Feeds:
Posts
Comments

Archive for the ‘Cardiac & Vascular Repair Tools Subsegment’ Category

Progenitor Cell Transplant for MI and Cardiogenesis

Posted in Cardiac & Vascular Repair Tools Subsegment, Cardiovascular Research, Chemical Genetics, Diagnostic Immunology, Frontiers in Cardiology and Cardiovascular Disorders, Genome Biology, Innovation in Immunology Diagnostics, Pre-Clinical Animal Model Development, Stem Cells for Regenerative Medicine, Technology Transfer: Biotech and Pharmaceutical, tagged , , , , , , , , , , , , , , , , , , , , , , on October 28, 2013| Leave a Comment »

Progenitor Cell Transplant for MI and Cardiogenesis  (Part 1

Author and Curator: Larry H. Bernstein, MD, FCAP
and
Curator: Aviva Lev-Ari, PhD, RN
This article is Part I of a review of three perspectives on stem cell transplantation onto a substantial size of infarcted myocardium to generate cardiogenesis in tissue that is composed of both repair fibroblasts and cardiomyocytes, after essentially nontransmural myocardial infarct.

Progenitor Cell Transplant for MI and Cardiogenesis (Part 1)

Larry H. Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/10/28/progenitor-cell-transplant-for-mi-and-cardiogenesis/

Source of Stem Cells to Ameliorate Damage Myocardium (Part 2)

Larry H. Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013-10-29/larryhbern/Source_of_Stem_Cells_to_Ameliorate_ Damaged_Myocardium/

An Acellular 3-Dimensional Collagen Scaffold Induces Neo-angiogenesis
 (Part 3)

Larry H. Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013-10-29/larryhbern/An_Acellular_3-Dimensional_Collagen_Scaffold _Induces_Neo-angiogenesis/

The same approach is considered for stroke in one of these studies.  These are issues that need to be considered
  1. Adult stem cells
  2. Umbilical cord tissue sourced cells
  3. Sheets of stem cells
  4. Available arterial supply at the margins
  5. Infarct diameter
  6. Depth of ischemic necrosis
  7. Distribution of stroke pressure
  8. Stroke volume
  9. Mean Arterial Pressure (MAP)
  10. Location of infarct
  11. Ratio of myocytes to fibrocytes
  12. Coexisting heart disease and, or
  13. Comorbidities predisposing to cardiovascular disease, hypertension
  14. Inflammatory reaction against the graft

Transplantation of cardiac progenitor cell sheet onto infarcted heart promotes cardiogenesis and improves function

L Zakharova1, D Mastroeni1, N Mutlu1, M Molina1, S Goldman2,3, E Diethrich4, and MA Gaballa1*
1Center for Cardiovascular Research, Banner Sun Health Research Institute, Sun City, AZ; 2Cardiology Section, Southern Arizona VA Health Care System, and 3Department of Internal Medicine, The University of Arizona, Tucson, AZ; and 4Arizona Heart Institute, Phoenix, AZ
Cardiovascular Research (2010) 87, 40–49   http://dx.doi.org/10.1093/cvr/cvq027

Abstract

Aims

Cell-based therapy for myocardial infarction (MI) holds great promise; however, the ideal cell type and delivery system have not been established. Obstacles in the field are the massive cell death after direct injection and the small percentage of surviving cells differentiating into cardiomyocytes. To overcome these challenges we designed a novel study to deliver cardiac progenitor cells as a cell sheet.

Methods and results

Cell sheets composed of rat or human cardiac progenitor cells (cardiospheres), and cardiac stromal cells were transplanted onto the infarcted myocardium after coronary artery ligation in rats. Three weeks later, transplanted cells survived, proliferated, and differentiated into cardiomyocytes (14.6 ± 4.7%). Cell sheet transplantation suppressed cardiac wall thinning and increased capillary density (194 ± 20 vs. 97 ± 24 per mm2, P < 0.05) compared with the untreated MI. Cell migration from the sheet was observed along the necrotic trails within the infarcted area. The migrated cells were located in the vicinity of stromal-derived factor (SDF-1) released from the injured myocardium, and about 20% of these cells expressed CXCR4, suggesting that the SDF-1/CXCR4 axis plays, at least, a role in cell migration. Transplantation of cell sheets resulted in a preservation of cardiac contractile function after MI, as was shown by a greater ejection fraction and lower left ventricular end diastolic pressure compared with untreated MI.

Conclusion

The scaffold-free cardiosphere-derived cell sheet approach seeks to efficiently deliver cells and increase cell survival.These transplanted cells effectively rescue myocardium function after infarction by promoting not only neovascular-ization but also inducing a significant level of cardiomyogenesis
Keywords  Myocardial infarction • Cardiac progenitor cells • Cardiospheres • Cardiac regeneration • Contractility

Introduction

Despite advances in cardiac treatment after myocardial infarction (MI), congestive heart failure remains the number one killer world-wide. MI results in an irreversible loss of functional cardiomyocytes followed by scar tissue formation. To date, heart transplant remains the gold standard for treatment of end-stage heart failure, a procedure which will always be limited by the availability of a donor heart. Hence, developing a new form of therapy is vital.
A number of adult non-cardiac progenitor cells have been tested for myocardial regeneration, including skeletal myoblasts,1 bone-marrow2, and endothelial progenitor cells.3,4 In addition, several cardiac resident stem cell populations have been characterized based on the expression of stem cell marker proteins.5–8 Among these, the c-Kit+ population has been reported to promote myocardial repair.5,9 Recently, an ex vivo method to expand cardiac-derived progenitor cells from human myocardial biopsies and murine hearts was developed.10 Using this approach, undifferentiated cells (or cardiospheres) grow as self-adherent clusters from postnatal atrium or ventricular biopsy specimens.11
To date, the most common technique for cell delivery is direct injection into the infarcted myocardium.12 This approach is inefficient because more than 90% of the delivered cells die by apoptosis and only a small number of the survived cells differentiated into cardiomyocytes.13 An alternative approach to cell delivery is a biodegradable scaffold-based engineered tissue.14,15 This approach has the clear advantage in creating tissue patches of different shapes and sizes and in creating a beating heart by decellularization technology.16 Advances are being made to overcome the issue of small patch thickness and to minimize possible toxicity of the degraded substances from the scaffold.15 Recently, scaffold-free cell sheets were created from fibroblasts, mesenchymal cells, or neonatal myocytes.17,18 Transplantation of these sheets resulted in a limited improvement in cardiac function due to induced neovascularization and angiogenesis through secretion of angiogenic factors.17–19 However, few of those progenitor cells have differentiated into cardiomyocytes.17 The need to improve cardiac contractile function suggests focusing on cells with higher potential to differentiate to cardiomyocytes with an improved delivery method.
In the present study, we report a cell-based therapeutic strategy that surpasses limitation inherent in previously used methodologies. We have created a scaffold-free sheet composed of cardiac progenitor cells (cardiospheres) incorporated into a layer of cardiac stromal cells. The progenitor cells survived when transplanted as a cell sheet onto the infarcted area, improved cardiac contractile functions, and supported recovery of damaged myocardium by promoting not only vascularization but also a significant level of cardiomyogenesis. We also showed that cells from a sheet can be recruited to the site of injury driven, at least partially, by the stromal-derived factor (SDF-1) gradient.

Methods

Detailed methods are provided in the Supplementary Methods

Animals

Three-month-old Sprague Dawley male rats were used. Rats were randomly placed into four groups:
(1) sham-operated rats, n = 12;
(2) MI, n = 12;
(3) MI treated with rat sheet, n = 10; and
(4) MI treated with human sheet, n = 10.

Myocardial infarction

MI was created by the ligation of the left coronary artery.20 Animals were intubated and ventilated using a small animal ventilator (Harvard Apparatus). A left thoracotomy was performed via the third intercostal rib, and the left coronary artery was ligated. The extent of infarct was verified by measuring the area at risk: heart was perfused with PBS containing 4 mg/mL Evans Blue as previously described by our laboratory.20 The area at risk was estimated by recording the size of the under-perfused (pale-colored) area of myocardium (see Supplementary material online, Figure S1). Only animals with an area at risk >30% were used in the present study. Post-mortem infarct size was measured using triphenyl tetrazolium chloride staining as previously described by our laboratory.20

Isolation of cardiosphere-forming cells

Cardiospheres were generated as described10 from atrial tissues obtained from:
(1) human atrial resection samples obtained from patients (aged from 53 to 73 years old) undergoing cardiac bypass surgery at Arizonam Heart Hospital (Phoenix, AZ) in compliance with Institutional Review Board protocol (n = 10),
(2) 3-month-old SD rats (n = 10). Briefly, tissues were cut into 1–2 mm3 pieces and tissue fragments were cultured ‘as explants’ in a complete explants medium for 4 weeks (Supplementary Methods).
Cell sheet preparation, labelling, handling, and transplantation
Cardiosphere-forming cells (CFCs) combined with cardiac stromal cells were seeded on double-coated plates (poly-L-lysine and collagen type IV from human placenta) in cardiosphere growing medium (Supplementary Methods). The sheets created from the same cell donors were divided into two groups,
one for transplantation and the other for characterization by immunostaining and RT–PCR (Supplementary Methods).
Prior to transplantation, rat cell sheets were labelled with 2 mM 1,1-dioctadecyl-3,3,3,3-tetramethylindocarbocyanine, DiI, for tracking transplanted cells in rat host myocardium (Molecular Probes, Eugene, OR). Sheets created using human cells were transplanted unlabelled. Sheets were gently peeled off the collagen-coated plate and folded twice to form four layers. The entire sheet with 200 ml of media was
  • gently aspirated into the pipette tip,
  • transferred to the supporting polycarbonate filter (Costar) and
  • spread off by adding media drops on the sheet (Figure 2A).
Polycarbonate filter was used as a flexible mechanical support for cell sheet to facilitate handling during the transplantation. Immediately after LAD occlusion, the cell sheet was transplanted onto the infarcted area, allowed to adhere to the ventricle for 5–7 min, and the filter was removed before closing the chest (Figure 2A).

Cardiac function

Three weeks after MI, closed-chest in vivo cardiac function was measured using a Millar pressure conductance catheter system (Millar Instruments, Houston, TX) (Supplementary Methods).

Cell sheet survival, engraftment, and cell migration

Rat host myocardium and cell sheet composition after transplantation were characterized by immunostaining (Supplementary Methods). Rat-originated cells were traced by DiI, while human-originated cells were identified by immunostaining with anti-human nuclei or human lamin antibodies.
  1. To assess sheet-originated cardiomyocytes within the host myocardium, the number of cells positive for both human nuclei and myosin heavy chain (MHC) (human sheet); or both DiI and MHC (rat sheet) were counted.
  2. To assess sheet-originated capillaries within the rat host myocardium, the number of cells positive for both human nuclei and von Willebrand factor (vWf) (human sheet); or both DiI and vWf (rat sheet) were counted. Cells were counted in five microscopic fields within cell sheet and area of infarct (n = 5). The number of cells expressing specific markers was normalized to the total number of cells determined by 40,6-diamidino-2-phenylindole staining of the nuclei DNA.
  3. To assess the survival of transplanted cells, sections were stained with Ki-67 antibody followed by fluorescent detection and caspase 3 primary antibodies followed by DAB detection (Supplementary Methods).
  4. To evaluate human sheet engraftment, sections were stained with human lamin antibody followed by fluorescent detection (Supplementary Methods).
  5. Rat host inflammatory response to the transplanted human cell sheet 21 days after transplantation was evaluated by counting tissue mononuclear phagocytes and neutrophils (Supplementary Methods).

