricular assist device (LVAD) has been drastically reduced over the past five years.5% in 2011
VAD Mortality 2011
The mortality rate among Cleveland Clinic patients placed on ventricular assist devices (VADs) was much lower than expected in 2011. Observed 10%, Expected 17.5%
Heart Failure – National Hospital Quality Measures
This composite metric, based on four heart failure hospital quality process measures developed by the Centers for Medicare and Medicaid Services (CMS), shows the percentage of patients who received all the recommended care for which they were eligible. Cleveland Clinic has set a target of UHC’s 90th percentile.
Cleveland Clinic, 2010 (N = 1,194) 93.9%
Cleveland Clinic, 2011 (N = 1,163) 96.9%
UHC Top Decile, 2011 99.2%
SOURCE
University HealthSystem Consortium (UHC) Comparative Database, January through November 2011 discharges.
The Centers for Medicare and Medicaid Services (CMS) calculates two heart failure outcome measures: all-cause mortality and all-cause readmission rates, each based on Medicare claims and enrollment information. Cleveland Clinic’s performance appears below.
Heart Failure All-Cause 30-Day Mortality (N = 762) July 2008 – June 2011
Cleveland Clinic 9.2%
National Average 11.6%
Heart Failure All-Cause 30-Day Readmission (N = 1,029) July 2008 – June 2011
Cleveland Clinic 27.3%
National Average 24.7%
SOURCE:
hospitalcompare.hhs.gov
Cleveland Clinic’s heart failure risk-adjusted 30-day mortality rate is below the national average; the difference is statistically significant. Our heart failure risk-adjusted readmission rate is higher than the national average; that difference is also statistically significant. To further reduce this rate, a multidisciplinary team was tasked with improving transitions from hospital to home or post-acute care facility. Specific initiatives have been implemented in each of these focus areas: communication, education and follow-up.
In 2011, 51% of lung transplant patients were from outside the state of Ohio.
Cleveland Clinic surgeons transplanted 111 lungs in 2011. Our Lung and Heart-Lung Transplant
Program is the leader in Ohio and among the best programs in the country.
July 2010 – June 2011
160 Performed in 2009
Liver-Lung
Heart-Lung
Double Lung
Single Lung
53.5% Idiopathic
Primary Disease of Lung Transplant Recipients (N = 101)
Source: Scientific Registry of Transplant Recipients. March 2011. Ohio, Lung Centers, Cleveland Clinic. Table 7
Cleveland Clinic surgeons transplanted 111 lungs in 2011. Our Lung and Heart-Lung Transplant Program is the leader in Ohio and among the best programs in the country.
Transplant Center @Mayo Clinic: Heart Transplant Procedures Outcomes
Mayo Clinic History
Dr. W.W. Mayo
Drs. William (left) and Charles Mayo
Mayo Clinic developed gradually from the medical practice of a pioneer doctor, Dr. William Worrall Mayo, who settled in Rochester, Minn., in 1863. His dedication to medicine became a family tradition when his sons, Drs. William James Mayo and Charles Horace Mayo, joined his practice in 1883 and 1888, respectively.
From the beginning, innovation was their standard and they shared a pioneering zeal for medicine. As the demand for their services increased, they asked other doctors and basic science researchers to join them in the world’s first private integrated group practice.
Although the Mayo doctors were initially viewed as unconventional for practicing medicine through this teamwork approach, the benefits of a private group practice were undeniable.
As the success of their method of practice became evident, so did its acceptance. Patients discovered the advantages to a “pooled resource” of knowledge and skills among doctors. In fact, the group practice concept that the Mayo family originated has influenced the structure and function of medical practice throughout the world.
Along with its recognition as a model for integrated group practice, “the Mayos’ Clinic” developed a reputation for excellence in individual patient care. Doctors and students came from around the world to learn new techniques from the Mayo doctors, and patients came from around the world for diagnosis and treatment. What attracted them was not only technologically advanced medicine, but also the caring attitude of the doctors.
Through the years, Mayo Clinic has nurtured and developed its founders’ style of working together as a team. Shared responsibility and consensus still provide the framework for decision making at Mayo.
That teamwork in medicine is carried out today by more than 55,000 doctors, nurses, scientists, students and allied health staff at Mayo Clinic locations in the Midwest, Arizona and Florida.
Alternative Solutions to Treatment of Heart Failure
Mayo Clinic, with transplant services in Arizona, Florida and Minnesota, performs more transplants than any other medical center in the world. Mayo Clinic has pre-eminent adult and pediatric transplant programs, offering cardiac, liver, kidney, pancreas and bone marrow transplant services. Since performing the first clinical transplant in 1963, Mayo’s efforts to continually improve and expand organ transplantation have placed Mayo at the leading edge of clinical and basic transplant research worldwide. Research activities in the Transplant Center at Mayo Clinic have contributed significantly to the current successful outcomes of organ transplantation.
People who survive a heart attack face the greatest risk of dying from sudden cardiac death (SCD) during the first month after leaving the hospital, according to a long-term community study by Mayo Clinic researchers of nearly 3,000 heart attack survivors.
Sudden cardiac death can happen when the hearts electrical system malfunctions; if treatment — cardiopulmonary resuscitation and defibrillation — does not happen fast, a person dies.
After that first month, the risk of sudden cardiac death drops significantly — but rises again if a person experiences signs of heart failure. The research results appear in the Nov. 5 edition of Journal of the American Medical Association.
Veronique Roger, M.D., a Mayo Clinic cardiologist provides an overview of the study and it’s findings.
For more information on heart attacks, click on the following link:http://www.mayoclinic.org/heart-attack/
VIEW VIDEOon Mayo Clinic Regenerative Medicine Consult Service – Stem Cell Transplantation post MI
In a proof-of-concept study, Mayo Clinic investigators have demonstrated that induced pluripotent stem (iPS) cells can be used to treat heart disease. iPS cells are stem cells converted from adult cells. In this study, the researchers reprogrammed ordinary fibroblasts, cells that contribute to scars such as those resulting from a heart attack, converting them into stem cells that fix heart damage caused by infarction. The findings appear in the current online issue of the journal Circulation.
Timothy Nelson, M.D., Ph.D., first author on the Mayo Clinic study, talks about the study and it’s findings.
Heart Transplant: Volumes and success measures Transplant Center@ Mayo Clinic
Mayo Clinic doctors’ experience and integrated team approach results in transplant outcomes that compare favorably with national averages. Teams work with transplant recipients before, during and after surgery to ensure the greatest likelihood of superior results.
Volumes and statistics are maintained separately for the three Mayo Clinic locations. Taken together or separately, transplant recipients at Mayo Clinic enjoy excellent results.
Volumes
Arizona
More than 100 heart transplants have been completed since the program began in 2005.
Florida
Surgeons at Mayo Clinic in Florida have performed more than 167 heart transplants and eight heart-lung transplants since the program began in 2001. Mayo surgeons have performed combined transplants, such as heart-kidney and heart-lung-liver transplants.
Minnesota
Mayo Clinic’s outcomes for heart transplantation compare favorably with national norms. Doctors at Mayo Clinic in Minnesota have transplanted more than 450 adult and pediatric patients, including both isolated heart transplants and combined transplants such as heart-liver, heart-kidney and others.
The Center for Heart Failure @Cleveland Clinic’s, and the Transplant Center @Mayo Clinic’s Institutions Profiles, Procedures Outcomes and Selection of their Research are now in:
Cardiovascular diseases comprise problems of the heart and blood vessels, including rhythm, blood supply, blood pressure, birth defects, or damage from cholesterol, tobacco, street drugs, radiation, viruses, bacteria, or fungi.
Thus the category includes heart failure (inadequate pump function), heart or vessel infection (endocarditis, vasculitis), birth defects (congenital heart disease)
Cardiovascular Diseases: Causes, Risks and Management
This book is a comprehensive review of Innovations in Cardiovascular Medicine, including the latest discoveries in
Cardiac Medical Imaging,
Regenerative Medicine,
Pharmacotherapy,
Medical Devices for Cardiac Repair,
Genomics, and opportunities for Targeted Therapy.
It is written by experts in their respective subspecialties. The e-Book’s articles have been published on the Open Access Online Scientific Journal, since April 2012. All new articles on this subject will continue to be incorporated with periodical updates.
The Journal is a scientific, medical and business, multi-expert authoring environment for information syndication in domains of Life Sciences, Medicine, Pharmaceutical and Healthcare Industries, BioMedicine, Medical Technologies & Devices. Scientific critical interpretations and original articles are written by PhDs, MDs, MD/PhDs, PharmDs, Technical MBAs as Experts, Authors, Writers (EAWs) on an Equity Sharing basis.
myocardial injury mapping by magnetic resonance contrast retention,
myocardial viability by MRI,
atheroma lipid liquid crystal characterization,
outpatient inotropic infusion therapy,
angiogenesis imaging,
multimodal in vivo stem cell imaging,
real-time velocity beam MRI,
in vivo microscopic MRI,
dobutamine stress echocardiography for low gradient valve disease,
alternative stress tests,
diagnostic electrocardiography in magnetic environments,
statistical methods to solve error propagation of large array genomics,
discovery of monocyte role in native coronary collateral development,
image tracked stem cell treatment of heart attacks,
singularity editing in differential topology.
Preface to the Three Volume Series
Cardiovascular disease has been a leading cause of death and disability and so it has also been a major focus for intense research, development, and progress. Knowledge of the causes, risks, and best practices for management continually change. That is why a dynamic electronic living textbook presents an exciting opportunity to help you keep current with the ephemeral leading edge. This book is an outgrowth of the commitment of Leaders in Pharmaceutical Business Intelligence to present the most exciting timely and pertinent advances of our day, in a continual medium to stay fresh and up to date. We hope diverse multispecialty perspectives will help you in your quest to understand, adapt and advance the leading edge of cardiovascular disease causes, risks and best practices management.
On the Diagnosis of Cardiovascular Disease: causes, manifestations, consequences and priorities
Doctors aim to spend their time on prevention, diagnosis, and disease management. More and more the time is diverted to expanding demands for documentation and bureaucratic navigation. This article focuses on the art of diagnosis, with examples based on cardiovascular diseases. Diagnosis cannot be achieved without a knowledge of the causes (etiology) of ailments, a necessary but not sufficient component of diagnosis. The causes broadly relate to nature and nurture, how our biological system develops and functions (nature), and its interactions with the outside world driven in part by behavior, diet, exposures, and activities (nurture). The nature of our individuality has been traced to the human genome, a map of code for protein products that build our structures and mediate our body part functions. Numerous blood tests have been devised to check the expression and activity level of such genomic products to identify disease and characterize its stage. The role of diet, behavior, exposures, activities or lack thereof is well established as a complicit factor in disease development and progression.
The art of diagnosis is designed to find out what is wrong. Literally, it is a flow of knowing, based on knowledge of causes of ailments, probabilities (prevalence), consequences, manifestations, priorities (which would be most urgent) and tests: CPCMPT. Review of those elements generates a list of concerns, often expressed as a “differential diagnosis” which is a prioritized list of plausible explanations for the observations, patient’s report of symptoms and findings from patient examination. The second stage of diagnosis, called the “work-up,” selects and applies tests to stratify the list of possibilities further as well as to characterize the manifestations and stage of disease. Technically, analysis of biological samples, imaging studies and intervention trials each represent tests; however, they are often viewed as distinct tools with just the former labeled as tests (biological samples include blood tests, urine tests, sputum or saliva samples, and biopsies). The primary goal of the work-up is to establish one or more specific diagnoses as the cause of ailment. The secondary goal of the work-up is to characterize the manifestations and stage of disease to define expectations and clarify options for the disease management. The third goal is to develop a management a plan to slow or stop the ailment, decrease risks of complications, slow or stop progression of disease manifestations or otherwise minimize functional impairment.
The manifestations of disease are categorized as signs and symptoms.
Signs are observable evidence of consequences,
Symptoms are subjective complaints.
A major component of diagnostic skill is the ability to identify and characterize correctly signs and symptoms of all relevant disease conditions. A second major component of diagnostic skill is the ability to select appropriate tests and interpret their significance in context, in keeping with the patient’s presentation.
When someone sees a doctor about chest pain, coronary artery disease is a prominent consideration. The most common causes of chest pain are mechanical (muscle and bone, e.g., muscle spasms, muscle and bone inflammation), but those conditions are not generally life-threatening. The consequences of blocked arteries – arrhythmia, permanent weakness of the heart, blood clots, pulmonary emboli, stroke, cardiogenic shock, death – raise the stakes and push coronary disease high in priority even when the probabilities are low. The prioritization of the differential diagnosis list has multiple considerations: urgency (how quickly it can worsen), severity of consequences, and the probabilities of a macrovascualar event (prevalence, risk factors). A ten percent risk of coronary disease typically takes precedence over a 70% likelihood of muscle spasm in terms of diagnostic testing.
The road map for the construction of our individuality as humans has been fully mapped: the human genome. Genetic variation means we are not fully determined by the mix of genes inherited from our parents. In addition to the genetic material on our 48 chromosomes, and the genetic material in mitochondria inherited from the mother, there are spontaneous changes in the genetic code, and there are modifications that affect gene expression (which codes produce gene products, quantities, rates, and post-production modifications).
The causes of cardiovascular disease are defined by Murphy’s law: what can go wrong will. However, on the nature side, most malfunctions are too severe to reach the light of day, so there is a limited list of disease mechanisms associated with sufficient viability to reach medical attention. Those mechanisms can be summarized by a mnemonic: diseases can develop new metals in-flame, a-fact externs generated (disease mechanisms: congenital, developmental, neoplastic, metabolic, inflammatory, infectious, extrinsic (e.g. stab wound), and degenerative). A taxonomy of cardiovascular diseases can be constructed in various ways: (1) itemize the major cardiovascular functions and subclassify the dysfunctions, (2) itemize by principle anatomic involvement and subclassify by pathology, (3) classify by mechanism of disease, etiology. Compendiums of cardiovascular disease may be found in: (1) French’s Differential Diagnosis, (2) Robbins and Angel Pathology, (3) Guyton’s Textbook of Physiology, as well as cardiovascular disease textbooks such as Hurst, Braunwald, Mayo Clinic, Cleveland Clinic…
Diagnosis takes many forms. The paranoid inclusive approach, manifested as “medical student syndrome”, considers any semblance of a sign or symptom vaguely similar to a disease manifestation as a frightening prospect worthy of detailed pursuit. The minimalist pragmatic approach commonly attributed to general practitioners focuses on reassurance, and pursuit of persisting complaints that match a common ailment. That approach has been summarized by the advice: when you hear hoof beats think of horses, not zebras. Specialists, on the other hand, are taught to consider all possibilities, with due consideration to urgency and treatability, so that zebras are not punished.
The healthcare system promotes the idea of generalists serving as the front line, identifying who can be managed simply, with specialists serving as finishers for more complex cases or cases requiring special skills. A flaw in that model is the need for detailed knowledge of zebras and subtle findings that may represent an urgent issue at the front line for triage. If the generalist does not know that mild symptoms from mitral valve disease or aortic valve disease may require urgent detailed assessment, patients may be referred to a specialist too late to prevent consequences that requires an earlier intervention.