Imaging

Images were captured using Olympus IX70 confocal microscope (Olympus Corp, Tokyo, Japan) equipped with argon and krypton lasers or Olympus IX-51 epifluorescence microscope using excitation/emission maximum filters: 490/520 nm, 570 /595 nm, and 355 /465 nm. Images were processed using DP2-BSW software (Olympus Corp).

Statistics

All data are represented as mean ± SE Significance (P < 0.05) was deter-mined using ANOVA (StatView).

Results

Generation of cardiospheres

Cardiospheres were generated from atrial tissue explants. After 7–14 days in culture, a layer of stromal cells arose from the attached explants (Supplementary material online, Figure S2a). CFCs, small phase-bright single cells, emerged from explants and bedded down on the stromal cell layer (Supplementary material online, Figure S2b).
  • After 4 weeks, single CFCs, as well as cardiospheres (spherical colonies generated from CFCs) were observed (Supplementary material online, Figure S2c).
Cellular characteristics of cardiospheres in vitro
Immunocytochemical analysis of dissociated cardiospheres revealed that
  • 30% of cells were c-Kitþ indicating that the CFCs maintain multi-potency. About
  • 22 and 28% of cells expressed a, b-MHC and cardiac troponin I, respectively.
These cells represent an immature cardiomyocyte population because they were smaller (10–15 pm in length vs. 60–80 pm for mature cardiomyocytes) and no organized structure of MHC was detected. Furthermore
  • 17% of the cells expressed a-smooth muscle actin (SMA) and
  • 6% were positive for vimentin,
    • both are mesenchymal cell markers (Supplementary material online, Figure S3a and b).
  • Less then 5% of cells were positive for endothelial cell marker; vWf.
Cell characteristics of human cardiospheres are similar to those from rat tissues (Supplementary material online, Figure S3c).
Cardiospheres were further characterized based on the expression of c-Kit antigen. RT–PCR analysis was performed on both c-Kitþ and c-Kit2 subsets isolated from re-suspended cardiospheres. KDR, kinase domain protein receptor, was recently identified as a marker for cardiovascular lineage progenitors in differentiating embryonic stem cells.21 Here, we found that
  • the c-Kitþ cells were also Nkx2.5 and GATA4-positive, but were low or negative for KDR (Supplementary material online, Figure S3d). In contrast,
  • c-Kit2 cells strongly expressed KDR and GATA4, but were negative for Nkx2.5.
  • Both c-Kitþ and c-Kit2 subsets did not express Isl1, a marker for multipotent secondary heart field progenitors.22
Characteristics of cell sheet prior to transplantation
The cell sheet is a layer of cardiac stromal cells in which the cardiospheres were incorporated at a frequency of 21 ± 0.5 spheres per 100,000 viable cells (Figure 1A). The average diameter of cardiospheres within a sheet was 0.13 ± 0.02 mm and their average area was 0.2 ± 0.06 mm2 (Figure 1A). After sheets were peeled off the plate, it exhibited a heterogeneous thickness ranging from 0.05– 0.1 mm (n 1/4 10), H&E staining (Figure1B) and Masson’s Trichrome staining (Figure 1C) of the sheet sections revealed tissue-like organized structures composed of muscle tissue intertwined with streaks of collagen with no necrotic core. Based on the immunostaining results, sheet compiled of several cell types including
  • SMAþ cardiac stromal cells (50%),
  • MHCþ cardiomyocytes (20%), and
  • vWfþ endothelial cells (10%) (Figure 1D and E).
  • 15% of the sheet-forming cells were c-Kitþ suggesting the cells multipotency (Figure 1E).
  • Cells within the sheet expressed gap-junction protein C43, an indicator of electromechanical coupling between cells (Figure 1D).
  • 40% of cells were positive for the proliferation marker Ki-67 suggesting an active cell cycle state (Figure 1D, middle panel).
Human sheet expressed genes
  1. known to be upregulated in undifferentiated cardiovascular progenitors such as c-Kit and KDR;
  2. cardiac transcription factors Nkx2.5 and GATA4; genes related to adhesion, cell homing, and
  3. migration such as ICAM (intercellular adhesion molecule), CXCR4 (receptor for SDF-1), and
  4. matrix metalloprotease 2 (MMP2).
No expression of Isl1 was detected in human sheet (Figure 1F).
sheet transplant on MI_Image_2
Figure 1 Cell sheet characteristics. (A) Fully formed cell sheet. Arrow indicates integrated cardiosphere. (B) H&E staining; pink colour (arrowhead) indicates cytosol and blue (arrows) indicates nuclear stain. Note that there is no necrotic core within the cell sheet. (C) Masson’s Trichrome staining of sheet section. Arrowhead indicates collagen deposition within the sheet. (D and E) Sheet sections were labelled with antibodies against following markers: (D) vWf (green), Ki-67 (green), C43 (green); (E) c-Kit (green), MHC (red), SMA (red) as indicated on top of each panel. Nuclei were labelled with blue fluorescence of 40,6-diamidino-2-phenylindole (DAPI). (F) Gene expression analysis of the cell sheet. Scale bars, 200 pm (A) or 50 pm (B–E).

Cell sheet survival and proliferation

Two approaches were used to track transplanted cells in the host myocardium.
  • rat cell sheets were labelled with red fluorescent dye, DiI, prior to the transplantation.
  • the sheet created from human cells (human sheet) were identified in rat host myocardium by immunostaining with human nuclei antibodies.
DiI-labelling together with trichrome staining showed engraftment of the cardiosphere-derived cell sheet to the infarcted myocardium (Figure 2B–D). In vivo sheets grew into a stratum with heterogeneous thickness ranging from 0.1–0.5 mm over native tissue. The percentage of Ki-67þ cells within the sheet was 37.5 ± 6.5 (Figure 2F) whereas host tissue was mostly negative (except for the vasculature).
To assess the viability of transplanted cells, the heart sections were stained with the apoptosis marker, caspase 3. A low level of caspase 3 was detected within the sheet, suggesting that the majority of transplanted cells survived after transplantation (Figure 2G).
sheet transplant on MI_Image_3
Figure 2 Transplantation and growth of cell sheet after transplantation.
(A) Sheet transplantation onto infarcted heart. Detached cell sheet on six-well plate (left); cell sheet folded on filter (middle); and transplanted onto left ventricle (right). Scale bar 2 mm. DiI-labelled cell sheets grafted above MI area at day 3
(B) and day 21
(C) after transplantation.
(D) LV section of untreated MI rat at day 21 showing no significant red fluorescence background.
Bottom row (B–D) demonstrates the enlargement of box-selected area of corresponding top panels.
(E) Similar sections stained with Masson’s Trichrome. Section of rat (F) or human (G) sheet treated rat at day 21 after MI.
(F) Section was stained with antibody against Ki-67 (green). Cell sheet was pre-labelled with DiI (red). Nuclei stained with blue fluorescence of DAPI.
(G) Section was double stained with human nuclei (blue) and caspase 3 (brown, arrows) antibodies and counterstained with eosin.
Asterisks (**) indicate cell sheet area. Scale bars 200 mm (B–D, top row), 100 mm (B–D, bottom row, and E) or 50 mm (F, G).
Identification of inflammatory response
Twenty-one days after transplantation of human cell sheet, inflammatory response of rat host was examined. Transplantation of human sheet on infarcted rats reduced the number of mononuclear phagocytes (ED1-like positive cells) compared with untreated MI control (Supplementary material online, Figure S4a–e and l). In addition, the number of neutrophils was similar in both control untreated MI and sheet-treated sections (Supplementary material online, Figure S4f–k and m). These data suggest that at 21 days post transplantation, human cell sheet was not associated with significant infiltration of host immune cells.

Cell sheet engraftment and migration

Development of new vasculature was determined in cardiac tissue sections by co-localization of DiI labelling and vWf staining (Figure 3C). Three weeks after transplantation, the capillary density of ischaemic myocardium in the sheet-treated group significantly increased compared with MI animals (194 ± 20 vs. 97 ± 24 per mm2, P < 0.05, Figure 3A and B). The capillaries originated from the sheet ranged in diameter from 10 to 40 jim (n 1/4 30). A gradient in capillary density was observed with higher density in the sheet area which was decreased towards underlying infarcted myocardium. Mature blood vessels were identified within the sheet area and in the underlying myocardium in close proximity to the sheet evident by vWf and SMA double staining (Figure 3D).
sheet transplant on MI_Image_4
Figure 3 Neovascularization of infarcted wall. (A) Frozen tissue sections stained with vWf antibody (green). LV section of control (sham), infarcted (MI), and MI treated with cell sheet (sheet) rats. Scale bar, 100 jim. (B) Capillary density decreased in the MI compared with sham (*P < 0.05) and improved after cell sheet treatment (#P < 0.05). (C) Neovascularization within cell sheet area was recognized by co-localization of DiI- (red) and vWf (green) staining. Scale bar 100 jim. (D) Mature blood vessels (arrows) were identified by co-localization of SMA (red) and vWf (green) staining. Scale bar 50 jim.
Furthermore, 3 weeks after transplantation, a large number of labelled human nuclei positive or DiI-labelled cells were detected deep within the infarcted area indicating cell migration from the epicardial surface to the infarct (Figure 4A, B, and D). Minor or no migration was detected when the cell sheet was transplanted onto non-infarcted myocardium, sham control (Figure 4C). To evaluate engraftment of sheet-originated cells, sections were labelled with anti-human nuclear lamin antibody. Quantification of engraftment was performed using two approaches: fluorescence intensity and cell counting. Fluorescence intensity of the signal was analysed and compared for different areas of myocardium (Figure 4E–J). Since the transplanted sheets are created by human cells and are stained with human nuclear lamin-labelled with green fluorescence, the signal intensity of the sheet is set to 100% (100% of cells are lamin-positive). Myocardial area with no or limited number of labelled cells had the lowest level of fluorescence signal (13%, or 3.2 ± 1.4% of total number of cells), while
  1. the area where the cell migrated from the sheet to the infarcted myocardium had higher signal intensity (47%, or 11.9 ± 1.7% of total number of cells), indicating a higher number of sheet-originated cells are engrafted in the infarcted area.) (Figure 4K and L).
  2. Migrated cells were positive for KDR (Supplementary material online, Figure S5).
sheet transplant on MI_Image_5
Figure 4 Engraftment quantification of cells migrated from the sheet into the infarcted area of MI. Animals were treated with rat (A) or human (B–F) sheets. Cardiomyocytes were labelled with MHC antibody (A, green or B, red). Rat sheet-originated cells were identified with DiI-labelling, red (A). Arrows indicate the track of migrating cells. Human sheet-originated cells were identified by immunostaining with human nuclei antibody followed by secondary antibodies conjugated with either Alexa 488 (B, E and F, green) or AP (C, D, blue). No migration was detected when the cell sheet was transplanted onto non-infarcted myocardium (C). Heart sections were counterstained with eosin, pink (C–D). Higher magnification of area selected in the box is presented (D, right). Immunofluorescence of sheet (green) grafted to the myocardium surface (E) or cells migrated to the infarction area (F). Fluorescence profiles acrossthe cell sheet itself(G, box 1), area underlying cell sheet (I, box 2) and infarction areawith migrated cells (F, box 3). Mean fluorescence intensityofthe grafted human (K) cells was determined by outlining the region of interest (ROI) and subtracting the background fluorescence for the same region. Fluorescence intensity was normalized to the area of ROI (ii 1/4 6). (L) Percent engraftment was defined as number of lamin-positive cells divided by total number of cells per ROI. ‘M’, myocardium,’S’ sheet, ‘I’ infarction. Scale bars 100 mm (A–C, D, left, E and F), or 50 mm (D, right).
To elucidate a possible mechanism of cell migration, sections were stained to detect SDF1 and its unique receptor CXCR4. The migration patterns of cells from the sheet coincided with SDF-1 expression. Within 3 days after MI, SDF-1 was expressed in the injured myocardium (Figure 5A). At 3 weeks after MI and sheet transplantation, SDF-1 was co-localized with the migrated labelled cells (Figure 5B). PCR analysis revealed CXCR4 expression in cell sheet before transplantation (Figure 1F). However, after transplantation only a fraction of migrated cells expressed CXCR4 (Figure 5C).
sheet transplant on MI_Image_6
Figure 5 Migration of sheet-originated cells into the infarcted area. Confocal images of MI animals treated with sheets from rats (A and B) or human (C). SDF1 (green) was detected at border zone of the infarct at day 3 (A) and day 21 (B). Rat sheet-originated cells were identified with DiI-labelling (red). Note co-localization of DiI-positive sheet-originated cells with SDF1 at 21 days after MI (B). Human cells were identified by immunostaining with human nuclei antibody, red, (C). Note human cells that migrated to the area of infarct express CXCR4 (green) (C). Scale bar, 200 mm (A, B) or 50 mm (C). ‘M’, myocardium, ‘S’ sheet, ‘I’ infarct.

3.7 Cardiac regeneration

The differentiation of migrating cells into cardiomyocytes was evident by the co-localization of MHC staining with either human nuclei (Figure 6A) or DiI (Figure 6B and C). In contrast to the immature cardiomyocyte-like cells within the pre-transplanted cell sheet, the migrated and newly differentiated cells within the myocardium were about 30–50 mm in size and co-expressed C43 (see Supplementary material online, Figure S6). Cardiomyogenesis within the infarcted myocardium was observed in the sheets created from either rat or human cells.
sheet transplant on MI_Image_6
Figure 6 Cardiac regeneration. Sections of MI animals treated with human (A) or rat (B, C) sheets. Human sheet was identified by immunostaining with human nuclei antibody (green). Section was double-stained with MHC (red) antibody. Newly formed cardiomyocytes was identified by co-localization of human nuclei and MHC (yellow, arrow). (B) Rat sheet-originated cells were identified by DiI labelling (red). Section was double-stained with MHC (green) antibody. Newly formed cardiomyocytes were detected by co-localization of DiI with MHC (yellow, arrows). (C) Higher magnification of area selected in the boxes (B). Scale bars 200 mm (B), or 20 mm (A, C). ‘M’, myocardium, ‘S’ sheet, ‘I’ infarct.

Cell sheet improved cardiac contractile function and retarded LV remodelling after MI

Closed-chest in vivo cardiac function was derived from left ventricle (LV) pressure–volume loops (PV loops), which were measured using a solid-state Millar conductance catheter system. MI resulted in a characteristic decline in LV systolic parameters and an increase in diastolic parameters (Table 1). Cell sheet treatment improved both systolic and diastolic parameters (Table 1). Specifically, load-dependent parameters of systolic function: ejection fraction (EF), dP/dTmax, and cardiac index (CI) were decreased in MI rats and increased towards sham control with the cell sheet treatment (Table 1). Diastolic function parameters, dP/dTmin, relaxation constant (Tau), EDV, and EDP were increased in the MI rats and returned towards sham control parameters after sheet treatment (Table 1). However, load-independent systolic function, Emax, was decreased after MI. Treatment with human sheet improved Emax, while treatment with rat sheet had no effect (Table 1). Treatment with either rat or human sheets retarded LV remodelling; as such that it increased the ratio of anteriolateral wall thickness/LV inner diameter (t/Di) and wall thickness/LV outer diameter (t/Do) (see Supplementary material online, Table S3). However, human sheets appear to further improve LV remodelling compared with rat sheets as indicated by increased ratio of wall thickness to ventricular diameter and decreased both EDV and EDP (Table 1 and see Supplementary material online, Table S3).
Table 1 Hemodynamic parameters
Table 1. hemodynamic parameters

Discussion

The majority of the cardiac progenitor cells delivered using our scaffold-free cell sheet survived after transplantation onto the infarcted heart. A significant percentage of transplanted cells migrated from the cell sheet to the site of infarction and differentiated into car-diomyocytes and vasculature leading to improving cardiac contractile function and retarding LV remodelling. Thus, delivery of cardiac progenitor cells together with cardiac mesenchymal cells in a form of scaffold-free cell sheet is an effective approach for cardiac regeneration after MI.
Consistent with previous studies,5,11 here we showed that cardio-spheres are composed of multipotent precursors, which have the capacity to differentiate to cardiomyocytes and other cardiac cell types. When we fractioned cardiospheres based on c-Kit expression, we identified two subsets: Kitþ /KDR2/low/Nkx2.5þ and Kit2/KDRþ/ Nkx2.52(Supplementary material online, Figure S3d), which are likely reflecting cardiac and vascular progenitors.20
In the present study, delivery of cardiac progenitor cells as a cell sheet facilitates cell survival after transplantation. Necrotic cores, commonly observed in tissue engineered patches,23,24 are absent in cardiosphere sheets prior to transplantation (Figure 1B and C). Poor cell survival is caused by multiple processes such as: ischemia from the lack of vasculature and anoikis due to cell detachment from sub-strate.25 A possible mechanism of cell survival within the sheet is the induction of neo-vessels soon after transplantation due to the presence of endothelial cells within the sheet before transplantation (Figure 10). The cell sheet continued to grow in vivo (Figure 2B and C), suppressed cardiac wall thinning, and prevented LV remodelling at 21 days after transplantation (see Supplementary material online, Table S3). This maybe due to the induction of neovascularization (Figure 3), which may prevents ischemia-induced cell death (Figure 2G). Another likely mechanism of cell survival is that the cells within the scaffold-free sheet maintained cell-to-cell adhesion16 as shown by ICAM expression (Figure 1F). The cells also exhibit C43-positive junctions (Figure 10, see Supplementary material online, Figure S6), which may facilitate electromechanical coupling between the transplanted cells and the native myocardium.
We observed cell migration from the sheet to the infarcted myocardium (Figure 4A and B, E and F), which may be facilitated by the strong expression of MMP2 in the cell sheet (Figure 1F). Although, the mechanism of cardiac progenitor cell migration remains unclear, previous observations showed that SDF-1 is upregulated after MI and plays a role in bone-marrow and cardiac stem cell migration.26,27 Our data suggest that SDF-1-CXCR4 axis plays, at least in part, a role in cardiac progenitor cell migration from cell sheet to the infarcted myocardium. This conclusion is based on the following observations: (1) cell sheet expresses CXCR4 prior to transplantation (Figure 1F), (2) migrated cells are located in the vicinity of SDF-1 release (Figure 5A and B), and (3) about 20% of migrated cells expressed CXCR4. Note, not all the migrated cells expressed CXCR4 suggesting other mechanisms are involved in cell migration (Figure 5C).
Here we report that implanting cardiosphere-generated cell sheet onto infarcted myocardium not only improved vascularization but also promoted cardiogenesis within the infarcted area (Figure 6). A larger number of newly formed cardiomyocytes were found deep within the infarct compared with the cell sheet periphery. Notably the transplantation of the cell sheet resulted in a significant improvement of the cardiac contractile function after MI, as was shown by an increase of EF and decrease of LV end diastolic pressure (Table 1).
The beneficial effect of cell sheet is, in part, due to the presence of a large number of activated cardiac mesenchymal stromal cells (myofibroblasts) within the sheet. Myofibroblasts are known to provide a mechanical support for grafted cells, facilitating contraction28 and to induce neovascularization through the release of cytokines.17 In addition, mesenchymal cells are uniquely immunotolerant. In xenograft models unmatched mesenchymal cells transplanted to the heart of immunocompetent rats were shown to suppress host immune response29 presumably due to inhibition of T-cell activation.30 Consistently with previous study from our laboratory,31 here, we demonstrated host tolerance to the cell sheet 21 days after MI. Finally, phase II and III clinical trials are currently undergoing in which allogeneic MSCs are used to treat MI in patients (Osiris Therapeutic, Inc.).
In summary, our results show that cardiac progenitor cells can be delivered as a cell sheet, composed of a layer of cardiac stromal cells impregnated with cardiospheres. After transplantation, cells from the cell sheet migrated to the infarct, partially driven by SDF-1 gradient, and differentiated into cardiomyocytes and vasculature. Transplantation of cell sheet was associated with prevention of LV remodelling, reconstitution of cardiac mass, reversal of wall thinning, and significant improvement in cardiac contractile function after MI. Our data also suggest that strategies, which utilize undigested cells, intact cell–cell interactions, and combined cell types such as our scaffold-free cell sheet should be considered in designing effective cell therapy.

References

Fuchs JR, Nasseri BA, Vacanti JP, Fauza DO. Postnatal myocardial augmentation with skeletal myoblast-based fetal tissue engineering. Surgery 2006;140:100–107.
Orlic D, Kajstura J, Chimenti S, Bodine DM, Leri A, Anversa P. Bone marrow stem cells regenerate infarcted myocardium. Pediatr Transplant 2003;7(Suppl. 3):86–88.
Kawamoto A, Tkebuchava T, Yamaguchi J, Nishimura H, Yoon YS, Milliken C et al. Intramyocardial transplantation of autologous endothelial progenitor cells for therapeutic neovascularization of myocardial ischemia. Circulation 2003;107:461–468.
Iwasaki H, Kawamoto A, Ishikawa M, Oyamada A, Nakamori S, Nishimura H et al. Dose-dependent contribution of CD34-positive cell transplantation to concurrent vasculogenesis and cardiomyogenesis for functional regenerative recovery after myocardial infarction. Circulation 2006;113:1311–1325.
Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S et al. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 2003;114: 763–776.
Oh H, Bradfute SB, Gallardo TD, Nakamura T, Gaussin V, Mishina Y et al. Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proc Natl Acad Sci USA 2003;100:12313–12318.
Laugwitz KL, Moretti A, Lam J, Gruber P, Chen Y, Woodard S et al. Postnatal isl1+ cardioblasts enter fully differentiated cardiomyocyte lineages. Nature 2005;433: 647–653.
Pfister O, Mouquet F, Jain M, Summer R, Helmes M, Fine A et al. CD31- but Not CD31+ cardiac side population cells exhibit functional cardiomyogenic differentiation. Circ Res 2005;97:52–61.
Dawn B, Stein AB, Urbanek K, Rota M, Whang B, Rastaldo R et al. Cardiac stem cells delivered intravascularly traverse the vessel barrier, regenerate infarcted myocardium, and improve cardiac function. Proc Natl Acad Sci USA 2005;102:3766–3771.