Parsimony in diagnosis refers to identifying the fewest number of diagnoses that explain all the findings. The concept has been attributed to Osler, and it builds on a guiding procedure voiced in the middle ages by Occum, known as Occum’s razor: when deciding between two explanations, favor the one that requires the fewest assumptions. Parsimony is a useful guide for diagnosis of a previously healthy patient who develops a number of findings that are temporally coherent. After age 65 (official geriatrics age), physicians are taught to abandon parsimony and expect more diagnoses than findings.
A study of difficult diagnoses lead to the concept of a pivotal finding as one that has a narrow differential list. The diagnostic process is prone to errors, including cognitive biases, which may benefit from computer assistance. Intuition and analytics can be applied to reduce cognitive bias. The author developed a just-in-time social networking system within a software package called Missive(c) that enables rapid access to such tools, combining efficiency in documentation with improved quality of analysis and reports (faster and better).
Among older Americans, more are hospitalized for heart failure than for any other medical condition (diastolic failure=stiff heart, systolic failure= inadequate pumping).
Genomics – the study of the genetic basis for disease – is rapidly expanding knowledge about etiology (cause of disease), and it helps identify opportunities for accurate diagnosis and treatment. The American Heart Association journal CIRCULATION has published 348 relevant articles related to cardiovascular genomics from 2010-2013. For example, just on the subtopic of atherosclerosis (hardening of arteries), genomics offers major progress. The genetic factors that affect arterial stiffness are strongly related to a very common underlying health concern, hypertension (high blood pressure). The counterpart to genetics is environment (nature versus nurture), but genetics carries the trump cards because it determines the sensitivities to environment.
[bring here ONLY the INTRODUCTION and the Summary of each, THEN The EDITOR will provide perspective on the Research and the current STate of Cardiology in the US in 2013/2014]
Hardening of the arteries is described as atherosclerosis, or porridge-like wall changes with scarring, which leads to heart attacks, high blood pressure, stroke, and organ injury mediated by ischemia (insufficient nutrient blood supply). The causes are both nature (genetic) and nurture (behavior, diet). Specifics of the causes guide diagnosis and management.
Chapter 1.2: Genomics
The completion of the human genome map was a major accomplishment, as gene products make signals, receptors and building blocks that establish health and disease. However, it is just a stepping stone, not explaining why, where, or how the gene products are regulated and interact.
Chapter 1.3: Cardiovascular Imaging
Imaging applies a principle of physics (light transmission, sound transmission, xray transmission, magnetic resonance, radioactivity) to provide a map of interior structures and/or activities. Image processing (computing) derives further information than simple display of an observed tissue-sensitive parameter. In the case of computed tomography (CT), magnetic resonance (MRI), positron-emission tomography (PET), and single-photon emission tomography (SPECT), computer reformatting of image data is essential.
Cardiovascular disease is the leading cause of death and disability, affecting more than four times as many people as all forms of cancer combined.
Chapter 2.2: Testing for cardiovascular risk
The volunteer population of Framingham Massachusetts provided decades of data clarifying determinants of risk for cardiovascular diseases. That data helped establish the usefulness of cholesterol screening, and lead to the search for additional tests to identify risk and guide management.
Chapter 2.3: Biomarkers
Biomarkers are chemistry levels (concentrations in the blood) that identify injury or risk for injury.
As the mysteries of the human genome products are unraveled, we get closer to identifying key components. One of them is Thymosin beta 4 (Tβ4) , which plays an essential role in cardiac and blood vessel development and regeneration. It may lead to breakthroughs in angiogenesis and vasculogenesis, or new vessel development, mimicking the behavior of the lucky few who develop new vessels, or collaterals, as a natural bypass system, without requiring a surgeon to provide a blood supply to avoid or limit heart attacks.
Chapter 3.2: Image guidance of Therapy
The US government is helping to sponsor new imaging methods, while they also inhibit it by adding new taxes.
Chapter 3.3: Drug therapy
Emerging new therapies are presented, along with the biological basis.
Chapter 3.4: Cardiovascular Interventions
Technological advances enable minimally invasive solutions to problems previously addressed by surgery or autopsy.
Contributors above, need a LINK to the appropriate contributors in each volume. Table of Contents of each volume above need a LINK to the eTOCS of each volume.
Please UPDATE all links ABOVE to the appropriate locations in the respective volumes, after implementing the carry over, remove links below EXCEPT CVD1,2,3 and remove this comment of mine in RED, here
Bernstein, HL and A. Lev-Ari 5/15/2013 Diagnosis of Cardiovascular Disease, Treatment and Prevention: Current & Predicted Cost of Care and the Promise of Individualized Medicine Using Clinical Decision Support Systems
C. Genomics & Genetics of Cardiovascular Disease Diagnoses
Lev-Ari, A. and L H Bernstein 3/7/2013 Genomics & Genetics of Cardiovascular Disease Diagnoses: A Literature Survey of AHA’s Circulation Cardiovascular Genetics, 3/2010 – 3/2013
D. Genetic Base of Atherosclerosis and Loss of Arterial Elasticity with Aging
Lev-Ari, A. 5/17/2013 Synthetic Biology: On Advanced Genome Interpretation for Gene Variants and Pathways: What is the Genetic Base of Atherosclerosis and Loss of Arterial Elasticity with Aging
F. Arterial Stiffness: Pharmacotherapy for Hypertension and Hypercholesterolemia Management
Pearlman, JD and A. Lev-Ari 5/24/2013 Imaging Biomarker for Arterial Stiffness: Pathways in Pharmacotherapy for Hypertension and Hypercholesterolemia Management
Lev-Ari, A. 4/28/2013 Genetics of Conduction Disease: Atrioventricular (AV) Conduction Disease (block): Gene Mutations – Transcription, Excitability, and Energy Homeostasis
Pearlman, JD and A. Lev-Ari 5/7/2013 On Devices and On Algorithms: Arrhythmia after Cardiac Surgery Prediction and ECG Prediction of Paroxysmal Atrial Fibrillation Onset
Pearlman, JD and A. Lev-Ari 5/22/2013 Acute and Chronic Myocardial Infarction: Quantification of Myocardial Perfusion Viability – FDG-PET/MRI vs. MRI or PET alone
A ventricular assist device (VAD) is an implantable mechanical pump that helps pump blood from the lower chambers of your heart (the ventricles) to the rest of your body. VADs are used in people who have weakened hearts or heart failure. Although VADs can be placed in the left, right or both ventricles of your heart, they are most frequently used in the left ventricle. When placed in the left ventricle they are called left ventricular assist devices (LVADs).
You may have a VAD implanted while you wait for a heart transplant or for your heart to become strong enough to effectively pump blood on its own. Your doctor may also recommend having a VAD implanted as a long-term treatment if you have heart failure and you’re not a good candidate for a heart transplant.
The procedure to implant a VAD requires open-heart surgery and has serious risks. However, a VAD can be lifesaving if you have severe heart failure.
This is an assessment of the development and progression of cardiogenic shock and review of the use of ventricular assist devices in that setting. It is another piece of the chapter on cardiothoracic surgical management at Columbia University Medical Center, New York, NY.
Department of Medicine, New York Presbyterian Hospital/Columbia University Medical Center, New York, New York, USA.
Abstract
Cardiogenic shock remains a deadly complication of acute myocardial infarction (MI). Early revascularization, inotropic support, and intraaortic balloon counterpulsation are the mainstays of treatment, but these are not always sufficient. New mechanical approaches, both percutaneous and surgical, are available in this high-risk population. We present a case of a young woman with a massive anterior wall MI and subsequent cardiogenic shock who was treated with advanced mechanical circulatory support. This case serves as an illustration of the stepwise escalation of mechanical support that can be applied in a patient with an acute MI complicated by refractory cardiogenic shock. We also review the literature with regard to the use of percutaneous left ventricular assist devices in the setting of cardiogenic shock.
A 21-year-old woman with a history of migraine headaches was admitted to the hospital with nonradiating substernal chest pain onset that morning. When she presented to another hospital she had a normal electrocardiogram (EKG) and was discharged. When the patient’s chest discomfort became crushing she presented again to the same hospital where her EKG revealed ST-segment elevations in an anterolateral distribution. Her peak (hs) troponin was 229 ng/mL and peak creatinine kinase was 6900 U/L. This was an elevation of CK far out of proportion to the troponin increase (suggestive of decreased peripheral circulation with massive release of CK from muscle). There was no family history of early myocardial infarction (MI), sudden cardiac death, clotting disorders, or hypercholesterolemia. She had been taking amitriptyline for migraines and oral contraceptives for 3 years. The patient developed significant hypotension, after she was given metoprolol and morphine, for which dobutamine and dopamine were administered. Medication was switched to norepinephrine because of excessive tachycardia. Cardiac catheterization was performed emergently approximately 12 hours after the onset of the patient’s chest pain.
Thrombectomy of an angiographically identified clot in the proximal portion of the left anterior descending artery was performed, followed by placement of a bare metal stent with no residual occlusion. An intraaortic balloon bump (IABP) was placed. The initial transthoracic echocardiogram revealed an ejection fraction of 25% and global hypokinesis with regional wall motion abnormalities, worst in the anterior, apical, and lateral walls. She was intubated and required significant hemodynamic support with norepinephrine. Her antiplatelet regimen consisted of oral aspirin, clopidogrel, and intravenous eptifibatide. The patient was transferred to the New York Presbyterian Hospital/Columbia University Medical Center approximately 12 hours after revascularization.
Transfer to NY Presbyteran Columbia Hospital
On arrival, the patient was intubated and sedated. Her blood pressure was 80/51mmHg, pulse rate was 140 beats/min, and oral temperature was 101F. On examination, she was tachycardic with warm extremities. The jugular veins were not distended. Her lactate was 7.0 mmol/L. (If she was so severely hypotensive with lactic acidemia, possibly from impaired liver and/or muscle circulation with aerobic glycolysis, then why was the temperature 101 deg F?) The patient was not tested for procalcitonin (Brahms, BioMerieux), but sepsis is now considered bacterial or abacterial. Whether there was release of bacterial endotoxin secondary to poor decreased circulation in the superior mesenteric artery is not known, which complicates the situation more. In a study of acute phase changes in liver proteins by Bernstein and associates [Transthyretin as a marker to predict outcome in critically ill patients. Devakonda A, George L, Raoof S, Esan A, Saleh A, Bernstein LH. Clin Biochem 2008; 41(14-15):1126-1130. ICID: 939927], and another on procalcitonin and sepsis [The role of procalcitonin in the diagnosis of sepsis and patient assignment to medical intensive care. Bernstein LH, Devakonda A, Engelman E, Pancer G, Ferrar J, Rucinski J, Raoof S, George L, Melniker L. J Clin Ligand Assay] there was a notable case of negative bacterial culture in a patient with highly elevated procalcitonin, considered a reliable early indicator of sepsis.
Procalcitonin (PCT) is a sensitive and specific inflammation marker, which can be used to detect both inflammatory infections and noninflammatory complications in postsurgical monitoring of patients after cardiac surgery using extracorporeal circulation. The optimum cut-off value for PCT levels, as a predictor of postoperative complications, appears to be 1.2 ng/mL with a sensitivity of 80% and a specificity of 90%. PCT may be used to monitor response to therapy because blood concentrations increase in an inflammatory disease relapse. Importance of procalcitonin in post-cardiosurgical patients. Topolcan O, Bartunek L, Holubec Jr L, Polivkova V, eta al. Journal of Clinical Ligand Assay 2008; 31(1-4): 57-60.]This might be expected to be associated with a CRP increase over 50-70 mg/ml. In addition, the hemogram would have been of some interest, perhaps raising the question of whether the cardiovascular impairment triggered other events [Validation and Calibration of the Relationship between Granulocyte Maturation and the Septic State. Bernstein LH and Rucinski J. Clin Chem Lab Med 2011; 49. Walter de Gruyter . http://dx.doi.org/10.1515cclm.2011.688. Converting Hematology Based Data into an Inferential Interpretation. Bernstein LH, David G, Rucinski J and Coifman RR. In Hematology – Science and Practice, 2012. Chapter 22, pp 541-552. InTech Open Access Publ. Croatia].
A chest radiograph showed pulmonary edema. Her EKG revealed sinus tachycardia at 121 beats/min with ST-segment elevation of 3 mm in leads V1 to V4 and poor R-wave progression throughout the precordial leads with pathologic Q waves in V1 to V6, I, and aVL. Eptifibatide (Integrilin, Merck & Co., Inc., Whitehouse Station, NJ) was stopped, and norepinephrine was continued at 20 mg/min. Dobutamine 2.5 mg/min and broad-spectrum antibiotics were administered. During the next 4 hours, the patient’s mean arterial pressure fluctuated between 60 and 70 mm Hg with a heart rate between 120 and 140 beats/min on 20 mg/min of norepinephrine, 2.5 mg/min of dobutamine, and the IABP. Rapid escalation of mechanical support with a left ventricular assist device (LVAD) was deemed necessary. Right-sided heart catheterization after placement of an Impella 2.5 assist device (ABIOMED, Inc.) revealed a cardiac output of 3.3 L/min and a cardiac index (CI) of 2.1 L/min/m2, despite addition of 3 ug/min and 4 U/h of vassopressin.
Day 2
On the second day after transfer she was severely hyponatremic, but her plasma sodium stabilized at 131 to 138 mmol/L after discontinuing the vasopressin. She also developed significant bleeding at the site of the Impella and hemolysis requiring several blood transfusions. Her hemoglobin on transfer was 10.4 g/dL, which trended down to 7.8 g/dL after Impella placement. The patient’s lactate dehydrogenase was 1980 U/L (probably reflecting poor liver perfusion), and total bilirubin was 2.6 mg/dL on day 2 of her hospitalization compared with 1.1 mg/dL on transfer.
Day 3
After the Impella device was removed on day 3 because of persistent bleeding, the patient’s hemoglobin, bilirubin, and platelet count stabilized, but while the patient was able to maintain end-organ perfusion initially as manifested by a normal creatinine, as the day progressed, the patient’s systemic blood pressure trended downward and urine output decreased, and she could not tolerate discontinuation of the vasoactive agents being administered. Pulmonary hypertension developed with a rate-dependent cardiac output as manifested by persistent tachycardia, and had an ejection fraction of 20% with severe hypokinesis of all segments except the basal inferior and inferolateral walls. As a consequence of the enduring cardiogenic shock and the low likelihood for recovery of left ventricular function, it was evident the patient required long-term mechanical support. A continuous flow LVAD (HeartMate II; Thoratec Corporation) was implanted as a rescue therapy, and the patient was emergently listed for transplantation.
Recovery
A comprehensive heart failure regimen was introduced, and the patient was discharged with warfarin 25 days after her transfer. A comprehensive hypercoagulability workup performed while the patient was receiving anticoagulation with negative results. Aside from oral contraceptive use, no other obvious risk factor for an acute arterial thrombosis could be identified, which is not surprising given that up to 40% of all thrombotic events occur in patients without a recognizable risk factor. Early revascularization, inotropic support, and intraaortic balloon counterpulsation are the mainstays of treatment, but these are not always sufficient. New mechanical approaches, both percutaneous and surgical, are available in this high-risk population. This case serves as an illustration of the stepwise escalation of mechanical support that can be applied in a patient with an acute MI complicated by refractory cardiogenic shock. We also review the literature with regard to the use of percutaneous left ventricular assist devices in the setting of cardiogenic shock.
Recommendation
The authors recommend the following protocol for patients with cardiogenic shock superimposed on acute MI. Treatment of cardiogenic shock. PCI, percutaneous coronary intervention; IABP, intraaortic balloon pump; VAD, ventricular assist device; VA-ECMO, venoarterial extracorporeal membrane oxygenation; OHT, orthotopic heart transplantation; pVAD, percutaneous ventricular assist device. It is important to note that it includes immediate revascularization in conjunction with IABP placement. In patients with refractory cardiogenic shock who are unable to be weaned from the IABP, mechanical circulatory support using a percutaneous or surgical device is the next essential measure to be taken. The type of mechanical support to be used depends on many factors, including the reversibility of the shock state, chances of ventricular recovery, and risk of bleeding. Mechanical circulatory support with left ventricular assists devices can improve cardiac performance and reduce myocardial ischemic injury. Principle mechanisms include unloading of the left ventricle, thereby decreasing myocardial oxygen demand and improvement of systemic hypotension, thus increasing coronary perfusion.
Although there were complications related to the use of the device, its deployment resulted in the improvement of the patient’s surgical candidacy by virtue of maintaining her end-organ function. After the removal of the Impella device, we thought the left ventricle in this patient would not recover, and for this reason, we chose a definitive surgical procedure as opposed to alternative temporary support device. Clinical studies focusing on the use of VA-ECMO in refractory cardiogenic shock after an acute MI are limited. Observational and retrospective series have thus far demonstrated a high mortality rate in these patients. However, a recent retrospective study of 33 patients who received ECMO support for advanced refractory cardiogenic shock after an acute MI demonstrated a mortality rate of 46% and 52% at 30 days and 1 year, respectively. In addition to mny complications with VA-ECMO, the procedure also can lead to increased afterload from the retrograde flow of peripheral cannulation., which may to lead to increased left ventricular pressure and wall stress, thereby compromising myocardial recovery and worsening pulmonary edema, both of which were major concerns
in this patient.
Conclusions
This case demonstrates that a sequential approach using percutaneous mechanical support as a bridge to surgical mechanical support is feasible in this high-risk population (Figure ). Advantages of percutaneous mechanical support include its rapid and straightforward placement. Disadvantages include its limited cardiac output and bleeding. Future technology should focus on a device that is capable of providing significant cardiac output and that can be easily placed, like the Impella. Such a device could alter the natural history of intractable cardiogenic shock.
“Artificial blood” has been the main focus of research in the past few years (1) and refers to a substance used to mimic and fulfill some functions of biological function.
A number of driving forces have led to the development of artificial blood substitutes (1):
The military, which requires a large volume of blood products that can be easily stored and readily shipped to the site of casualties.
HIV; with the advent of this virus, the medical community and the public suddenly became aware of the significance of transfusion-transmitted diseases and became concerned about the safety of the national blood supply.
The growing shortage of blood donors. Approximately 60% of the population is eligible to donate blood, but fewer than 5% are regular blood donors.
Short shelf-life of the blood products.
High hospital needs: cancer patients, transplantation etc
Artificial blood products offer many important benefits:
Readily available
Have a long shelf life
Can undergo filtration and pasteurization processes
Do not require blood typing (i.e A,B AB, O)
Do not appear to cause immunosuppression in the recipient.
Researchers have focused their efforts on creating artificial substitutes for 2 important functions of blood: A) oxygen transport by red blood cells and B) hemostasis by platelets (1).
A) Red Cell Substitutes:
Hemoglobin based
Perfluorocarbon (PFC) based
A1) Hemoglobin-based
The hemoglobin-based substitutes use hemoglobin from several different sources (1):
Human – Human hemoglobin is obtained from donated blood that has reached its expiration date and from the small amount of red cells collected as a by-product during plasma donation.
Animal – Animal hemoglobin is obtained from cows. This source creates some apprehension regarding the possible transmission of animal pathogens, specifically bovine spongiform encephalopathy.
Recombinant – Recombinant hemoglobin is obtained by inserting the gene for human hemoglobin into bacteria and then isolating the hemoglobin from the culture.
Understanding hemoglobin, its transition from a monomer to a tetramer and the way it needs to be linked to the surface of the artificial blood cells is of major issue and will be discussed in more depth in part II.
A2) Perfluorocarbon (PFC) based
PFCs are synthetic hydrocarbons with halide substitutions and are about 1/100th the size of a red blood cell. These solutions have the capacity to dissolve up to 50 times more oxygen than plasma. Because PFC solutions are modified hydrocarbons, however, they do not mix well with blood and must be emulsified with lipids or oils. The PFCs are inert products. After infusion, the molecules vaporize and are then exhaled over several days (1).
B) Platelet Substitutes:
Platelets are also at very high need due to their extremely short shelf-life (5 days) and very limited supply. Several methods have been utilized to create platelet substitutes including:
Infusible platelet membranes
Thrombospheres
Lyophilized human platelet product
Use and need for HLA antigen or platelet antigens, fibrinogen proteins and aggregation factors will be further discussed in part II.
In Summary:
The growing need for blood supply due to short shelf-life, limited supply and increase in disease/injured population have urged researchers to look for blood substitutes. Although the many years of research and profound progress that have been made, there’s plenty of disadvantages having complications and limited clinical benefits. The topic of blood substitutes will be further discussed in part II, highlighting the different substitutes that were developed, those which entered clinical trails, and the potential use of nanotechnology in this field of research.
4. Jiin-Yu Chen, Michelle Scerbo, and George Kramer. A Review of Blood Substitutes: Examining The History, Clinical Trial Results, and Ethics of Hemoglobin-Based Oxygen Carriers. Clinics (San Paulo) 2009 August; 64(8): 803-813. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2728196/
This is the THIRD of a three part series on the evolution of vascular biology and the studies of the effects of biomaterials in vascular reconstruction and on drug delivery, which has embraced a collaboration of cardiologists at Harvard Medical School , Affiliated Hospitals, and MIT, requiring cardiovascular scientists at the PhD and MD level, physicists, and computational biologists working in concert, and an exploration of the depth of the contributions by a distinguished physician, scientist, and thinker.
The FIRST part – Vascular Biology and Disease – covered the advances in the research on
the acquired knowledge of the pharmacodynamics of drug interactions and drug distribution.
In this THIRD part, on Problems and Promise of Biomaterials Technology, we cover the biomaterials used and the design of the cardiovascular devices, extension of uses, and opportunities for improvement
Biomaterials Technology: Tissue Engineering and Vascular Models –
Problems and Promise
We have thus far elaborated on developments in the last 15 years that have led to significant improvements in cardiovascular health.
First, there has been development of smaller sized catheters that can be introduced into
not only coronary arteries, but into the carotid and peripheral vasculature;
Second, there has been specific design of coated-stents that can be placed into an artery
for delivery of a therapeutic drug.
This began with a focus on restenosis, a serious problem after vascular repair, beginning
with the difficult problem of control of heparin activity given intravenously, and was
extended to modifying the heparan-sulfate molecular structure
to diminish vascular endothelial hyperplasia,
concurrent with restriction of the anticoagulant activity.
Third, the ability to place stents with medicated biomaterials locally has extended to
the realm of chemotherapy, and we shall see where this progresses.
The Engineered Arterial Blood Flow Models
Biomedical engineers, in collaboration with physicians, biologists, chemists, physicists, and
mathematicians, have developed models to predict vascular repair by knowledge of
the impact of interventions on blood flow.
These models have become increasingly sophisticated and precise, and they propel us
toward optimization of cardiovascular therapeutics in general and personalizing treatments
for patients with cardiovascular disease. (1)
The science of vascular biology has been primarily stimulated by the clinical imperative to
combat complications that ensue from vascular interventions.
Thus, when a novel vascular biological finding or cardiovascular medical/surgical technique
is presented, we are required to ask the 2-fold question:
what have we learned about the biology of the blood vessel?
how might this knowledge be used to enhance clinical perspective and treatment?
The innovative method of engineering arterial conduits presented by Campbell et al. in Circulation Research presents us with just such a challenge, and we deal with it’s biological and clinical ramifications.
Each of four pivotal studies in vascular tissue engineering has been an important advance
in the progression to a tissue-engineered blood vessel that can serve as a
living graft, responsive to the biological environment as
a self-renewing tissue with an inherent healing potential.
Weinberg and Bell taught us that a tissue-engineered graft could be constructed
and could be composed of human cells.
L’heureux et al demonstrated that the mechanical strength of such a material
derived in major part from the extracellular matrix and
production of matrix and integrity of cellular sheets
could be enhanced by alterations in culture conditions.
Niklason et al. noted that grafts are optimally formed
when incubated within environmental conditions that they will confront in vivo
or would have experienced if formed naturally.
Campbell et al. now demonstrate that it is possible to remove
the immune reaction and acute rejection that may follow cell-based grafting
by culturing tissues in the anticipated host and
address a fundamental issue of whether cell source or site of cell placement
dictates function after cell implantation.
It appears that the vascular matrix can be remodeled by the body according to the needs of the environment. It may
very well be that the ultimate configuration of autologous cell-based vascular graft need not be determined at
outset by the cells that comprise the device, but rather
by a dynamics that is established by environmental needs, wherein the body molds
tissue-engineered constructs to meet
local flow,
metabolic, and
inflammatory requirements.
In other words, cell source for tissue reconstruction may be secondary to cell pliability to environmental influence.
Endothelial and smooth muscle cells from many, perhaps any,
vascular bed can be used to create new grafts and will then
achieve secondary function once in place in the artery.
The environmental remodeling observed after implantation
may modify limitations of grafts that are composed of nonvascular peritoneal cells whose initial structure
is not either venous or arterial. (2)
The trilaminate vascular architecture provides biochemical regulation and mechanical integrity.
Yet regulatory control can be regained after injury without recapitulating tertiary structure.
Tissue-engineered (TE) endothelium controls repair even when
placed in the perivascular space of injured vessels.
It remains unclear from vascular repair studies whether endothelial implants recapitulate the vascular
epithelial lining or expose injured tissues to endothelial cells (ECs) with unique healing potential because
ECs line the vascular epithelium and the vasa vasorum.
Authors examined this issue in a nonvascular tubular system, asking whether airway repair is controlled by
bronchial epithelial cells (EPs) or by
Endothelial Cells (ECs) of the perfusing bronchial vasculature.
Localized bronchial denuding injury
damaged epithelium, narrowed bronchial lumen, and led to
mesenchymal cell hyperplasia, hypervascularity, and inflammatory
cell infiltration. Peribronchial TE constructs embedded with
EPs or ECs limited airway injury, although optimum repair was obtained
when both cells were present in TE matrices.
EC and EP expression of
PGE2, TGF1, TGF2, GM-CSF, IL-8, MCP-1, and soluble VCAM-1
and ICAM-1 was altered by matrix embedding,
but expression was altered most significantly when both,
EC and EP, cells were present simultaneously.
EPs may provide for functional control of organ injury and fibrous response, and
ECs may provide for preservation of tissue perfusion and the epithelium in particular.
Together the two cells
optimize functional restoration and healing, suggesting that
multiple cells of a tissue contribute to the differentiated biochemical function and repair
of a tissue, but need not assume
a fixed, ordered architectural relationship, as in intact tissues, to achieve these effects. (3)
The implantation of matrix-embedded endothelial cells (MEECs)
is considered to have therapeutic potential in controlling the vascular response to injury and
maintaining patency in arteriovenous anastomoses.
Authors considered the 3-dimensional microarchitecture of the tissue engineering scaffold to be
a key regulator of endothelial behavior in MEEC constructs.
Notably, Authors found that
ECs in porous collagen scaffold had a markedly altered cytoskeletal structure with oriented actin
fibers and rearranged focal adhesion proteins, in comparison to cells grown on 2D surfaces.
Examining the immunomodulatory capabilities of MEECs revealed, MEECs were able to reduce the recruitment
of monocytes to an inflamed endothelial monolayer by 5-fold compared to EC on 2D surfaces.
An analysis of secreted factors from the cells revealed
an 8-fold lower release of Monocyte Chemotactic Protein-1 (MCP-1) from MEECs.
Differences between 3D and 2D cultured cells were abolished in the presence of
inhibitors to the focal adhesion associated signaling molecule Src, suggesting that
adhesion-mediated signaling is essential in controlling the potent immunomodulatory
effects of MEEC. (4)
Cardiogenesis is regulated by a complex interplay between transcription factors. How do these interactions regulate the transition from mesodermal precursors to cardiac progenitor cells (CPCs)?
Yin Yang 1 (YY1), a member of the GLI-Kruppel
family of DNA-binding zinc finger transcription factor (TF), can
activate or inhibit transcription in a context-dependent manner.
These investigators performed a bioinformatic-based transcription factor genome-wide sequencing analysis
binding site analysis on upstream promoter regions of genes that are enriched in embryonic stem cell–derived CPCs
to identify novel regulators of mesodermal cardiac lineage
From 32 candidate transcription factors screened, they found that
Yin Yang 1 (YY1), a repressor of sarcomeric gene expression, is present in CPCs.
They uncovered the ability of YY1 to transcriptionally activate Nkx2.5,
Nkx2.5 asa key marker of early cardiogenic commitment.
YY1 regulates Nkx2.5 expression via a 2.1-kb cardiac-specific enhancer as demonstrated by in vitro
luciferase-based assays,
in vivo chromatin immunoprecipitation,
and genome-wide sequencing analysis.
Furthermore, the ability of YY1 to activate Nkx2.5 expression depends on its cooperative interaction with Gata4.
Cardiac mesoderm–specific loss-of-function of YY1 resulted in early embryonic lethality.
This was corroborated in vitro by embryonic stem cell–based assays which showed the
overexpression of YY1 enhanced the cardiogenic differentiation of embryonic stem cells into CPCs.
The results indicate an essential and unexpected role for YY1
to promote cardiogenesis as a transcriptional activator of Nkx2.5
and other CPC-enriched genes. (5)
Proportional Hazards Models to Analyze First-onset of Major
Cardiovascular Disease Events
Various measures of arterial stiffness and wave reflection are considered to be cardiovascular risk markers.
Prior studies have not assessed relations of a comprehensive panel of stiffness measures to prognosis
Authors used Proportional Hazards Models to analyze first-onset of major cardiovascular disease events
myocardial infarction,
unstable angina,
heart failure, or
stroke
In relation to arterial stiffness measured by
pulse wave velocity [PWV]
wave reflection
augmentation index [AI]
carotid-brachial pressure amplification [PPA]
and central pulse pressure [CPP]
in 2232 participants (mean age, 63 years; 58% women) in the Framingham Heart Study.
During median follow-up of 7.8 (range, 0.2 to 8.9) years,
151 of 2232 participants (6.8%) experienced an event.