 

Read Full Post »

Contributions to Cardiomyocyte Interactions and Signaling

Posted in Cardiac & Vascular Repair Tools Subsegment, Cell Biology, Signaling & Cell Circuits, Disease Biology, Small Molecules in Development of Therapeutic Drugs, Frontiers in Cardiology and Cardiovascular Disorders, Innovation in Immunology Diagnostics, Medical Imaging Technology, Image Processing/Computing, MRI, CT, Nuclear Medicine, Ultra Sound, Nanotechnology for Drug Delivery, Pharmacotherapy of Cardiovascular Disease, Proteomics, Resident-cell-based, Stem Cells for Regenerative Medicine, Technology Transfer: Biotech and Pharmaceutical, Uncategorized, tagged , , , , , , , , , , , , , , , , , , , , , , , , , , , , , , on October 21, 2013| Leave a Comment »

Contributions to Cardiomyocyte Interactions and Signaling

Author and Curator: Larry H Bernstein, MD, FCAP

and

Curator: Aviva Lev-Ari, PhD, RN

Introduction

This is Part II of the ongoing research in the Lee Laboratory, concerned with Richard T Lee’s dissection of the underlying problems that will lead to a successful resolution of myocardiocyte regeneration unhampered by toxicity, and having a suffuciently sustained effect for an evaluation and introduction to the clinic.  This would be a milestone in the treatment of heart failure, and an alternative to transplantation surgery.  This second presentation focuses on the basic science work underpinning the therapeutic investigations.  It is work that, if it was unsupported and did not occur because of insufficient funding, the Part I story could not be told.

Cardiomyocyte hypertrophy and degradation of connexin43 through spatially restricted autocrine/paracrine heparin-binding EGF

J Yoshioka, RN Prince, H Huang, SB Perkins, FU Cruz, C MacGillivray, DA Lauffenburger, and RT Lee *
Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA; and Biological Engineering Division, MIT, Cambridge, MA
PNAS 2005; 302(30):10622-10627.  http://pnas.org/cgi/doi/10.1073/pnas.0501198102

Growth factor signaling can affect tissue remodeling through autocrine/paracrine mechanisms. Recent evidence indicates that EGF receptor transactivation by heparin-binding EGF (HB-EGF) contributes to hypertrophic signaling in cardiomyocytes. Here, we show that HB-EGF operates in a spatially restricted circuit in the extracellular space within the myocardium, revealing the critical nature of the local microenvironment in intercellular signaling. This highly localized microenvironment of HB-EGF signaling was demonstrated with 3D morphology, consistent with predictions from a computational model of EGF signaling. HB-EGF secretion by a given cardiomyocyte in mouse left ventricles led to cellular hypertrophy and reduced expression of connexin43 in the overexpressing cell and in immediately adjacent cells but not in cells farther away. Thus, HB-EGF acts as an autocrine and local paracrine cardiac growth factor that leads to loss of gap junction proteins within a spatially confined microenvironment. These findings demonstrate how cells can coordinate remodeling with their immediate neighboring cells with highly localized extracellular EGF signaling. Within 3D tissues, cells must coordinate remodeling in response to stress or growth signals, and this communication may occur by direct contact or by secreted signaling molecules. Cardiac hypertrophy is a physiological response that enables the heart to adapt to an initial stress; however, hypertrophy can ultimately lead to the deterioration in cardiac function and an increase in cardiac arrhythmias. Although considerable progress has been made in elucidating the molecular pathogenesis of cardiac hypertrophy, the precise mechanisms guiding the hypertrophic process remain unknown. Recent evidence suggests that myocardial heparin-binding (HB)-epidermal growth factor participates in the hypertrophic response. In cardiomyocytes, hypertrophic stimuli markedly increase expression of the HB-EGF gene, suggesting that HB-EGF can act as an autocrine trophic factor that contributes to cellular growth. HB-EGF is first synthesized as a membrane-anchored form (proHB-EGF), and subsequent ectodo-main shedding at the cell surface releases the soluble form of HB-EGF. Soluble HB-EGF is a diffusible factor that can be captured by the receptors to activate the intracellular EGF receptor signaling cascade. Indeed, EGF receptor (EGFR) transactivation, triggered by shedding of HB-EGF from the cell surface, plays an important role in cardiac hypertrophy resulting from pressure overload in the aortic-banding model. EGFR activation can occur through autocrine and paracrine signaling. In autocrine signaling, a cell produces and responds to the same signaling molecules. Paracrine signaling molecules can target groups of distant cells or act as localized mediators affecting only cells in the immediate environment of the signaling cell. Thus, although locally produced HB-EGF may travel through the extra-cellular space, it may also be recaptured by the EGFR close to the point where it was released from the cell surface. The impact of spatially localized microenvironments of signaling could be extensive heterogeneous tissue remodeling, which can be particularly important in an electrically coupled tissue like myocardium. Interestingly, recent data suggest that EGF can regulate protea-some-dependent degradation of connexin43 (Cx43), a major trans-membrane gap junction protein, in liver epithelial cells, along with a rapid inhibition of cell–cell communication through gap junctions. One of the critical potential myocardial effects of HB-EGF could therefore be to increase degradation of Cx43 and reduce electrical stability of the heart. Reduced content of Cx43 is commonly observed in chronic heart diseases such as hypertrophy, myocardial infarction, and failure. Thus, we hypothesized that HB-EGF signals may operate in a spatially restricted local circuit in the extracellular space. We also hypothesized that HB-EGF secretion by a given cardiomyocyte could create a local remodeling microenvironment of decreased Cx43 within the myocardium. To explore whether HB-EGF signaling is highly spatially constrained, we took advantage of the nonuniform gene transfer to cardiac myocytes in vivo, normally considered a pitfall of gene therapy. We also performed computational modeling to predict HB-EGF dynamics and developed a 3D approach to measure cardiomyocyte hypertrophy.

Results

Autocrine HB-EGF and Cardiomyocyte Growth.

To assess the effects of gene transfer of HB-EGF on cardiomyocyte hypertrophy, cells were infected with adenoviral vectors expressing GFP alone (Ad-GFP) or HB-EGF and GFP (Ad-HB-EGF). At this level of infection, 99% of cardiomyocytes were transduced. The incidence of apoptotic cell death (sub-G1 fraction) was not different between Ad-GFP cells, suggesting that expression of GFP by the adenoviral vector was not cardiotoxic in these conditions. Western analysis by using an anti-HB-EGF antibody confirmed successful gene transfer of HB-EGF in cardiomyocytes (18 ± 5-fold, n = 4, P < 0.01); HB-EGF appeared electrophoretically as several bands from 15 to 30 kDa (Fig. 1A). The strongest band corresponds to the soluble 20-kDa form of HB-EGF. To confirm that Ad-HB-EGF results in cellular hypertrophy, cell size and protein synthesis were measured. Ad-HB-EGF enlarged cardiomyocytes compared with Ad-GFP-infected cells by phase-contrast microscopy (24 ± 10% increase in cell surface area, n = 27, P < 0.05) and with flow cytometry analysis (26 ± 10% increase of Ad-GFP infected cells, P < 0.01, Fig. 1B). Overexpression of HB-EGF increased total protein synthesis in cardiomyocytes as measured by [3H]leucine uptake (34 ± 6% of Ad-GFP, n = 6, P < 0.01, Fig. 1C). Uninfected cells within the same dish (and thus sharing the same culture media) did not develop hypertrophy. Additionally, medium from cultures previously infected with Ad-HB-EGF for 48 h was collected and applied to adenovirus-free cultures. Conditioned medium from Ad-HB-EGF-infected cardiomyocytes failed to stimulate hypertrophy in naive cardiomyocytes (Fig. 1C), and there were no significant differences in cell size between noninfected cells from Ad-GFP and Ad-HB-EGF dishes. These results suggest that HB-EGF acts primarily as an autocrine growth factor in cardiomyocytes in vitro.
Because the dilution factor in culture media is important for autocrine/paracrine signaling, we determined the concentration of soluble HB-EGF in the conditioned medium and the effective concentration to stimulate cardiomyocyte growth. HB-EGF levels in the conditioned medium from Ad-HB-EGF dishes were 258 ± 73 pg/ml (n = 4), whereas HB-EGF levels from Ad-GFP dishes (n = 8) were below the limit of detection (6.7 pg/ml). The addition of 300 pg/ml of exogenous recombinant HB-EGF into fresh media failed to stimulate hypertrophy in cardiomyocytes as measured by [3H]leucine uptake (-12 ± 5.0% compared with control, n = 5,P = not significant), but 2,000 pg/ml of recombinant HB-EGF did result in a significant effect (+24 ± 5.5% compared with control, n = 6, P < 0.05). This comparison implies that the local concentration of autocrine ligand is substantially greater than that indicated by a bulk measurement of conditioned media, consistent with previous experimental and theoretical studies.

Fig. 1. Effects of gene transfer of HB-EGF on rat neonatal cardiomyocyte growth.

(A) Cells were infected with adenoviral vectors expressing GFP (Ad-GFP), or HB-EGF and GFP (Ad-HB-EGF). Western analysis showed the successful gene transfer of HB-EGF. (8) FACS analysis of 5,000 cardiomyocytes demonstrated that overexpression of HB-EGF produced a 26 ± 10% increase in cell size that was significantly greater than the overex-pression of GFP. Bar graphs with errors represent mean ± SEM from three independent experiments. **, P < 0.01 vs. Ad-HB-EGF-nonin-fected cells and Ad-GFP nonin-fected cells. , P < 0.05 vs. Ad-GFP infected cells. (C) Overexpression of HB-EGF resulted in a 34 ± 6% increase in [3H]leucine uptake compared with Ad-GFP (n = 6), whereas conditioned medium from Ad-HB-EGF cells caused an only insignificant increase. **, P < 0.05 vs. Ad-GFP control and conditioned medium Ad-GFP.

 Effects of HB-EGF on Cx43 Content in Cultured Cardiomyocytes

Because EGF can induce degradation of the gap junction protein Cx43 in other cells, we then determined whether Cx43 is regulated by HB-EGF in cardiomyocytes. Fig. 2A shows a representative immunoblot from three separate experiments in which Cx43 migrated as three major bands at 46, 43, and 41 kDa, as reported in ref. 16. Overexpression of HB-EGF decreased total Cx43 content (27 ± 11% compared with Ad-GFP, n = 4, P < 0.05) without affecting the intercellular adhesion protein, N-cadherin. The phosphorylation of ERK1/2, an intracellular signaling kinase downstream of EGFR transactivation, was augmented by HB-EGF (3.2 ± 1.0-fold compared with Ad-GFP, n = 4, P < 0.05). Northern analysis showed that HB-EGF did not reduce Cx43 gene expression, suggesting that HB-EGF decreases Cx43 by posttranslational modification (Fig. 2B). AG 1478 (10 iLM), a specific inhibitor of EGFR tyrosine kinase, abolished the effect of HB-EGF on Cx43 (Fig. 2C), indicating that the decrease in Cx43 content depends on EGFR transactivation by HB-EGF. The conditioned medium from Ad-HB-EGF-infected cells did not change expression of Cx43 in naive cells, even though ERK1/2 was slightly activated by the conditioned medium (Fig. 1D). These data are consistent with the hypertrophy data presented above, demonstrating that HB-EGF can act as a predominantly autocrine factor both in hypertrophy and in the reduction of Cx43 content in cardiomyocytes.

Computational Analysis Predicts HB-EGF Autocrine/Paracrine Signaling in Vivo.

Although these in vitro experiments showed HB-EGF as a predominantly autocrine cardiac growth factor, HB-EGF signaling in vivo takes place in a very different environment. Therefore, we sought to determine the extent that soluble HB-EGF may travel in the interstitial space of the myocardium with a simple 2D model of HB-EGF diffusion (Fig. 3A). An approximate geometric representation of myocytes in cross-section is a square (15 x 15 iLm), with each of the corners occupied by a capillary (diameter 5 iLm). The cell shape was chosen so that the extracellular matrix width (0.5 iLm), in which soluble HB-EGF is free to diffuse, was constant around all tissue features. This model geometry is based on a square array of capillaries; although a hexagonal pattern of capillary distribution is commonly accepted, the results are not expected to be substantially different with this simpler construction, because both have four capillaries surrounding each myocyte. The model represents a single central cell that is releasing HB-EGF at a constant rate, Rgen, (approximated from the HB-EGF concentration measurement in conditioned medium) into the extracellular space. HB-EGF then can diffuse throughout this space, or enter a capillary and leave the system. This system is governed by
  • the diffusion equation at steady state (DV2C = 0),
  • the boundary condition for the ligand producing cell (—DVC = Rgen),
  • the boundary condition for all other cells (—DVC = 0), and
  • the capillary boundary condition (DVC = h(C — Cblood)).

C denotes HB-EGF concentration, D is the diffusivity constant, h is the mass transfer coefficient, and Cblood is the concentration of HB-EGF in the blood, approximated to be zero.  The numerical solution in Fig. 3B illustrates that HB-EGF remained localized around the cell which produced it and did not diffuse farther because of the sink-like effect of the capillaries. The maximum concentration of soluble HB-EGF achieved is 0.27 nM, which is near the threshold level of HB-EGF measured to stimulate cardiomyocyte growth (2,000 pg/ml). Therefore, the central HB-EGF-producing cell only signals to its four adjacent neighbors where the HB-EGF concentration reaches this threshold. However, if the model geometry is altered to reflect a 50% and 150% increase in cross-sectional area in all cells because of hypertrophy, estimated from 1 and 4 weeks of transverse aortic constriction, the maximum concentration achieved increases slightly to 0.29 nM and 0.37 nM, respectively. As the cell width increases, HB-EGF must diffuse farther to reach a capillary, exposing adjacent cells to a higher concentration during hypertrophy. However, no additional cells are exposed to HB-EGF. 

Fig. 3. Computational modeling of HB-EGF diffusion in the myocardium.

Red areas represent capillaries, green represents the HB-EGF ligand producing cell, pink represents adjacent cells, and white is an extracellular matrix where HB-EGF is free to diffuse. (A) The model geometry where HB-EGF is generated by the ligand-producing cell at a constant rate, Rgen, and diffuses throughout the extracellular space or enters a capillary and leaves the system with a mass transfer coefficient, h. (B) Numerical solution of the steady-state HB-EGF concentration profile with Rgen = 10 cell-1s-1, D = 0.7 µm2/s, and h = 0.02 µm/s, where concentration is shown by the color scale and height depicted. The maximum concentration achieved with the stated parameters was 0.27 nM from a capillary. Myocyte length was assumed to be 100 µm.

The driving force that determined the extent to which HB-EGF traveled was the rate of HB-EGF transfer into the capillaries and the diffusivity of HB-EGF. The exact mechanism of macromolecule transport into capillaries is unknown; however, it is most likely through diffusion, transcytosis, or a combination of the two. In the case of diffusion, the mass transfer coefficient governing the flux of HB-EGF through the capillary wall is coupled to the diffusivity of HB-EGF, whereas the terms are uncoupled for the case of transcytosis. Therefore, this model assessed transcytosis as a conservative scenario for HB-EGF localization. Parameter perturbation with uncoupled diffusion and capillary mass transfer showed that HB-EGF remained localized around the origin of production and diffused only to immediate neighbors for mass transfer coefficients >0.002 µm/s. For values <0.002 µm/s, HB-EGF diffused distances more than two cells away from the origin. Although the actual mass transfer coefficient of ligands in the size range of HB-EGF is unknown, values for O2 (0.02 µm/s, 0.032 kDa) (19) and LDL (1.7 x 10-5 µm/s, 2,000–3,000 kDa) (20) have been reported, and we assumed HB-EGF is in the upper end of that range due to its small size. HB-EGF also binds to EGFRs, the extracellular matrix, and cell surface heparan sulfate proteoglycans. EGFR binding and internalization could serve to further localize HB-EGF. The number of extracellular binding sites does not affect the steady-state HB-EGF concentration profile if this binding is reversible. However, these binding sites could serve to localize HB-EGF as the cell begins to produce the ligand by slowing the travel of HB-EGF to the capillaries in the approach to the steady state, or as a source of HB-EGF as the cell slows or stops HB-EGF production. At a diffusivity of 0.7 µm2/s (21), HB-EGF traveled only one cell away, but traveled approximately five cells away at 51.8 µm2/s (22), with a peak concentration below the estimated threshold for stimulating.

Overexpression of HB-EGF Causes Hypertrophy on the Infected Cell and Its Immediate Neighbor in Vivo.

To explore whether HB-EGF signals operate in a spatially restricted local circuit in the in vivo myocardial extracellular space as predicted by computational modeling, adenoviral vectors were injected directly into the left ventricular free wall in 26 male mice (Ad-GFP, n = 12; Ad-HB-EGF, n = 14). Of the 26 mice, 5 (4 Ad-GFP and 1 Ad-HB-EGF) mice died after the surgery. Gene expression was confirmed as positive cellular fluorescence in the presence of GFP, allowing determination of which cells were infected at 7 days (Fig. 4A). Immunohis-tochemical staining revealed that HB-EGF was localized on the Ad-HB-EGF-infected cell membrane or in the extracellular space around the overexpressing cell (Fig. 4A). For comparison, remote cells were defined as noninfected cells far (15–20 cell dimensions) from the adenovirus-infected area and in the same field as infected cells. Conventional 2D cross-sectional analysis blinded to treatment group (Fig. 4B) showed that Ad-GFP-infected cells (n = 102) resulted in no cellular hypertrophy compared with noninfected, adjacent (n = 92), or remote (n = 97) cells (2D myocyte cross-sectional area, 250 ± 7 versus 251 ± 7 or 255 ± 6 µm2, respectively). These data suggest that expression of GFP in these conditions does not cause cellular hypertrophy. However, overexpression of HB-EGF caused hypertrophy in both Ad-HB-EGF-infected cells (a 41 ± 5% increase of Ad-GFP-infected cells, n = 119, P < 0.01) and noninfected adjacent cells (a 33 ± 5% increase of Ad-GFP-adjacent cells, n = 97, P < 0.01) compared with remote cells (n = 109). Because 2D analysis of cardiomyocyte hypertrophy can be influenced by the plane of sectioning, we then developed a 3D histology approach that allowed reconstruction of cardiomyocytes in situ (Fig. 4C). We performed an independent 3D histology analysis of cardiomyocytes to determine cell volumes, blinded to treatment group (Fig. 4B). The volumes of both HB-EGF-infected cells (n = 19, 42,700 ± 4,000 µm3) and their adjacent cells (n = 11, 33,500 ± 3,300 µm3) were significantly greater than volumes of remote cells (n = 13, 18,600 ± 1,700 µm3, P < 0.01 vs. HB-EGF-infected cells and P < 0.05 vs. HB-EGF-adjacent cells, Fig. 4D). In contrast, cells treated with Ad-GFP (n = 12) showed no hypertrophy in the Ad-GFP-adjacent (n = 10) or remote cells (n = 9). These data demonstrate that HB-EGF acts as both an autocrine and local paracrine growth factor within myocardium, as predicted by computational modeling.

Degradation of Cx43 Through Local Autocrine/Paracrine HB-EGF

To determine whether the spatially confined effect of HB-EGF reduces local myocardial Cx43 in vivo, Cx43 was assessed with immunohistochemistry and confocal fluorescence imaging. Cells infected with Ad-HB-EGF had significant decreases in Cx43 immunoreactive signal compared with Ad-GFP cells, consistent with the results of in vitro immunoblotting (Fig. 5A). Quantitative digital image analyses of Cx43 in a total of 22 fields in 6 Ad-HB-EGF hearts and 19 fields in 4 Ad-GFP hearts were analyzed (Fig. 5B). Although Ad-GFP-infected cells showed immunoreactive Cx43 at the appositional membrane, overexpression of HB-EGF increased Cx43 in intracellular vesicle-like components (Fig. 5C), with reduced gap junction plaques (percent Cx43 area per cell area, 52 ± 8% of Ad-GFP control, P < 0.01). These data suggest that reduced expression of Cx43 can be attributed to an increased rate of internalization and degradation in gap junction plaques in cardiomyocytes. Interestingly, HB-EGF secretion by a given cardiomyocyte caused a 37 ± 13% reduction of Cx43 content in its adjacent cells compared with GFP controls (P < 0.05). As degradation of Cx43 may accompany structural changes with marked rearrangement of intercellular connections.  In contrast to Cx43, there was no significant difference in total area occupied by N-cadherin immunoreactive signal in between Ad-GFP (n = 19) and Ad-HB-EGF hearts (1.8 ± 0.5-fold compared with Ad-GFP, n = 17, P = not significant), indicating that HB-EGF has a selective effect on Cx43. Taken together, these data show that HB-EGF leads to cardiomyocyte hypertrophy and degradation of Cx43 in the infected cell and its immediately adjacent neighbors because of autocrine/ paracrine signaling. It should be noted, however, that quantifying the Cx43 from immunostaining could be limited by a nonlinear relation between the amount of Cx43 present and the area of staining.

Fig. 4. Effects of gene transfer of HB-EGF on cardiomyocyte hypertrophy in vivo.

(A) Adenoviral vectors (Ad-GFP or Ad-HB-EGF) were injected into the left ventricular free wall in mice. Myocytes were grouped as infected or noninfected on the basis of GFP fluorescence. Overex-pression of HB-EGF was confirmed by im-munohistochemistry. The presented image was pseudocolored with blue from that stained with Alexa Fluor 555 for the presence of HB-EGF. (Scale bars: 20 sm.) (B) 2D cross-sectional area of cardiomyo-cytes was measured in infected and non-infected cells in the same region of the same animal. Overexpression of HB-EGF caused cellular hypertrophy in both infected and adjacent cells. **, P < 0.01 vs. Ad-GFP infected; , P < 0.01 vs. Ad-HB-EGF remote; and §, P < 0.01 vs. Ad-GFP adjacent cells. GFP (infected 102 cells, adjacent 92 cells, and remote 97 cells from 5 mice), and HB-EGF (infected 119 cells, adjacent 97 cells, and remote 109 cells from 7 mice). The 3D histology also revealed cellular hypertrophy in both Ad-HB-EGF-infected cell and its adjacent cell. **, P < 0.01 vs. Ad-GFP infected; , P < 0.01; and *, P < 0.05 vs. Ad-HB-EGF remote cells. GFP (infected 12 cells, adjacent 10 cells, and remote 9 cells), and HB-EGF (infected 19 cells, adjacent 11 cells, and remote 13 cells). Statistical analysis was performed with one-way ANOVA. (C) Sample image of extracted myocytes in three dimensions.