In multivariable models adjusted for
age,
sex,
systolic blood pressure,
use of antihypertensive therapy,
total and high-density lipoprotein cholesterol concentrations,
smoking, and
presence of diabetes mellitus,
Higher aortic PWV was associated with a 48% increase in
cardiovascular disease risk
(95% confidence interval, 1.16 to 1.91 per SD; P0.002).
After PWV was added to a standard risk factor model,
integrated discrimination improvement was 0.7%
(95% confidence interval, 0.05% to 1.3%; P < 0.05).
In contrast, AI, CPP, and PPA were not related to
cardiovascular disease outcomes in multivariable models.
(1) Higher aortic stiffness assessed by PWV is associated with
increased risk for a first cardiovascular event.
(2) Aortic PWV improves risk prediction when added to standard risk factors
and may represent a valuable biomarker of CVD risk in the community. (6)
1. Engineered arterial models to correlate blood flow to tissue biological response. J Martorell, P Santoma, JJ Molins,
AA Garcıa-Granada, JA Bea, et al. Ann NY Acad Sci 2012: 1254:51–56. (Issue: Evolving Challenges in Promoting
Cardiovascular Health) http://dx.doi.org/10.1111/j.1749-6632.2012.06518.x
3. Tissue-engineered endothelial and epithelial implants differentially and synergistically regulate airway repair.
BG Zani, K Kojima, CA Vacanti, and ER Edelman. PNAS 13, 2008; 105(19):7046–7051. http://www.pnas.org/cgi/doi/10.1073/pnas.0802463105
The European Society of Cardiology (ESC) produced updated guidance on management of STEMI in 2012.
It also produced a third version of the Universal Definition of Myocardial Infarction.
The importance of early diagnosis is stressed, with first ECG in patients
with suspected STEMI recommended within 10 min of first medical contact (FMC)
and primary percutaneous coronary intervention (PPCI) for STEMI
ideally within 90 min (rated ‘acceptable’ out to a maximum of 120 min).
The guidance highlights the importance of collaborative networks
to facilitate achievement of such targets.
the importance of prompt assessment
management of atypical presentations not always considered under the umbrella of STEMI, including
left bundle branch block (LBBB),
paced rhythms, and
isolated ST-segment elevation in lead aVR,
especially when accompanied by symptoms consistent with myocardial ischaemia.
Therapeutic hypothermia is now recommended for
all resuscitated patients with STEMI complicated by cardiac arrest
immediate coronary angiography with a view to follow-on PPCI
when the ECG demonstrates persistent ST-segment elevation.
In the light of recently published studies and meta-analyses,
including that of Kalesan et al., drug-eluting stents (DES) are
now routinely preferred to bare metal stents (BMS) in view of
the reduced need for repeat revascularization and the lack of
previously perceived hazard for stent thrombosis.
The more potent antiplatelet agents prasugrel and ticagrelor are also preferred
to clopidogrel for all STEMI cases, with duration of dual antiplatelet therapy (DAPT)
ideally for 1 year, but reduced to a strict
minimum of 6 months for patients receiving DES.
The Third Universal Definition of Myocardial Infarction was published
simultaneously with the STEMI guidance. This guideline endorses
cardiac troponin as the biomarker of choice to detect myocardial necrosis
with spontaneously occurring myocardial infarction (MI) defined as an
elevation above the 99th percentile upper reference value for the assay.
There is further development and clarification of MI in different settings
to allow standardization across trials and registries
in particular after revascularization procedures: after CABG with normal baseline troponin
MI is defined as a rise to a value 10 times greater than baseline in the first 48 h, and
a rise to 5 times greater than 99th percentile upper reference after PCI
in patients with a normal baseline level (or a 20% rise when troponin is elevated and stable or falling pre-procedure).
ACCF/AHA updated guidance on the management of unstable angina/non-STEMI:
angiography with a view to revascularization
is now recommended within 12–24 h of presentation, with
DAPT pre-loading prior to PCI procedures also now advocated.
Ticagrelor and prasugrel are cited as acceptable alternatives to clopidogrel. The maintenance dose of aspirin recommended for the majority of cases is 81 mg daily. This guideline brings about transatlantic agreement in most areas.
Risk Stratification
Identification and appropriate triage of patients presenting to emergency departments
with acute chest pain remains a difficult dilemma:
many are low-risk and have a non-cardiac origin
a significant minority with coronary artery disease may not be picked up
on clinical grounds even when accompanied by appropriate tests,
including ECG and biomarker estimation used in conjunction
with a clinical risk score (e.g. GRACE, TIMI).
As endorsed in ESC guidance, there has been increasing interest in
non-typical ECG patterns for the diagnosis of STEMI; although LBBB is
an accepted surrogate
Widimsky et al. retrospectively analysed 6742 patients admitted to hospital with acute MI
in patients presenting with right bundle branch block, a blocked epicardial vessel was
more common (51.7 vs. 39.4%; P < 0.001) and incidence of both shock and mortality
comparable with LBBB (14.3 vs. 13.1%; P = NS; and 15.8 vs. 15.4%; P = NS, respectively).
Wong et al. demonstrated the importance of ST-elevation in lead aVR,
often viewed as indicative of left main stem occlusion, having increased mortality
in patients presenting with both inferior and anterior infarction.
Perhaps the most important data regarding the ECG in 2012 were also the most simple:
Antoni et al. highlighted a powerful and very simple method of risk stratification;
heart rate measured on a 12-lead ECG at discharge after Primary PCI (PPCI) is an
independent predictor of mortality at 1 and 4 years of follow-up.
Patients with a discharge heart rate of ≥70 b.p.m. had a two-fold higher mortality at both follow-up
time points, with every increase of 5 b.p.m. in heart rate
equating to a 29% increase in mortality at 1 year and 24% at 5 years.
These findings have important implications for the optimization of patient therapies after MI (including the use of
rate-limiting agents such as beta-blockers, calcium channel-blockers, and ivabradine), although large randomized
trials are needed to confirm that
interventions to reduce heart rate will replicate the benefits observed in this study.
Figure 1. Kaplan–Meier time-to-event plots for heart rate at discharge divided by quartiles and all-cause mortality
(A and C) and cardiovascular mortality (B and D) at 1-year (A and B) and 4-year (C and D) follow-up,
demonstrating relationship between discharge heart rate and mortality after PPCI for STEMI.
Modified from Antoni et al.
Coronary Intervention and Cardioprotection in Acute Coronary Syndromes
Microvascular obstruction during PCI for ACS/STEMI is associated with increased infarct size and adverse prognosis;
its pathophysiology is thought to be a combination of
mechanical distal embolization of thrombus and plaque constituents during PCI, coupled with
enhanced constriction/hyperreactivity of the distal vascular bed.
The most novel Strategy to Reduce Infarct Size
is the use of a Bare Metal Stent (BMS) covered on its outer surface with a mesh micronet designed to
trap and hold potentially friable material that might embolize distally at the time of PCI.
The MASTER study randomized 433 STEMI patients to PPCI
with conventional BMS or DES at the operator’s discretion vs.
the novel MGuard stent (InspireMD, Tel Aviv, Israel);
the primary endpoint of complete ST-segment resolution was better
in patients receiving MGuard (57.85 vs. 44.7%; P = 0.008), as was
the achievement of TIMI grade 3 flow in the treated vessel (91.7 vs. 82.9%; P = 0.006).
Nevertheless, median ST-segment resolution did not differ
between treatment groups,
myocardial blush grade was no different, and
safety outcomes at 30 days (death, adverse events) as well as
overall MRI-determined infarct mass.
Higher TVR rates may accrue with a BMS platform when compared with
current-generation DES (as now endorsed for PPCI in ESC guidance).
In comparing the four studies in cardioprotection, there remains little to choose between strategies as evidenced by
the relatively minor differences between surrogate endpoints employed regardless of
Figure 2. Comparison of study endpoints for reduction in infarct size in STEMI.
Study endpoints listed on the x-axis. STR, ST-segment resolution; TIMI 3, thrombolysis in
myocardial infarction grade 3 antegrade flow; myocardial blush grade 2/3 (MBG 2/3).
Recent advances in
PCI equipment,
peri-procedural pharmacology,
technique, and safety, as well as
convergence of national guidance,
are leading to the point where
even in the highest risk patients such as those presenting with ACS, small improvements
may be difficult to discern despite large well-designed and -conducted studies.
References
a. The Task Force on the management of ST-segment elevation acute myocardial infarction
of the European Society of Cardiology. ESC guidelines for the management of acute
myocardial infarction in patients presenting with ST-segment elevation. EurHeartJ 2012;33:2569–2619. b. Management of acute myocardial infarction in patients presenting
with ST-segment elevation. The Task Force on the Management of Acute Myocardial
Infarction of the European Society of Cardiology. Eur Heart J 2003; 24 (1): 28-66. http://dx.doi.org/10.1093/eurheartj/ehs215
ESC Guidelines for the management of acute coronary syndromes in patients presenting
without persistent ST-segment elevation: The Task Force for the management of acute
coronary syndromes (ACS) in patients presenting without persistent ST-segment elevation
of the European Society of Cardiology (ESC). http://dx.doi.org/10.1093/eurheartj/ehr236
Thygesen K, Alpert JS, Jaffe AS, Simoons ML, Chaitman BS, White HD. The Writing Group on
behalf of the Joint ESC/ACCF/AHA/WHF Task Force for the Universal Definition of
Myocardial Infarction. Third universal definition of myocardial infarction. EurHeartJ2012;33:2551–2567. http://dx.doi.org/10.1093/eurheartj/ehm355
Kalesan B, Pilgrim T, Heinimann K, Raber L, Stefanini GG, et al. Comparison of drug-eluting
stents with bare metal stents in patients with ST-segment elevation myocardial infarction. EurHeartJ 2012;33:977–987.
Jneid H, Anderson JL, Wright RS, Adams CS, et al. 2012 ACCF/AHA Focused Update of the
Guideline for the Management of Patients with Unstable Angina/Non-ST-Elevation Myocardial
Infraction (Updating the 2007 Guideline and Replacing the 2011 Focused Update). A Report
of the American College of CardiologyFoundation/American Heart Association Task Force
on Practice Guidelines. J Am Coll Cardiol2012;60:645–681.
Widimsky P, Rohác F, Stásek J, Kala P, Rokyta R, et al. Primary angioplasty in acute myocardial
infarction with right bundle branch block: should new onset right bundle branch block be added
to future guidelines as an indication for reperfusion therapy? EurHeartJ2012;33:86–95.
Wong CK, Gao W, Stewart RA, French JK, and the HERO-2 Investigators. The prognostic meaning of
the full spectrum of aVR ST-segment changes in acute myocardial infarction. EurHeartJ2012;33:384–392.
Antoni L, Boden H, Delgado V, Boersma E, et al. Relationship between discharge heart rate and mortality
in patients after myocardial infarction treated with primary percutaneous coronary intervention. EurHeartJ2012;33:96–102.
Stone GW, Abizaid A, Silber S, Dizon JM, Merkely B, et al. Prospective, randomised, multicenter evaluation
of a polyethylene terephthalate micronet mesh-covered stent (MGuard) in ST-segment elevation myocardial
infarction. The MASTER Trial. J Am Coll Cardiol. doi:pii:S0735-1097(12)04506-8. 10.1016/j.jacc.2012.09.004.
Zhou C, Yao Y, Zheng Z, Gong J, Wang W, Hu S, Li L. Stenting technique, gender, and age are associated with
cardioprotection by ischaemic postconditioning in primary coronary intervention: a systematic review of
10 randomized trials. EurHeartJ2012;33:3070–3077.
Resistant hypertension is defined as failure to achieve goal blood pressure (BP) <140/90 mm Hg
(or <130/80 mm Hg in patients with diabetes mellitus or chronic kidney disease) in patients with
hypertension who are compliant with maximum tolerated doses of an appropriate antihypertensive drug regimen consisting of a minimum of 3 agents of different classes, including a diuretic.
Patients who meet the criteria for resistant hypertension but whose BP can be controlled on maximum tolerated
doses of ≥4 antihypertensive agents are classified as having controlled resistant hypertension.
Although the number of failed antihypertensive drugs required for the classification of resistant hypertension is arbitrary,
this diagnosis identifies patients at high risk for having a potentially curable form of hypertension, and
those who may benefit from specific therapeutic approaches to lower BP.
Summary
The first portion of this document shows the impact that ER Edelman and his peers have had in the development
of interventional cardiology, and in carrying out studies to test, validate, or reject assumptions about the interaction of
biomaterials with
vascular and smooth muscle tissue in the repair of injured vessels, by
trauma
inflammatory injury
stent placement.
In the second portion of this discussion, I introduce current views about complications in implanted devices, evolving
standards, and the current definitions of stable, unstable, and previously unclassified ACS risk.
Pushing Drug-Eluting Stents Into Uncharted Territory
Simpler Than You Think—More Complex Than You Imagine
Mechanical failure is a characteristic of a material or a device and not necessarily an indication of inadequacy. All devices will fail under some specific stress. It is only failure at the lowest levels of stress that may represent inadequacy. Stress on a material, for example, rises with strain until a critical load is exceeded, at which point the material fatigues and loses mechanical integrity. Failure analysis, the science by which these conditions are rigorously defined, is an important component of device design, development, and use. Once the transition point to failure is identified, material use can be restricted to the zone of safety or modified so as to have this zone expanded. Just as the characterization of a material is incomplete unless pushed to the limits of load bearing, characterization of an implantable device is incomplete unlesspreclinical and clinical environments test the limits of device functionality. It was in this light in 1999 that the Authors noted the impossibility of defining the functional limits of novel bare metal stents in head-to-head trials, which, by necessity, could only include lesions into which the predicate device (the Palmaz-Schatz stent, Cordis, Warren, NJ) could have be placed.
New School Percutaneous Interventions
Over the past 5 years, the number of percutaneous interventions has grown by 40%. This expansion derives from an increased breadth of cases, as percutaneous interventions are now routinely performed in diabetic, small-vessel, multilesion,diffuse disease, and acute coronary syndrome settings. Contemporaneously, widespread adoption of drug-eluting stents has emboldened clinicians and provided greater security in the use of these devices in lesions or patients previously thought to
Head-to-head randomized trial data have accumulated so that analysis may demonstrate differences among drug-eluting stents. The playing field for prospective randomized trials could enhance the weight of evidence to unanswered questions about what underlying factors determine device failure.
Complexity Simplified
Drug-eluting stent “failure” can be defined operationally in the same way as material failure:
inadequate function in the setting of a given load or strain.
The inability to withstand stress may take many forms that can change over time. Failure may be manifest acutely as
the inability to deliver a stent to the desired location,
subacutely as stent thrombosis or
postprocedural myonecrosis, and later as
restenosis
“Simple lesions” are those in which few devices should fail;“Complex” lesions have a heightened risk of failure. To be of value, each scale of advancing complexity must provoke higher failure rates. For any device may fail sooner than another along one such “complexity” scale and later along another. As advanced drug-eluting stent designs have enhanced deliverability and reduced restenosis rates, 7 randomized trials comparing directly the two Food and Drug Administration (FDA)-approved drug-eluting stents, Cypher (Cordis-Johnson and Johnson) and Taxus (Boston Scientific, Boston, Mass), have been reported. These trials report a broad range of restenotic failure as evidenced by the need for revascularization. Across these trials, driven by a variety of factors, revascularization rates vary quite widely.