Discussion

We have demonstrated in this study that HB-EGF secreted by cardiomyocytes leads to cellular growth and reduced expression of the principal ventricular gap junction protein Cx43 in a local autocrine/paracrine manner. Although proHB-EGF is biologically active as a juxtacrine growth factor that can signal to immediately neighboring cells in a nondiffusible manner, several studies have revealed the crucial role of metalloproteases in the enzymatic conversion of proHB-EGF to soluble HB-EGF, which binds to and activates the EGFR. Hypertrophic stimuli such as mechanical strain and G protein-coupled receptors agonists mediate cardiac hypertrophy through the shedding of membrane-bound proHB-EGF. Thus, an autocrine/paracrine loop, which requires the diffusible, soluble form of HB-EGF, is necessary for subsequent transactivation of the EGFR to produce the hypertrophic response.

To our knowledge, there have been no previous reports concerning the spatial extent of autocrine/paracrine ligand distribution and signaling in myocardial tissue. A theoretical analysis by Shvartsman et al. predicted, from computational modeling in an idealized cell culture environment, that autocrine ligands may remain highly localized, even within subcellular distances; this prediction has support from experimental data in the EGFR system. In contrast, a theoretical estimate by Francis and Palsson has suggested that cytokines might effectively communicate larger distances, approximated to be 200–300 m from the point of release. However, these studies have all focused on idealized cell culture systems, so our combined experimental and computational investigation here aimed at understanding both in vitro and in vivo situations offers insight.
Our computational model of diffusion in the extracellular space predicts that HB-EGF acts as both an autocrine and spatially restricted paracrine growth factor for neighboring cells. We studied the responses of the signaling cell and its immediate neighbors compared with more distant cells. For a paracrine signal to be delivered to its proper target, the secreted signaling molecules cannot diffuse too far; in vitro experiments, in fact, indicated that HB-EGF acts as a predominantly autocrine signal in cell culture, where diffusion into the medium is relatively unconstrained.
In contrast, in the extracellular space of the myocardium, HB-EGF is localized around the source of production because of tissue geometry, thereby acting in a local paracrine or autocrine manner only. Indeed, our results from in vivo gene transfer demonstrated that both the cell releasing soluble HB-EGF and its surrounding cells undergo hypertrophy. This localized conversation between neighboring cells may allow remodeling to be fine-tuned on a highly spatially restricted level within the myocardium and in other tissues.

Common genetic variation at the IL1RL1locus regulates IL-33/ST2 signaling

JE Ho, Wei-Yu Chen, Ming-Huei Chen, MG Larson, ElL McCabe, S Cheng, A Ghorbani, E Coglianese, V Emilsson, AD Johnson,….. CARDIoGRAM Consortium, CHARGE Inflammation Working Group, A Dehghan, C Lu, D Levy, C Newton-Cheh, CHARGE Heart Failure Working Group, …. JL Januzzi, RT Lee, and TJ Wang J Clin Invest Oct 2013; 123(10):4208-4218.  http://dx.doi.org/10.1172/JCI67119

Abstract and Introduction

The suppression of tumorigenicity 2/IL-33 (ST2/IL-33) pathway has been implicated in several immune and inflammatory diseases. ST2 is produced as 2 isoforms. The membrane-bound isoform (ST2L) induces an immune response when bound to its ligand, IL-33. The other isoform is a soluble protein (sST2) that is thought to be a decoy receptor for IL-33 signaling. Elevated sST2 levels in serum are associated with an increased risk for cardiovascular disease. We investigated the determinants of sST2 plasma concentrations in 2,991 Framing­ham Offspring Cohort participants. While clinical and environmental factors explained some variation in sST2 levels, much of the variation in sST2 production was driven by genetic factors. In a genome-wide associ­ation study (GWAS), multiple SNPs within IL1RL1 (the gene encoding ST2) demonstrated associations with sST2 concentrations. Five missense variants of IL1RL1 correlated with higher sST2 levels in the GWAS and mapped to the intracellular domain of ST2, which is absent in sST2. In a cell culture model, IL1RL1 missense variants increased sST2 expression by inducing IL-33 expression and enhancing IL-33 responsiveness (via ST2L). Our data suggest that genetic variation in IL1RL1 can result in increased levels of sST2 and alter immune and inflammatory signaling through the ST2/IL-33 pathway. Suppression of tumorigenicity 2 (ST2) is a member of the IL-1 receptor (IL-1R) family that plays a major role in immune and inflammatory responses. Alternative promoter activation and splicing produces both a membrane-bound protein (ST2L) and a soluble form (sST2). The transmembrane form of ST2 is selectively expressed on Th2- but not Th1-type T cells, and bind­ing of its ligand, IL-33, induces Th2 immune responses.  In contrast, the soluble form of ST2 acts as a decoy receptor by sequestering IL-33. The IL-33/ST2 pathway has important immunomodulatory effects. Clinically, the ST2/IL-33 signaling pathway participates in the pathophysiology of a number of inflammatory and immune diseases related to Th2 activation, including asthma, ulcera­tive colitis, and inflammatory arthritis. ST2 expression is also upregulated in cardiomyocytes in response to stress and appears to have cardioprotective effects in experimental studies. As a biomarker, circulating sST2 concentrations have been linked to worse prognosis in patients with heart failure, acute dyspnea, and acute coronary syndrome, and also predict mortality and incident cardiovascular events in individuals without existing cardiovascular disease. Both sST2 and its transmembrane form are encoded by IL-1R– like 1 (IL1RL1). Genetic variation in this pathway has been linked to a number of immune and inflammatory diseases. The contribution of IL1RL1 locus variants to interindividual variation in sST2 has not been investigated. The emergence of sST2 as an important predictor of cardiovascular risk and the important role outside of the ST2/IL-33 pathway in inflammatory diseases highlight the value of understanding genetic determinants of sST2. The fam­ily-based FHS cohort provides a unique opportunity to examine the heritability of sST2 and to identify specific variants involved using a genome-wide association study (GWAS). Thus, we per­formed a population-based study to examine genetic determinants of sST2 concentrations, coupled with experimental studies to elu­cidate the underlying molecular mechanisms.

Results

Clinical characteristics of the 2,991 FHS participants are presented in Supplemental Table 1 (supplemental material available online with this article; doi:10.1172/JCI67119DS1). The mean age of participants was 59 years, and 56% of participants were women. Soluble ST2 concentrations were higher in men compared with those in women (P < 0.001). Soluble ST2 concentrations were positively associated with age, systolic blood pressure, body-mass index, antihypertensive medication use, and diabetes mellitus (P < 0.05 for all). Together, these variables accounted for 14% of the variation in sST2 concentrations. The duration of hypertension or diabetes did not materially influence variation in sST2 concentra­tions. After additionally accounting for inflammatory conditions, clinical variables accounted for 14.8% of sST2 variation.

Heritability of sS72.

The age- and sex-adjusted heritability (h2) of sST2 was 0.45 (P = 5.3 x 10–16), suggesting that up to 45% of the vari­ation in sST2 not explained by clinical variables was attributable to genetic factors. Multivariable adjustment for clinical variables pre­viously shown to be associated with sST2 concentrations (21) did not attenuate the heritability estimate (adjusted h2 = 0.45, P = 8.2 x 10–16). To investigate the influence of shared environmental fac­tors, we examined the correlation of sST2 concentrations among 603 spousal pairs and found no significant correlation (r = 0.05, P = 0.25).

Genetic correlates of sS72.

We conducted a GWAS of circulating sST2 concentrations. Quantile-quantile, Manhattan, and regional linkage disequilibrium plots are shown in Supplemental Figures 1–3.  All genome-wide significant SNPs were located in a 400-kb linkage disequilibrium block that included IL1RL1 (the gene encoding ST2), IL1R1, IL1RL2, IL18R1, IL18RAP, and SLC9A4 (Figure 1). Results for 11 genome-wide significant “indepen­dent” SNPs, defined as pairwise r2 < 0.2, are shown in Table 1. In aggregate, these 11 “independent” genome-wide significant SNPs across the IL1RL1 locus accounted for 36% of heritability of sST2. In conditional analyses, 4 out of the 11 SNPs remained genome-wide significant, independent of each other (rs950880, rs13029918, rs1420103, and rs17639215), all within the IL1RL1 locus. The most significant SNP (rs950880, P = 7.1 x 10–94) accounted for 12% of the residual interindividual variability in circulating sST2 concentrations. Estimated mean sST2 concen­trations were 43% higher in major homozygotes (CC) compared with minor homozygotes (AA). Tree loci outside of the IL1RL1 locus had suggestive associations with sST2 (P < 1 x 10–6) and are displayed in Supplemental Table 3.

In silico association with expression SNPs.

The top 10 sST2 SNPs (among 11 listed in Table 1) were explored in collected gene expression databases. There were 5 genome-wide significant sST2 SNPs associated with gene expression across a variety of tissue types (Table 2). Specifically, rs13001325 was associated with IL1RL1 gene expression (the gene encoding both soluble and transmembrane ST2) in several subtypes of brain tissue (prefrontal cortex, P = 1.95 x 10–12; cerebellum, P = 1.54 x 10–5; visual cortex, P = 1.85 x 10–7). The CC genotype of rs13001325 was associated with a higher IL1RL1 gene expression level as well as a higher circulating sST2 concentration when compared with the TT genotype (Supplemental Figure 4). Other ST2 variants were significantly associated with IL18RAP (P = 8.50 x 10–41, blood) and IL18R1 gene expression (P = 2.99 x 10–12, prefrontal cortex).

In silico association with clinical phenotypes in published data. 

The G allele of rs1558648 was associated with lower sST2 concentra­tions in the FHS (0.88-fold change per G allele, P = 3.94 x 10–16) and higher all-cause mortality (hazard ratio [HR] 1.10 per G allele, 95% CI 1.03–1.16, P = 0.003) in the CHARGE consortium, which observed 8,444 deaths in 25,007 participants during an average fol­low-up of 10.6 years (22). The T allele of rs13019803 was associated with lower sST2 concentrations in the FHS (0.87-fold change per G allele, P = 5.95 x 10–20), higher mortality in the CHARGE consor­tium (HR 1.06 per C allele, 95% CI 1.01–1.12, P = 0.03), and higher risk of coronary artery disease (odds ratio 1.06, 95% CI 1.00–1.11, P = 0.035) in the CARDIoGRAM consortium, which included 22,233 individuals with coronary artery disease and 64,762 controls (23). In relating sST2 SNPs to other clinical phenotypes (including blood pressure, body-mass index, lipids, fasting glucose, natriuretic peptides, C-reactive protein, and echocardiographic traits) in pre­viously published studies, we found nominal associations with C-reactive protein for 2 SNPs (Supplemental Table 4).

Putative functional variants.

Using GeneCruiser, we examined nonsynonymous SNPs (nSNPs) (missense variants) that had at least suggestive association with sST2 (P < 1 x 10–4), includ­ing SNPs that served as proxies (r2 = 1.0) for nSNPs within the 1000 Genomes Pilot 1 data set (ref. 24 and Table 3). There were 6 missense variants located within the IL1RL1 gene, 5 of which had genome-wide significant associations with sST2 concen­trations, including rs6749114 (proxy for rs10192036, Q501K), rs4988956 (A433T), rs10204137 (Q501R), rs10192157 (T549I), rs10206753 (L551S), and rs1041973 (A78AE). Base substitutions and corresponding amino acid changes for these coding muta­tions are listed in Table 3. In combination, these 6 missense muta­tions accounted for 5% of estimated heritability, with an effect estimate of 0.23 (standard error [s.e.] 0.02, P = 2.4 x 10–20). When comparing major homozygotes with minor homozygotes, the esti­mated sST2 concentrations for these missense variants differed by 11% to 15% according to genotype (Supplemental Table 5). In conditional analyses, intracellular and extracellular variants appeared to be independently associated with sST2. For instance, in a model containing rs4988956 (A433T) and rs1041973 (A78E), both SNPs remained significantly associated with sST2 (P = 2.61 x 10–24 and P = 7.67 x 10–15, respectively). In total, missence variants added little to the proportion of sST2 variance explained by the 11 genome-wide significant nonmissense variants listed in Table 1. In relating these 6 missense variants to other clinical phenotypes in large consortia, we found an association with asthma for 4 out of the 6 variants (lowest P = 4.8 x 10–12 for rs10204137) (25).

Homology map of IL1RL1 missense variants and ST2 structure.

Of the 6 missense variants mapping to IL1RL1, 5 were within the cytoplas­mic Toll/IL-1R (TIR) domain of the transmembrane ST2 receptor (Figure 2A), and these intracellular variants are thus not part of the circulating sST2 protein. Of these cytoplasmic domain variants, A433T was located within the “box 2” region of sequence conserva­tion, described in the IL-1R1 TIR domain as important for IL-1 sig­naling . Q501R/K was within a conserved motif called “box 3,” but mutants of IL-1R1 in box 3 did not significantly affect IL-1 signaling in previous experiments (26). Both T549I and L551S were near the C terminus of the transmembrane ST2 receptor and were not predicted to alter signaling function based on previous exper­iments with the IL-1R . The A78E SNP was located within the extracellular domain of ST2 and is thus present in both the sST2 isoform and the transmembrane ST2 receptor. In models of the ST2/IL-33/IL-1RAcP complex derived from a crystal structure of the IL-1RII/IL-1β/IL-1RAcP complex (protein data bank ID 1T3G and 3O4O), A78E was predicted to be located on a surface loop within the first immunoglobulin-like domain (Figure 2B), distant from the putative IL-33 binding site or the site of interaction with IL-1RAcP. There were 2 rare extracellular variants that were not cap­tured in our GWAS due to low minor allele frequencies (A80E, MAF 0.008; A176T, MAF 0.002). Both were distant from the IL-33 bind­ing site on homology mapping and unlikely to affect IL-33 binding.

Functional effects of IL1RL1 missense variants on sST2 expression and promoter activity.

Since 5 of the IL1RL1 missense variants asso­ciated with sST2 levels mapped to the intracellular domain of ST2L and hence are not present on sST2 itself, we hypothesized that these missense variants exert effects via intracellular mecha­nisms downstream of ST2 transmembrane receptor signaling to regulate sST2 levels. To investigate the effect of IL1RL1 missense variants (identified by GWAS) on sST2 expression, stable cell lines expressing WT ST2L, IL1RL1 variants (A78E, A433T, T549I, Q501K, Q501R, and L551S), and a construct containing the 5 IL1RL1 intracellular domain variants (5-mut) were generated. Expression of ST2L mRNA and protein (detected in membrane fractions) was confirmed (Supplemental Figures 5 and 6). Eight different stable clones in each group were analyzed to reduce bias from clonal selection. Intracellular domain variants (A433T, T549I, Q501K, Q501R, L551S, and 5-mut), but not the extracellular domain variant (A78E), were associated with increased basal sST2 expression when compared with WT expression (P < 0.05 for all, Figure 3A). sST2 expression was highest in the 5-mut construct, suggesting that intracellular ST2L variants cooperatively regulate sST2 levels. This same pattern was consistent across different cell types (U937, Jurkat T, and A549 cells; Supplemental Figure 7). These findings suggest that intracellular domain variants of the transmembrane ST2 receptor may functionally regulate downstream signaling.   IL1RL1 transcription may occur via two alternative promoters (proximal vs. distal), which leads to differential expression of the soluble versus membrane-bound ST2 proteins. Similar to the sST2 protein expression results above, the intracellular domain variants, but not the extracellular domain variant, were associated with higher basal proximal promoter activity. Dis­tal promoter activity was also increased for most intracellular domain variants (Supplemental Figure 8).

IL1RL1 intracellular missense variants resulted in higher IL-33 pro­tein levels.

In addition to upregulation of sST2 protein levels, IL1RL1 intracellular missense variants caused increased basal IL-33 protein expression (Figure 3B), suggesting a possible autoregulatory loop whereby IL-33 signaling positively induces sST2 expression. IL-33 induced sST2 protein expression in cells expressing both WT and IL1RL1 missense variants. Interest­ingly, this effect was particularly pronounced in the A433T and Q501R variants (Supplemental Figure 9A).

Enhanced IL-33 responsiveness is mediated by IL-113 in A433T and Q501R variants.

Interaction among IL-33, sST2, and IL-113.

Inhibition of IL-113 by anti–IL-113 mAb reduced basal expression of sST2 (Supplemental Figure 11A). Blocking of IL-33 by sST2 did not reduce the induction of IL-113 levels by the IL1RL1 variants (Supplemental Figure 11B). Furthermore, inhibition of IL-113 by anti–IL-113 reduced the basal IL-33 levels. IL-33 itself upregulated sST2 levels, which in turn reduced IL-33 levels (Supplemental Figure 11C). Our results revealed that both IL-33 and IL-113 drive sST2 expression and that IL-113 acts as an upstream inducer of IL-33 and maintains IL-33 expression by intracellular IL1RL1 vari­ants (Supplemental Figure 11D). This suggests that IL1RL1 vari­ants upregulated sST2 mainly through IL-33 autoregulation and that the enhanced IL-33 responsiveness by A433T and Q501R was mediated by IL-113 upregulation.

IL1RL1 missense variants modulate ST2 signaling pathways

The effect of IL1RL1 missense variants on known ST2 downstream regulatory pathways, including NF-KB, AP-1/c-Jun, AKT, and STAT3 , was examined in the presence and absence of IL-33 (Figure 4 and Supplemental Figure 12). The IL1RL1 intracellular missense vari­ants (A433T, T549I, Q501K, Q501R, and L551S) were associated with higher basal phospho–NF-KB p65 and phospho–c-Jun levels (Figure 4, A and B). Consistent with enhanced IL-33 responsive­ness in A433T and Q501R cells, levels of IL-33–induced NF-KB and c-Jun phosphorylation were enhanced in these 2 variants (Figure 4, B and D). In contrast, A433T and Q501R variants showed lower basal phospho-AKT levels (Figure 4E). ……….. The majority of sST2 gene variants in our study were located within or near IL1RL1, the gene coding for both transmembrane ST2 and sST2. IL1RL1 resides within a linkage disequilibrium block of 400 kb on chromosome 2q12, a region that includes a number of other cytokines, including IL-18 receptor 1 (IL18R1) and IL-18 receptor accessory protein (IL18RAP). Polymorphisms in this gene cluster have been associated previously with a num­ber of immune and inflammatory conditions, including asthma, celiac disease, and type 1 diabetes mellitus . Many of these variants were associated with sST2 concentrations in our analysis (Supplemental Table 6). The immune effects of ST2 are corroborated by experimental evidence: membrane-bound ST2 is selectively expressed on Th2- but not Th1-type T helper cells, and activation of the ST2/IL-33 axis elaborates Th2 responses. In general, the allergic phenotypes above are thought to be Th2-mediated processes, in contrast to atherosclerosis, which appears to be a Th1-driven process.

Fig 2 Models of ST2 illustrate IL1RL1 missense variant locations.

Figure 2 Models of ST2 illustrate IL1RL1 missense variant locations.

Models of the (A) intracellular TIR domain (ST2-TIR) and the (B) extracellular domain (ST2-ECD) of ST2 (protein data bank codes 3O4O and 1T3G, respectively). Domains of ST2 are shown in yellow, with identified mis-sense SNP positions represented as red spheres and labels. Note that positions 549 and 551 are near the C terminus of ST2, which is not defined in the crystal structure (protein data bank ID 1T3G, shown as dashed black line in A). Arrows point toward the transmembrane domain, which is also not observed in crystal structures.

Fig 3 IL1RL1 intracellular missense variants resulted in higher sST2 and IL-33.

Figure 3   IL1RL1 intracellular missense variants resulted in higher sST2 and IL-33.

Media from KU812 cells expressing WT and IL1RL1 missense variants were collected for ELISA analysis of (A) sST2, (B) IL-33, and (C) IL-113 levels. Horizontal bars indicate mean values, and symbols represent indi­vidual variants. *P < 0.05, **P < 0.01 vs. WT. (D) Effect of anti–IL-113 mAb on IL-33–induced sST2 expression. Dashed line indicates PBS-treated cells as referent group. Error bars represent mean ± SEM from 2 independent experiments. *P < 0.05 vs. IL-33.

Fig 4 IL1RL1 missense variants modulated ST2 signaling pathways

Figure 4  IL1RL1 missense variants modulated ST2 signaling pathways. 

KU812 cells expressing WT or IL1RL1 variants were treated with PBS or IL-33. Levels of the following phosphorylated proteins were detected in cell lysates using ELISA: (A and B) phospho-NF-KB p65; (C and D) phospho-c-Jun activity; and (E and F) phospho-AKT. (A, C, and E) White bars represent basal levels, and (B, D, and F) gray bars represent relative fold increase (compared with PBS-treated group) after IL-33 treatment. *P < 0.05 vs. WT; **P < 0.01 vs. PBS-treated group. Dashed line in B, D, and F represents PBS-treated cells as referent group. Error bars represent mean ± SEM from 2 independent experiments. Fig 5 IL-33–induced sST2 expression is enhanced with mTOR inhibition and occurs via ST2L-dependent signaling.

Figure 5  IL-33–induced sST2 expression is enhanced with mTOR inhibition and occurs via ST2L-dependent signaling.

(A) sST2 mRNA expression in KU812 cells after treatment with DMSO, IL-33, or IL-33 plus signal inhibitors (wortmannin, LY294002, rapamycin, PD98059, SP60125, BAY11-7082, or SR11302). (B) ST2L mRNA and (C) sST2 mRNA expression in KU812 cells treated with PBS (white columns), rapamycin (rapa), anti-ST2 mAb, IL-33, IL-33 plus anti-ST2, IL-33 plus rapamycin, IL-33 plus rapamycin plus anti-ST2 mAb, or rapamycin plus anti-ST2. (D) IL33 mRNA expression in KU812 cells after treatment with DMSO, signal inhibitors, IL-33 plus signal inhibitors, and IL-1n plus signal inhibitors. *P < 0.05 vs. PBS-treated group; #P < 0.05 vs. IL-33–treated group; &P < 0.05 vs. IL-1n–treated group. Error bars represent mean ± SEM from 2 independent experiments. (E) A schematic model illustrating the regulation of sST2 expression by IL1RL1 missense variants through enhanced induction of IL-33 via enhanced NF-KB and AP-1 signaling and enhanced IL-33 responsiveness via increasing ST2L expression.