The clinical end point of target lesion revascularization (TLR) becomes
a single measure of device failure.
When the 7 trials are depicted in order of increasing TLR, the rate of failure increases more slowly with 1 device than
the other. This gives two regression plots for Taxus vs Cypher with different slopes, as complexity increases, and the
separation between the failure rates of the two devices broadens plotted against “degree of complexity” assigned by the slopes of the lines.
Finally, the correlation between TLR rates for Taxus and Cypher stents indicates that trial-specific events and conditions determined TLR (with a sharp slope of Taxus vs Cypher (r-sq = 0.85). The ratio of TLR (the slope) wasgreater than 3, suggesting that although both devices are subject to increasing failure as complexity increases,
one device becomes ever-more likely than the other to fail when applied in settings with ever-higher TLR risk.
In other words, composite medical devices with a wide range of
structural,
geometric, and
pharmacological differences
can be shown to produce different clinical effects
as the environments in which they are tested become increasingly complex.
What the Individual Trials Cannot Tell Us
The progressive difference between the performances of the 2 FDA-approved drug-eluting stents as they are pushed into
more complex settings is precisely what one would anticipate from medical devices with different performance signatures.
Most randomized trials, even if they include high complexity, are unable to identify predictors of failure because of the low numbers of patients enrolled, and the problem gets worse as the number of subsets increase. Consequently, device development, and clinical practice, knowing which patient or lesion characteristics confer higher failure rates is critical.
This analysis has centered on restenosis. Other failure modes to be considered are
stent thrombosis,
postprocedural myonecrosis
late plaque rupture
vascular disease away from the site
heightened inflammatory reaction
are no less critical and may be determined by
completely different device or patient characteristics.
Well-executed registry or pooled data
It is in this light that the registry report of Kastrati et al. in the current issue of Circulation is of greatest value. There are
two ways in which well-executed registry or pooled data can be most complementary to randomized trials.
First, large numbers of patients provide a higher incidence of rare failure modes as well as allow more granular determination of lesion- or patient-specific predictors of failure (meta-analysis or better, combined data file). A pooled analysis of several head-to-head randomized bare metal stent trials allowed identification of clear risk factors for stent thrombosis that had eluded analysis of the individual (smaller) trials.
Second, registry or pooled data may incorporate a broader range of patient characteristics, allowing greater discrimination between devices. The report of Kastrati et al may fall into this category as well, as it includes “high risk” populations from several randomized trials. They report on more than 2000 lesions in 1845 patients treated with either Taxus or Cypher drug-eluting stents at two hospitals. The study population is from a series of randomized trials comparing Taxus and Cypher stents. Using multivariate analysis to identify what lesion and patient characteristics predict failure (restenosis), they identified risk factors that included
prior history of coronary bypass surgery
calcification
smaller vessel size
greater degree of prestent and poststent stenosis.
Use of a Cypher rather than Taxus stent was independently associated with lower restenosis risk.
An interesting negative finding was the absence of diabetes as a significant predictor, at odds with strong suggestions from several other analyses. A better understanding from preclinical or clinical studies of the effect of diabetic states on restenosis is critical.
Author’s opinion voiced:
This Author (LHB), considers the study underpowered to answer that question because of further partitioning with several variables. Pooled data with
rigorous ascertainment and
careful statistical methodology, taken
together with randomized trial data, open a door to device choice based on the knowledge that risk of failure (complexity) does vary, and
the higher the complexity, the greater the incremental benefit of choosing one device over another.
A decision algorithm is therefore possible, whereby multiple failure modes and risk factors are weighed, and
an optimum stent choice made which balances
safety and efficacy based on the totality of evidence, rather than anecdote and loose comparisons of disparate subgroups from individual trials.
Evaluating Clinical Trials
The subject of trial(s) is difficult… the aim and meaning of all the trials… is
to let people know what they ought to do or what they must believe
It was perhaps naïve to imagine that devices as different one from another as the two current FDA-approved drug-eluting
stents would produce identical clinical results. If so, it ought not to come as a surprise that head-to-head randomized trial
data from many different countries in complex settings are now indicating just how differently the 2 devices may perform.
Future trials should be designed and evaluated to examine why these differences exist. Trials residing
only in previous safety and complexity domains
are unlikely to offer deeper insights into
device performance,
patient care decisions, or
discrimination of alternative therapies.
We look forward to more trials that will examine what we currently believe to be the limits of
drug-eluting stents and interventional cardiology and to
help define in simple terms differences
between complex devices applied to complex problems.
This 2009 article was an excellent demonstration of comparing two commonly used coated-stents, and then extending the argument to the need for more data to further delineated the factors that explain the differences they found. In the previous article, the SECOND in the three article series, Stents and Drug Delivery
Local drug delivery from endovascular stents has transformed how we treat coronary artery disease. Yet, few drugs are in fact effective when delivered from endovascular implants and those that possess a narrow therapeutic window. The width of this window is predicated to a great degree upon the extent of drug deposition and distribution through the arterial wall.
Drugs that are retained within the blood vessel are far more effective than those that are not.
Thus, for example, heparin regulates virtually every aspect of the vascular response to injury, but it is so soluble and diffusible that it simply cannot stay in the artery for more than minutes after release.
Heparin has no effect on intimal hyperplasia when eluted from a stent.
Paclitaxel and sirolimus in contradistinction are far smaller compounds with perhaps more narrow and specific effects than heparin.
These drugs bind tenaciously to tissue protein elements and specific intracellular targets and remain beneath stent struts long after release.
The clinical efficacy of paclitaxel and sirolimus at reducing coronary artery restenosis rates following elution from stents appears incontrovertible. Emerging clinical and preclinical data suggest that the benefit of the local release of these drugs is beset by significant complications, that rise with lesion complexityas
the native composition and layered ultrastructure of the native artery is more significantly disrupted.
Virmani and others have hypothesized that the attraction of lipophilic drugs like paclitaxel and sirolimus to fat should affect their retention within and effects upon atheromatous lesions.
Though stents are deployed in diseased arteries drug distribution has only been quantified in intact, non-diseased vessels.
Authors @ MIT, correlated steady-state arterial drug distribution with tissue ultrastructure and composition in abdominal aortae from atherosclerotic human autopsy specimens and rabbits
with lesions induced by dietary manipulation and controlled injury.
Drug and compositional metrics were quantified and correlated at a compartmental level, in each of the tunica layers, or at an intra-compartmental level. All images were processed to
eliminate backgrounds and artifacts, and
pixel values between thresholds were extracted for all zones of interest.
Specific algorithms analyzed each of the histo/immuno-stained arterial structures. Intra-compartmental analyses were
performed by sub-dividing arterial cross-sections into 2–64 equal sectors and
evaluating the pixel-average luminosity for each sector.
Linear regression of drug versus compositional luminosities asymptotically approached steady state after subdivision into 16 sectors. This system controlled delivered dose and removed the significant unpredictability in release that is imposed by variability
in stent position relative to the arterial wall,
inflation techniques and stent geometry.
As steady state tissue distribution results were obtained under constant source conditions, without washout by flowing blood,
they constitute upper bounds for arterial drug distribution
following transient modes of in vivo drug delivery wherein
only a fraction of the eluted dose is absorbed by the artery
Paclitaxel, everolimus, and sirolimus deposition in human aortae was maximal in the media and scaled inversely with lipid content.
Net tissue paclitaxel and everolimus levels were indistinguishable in mildly injured rabbit arteries independent of diet. Yet, serial sectioning of cryopreserved arterial segments demonstrated
a differential transmural deposition pattern that was amplified with disease and
correlated with expression of their intracellular targets, tubulin and FKBP-12.
Tubulin distribution and paclitaxel binding increased with
vascular injury and macrophage infiltration, and
were reduced with (reduced) lipid content.
Sirolimus analogues and their specific binding target FKBP-12 were less sensitive to alterations of diet
in mildly injured arteries, presumably reflecting a faster transient response of FKBP-12 to injury.
The idea that drug deposition after balloon inflation and stent implantation within diseased, atheromatous and sclerotic vessels tracks so precisely with specific tissue elements is
an important consideration of drug-eluting technologies and
may well require that we consider diseased rather than naïve tissues in preclinical evaluations.
Another publication in the same year reveals the immense analytical power used in understanding the complexities
of drug-eluting stents.
Luminal Flow Amplifies Stent-Based Drug Deposition in Arterial Bifurcations
Treatment of arterial bifurcation lesions using drug-eluting stents (DES) is now common clinical practice.
Arterial drug distribution patterns become challenging to analyze if the lesion involves more than a vessel
such as in the case of bifurcations. As use extends to nonstraightforward lesions and complex geometries,
questions abound
regarding DES longevity and safety
Indeed, there is no consensus on best stent placement scenario, no understanding as to
whether DES will behave in bifurcations as they do in straight segments, and
whether drug from a main-branch (MB) stent can be deposited within a side-branch (SB).
It is not evident how to
efficiently determine the efficacy of local drug delivery and
quantify zones of excessive drug that are
harbingers of vascular toxicity and thrombosis,
and areas of depletion that are associated
with tissue overgrowth and
luminal re-narrowing.
Geometry modeling and governing equations
Authors @MIT constructed two-phase computational models of stent-deployed arterial bifurcations
simulating blood flow and drug transport to investigate the
factors modulating drug distribution when the main-branch (MB) was treated using a DES.
The framework for constructing physiologically realistic three dimensional computational models of single and bifurcated arterial vessels was SolidWorks (Dassault Systemes) (Figs. 1A–1B, Movie S1). The geometry generation algorithm allowed for controlled alteration of several parameters including
stent location
strut dimensions
stent-cell shape
lumen diameter to arterial tissue thickness ratio
lengths of the arterial branches
extent of stent apposition and
the bifurcation angle.
For the current study, equal lengths (2LS) were assumed for the proximal and distal sections of the MB from the bifurcation. The SB was constructed at an angle of 300. The inlet conditions were based on
mean blood flow and
diameter measurements
obtained from human left anterior descending coronary artery (LAD).
The diameter of the lumen (DMB) and thickness (TMB) for the MB were defined such that DMB=TMB~10 and
this ratio was also maintained for the SB.
Schematics of the computational models used for the study. A stent of length LS is placed at the upstream section of the arterial vessel in the (A) absence and in the (B) presence of a bifurcation, respectively.
A delta wing-shaped cell design belonging to the class of slotted-tube stents was used for all simulations.
The length (LS) and diameter (DS) were
fixed at 9|10-2 m and 3|10-2 m, respectively, for the MB stent.
All stents were assumed to be perfectly apposed to the lumen of MB and the intrinsic strut shape was modeled as
square with length 10-4 m.
The continuity and momentum equations were solved within the arterial lumen, where
vf , rho~1060 kg=m3, P and m are
velocity
density
pressure and the
viscosity of blood.
In order to capture boundary layer effects at the lumen-wall (or mural) surface, a Carreau model was employed for
all the simulations to account for shear thinning behavior of blood at low shear rates
In the arterial lumen, drug transport followed advection-diffusion process. Similar to the momentum transport in the arterial lumen, the continuity equation was solved within the arterial wall by assuming it as a porous medium.
A finite volume solver (Fluent, ANSYS Inc.) was utilized to perform the coupled flow and drug transport simulations. The semi-implicit method for pressure-linked equations-consistent (SIMPLEC) algorithm was used with second order spatial accuracy. A second order discretization scheme was used to solve the pressure equation and second order upwind schemes were used for the momentum and concentration variables.
Simulations for each case were performed
for at least 2500 iterations or
until there was a 1028 reduction in the mass transport residual.
Drug distribution in non-bifurcating vessels
Constant flow simulations generate local recirculation zones juxtaposed to the stent which in turn act as
secondary sources of drug deposition and
induce an asymmetric tissue drug distribution profile in the longitudinal flow direction.
Our3D computational model predicts a far more extensive fluid mechanic effect on drug deposition than previously appreciated in two-dimensional (2D) domains.
Within the stented region, drug deposition on the mural interface quantified as
the area-weighted average drug concentration (AWAC)
in the distal segment of the stent is 12% higher than the proximal segment
Total drug uptake in the arterial wall denote as volume-weighted average concentration (VWAC) is highest in the middle segment of the stent and 5% higher than the proximal stent region
Increased mural drug deposition along the flow direction in a non-bifurcating arterial vessel.
Inset shows a high magnification image of drug pattern in the distal stent segment outlined by black dashed line.
The entire stent is divided into three equal sections denoted as proximal, middle and distal sections, respectively
and the same notation is followed for subsequent analyses.
These observations indicate that the flow-mediated effect induced by the presence of the stent in the artery
is maximal on the mural surface and
increases in the longitudinal flow direction.
Further, these results suggest that transmural diffusion-mediated transport sequesters drug from both
the proximal and distal portions of the stent
into the central segment of the arterial wall beneath the stent.
Predicted levels of average drug concentration varied exponentially
with linear increments of inlet flow rate
but maintained similar relationship between the inter-segment concentration levels within the stented region.
Stent position influences drug distribution in bifurcated beds
The location of the stent directly modulates
the extent to which drug is deposited on the arterial wall as well as
spatial gradients that are established in arterial drug distribution.
Similar to the non-bifurcating vessel case,
peaks in drug deposition occur directly beneath the stent struts regardless of the relative location of the SB with respect to the stent. However,
drug distribution and corresponding spatial heterogeneitywithin inter-strut regions depend on the stent location with respect to the flow divider.
Mural drug deposition is a function of relative stent position with respect to the side-branch and Reynolds number in arterial bifurcations.
Impact of flow on drug distribution in bifurcations
One can appreciate how blood flow and flow dividers affect arterial drug deposition, and especially on inter-strut drug deposition.
Drug deposition within the stented-region of MB and the entire SB significantly decreases with flow acceleration regardless of stent placement.
Simulations predicted
Local endovascular drug delivery was long assumed to be governed by diffusion alone. The impact of flow was
thought to be restricted to systemic dilution.
2D computational models suggested a complex interplay between the stent and blood flow
extensive flow-mediated drug delivery in bifurcated vascular beds where the drug distribution patterns are heterogeneous and sensitive to relative stent position and luminal flow.
A single DES in the MB coupled with large retrograde luminal flow on the lateral wall of the side-branch (SB) can provide drug deposition on the SB lumen-wall interface, except
when the MB stent is downstream of the SB flow divider.
the presence of the SB affects drug distribution in the stented MB.
Fluid mechanic effects play an even greater role than in the SB
especially when the DES is across and downstream to the flow divider
and in a manner dependent upon
the Reynolds number.
Summary
We presented the hemodynamic effects on drug distribution patterns using a
simplified uniform-cell stent design, though our methodology is adaptable to
several types of stents with variable design features.
Variability in arterial drug distribution due to other geometric and morphologic aspects such as
bifurcation angle, arterial taper as well as presence of a trifurcation can also be understood using our computational framework.
Further, performance of a candidate DES using other commonly used stenting procedures for bifurcation lesions such as culotte and crush techniques can be quantified based on their resulting drug distribution patterns.
Other Related Articles that were published on this Open Access Online Scientific Journal include the following:
Hypertriglyceridemia concurrent Hyperlipidemia: Vertical Density Gradient Ultracentrifugation a Better Test to Prevent Undertreatment of High-Risk Cardiac Patients
Fight against Atherosclerotic Cardiovascular Disease: A Biologics not a Small Molecule – Recombinant Human lecithin-cholesterol acyltransferase (rhLCAT) attracted AstraZeneca to acquire AlphaCore
High-Density Lipoprotein (HDL): An Independent Predictor of Endothelial Function & Atherosclerosis, A Modulator, An Agonist, A Biomarker for Cardiovascular Risk
Peroxisome proliferator-activated receptor (PPAR-gamma) Receptors Activation: PPARγ transrepression for Angiogenesis in Cardiovascular Disease and PPARγ transactivation for Treatment of Diabetes
Clinical Trials Results for Endothelin System: Pathophysiological role in Chronic Heart Failure, Acute Coronary Syndromes and MI – Marker of Disease Severity or Genetic Determination?
Inhibition of ET-1, ETA and ETA-ETB, Induction of NO production, stimulation of eNOS and Treatment Regime with PPAR-gamma agonists (TZD): cEPCs Endogenous Augmentation for Cardiovascular Risk Reduction – A Bibliography
Positioning a Therapeutic Concept for Endogenous Augmentation of cEPCs — Therapeutic Indications for Macrovascular Disease: Coronary, Cerebrovascular and Peripheral
Cardiovascular Outcomes: Function of circulating Endothelial Progenitor Cells (cEPCs): Exploring Pharmaco-therapy targeted at Endogenous Augmentation of cEPCs
Vascular Medicine and Biology: CLASSIFICATION OF FAST ACTING THERAPY FOR PATIENTS AT HIGH RISK FOR MACROVASCULAR EVENTS Macrovascular Disease – Therapeutic Potential of cEPCs
Cardiac Surgery Theatre in China vs. in the US: Cardiac Repair Procedures, Medical Devices in Use, Technology in Hospitals, Surgeons’ Training and Cardiac Disease Severity”
Dilated Cardiomyopathy: Decisions on implantable cardioverter-defibrillators (ICDs) using left ventricular ejection fraction (LVEF) and Midwall Fibrosis: Decisions on Replacement using late gadolinium enhancement cardiovascular MR (LGE-CMR)
Competition in the Ecosystem of Medical Devices in Cardiac and Vascular Repair: Heart Valves, Stents, Catheterization Tools and Kits for Open Heart and Minimally Invasive Surgery (MIS)
Global Supplier Strategy for Market Penetration & Partnership Options (Niche Suppliers vs. National Leaders) in the Massachusetts Cardiology & Vascular Surgery Tools and Devices Market for Cardiac Operating Rooms and Angioplasty Suites
English: Cardiovascular disease: PAD therapy with stenting Deutsch: PAVK Therapie: Kathetertherapie mit stenting (Photo credit: Wikipedia)
Endoscopic image of self-expanding metallic stent in esophagus. Photograph released into public domain on permission of patient. — Samir धर्म 07:38, 2 June 2006 (UTC) (Photo credit: Wikipedia)
This is the second article of a three part series recognizing the immense contribution of Elazer Edelman, MD, PhD, and his laboratory group at MIT to vascular biology, cardiovascular disease studies, and the bioengineering, development, and use of stenting technology for drug delivery, vascular repair, and limitation of vessel damage caused by stent placement.
The first article, published on this Open Access Online Scientific Journal
was concerned with vascular biology, and largely on both the impact of drug delivery design and placement on the endothelium of the vessel wall, and on the kinetics of drug delivery based on the location of stent placement versus intravascular injection as well as the metabolic events taking place in the arterial endothelium, intima, and muscularis.
This second article, is concerned with stents and drug delivery as it has evolved since the last decade of the 20th century based on biomaterials development and vascular biology principles to minimize inherent injury risk over this period.
The third. will be concerned with the lessons from biomaterials and stent mechanics going forward.
Heart care is in the midst of a transformation. Patients who once required heart surgery are treated with a stent, catheters for repair of valves, rhythm abnormalities, and a growing number of heart or vascular distrbances.
The catheters are threaded in through the femoral artery, and sometimes through the radial artery. The American College of Cardiology annual meeting highlights research on these devices. The procedure allows patients to leave the hospital after a day or two post-implant, but the initial cost of the novel devices is high. Not everyone qualifies for the treatment, and it will take a few years to compare the long term results with the benefits from surgery. But these procedures have allowed many patients treatment alternatives to surgery, and they offer an option for people who cannot be successfully managed by conservative medical therapy.
The effects of stent placement on vascular injury and the initiation of an inflammatory response
Leukocytes are recruited early and abundantly to experimentally injured vessels,
in direct proportion to cell proliferation and intimal growth.
Activated circulating leukocytes and Mac-1 (CD11 by CD18, aMb2) (monocytic) expression are
markers of restenosis risk in patients undergoing angioplasty.
Angioplastied vessels lack endothelium but have extensive fibrin(ogen) and platelet deposition. Consequently, Mac-1-dependent adhesion to fibrin(ogen) would be expected to
signal leukocyte recruitment and function, thereby
promote intimal growth
In this study
M1/70, an anti-CD11b blocking mAb, was administered to rabbits before, and every 48 hr for 3, 6, or 14 days after iliac artery balloon denudation.
M1/70 was bound to isolated rabbit monocytes.
The result was
Mac-1-mediated dose-dependent
inhibition of fibrinogen binding in vitro, thereby,
reducing by half leukocyte recruitment at 3, 6, and 14 days after injury.
Neointimal growth 14 days after injury was markedly attenuated by treatment with M1/70 –
intimal area after balloon injury, 0.12+0.09 mm2, compared with
0.32+0.08 mm2 in vehicle treated controls, P<0.01, and
intimal area after stent injury, 0.56+0.16 mm2, compared with
0.84+ 0.13 mm2 in vehicle-treated controls, P <0.05, and
0.90+0.15 mm2 in IgG-treated controls, P <0.02).
Mac-1 blockade reduces experimental neointimal thickening. These findings suggest that
leukocyte recruitment to and
infiltration of injured arteries
may be a valid target for preventing intimal hyperplasia. (1) Emerging data indicate that the inflammatory response after mechanical arterial injury
correlates with the severity of neointimal hyperplasia in animal models
and post angioplasty restenosis in humans.
The present study was designed to examine whether a nonspecific
stimulation of the innate immune system,
induced in close temporal proximity to the vascular injury,
would modulate the results of the procedure.
A LPS dose was chosen to be sufficient to induce systemic inflammation but not septic shock. Key markers of inflammation increased after LPS administration were:
serum interleukin-1 levels, and
monocytic stimulation (CD14 levels on monocytes)
Arterial macrophage infiltration at 7 days after injury was
1.7+1.2% of total cells in controls and
4.2+1.8% in LPS-treated rabbits (n=4, P<0.05).
The injured arteries 4 weeks after injury had significantly increased
luminal stenosis: 38+4.2% versus 23+2.6%, mean+SEM; n=8, P<0.05; and
neointima-to-media ratio: 1.26+0.21 versus 0.66+0.09, P<0.05 in LPS-treated animals compared with controls.
This effect was abolished by anti-CD14 Ab administration. Serum Il-1 levels and monocyte CD14 expression were significantly increased
in correlation with the severity of intimal hyperplasia.
LPS treatment increased neointimal area after stenting
from 0.57+0.07 to 0.77+0.1 mm2, and
stenosis from 9+1% to 13+1.7% (n=5, P<0.05).
Nonspecific systemic stimulation of the innate immune system
concurrently with arterial vascular injury
facilitates neointimal formation, and conditions associated with
increased inflammation may increase restenosis.(2)
The efficacy and toxicity of these local therapeutics depend upon
arterial drug deposition,
distribution, and
retention.
To examine how administered dose and drug release kinetics control arterial drug uptake, a model was created using principles of
computational fluid dynamics and
transient drug diffusion–convection.
The modeling predictions for drug elution were validated using
empiric data from stented porcine coronary arteries.
Inefficient, minimal arterial drug deposition was predicted when a bolus of drug was released and depleted within seconds.
Month-long stent-based drug release
efficiently delivered nearly continuous drug levels, but
the slow rate of drug presentation limited arterial drug uptake.
Uptake was only maximized when
the rates of drug release and absorption matched,
which occurred for hour-long drug release.
Of the two possible means for increasing the amount of drug on the stent,
modulation of drug concentration potently impacts
the magnitude of arterial drug deposition,
while changes in coating drug mass affect duration of release.
We demonstrate the importance of drug release kinetics and administered drug dose
in governing arterial drug uptake and suggest
novel drug delivery strategies for controlling spatio-temporal arterial drug distribution.(3)
Arterial drug concentrations determine local toxicity. Therefore, the emergent safety concerns surrounding drug-eluting stents mandate an investigation of the factors contributing to fluctuations in arterial drug uptake.
Drug-eluting stents were implanted into porcine coronary arteries, arterial drug uptake was followed and modeled using 2-dimensional computational drug transport.
Arterial drug uptake in vivo occurred faster than predicted by free drug diffusion, thus
an alternate, mechanism for rapid transport has been proposed involving carrier-mediated transport.
Though there was minimal variation in vivo in release kinetics from stent to stent,
arterial drug deposition varied by up to 114% two weeks after stent implantation.
extent of adherent mural thrombus fluctuated by 113% within 3 days.
The computational drug transport model predicted that focal and diffuse thrombi
elevate arterial drug deposition in proportion to the thrombus size
by reducing drug washout subsequently increasing local drug availability.
Variable peristrut thrombus can explain fluctuations in arterial drug uptake even in the face of a narrow range of drug release from the stent. The mural thrombus effects on arterial drug deposition may be circumvented by forcing slow rate limiting arterial transport, that cannot be further hindered by mural thrombus. (4)
1. A mAb to the b2-leukocyte integrin Mac-1 (CD11byCD18) Reduces Intimal Thickening after Angioplasty or Stent Implantation in Rabbits. C Rogers, ER Edelman, and DI Simon. PNAS Aug 1998; 95: 10134–10139.
2. Formation After Balloon and Stent Injury in Rabbits Systemic Inflammation Induced by Lipopolysaccharide increases Neointimal Formation After Balloon and Stent Injury in Rabbits. HD Danenberg, FGP Welt, M Walker, III, P Seifert, et al. Circulation 2002;105;2917-2922; http://dx.doi.org/10.1161/01.CIR.0000018168.15904.BB
3. Intravascular drug release kinetics dictate arterial drug deposition, retention, and distribution.
4. Thrombus causes fluctuations in arterial drug delivery from intravascular stents. B Balakrishnan, J Dooley, G Kopia, ER Edelman. J Control Release 2008. http://dx.doi.org/10.1016/j.jconrel.2008.07.027
Perivascular Graft Repair
Heparin remains the gold-standard inhibitor of the processes involved in the vascular response to injury. Though this compound has profound and wide-reaching effects on vascular cells, its clinical utility is unclear. It is clear that the mode of heparin delivery is critical to its potential and it may well be that
routine forms of administration are insufficient
to observe benefit given the heparin’s short half-life and complex pharmacokinetics.
When ingested orally, heparin is degraded to inactive oligomer fragments while systemic administration
is complicated by the need for continuous infusion
and the potential for uncontrolled hemorrhage.
Thus alternative heparin delivery systems have been proposed to maximize regional effects while limiting systemic toxicity. Yet, as heparin is such a potent antithrombotic compound and since existing local delivery systems lack the ability to
precisely regulate release kinetics,
even site-specific therapy is prone to bleeding.
Authors now describe the design and development of a novel biodegradable system for the perivascular delivery of heparin to the blood vessel wall with well-defined release kinetics.
This system consists of heparin-encapsulated
poly(DL lactide-co-glycolide) (pLGA) microspheres sequestered in an alginate gel.
Controlled release of heparin from this heterogeneous system is obtained for a period of 25 days.
The experimental variables affecting heparin release from these matrices were investigated by
gel permeation chromatography (GPC) and scanning electron microscopy (SEM)
to monitor the degradation process and correlated well with the release kinetics.
Heparin-releasing gels inhibited growth in tissue culture of
bovine vascular smooth muscle cells in a dose-dependent manner.
and also controlled vascular injury in denuding and
interposition vascular graft animal models of disease even when uncontrolled bleeding was evident with standard matrix-type release.
This system provided an effective means of examining
the effects of various compounds in
the control of smooth muscle cell proliferation in accelerated arteriopathies and also
shed light on the biologic nature of these processes.(1)
Soft tissue adhesives are employed to repair and seal many different organs that range in both
tissue surface chemistry and
mechanical effects during organ function.
This complexity motivates the development of tunable adhesive materials with
high resistance to uniaxial or multiaxial loads
dictated by a specific organ environment.
Co-polymeric hydrogels comprising
aminated star polyethylene glycol and
dextran aldehyde (PEG:dextran)
are materials exhibiting physico-chemical properties that can be modified
Here we report that resistance to failure
under specific loading conditions, as well as
tissue response at the adhesive material–tissue interface, can be modulated through regulation of
the number and density of adhesive aldehyde groups.
Author found that atomic force microscopy (AFM) can
characterize the material aldehyde density available for tissue interaction,
facilitating rapid, informed material choice.
Further, the correlation between AFM quantification of nanoscale unbinding forces
with macroscale measurements of adhesion strength
by uniaxial tension or multiaxial burst pressure allows the design of materials with specific cohesion and adhesion strengths.
However, failure strength alone does not predict optimal in vivo reactivity. The development of adhesive materials is significantly enabled when
experiments are integrated along length scales to consider
organ chemistry and mechanical loading states concurrently
with adhesive material properties and tissue response. (2)
Cell culture and animal data support the role of endothelial cells and endothelial-based compounds in regulating vascular repair after injury.
Authors describe a long-term study in pigs in which the biological and immunological
responses to endothelial cell implants were investigated 3 months after angioplasty,
approximately 2 months after the implants have degraded.
Confluent porcine or bovine endothelial cells grown in polymer matrices were implanted adjacent to 28 injured porcine carotid arteries.
Porcine and bovine endothelial cell implants significantly
reduced experimental restenosis compared to control by 56 and 31%, respectively.
Host humoral responses were investigated by detection of an increase in serum antibodies that bind to the bovine or porcine cell strains used for implantation.
A significant increase in titer of circulating antibodies to the bovine cells was observed
after 4 days in all animals implanted with xenogeneic cells.
Detected antibodies returned to presurgery levels after Day 40.
No significant increase in titer of antibodies to the porcine cells was observed during the experiment in animals implanted with porcine endothelial cells.
No implanted cells, Gelfoam, or focal inflammatory reaction could be detected
histologically at any of the implant sites at 90 days.
Suggesting that tissue engineered endothelial cell implants
may provide long term control of vascular repair after injury,
rather than simply delaying lesion formation and that
allogeneic implants are able to provide a greater benefit than xenogeneic implants. (3)
Vascular access complications are a major problem in hemodialysis patients. Native arteriovenous fistulae, historically the preferred mode of access, have a patency rate of only 60% at 1 year.
The most common mode of failure is due to progressive stenosis at the anastomotic site.
Authors have previously demonstrated that perivascular endothelial cell implants
inhibit intimal thickening following acute balloon injury in pigs, and now seek to determine if these
implants provide a similar benefit in the chronic and more complex injury model of arteriovenous anastomoses.
Side-to-side femoral artery-femoral vein anastomoses were created in 24 domestic swine.
toxicological,
biological and
immunological responses
were investigated 3 days and 1 and 2 months postoperatively to allogeneic endothelial cellimplants . The anastomoses were wrapped with polymer matrices containing
confluent porcine aortic endothelial cells (PAE; n = 14) or
control matrices without cells (n = 10).
PAE implants significantly reduced intimal hyperplasia at the anastomotic sites
compared to controls by 68% (p ! 0.05) at 2 months.
The beneficial effects of the PAE implants were not due to
differences in the rates of reendothelialization between the groups.
No significant immunological response to the allogeneic endothelial cells that impacted on efficacy was detected in any of the pigs.
No apparent toxicity was observed in any of the animals treated with endothelial implants.
These data suggest that perivascular endothelial cell implants
are safe and reduce early intimal hyperplasia in a porcine model of arteriovenous anastomoses. (4)
1. Perivascular graft heparin delivery using biodegradable polymer wraps. ER Edelman, A Nathan,
3. Endothelial Implants Provide Long-Term Control of Vascular Repair in a Porcine Model of Arterial Injury. HM Nugent, ER Edelman. J Surg Res 2001; 99:228–234. http://dx.doi.org/10.1006/jsre.2001.6198
4. Perivascular Endothelial Implants Inhibit Intimal Hyperplasia in a Model of Arteriovenous Fistulae: A Safety and Efficacy Study in the Pig. HM Nugent, A Groothuis, P Seifert, et al. J Vasc Res 2002;39:524–533.
Endovascular stents reside in a dynamic flow environment and yet the impact of flow
on arterial drug deposition after stent-based delivery is only now emerging.
Authors employed computational fluid dynamic modeling tools to investigate
the influence of luminal flow patterns on arterial drug deposition and distribution.
Flow imposes recirculation zones distal and proximal to the stent strut that extend
the coverage of tissue absorption of eluted drug and
induce asymmetry in tissue drug distribution.
Our analysis now explains how the disparity in
sizes of the two recirculation zones and
the asymmetry in drug distribution are determined by a complex interplay of local flow and strut geometry.
When temporal periodicity was introduced as a model of
pulsatile flow,
the net luminal flow served as an index of flow-mediated spatiotemporal tissue drug uptake.
Dynamically changing luminal flow patterns are intrinsic to the coronary arterial tree. Coronary drug-eluting stents should be appropriately considered where
luminal flow,
strut design and
pulsatility
have direct effects on tissue drug uptake after local delivery.(1)
The efficacy of drug-eluting stents (DES) requires delivery of potent compounds directly to the underlying arterial tissue.
The commercially available DES drugs rapamycin and paclitaxel bind specifically to
their respective therapeutic targets, FKBP12 and polymerized microtubules,
while also associating in a more general manner with other tissue elements.
As it is binding that provides biological effect, the question arises as to whether other
locally released or systemically circulating drugs can
displace DES drugs from their tissue binding domains.
Specific and general binding sites for both drugs are distributed across the media and adventitia with higher specific binding associated with the binding site densities in the media.
The ability of rapamycin and paclitaxel to compete for specific protein binding and general tissue deposition
was assessed for both compounds simultaneously and
in the presence of other commonly administered cardiac drugs.
Drugs classically used to treat standard cardiovascular diseases, such as hypertension and hypercoaguability,
displace rapamycin and paclitaxel from general binding sites, possibly
decreasing tissue reserve capacity for locally delivered drugs.
Paclitaxel and rapamycin do not affect the other’s binding
to their biologically relevant specific protein targets, but
can displace each other from tissue at three log order molar excess,
decreasing arterial loads by greater than 50%.
Local competitive binding therefore should not limit the placement of rapamycin and paclitaxel eluting stents in close proximity.(2)
Stent thrombosis is a lethal complication of endovascular intervention. There is concern about the inherent risk associated with specific stent designs and drug-eluting coatings
Authored examined whether drug-eluting coatings are inherently thrombogenic and whether the response to these materials was determined to any degree
by stent design and
stent deployment with custom-built stents.
Drug/polymer coatings uniformly reduce rather than increase thrombogenicity relative to matched bare metal counterparts (0.65-fold; P 0.011).
Thick-strutted (162 m) stents were 1.5-fold more thrombogenic than otherwise
identical thin-strutted (81 m) devices in ex vivo flow loops (P< 0.001),
commensurate with 1.6-fold greater thrombus coverage
3 days after implantation in porcine coronary arteries (P 0.004).
When bare metal stents were deployed in
malapposed or overlapping configurations, thrombogenicity increased compared with apposed, length-matched controls (1.58-fold, P < 0.001; and 2.32-fold, P <0.001).
The thrombogenicity of polymer-coated stents with thin struts was
lowest in all configurations and remained insensitive to incomplete deployment.
Computational modeling– based
predictions of stent-induced flow derangements
correlated with spatial distribution of formed clots.
Drug/polymer coatings do not inherently increase acute stent clotting;
they reducethrombosis.
However, strut dimensions and positioning relative to the vessel wall
are critical factors in modulating stent thrombogenicity.
Optimal stent geometries and surfaces, as demonstrated with thin stent struts,
help reduce the potential for thrombosis
despite complex stent configurations and variability in deployment. (Circulation. 2011;123:1400-1409.) (3)
1. Luminal flow patterns dictate arterial drug deposition in stent-based delivery.
VB Kolachalama, AR Tzafriri, DY Arifin, ER Edelman. J Control Release 2009; 133:24–30.
Multiple studies have shown that diabetes mellitus (DM) can affect the
efficacy of revascularization therapies and subsequent clinical outcomes.
Selecting the appropriate myocardial revascularization strategy is critically important
in the setting of multivessel coronary disease.
Optimal medical therapy is an appropriate first-line strategy in patients with DM and mild symptoms. When medical therapy does not adequately control symptoms,
revascularization with either PCI or CABG may be used.
In patients with treated DM, moderate to severe symptoms and complex multivessel coronary disease,
coronary artery bypass graft surgery provides better survival,
fewer recurrent infarctions and
greater freedom from re-intervention.
Decisions regarding revascularization in patients with DM must take into account multiple factors and as such require a multidisciplinary team approach (‘heart team’). (1)
An incomplete understanding of the transport forces and local tissue structures
that modulate drug distribution has hampered
local pharmacotherapies in many organ systems.
These issues are especially relevant to arteries, where stent-based delivery allows fine control of locally directed drug release.
Local delivery produces tremendous drug concentration gradients
these are in part derived from transport forces,
differences in deposition from tissue to tissue
This suggests that tissue ultrastructure also plays an important role.
Authors measured the equilibrium drug uptake and the penetration and diffusivity of
dextrans (a model hydrophilic drug similar to heparin) and albumin
in orthogonal planes in arteries explanted from different vascular beds.
Authors found significant variations in drug distribution with
geometric orientation and
arterial connective tissue content.
Drug diffusivities parallel to the connective tissue sheaths were
one to two orders of magnitude greater than across these sheaths.
This diffusivity difference remained relatively constant for drugs up to 70 kDa
before decreasing for larger drugs.
Drugs also distributed better into elastic arteries, especially at lower molecular weights,
with almost 66% greater transfer into the thoracic aorta
than into the carotid artery.
Arterial drug transport is thus highly anisotropic and
dependent on arterial tissue content.
The role of the local composition and geometric organization of arterial tissue
in influencing vascular pharmacokinetics
is likely to become a critical consideration for local vascular drug delivery (2)
Radiolabeled drug-eluting stents have been proposed
to potentially reduce restenosis in coronary arteries.
A P-32 labeled oligonucleotide (ODN) loaded on a polymer coated stent
is slowly released in the arterial wall to deliver a therapeutic dose to the target tissue.
A relatively low proportion of drugs is transferred to the arterial wall (< 2%– 5% typically). This raises questions about the degree to which radiolabeled drugs eluted from the stent
can contribute to the total radiation dose delivered to tissues.
A three-dimensional diffusion-convection transport model is used
to model the transport of a hydrophilic drug released
from the surface of a stent to the arterial media.
Large drug concentration gradients are observed
near the stent struts giving rise to a
non-uniform radiation activity distribution for the drug
in the tissues as a function of time.
A voxel-based kernel convolution method is used to calculate the radiation dose rate
resulting from this activity build-up in the arterial wall
based on the medical internal radiation dose formalism.
Measured residence time for the P-32 ODN in the arterial wall and
at the stent surface obtained from animal studies
are used to normalize the results in terms of absolute dose to tissue.
The results indicate radiation due to drug eluted from the stent
contributes only a small fraction of the total radiation delivered to the arterial wall,
the main contribution comes from the activity embedded in the stent coating.
For hydrophilic compounds with rapid transit times in arterial tissue and minimal binding interactions,
the activity build-up in the arterial wall contributes only a small fraction
to the total dose delivered by the P-32 ODN stent.
For these compounds, it is concluded that radiolabeled drug-eluting stent
would not improve the performance of radioactive stents in treating restenosis.
Also, variability in the efficacy of drug delivery devices
makes accurate dosimetry difficult and
the drug washout in the systemic circulatory system
may yield an unnecessary activity build-up and dose to healthy organs. (3)
The first compounds considered for stent-based delivery,
such as heparin have failed to stop restenosis clinically.
More recent compounds, such as paclitaxel, are of a different sort.
They are hydrophobic, and their effects after local release seem far more profound.
This dichotomy raises the question of whether drugs that have an effect when released from a stent do so because of
differences in biology or differences in physicochemical properties and targeting.
Authored applied continuum pharmacokinetics to examine the effects of
transport forces and device geometry on
the distribution of stent-delivered hydrophilic and hydrophobic drugs.
Stent-based delivery leads to large concentration gradients.
Drug concentrations range from nil to several times the
mean tissue concentration over a few micrometers.
Concentration variations were a function of the Peclet number (Pe),
the ratio of convective to diffusive forces.
Although hydrophobic drugs exhibit greater variability than hydrophilic drugs,
more negatively than hydrophobic drugs, and notably
affect local concentrations without changing mean concentrations.
Local concentrations and gradients are inextricably linked to biological effect. Therefore,
these results provide a potential explanation for the variable success of stent-based delivery.
Authors conclude that mere proximity of delivery devices to tissues
does not ensure adequate targeting,
because physiological transport forces cause
local concentrations to deviate significantly from mean concentrations. (4)
1. Role of CABG in the management of obstructive coronary arterial disease in patients with diabetes mellitus. D Aronson, ER Edelman. Curr Opin Pharmacol 2012, 12:134–141. Issue on Cardiovascular and renal. [Eds: JY Jeremy, K Zacharowski, N Shukla, S Wan]. http://dx.doi.org/10.1016/j.coph.2012.01.011
3. Dose model for stent-based delivery of a radioactive compound for the treatment of restenosis in coronary arteries. C Janickia, Chao-Wei Hwang, ER Edelman. Med Phys 2003; 30(10), 2622-7. http://dx.doi.org/10.1118/1.1607506
4. Physiological Transport Forces Govern Drug Distribution for Stent-Based Delivery. Chao-Wei Hwang, D Wu, ER Edelman. Circulation. 2001;104(5) :600-605; e14 – e9010. http://dx.doi.org/10.1161/hc3101.09221
Stent-Versus-Stent Equivalency Trials. Are Some Stents More Equal Than Others? Elazer R. Edelman, Campbell Rogers Circulation. 1999; 100(9): 896-898; e47 – e47. http://dx.doi.org/10.1161/01.CIR.100.9.896
New endovascular stent designs are displacing tried and-true devices for use in an ever-broader array of lesions. There is disagreement as to which device is most advantageous and whether design determines outcome. Preclinical research says that this should be the case. Clinical trials have failed to validate design dependence. Can the divergent results be reconciled? More than 50 different stent configurations are available. The processes of industrial development and federal regulatory evaluation support the importance of design.
Stents are made from
a spectrum of materials
a range of manufacturing techniques, and have
variable surfaces,
dimensions,
surface coverage, and
strut configurations.
The number of parameters involved may doom the number of subsets to approach the number of designs. Moreover, each device seems to have a unique optimal mode of placement. Differences have been reported in
flexibility,
tracking ability,
expansion,
radiovisibility,
side-branch access, and
resistance to compression and recoil for different devices.
Regulatory approval includes standards for safety:
toxicity,
biocompatibility,
structural and material analysis, and
fatigue testing
It has been suggested that
hoop strength,
surface cracking,
uniformity of expansion, and
other features become standardized as well.
Four different direct comparisons of first-generation Palmaz-Schatz slotted-tube stents and
second-generation stents have been made. In several studies there were no significant differences
in restenosis at follow-up, including
minimal luminal diameter (MLD),
percent diameter stenosis,
late loss, or
binary restenosis rate.
In the fourth study, restenosis was far greater for the Gianturco-Roubin II (GR-II) stent (Cook) than
the Palmaz-Schatz stent (Cordis-Johnson & Johnson).
The data for all stents bunch across trials: with the exception of the GR-II stent,
variability between the test stent groups was no greater than
the variability between the Palmaz-Schatz stent groups in the different trials.
Three distinct possibilities exist to explain the absence of clinical evidence that different designs behave differently:
(1) no differences in clinical outcomes exist between devices;
(2) differences exist but are so slight as to be clinically meaningless; and
(3) differences exist that may be clinically meaningful, but trials performed to date were not designed to detect them.
Schematic representation of device performance plotting outcome against indication indicates that
complication rates rise as lesion complexity increases.
When 2 devices are clinically different, their curves are displaced, and when they are indistinguishable, their curves overlap.
Clinical trials that restrict the test population to lesions low on the complexity scale
ensure safety for all patients but are not the ideal venues in which to detect differences between devices.
Thus, although stents 1 and 2 may have different clinical outcomes, in a restricted-criteria equivalency trial with low complexity, they appear identical. It is only when the test device performs worse than the standard, that differences can be appreciated.
In contrast, an open registry will not only show when a test stent is worse than the standard stent but also when it is better.
Equivalency Trials
Stent-versus-stent trials are equivalency trials, designed to show that a test device performs “as well as” a standard, currently acceptable device. This is a valid regulatory threshold but
not the means to evaluate the full potential of a device.
Equivalency trials must by definition commence with a patient population for whom the standard device is safe. Trials with currently approved devices as the standard necessitate that
patient entry and lesion selection be determined by
limitations of the standard, not the device.
to observe a difference in such a trial
the test device performs worse
For the test device to perform better, both the test and the standard must be challenged.
This was not the case for the trials in which
the average reference vessel size was 3.0+0.05 mm and
American College of Cardiology type B2 and C lesions accounted for only ~65% of lesions.
These lesions are those for which the Palmaz-Schatz stent is approved and technically suited, but
they represent only a minority of those lesions now receiving stents
Complexity, Equivalence, and Better
In truth, it may be most appropriate to think about parameters of device success and safety as a continuum, describing a correlation between events such as
thrombosis or restenosis and
a continuous measure of indication,
vessel dimension, or lesion complexity (Figure).
A given device may be represented by a characteristic response over a range of indications.
When there is a lateral offset to the curves,
differences in potential performance are anticipated.
Curves might even cross, rather than run parallel, indicating that devices might be matched
to lesions and indications. Open trials would consider the entire range of the curves.
equivalency trials are limited to a small region of the curve.
The first-generation stents were a major innovation in interventional cardiology, and their place in medical history and biotechnology is unassailable.
Demonstration that new stents are better than old will require that evaluations be
performed in lesions for which current devices have marginal or limited application.
Complex or acutely unstable lesions, small arteries, and diseased bypass grafts are
the next great challenges of interventional cardiology.
Perhaps in these settings, future stent trials will provide firm evidence that
the manner in which blood vessels are manipulated dictates biological sequelae.
Proof that stent design can alter clinical outcomes may then unleash the potential
to change the way in which we consider design, approval, and use of new devices.
REFERENCES
Menichelli, M. (2006). Sirolimus Stent vs. Bare Stent in Acute Myocardial Infarction Trial. Presented at The European Paris Course on Revascularization (EuroPCR), May 16-19, 2006, Paris, France Paris, France.http://www.medscape.com/viewprogram/5505?rss
Pfisterer, P.E. (2006). Basel Stent Cost-effectiveness Trial-Late Thrombotic events (BASKET LATE) Trial. Presented at American College of Cardiology 55th Annual Scientific Session, March 11 – 14, 2006, Atlanta, Georgia.http://www.medscape.com/viewprogram/5185
Rogers, C. Edelman E.R. (2006). Pushing drug-eluting stents into uncharted territory, Simpler then you think – more complex than you imagine. Circulation,113, 2262-2265.
Shirota, T., Yasui, H., Shimokawa, H. & Matsuda, T. (2003). Fabrication of endothelial progenitor cell (EPC)-seeded intravascular stent devices and in vitro endothelialization on hybrid vascular tissue. Biomaterials 24(13), 2295–2302.
Simonton, C. (2006). The STENT Registry: A real-world look at Sirolimus- and Pacitaxel-Eluting Stents. Cath Lab Digest, 14 (1), 1-10.
Turco, M. (2006). TAXUS ATLAS Trial – 9-Month results: Evaluation of TAXUS Liberte vs. TAXUS Express. Presented at The European Paris Course on Revascularization (EuroPCR), May 16-19, 2006, Paris, France Paris, France.http://www.medscape.com/viewprogram/5505?rss
Hypertriglyceridemia concurrent Hyperlipidemia: Vertical Density Gradient Ultracentrifugation a Better Test to Prevent Undertreatment of High-Risk Cardiac Patients
Fight against Atherosclerotic Cardiovascular Disease: A Biologics not a Small Molecule – Recombinant Human lecithin-cholesterol acyltransferase (rhLCAT) attracted AstraZeneca to acquire AlphaCore
High-Density Lipoprotein (HDL): An Independent Predictor of Endothelial Function & Atherosclerosis, A Modulator, An Agonist, A Biomarker for Cardiovascular Risk
Peroxisome proliferator-activated receptor (PPAR-gamma) Receptors Activation: PPARγ transrepression for Angiogenesis in Cardiovascular Disease and PPARγ transactivation for Treatment of Diabetes
Clinical Trials Results for Endothelin System: Pathophysiological role in Chronic Heart Failure, Acute Coronary Syndromes and MI – Marker of Disease Severity or Genetic Determination?
Inhibition of ET-1, ETA and ETA-ETB, Induction of NO production, stimulation of eNOS and Treatment Regime with PPAR-gamma agonists (TZD): cEPCs Endogenous Augmentation for Cardiovascular Risk Reduction – A Bibliography
Positioning a Therapeutic Concept for Endogenous Augmentation of cEPCs — Therapeutic Indications for Macrovascular Disease: Coronary, Cerebrovascular and Peripheral
Cardiovascular Outcomes: Function of circulating Endothelial Progenitor Cells (cEPCs): Exploring Pharmaco-therapy targeted at Endogenous Augmentation of cEPCs
Vascular Medicine and Biology: CLASSIFICATION OF FAST ACTING THERAPY FOR PATIENTS AT HIGH RISK FOR MACROVASCULAR EVENTS Macrovascular Disease – Therapeutic Potential of cEPCs
Cardiac Surgery Theatre in China vs. in the US: Cardiac Repair Procedures, Medical Devices in Use, Technology in Hospitals, Surgeons’ Training and Cardiac Disease Severity”
Dilated Cardiomyopathy: Decisions on implantable cardioverter-defibrillators (ICDs) using left ventricular ejection fraction (LVEF) and Midwall Fibrosis: Decisions on Replacement using late gadolinium enhancement cardiovascular MR (LGE-CMR)
Competition in the Ecosystem of Medical Devices in Cardiac and Vascular Repair: Heart Valves, Stents, Catheterization Tools and Kits for Open Heart and Minimally Invasive Surgery (MIS)
Global Supplier Strategy for Market Penetration & Partnership Options (Niche Suppliers vs. National Leaders) in the Massachusetts Cardiology & Vascular Surgery Tools and Devices Market for Cardiac Operating Rooms and Angioplasty Suites
Diagram showing the location of vascular smooth muscle cells (Photo credit: Wikipedia)
English: simplified diagram of the human Arterial system in anterior view. Français : Diagramme simplifié du système artériel humain en vue antérieure (en anglais). (Photo credit: Wikipedia)
Tricuspid Valve Reconstruction for Infective Endocarditis: Operative Highlights (Video)
There are no easy solutions for acute infective tricuspid valve endocarditis in IV drug users, as the risk of prosthetic endocarditis in this population is high. Complete valve resection without replacement is feasible but leads to progressive right-sided heart failure. Reconstruction of the tricuspid valve with autologous pericardium is an alternative option, as demonstrated in the video case study below.
A 29-year-old female drug abuser with fever, hemoptysis and MRSA bacteremia was started on IV antibiotics. She looked frail and had prominent jugular venous pressure as well as 95 percent saturation on 2 liters of nasal cannula oxygen. She was not on inotropes and had a pulmonary artery pressure of 40/20 mmHg with a good cardiac index. Chest CT showed a large left pleural effusion with associated atelectasis of the left lung. The right lung had manifestations of septic emboli and a smaller pleural effusion.
A Cleveland Clinic surgical team led by cardiothoracic surgeon Faisal Bakaeen, MD, proceeded to excise the patient’s extensive infected and devitalized tissue around the tricuspid valve, leaving only a portion of the anterior leaflet to serve as a reference for reconstruction using autologous pericardium. Dr. Bakaeen walks us through the essential surgical steps — and their underlying rationale — in the narrated operative video below.
An article that appeared in NEJM compares early surgery versus conventional treatment for infective endocarditis. Early Surgery versus Conventional Treatment for Infective Endocarditis Duk-Hyun Kang, Yong-Jin Kim, Sung-Han Kim, Byung Joo Sun, et al.
Background and Purpose: While current guidelines advocate surgical management for complicated left-sided infective endocarditis and early surgery for patients with infective endocarditis and congestive heart failure, the indications for surgical intervention to prevent systemic embolism remain unclear. Surgery is favored by experience with complete excision of infected tissue and valve repair, and low operative mortality, but it does not remove concerns about residual active infection, which results in two sets of guidelines, the 2006 ACC-AHA for class IIa indication only for recurrent emboli and persistent vegetation, and the 2009 ESC guidelines for class IIb indication for very large, isolated vegetations. The Early Surgery versus Conventional Treatment in Infective Endocarditis (EASE) trial was conducted to determine whether early surgical intervention woulddecrease rate of death or embolic events.
Patient Enrollment: The study enrolled 76 consecutive patients, 18 years of age or older, with left-sided, native-valve infective endocarditis and a high risk of embolism. For all patients with suspected infective endocarditis, blood cultures were obtained and transthoracic echocardiography was performed within 24 hours after hospitalization. Patients were only eligible for enrollment if they had received a diagnosis of definite infective endocarditis and had severe mitral valve or aortic valve disease and vegetation with a diameter greater than 10 mm. Patients were excluded if they had moderate-to-severe congestive heart failure, infective endocarditis complicated by heart block, annular or aortic abscess, destructive penetrating lesions requiring urgent surgery, or fungal endocarditis, or were over 80 years age, or coexisting major embolic stroke with a risk of hemorrhagic transformation at the time of diagnosis, and a serious coexisting condition. Patients were also excluded if they had infective endocarditis involving a prosthetic valve, right-sided vegetations, or small vegetations (diameter, ≤10 mm) or had been referred from another hospital more than 7 days after the diagnosis of infective endocarditis.
The protocol specified that patients who were assigned to the early-surgery group should undergo surgery within 48 hours after randomization. Patients assigned to the conventional-treatment group were treated according to the AHA guidelines, and surgery was performed only if complications requiring urgent surgery developed during medical treatment or if symptoms persisted after the completion of antibiotic therapy. Details of the study procedures are provided in the Supplementary Appendix, available at NEJM.org.
Study End Points: The primary end point was a composite of in-hospital death or clinical embolic events that occurred within 6 weeks after randomization. An embolic event was defined as a systemic embolism fulfilling both prespecified criteria: the acute onset of clinical symptoms or signs of embolism and the occurrence of new lesions, as confirmed by follow-up imaging studies. Prespecified secondary end points, at 6 months of follow-up, included death from any cause, embolic events, recurrence of infective endocarditis, and repeat hospitalization due to the development of congestive heart failure.
Clinical and Echocardiographic Characteristics of the Patients at Baseline, According to Treatment Group:
The mean age of the patients was 47 years, and 67% were men. The mitral valve was involved in 45 patients, the aortic valve in 22, and both valves in 9. Severe mitral regurgitation was observed in 45 patients, severe aortic regurgitation in 23, severe aortic stenosis in 3, severe mitral regurgitation and stenosis in 1, and both severe mitral regurgitation and aortic regurgitation in 4. The median diameter of vegetation was 12 mm (interquartile range, 11 to 17). All patients met the Duke criteria for definite endocarditis; the most common pathogens in both groups were viridans streptococci (in 30% of all patients), other streptococci (in 30%), and Staphylococcus aureus (in 11%). Characteristics of Antibiotic Therapy, According to Treatment Group: There were no significant between-group differences in terms of control of the underlying infection, the antibiotic regimen used, or the duration of antibiotic therapy.
Surgical Procedures: All patients in the early-surgery group underwent valve surgery within 48 hours after randomization; the median time between randomization and surgery was 24 hours (interquartile range, 7 to 45). Of the 22 patients with involvement of the mitral valve, 8 patients underwent mitral-valve repair and 14 underwent mitral-valve replacement with a mechanical valve. Of the 15 patients with involvement of the aortic valve or both the mitral and aortic valves, 14 underwent mechanical-valve replacement and 1 underwent valve replacement with a biologic prosthesis. Concomitant coronary-artery bypass grafting at the time of valve surgery was performed in 2 patients (5%).
Conventional Therapy: Of the 39 patients assigned to the conventional-treatment group, 30 (77%) underwent surgery during the initial hospitalization (27 patients) or during follow-up (3). The surgical procedures included 11 mitral-valve repairs, 6 mitral-valve replacements (with 5 patients receiving a mechanical valve and 1 a biologic prosthesis), 11 aortic-valve replacements (with 9 patients receiving a mechanical valve and 2 a biologic prosthesis), and 2 combined aortic-valve replacements (with 1 patient receiving a mechanical valve and 1 a biologic prosthesis) and mitral-valve repairs. In 8 patients (21%), indications for urgent surgery developed during hospitalization (median time to surgery after randomization, 6.5 days [interquartile range, 6 to 10]). Elective surgery was performed in an additional 22 patients owing to symptoms or left ventricular dysfunction more than 2 weeks after randomization. Surgical results are shown in the Supplementary Appendix.
Primary End Point: The primary end point of in-hospital death or embolic events within the first 6 weeks after randomization occurred in one patient (3%) in the early-surgery group, as compared with nine (23%) in the conventional-treatment group (hazard ratio, 0.10; 95% confidence interval [CI], 0.01 to 0.82; P=0.03). In the early-surgery group, one patient died in the hospital and no patients had embolic events; in the conventional-treatment group, one patient died in the hospital and eight patients had embolic events (Table 3TABLE 3). http://www.nejm.org/na101/home/literatum/publisher/mms/journals/content/nejm/2012/nejm_2012.366.issue-26/nejmoa1112843/production/images/small/nejmoa1112843_t3.gif
At 6 weeks after randomization, the rate of embolism was 0% in the early-surgery group, as compared with 21% in the conventional-treatment group (P=0.005). No patient in either group had an embolic event or was hospitalized for congestive heart failure during follow-up. Recurrence of infective endocarditis within 6 months after discharge was not observed in any patient in the early-surgery group but was reported in 1 patient in the conventional-treatment group. Among the 11 patients (28%) in the conventional-treatment group who were treated medically and discharged without undergoing surgery, 1 (3%) died suddenly, 7 (18%) had symptoms related to severe valve disease or recurrence of infective endocarditis (3 of whom underwent surgery during follow-up), and 3 (8%) had no symptoms or embolic events (Table S3 in the Supplementary Appendix).
There was no significant difference between the early-surgery and conventional-treatment groups in all-cause mortality at 6 months (3% and 5%, respectively; hazard ratio, 0.51; 95% CI, 0.05 to 5.66; P=0.59) (Figure 2AFIGURE 2). http://www.nejm.org/na101/home/literatum/publisher/mms/journals/content/nejm/2012/nejm_2012.366.issue-26/nejmoa1112843/production/images/small/nejmoa1112843_f2.gif
Kaplan–Meier Curves for the Cumulative Probabilities of Death and of the Composite End Point at 6 Months, According to Treatment Group.
At 6 months, the rate of the composite of death from any cause, embolic events, recurrence of infective endocarditis, or repeat hospitalization due to the development of congestive heart failure was 3% in the early-surgery group, as compared with 28% in the conventional-treatment group (hazard ratio, 0.08; 95% CI, 0.01 to 0.65; P=0.02). The estimated actuarial rate of end points was significantly lower in the early-surgery group than in the conventional-treatment group (P=0.009 by the log-rank test) (Figure 2B).
Conclusion: Early surgery performed within 48 hours after diagnosis reduced the composite primary end point of death from any cause or embolic events by effectively reducing the risk of systemic embolism. Moreover, these improvements in clinical outcomes were achieved without an increase in operative mortality or recurrence of infective endocarditis.
2012pharmaceutical
sjwilliamspa