Quantitating subcellular metabolism with multi-isotope imaging mass spectrometry

ML Steinhauser, A Bailey, SE Senyo, C Guillermier, TS Perlstein, AP Gould, RT Lee, and CP Lechene
Department of Medicine, Divisions of Cardiovascular Medicine & Genetics, Brigham and Women’s Hospital, Harvard Medical School & Harvard Stem Cell Institute Division of Physiology and Metabolism, Medical Research Council National Institute for Medical Research, Mill Hill, London, UK National Resource for Imaging Mass Spectroscopy
Nature 2012;481(7382): 516–519.   http://dx. do.org/10.1038/nature10734

Mass spectrometry with stable isotope labels has been seminal in discovering the dynamic state of living matter, but is limited to bulk tissues or cells. We developed multi-isotope imaging mass spectrometry (MIMS) that allowed us to view and measure stable isotope incorporation with sub-micron resolution. Here we apply MIMS to diverse organisms, including Drosophila, mice, and humans. We test the “immortal strand hypothesis,” which predicts that during asymmetric stem cell division chromosomes containing older template DNA are segregated to the daughter destined to remain a stem cell, thus insuring lifetime genetic stability. After labeling mice with 15N-thymidine from gestation through post-natal week 8, we find no 15N label retention by dividing small intestinal crypt cells after 4wk chase. In adult mice administered 15N-thymidine pulse-chase, we find that proliferating crypt cells dilute label consistent with random strand segregation. We demonstrate the broad utility of MIMS with proof-of-principle studies of lipid turnover in Drosophila and translation to the human hematopoietic system. These studies show that MIMS provides high-resolution quantitation of stable isotope labels that cannot be obtained using other techniques and that is broadly applicable to biological and medical research. MIMS combines ion microscopy with secondary ion mass spectrometry (SIMS), stable isotope reporters, and intensive computation (Supplemental Fig 1). MIMS allows imaging and measuring stable isotope labels in cell domains smaller than one micron cubed. We tested the potential of MIMS to quantitatively track DNA labeling with 15N-thymidine in vitro. In proliferating fibroblasts, we detected label incorporation within the nucleus by an increase in the 15N/14N ratio above natural ratio (Fig 1a). The labeling pattern resembled chromatin with either stable isotope-tagged thymidine or thymidine analogs (Fig 1b). We measured dose-dependent incorporation of 15N-thymidine over three orders of magnitude (Fig 1d, Supplemental Fig 2). We also tracked fibroblast division after a 24-hour label-free chase (Fig 1d,e, Supplemental Fig 3). Cells segregated into two populations, one indistinguishable from control cells suggesting no division, the other with halving of label, consistent with one division during chase. We found similar results by tracking cell division in vivo in the small intestine (Fig 1f,g, Supplemental Figs 4–6). We measured dose-dependent 15N-thymidine incorporation within nuclei of actively dividing crypt cells (Fig 1g, Supplemental Fig 4), down to a dose of 0.1µg/ g (Supplemental Fig 2). The cytoplasm was slightly above natural ratio, likely due to low level soluble 15N-thymidine or mitochondrial incorporation (Supplemental Fig 2). We measured halving of label with each division during label-free chase (Supplemental Fig 6). We then tested the “immortal strand hypothesis,” a concept that emerged from autoradiographic studies and that predicted long-term label retaining cells in the small intestinal crypt. It proposes that asymmetrically dividing stem cells also asymmetrically segregate DNA, such that older template strands are retained by daughter cells that will remain stem cells and newer strands are passed to daughters committed to differentiation (Supplemental Fig 7)5,6. Modern studies continue to argue both for or against the hypothesis, leading to the suggestion that definitive resolution of the debate will require a new experimental approach. Although prior evidence suggests a concentration of label-retaining cells in the +4 anatomic position, we searched for DNA label retention irrespective of anatomic position or molecular identity. We labeled mice with 15N-thymidine for the first 8 wks of life when intestinal stem cells are proposed to form. After a 4-wk chase, mice received bromodeoxyuridine (BrdU) for 24h prior to sacrifice to identify proliferating cells(Fig 2a, Supplemental Fig 8: Exp 1), specifically crypt base columnar (CBC) cells and transit amplifying cells (TA) (Supplemental Fig 9), which cycle at a rate of one and two times per 24h, respectively (Supplemental Fig 10). All crypt cell nuclei were highly labeled upon completion of 15N-thymidine; after a four-week chase, however, we found no label retention by non-Paneth crypt cells (Fig 2b–f; n=3 mice, 136 crypts analysed). 15N-labeling in BrdU−/15N+ Paneth and mesenchymal cells was equivalent to that measured at pulse completion (Fig2b,c) suggesting quiescence during the chase (values above 15N/14N natural ratio: Paneth pulse=107.8 +/− 5.0% s.e.m. n=51 vs Paneth pulse-chase=96.3+/−2.8% s.e.m. n=218; mesenchymal pulse=92.0+/−5.0% s.e.m. n=89 vs mesenchymal pulse-chase=90.5+/ −2.2% s.e.m. n=543). The number of randomly selected crypt sections was sufficient to detect a frequency as low as one label-retaining stem cell per crypt irrespective of anatomic location within the crypt. Because each anatomic level contains approximately 16 circumferentially arrayed cells, a 2-dimensional analysis captures approximately 1/8th of the cells at each anatomic position (one on each side of the crypt; Supplemental Fig 9a). Therefore, assuming only 1 label-retaining stem cell per crypt we should have found 17 label-retaining cells in the 136 sampled crypts (1/8th of 136); we found 0 (binomial test p<0.0001). The significance of this result held after lowering the expected frequency of label-retaining cells by 25% to account for the development of new crypts, a process thought to continue into adulthood. In three additional experiments, using shorter labeling periods and including in utero development, we also found no label-retaining cells in the crypt other than Paneth cells (Supplemental Fig 8, Exps 2–4).

Fig 1 post-natal human DNA synthesis in the heart

In recent years, several protocols have been developed experimentally in an attempt to identify novel therapeutic interventions aiming at the reduction of infarct size and prevention of short and long term negative ventricular remodeling following ischemic myocardial injury. Three main strategies have been employed and a significant amount of work is being conducted to determine the most effective form of action for acute ischemic heart failure. The delivery of bone marrow progenitor cells (BMCs) has been highly controversial, but recent clinical data have shown improvement in ventricular performance and clinical outcome. These observations have not changed the nature of the debate concerning the efficacy of this cell category for the human disease and the mechanisms involved in the impact of BMCs on cardiac structure and function. Whether BMCs transdifferentiate and acquire the cardiomyocyte lineage has faced strong opposition and data in favor and against this possibility have been reported. However, this is the only cell class which has been introduced in the treatment of heart failure in patients and large clinical trials are in progress.
Human embryonic stem cells (ESCs) have repeatedly been utilized in animal models to restore the acutely infarcted myocardium, but limited cell engraftment, modest ability to generate vascular structures, teratoma formation and the apparent transient beneficial effects on cardiac hemodynamics have questioned the current feasibility of this approach clinically. Tremendous efforts are being performed to reduce the malignant tumorigenic potential of ESCs and promote their differentiation into cardiomyocytes with the expectation that these extremely powerful cells may be applied to human beings in the future. Additionally, the study of ESCs may provide unique understanding of the mechanisms of embryonic development that may lead to therapeutic interventions in utero and the correction of congenital malformations.
The recognition that a pool of primitive cells with the characteristics of stem cells resides in the myocardium and that these cells form myocytes, ECs and SMCs has provided a different perspective of the biology of the heart and mechanisms of cardiac homeostasis and tissue repair. Regeneration implies that dead cells are replaced by newly formed cells restoring the original structure of the organ. In adulthood, this process occurs during physiological cell turnover, in the absence of injury. However, myocardial damage interferes with recapitulation of cell turnover and restitutio ad integrum of the organ. Because of the inability of the adult heart to regenerate itself after infarction, previous studies have promoted tissue repair by injecting exogenously expanded CPCs in proximity of the necrotic myocardium or by activating resident CPCs through the delivery of growth factors known to induce cell migration and differentiation. These strategies have attenuated ventricular dilation and the impairment in cardiac function and in some cases have decreased animal mortality.

Although various subsets of CPCs have been used to reconstitute the infarcted myocardium and different degrees of muscle mass regeneration have been obtained, in all cases the newly formed cardiomyocytes possessed fetal-neonatal characteristics and failed to acquire the adult cell phenotype. In the current study, to enhance myocyte growth and differentiation, we have introduced cell therapy together with the delivery of self-assembly peptide nanofibers to provide a specific and prolonged local myocardial release of IGF-1. IGF-1 increases CPC growth and survival in vitro and in vivo and this effect resulted here in a major increase in the formation of cardiomyocytes and coronary vessels, decreasing infarct size and restoring partly cardiac performance. This therapeutic approach was superior to the administration of CPCs or NF-IGF-1 only. Combination therapy appeared to be additive; it promoted myocardial regeneration through the activation and differentiation of resident and exogenously delivered CPCs. Additionally, the strategy implemented here may be superior to the utilization of BMCs for cardiac repair. CPCs are destined to form myocytes, and vascular SMCs and ECs and, in contrast to BMCs, do not have to transdifferentiate to acquire cardiac cell lineages. Transdifferentiation involves chromatin reorganization with activation and silencing of transcription factors and epigenetic modifications.

Selected References

  1. Hsieh PC, Davis ME, Gannon J, MacGillivray C, Lee RT. Controlled delivery of PDGF-BB for myocardial protection using injectable self-assembling peptide nanofibers. J Clin Invest 2006;116:237–248. [PubMed: 16357943]
  2. Davis ME, Hsieh PC, Takahashi T, Song Q, Zhang S, Kamm RD, Grodzinsky AJ, Anversa P, Lee RT. Local myocardial insulin-like growth factor 1 (IGF-1) delivery with biotinylated peptide nanofibers improves cell therapy for myocardial infarction. Proc Natl Acad Sci USA 2006;103:8155–8160. [PubMed: 16698918]
  3. Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K, Leri A, Kajstura J, Nadal-Ginard B, Anversa P. Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 2003;114:763–776. [PubMed: 14505575]
  4. Rota M, Padin-Iruegas ME, Misao Y, De Angelis A, Maestroni S, Ferreira-Martins J, Fiumana E, Rastaldo R, Arcarese ML, Mitchell TS, Boni A, Bolli R, Urbanek K, Hosoda T, Anversa P, Leri A, Kajstura J. Local activation or implantation of cardiac progenitor cells rescues scarred infarcted myocardium improving cardiac function. Circ Res 2008;103:107–116. [PubMed: 18556576]

Cardiac anatomy.

Figure 2.  Cardiac anatomy.

(A and B) Cardiac weights and infarct size. R and L correspond, respectively, to the number of myocytes remaining and lost after infarction. (C–G) LV dimensions. Sham-operated: SO. *Indicates P<0.05 vs SO; **vs untreated infarcts (UN); †vs infarcts treated with CPCs; ‡vs infarcts treated with NF-IGF-1.

Ventricular function

Figure 3.  Ventricular function.

Combination therapy (CPC-NF-IGF-1) attenuated the most the negative impact of myocardial infarction on cardiac performance. See Figure 2 for symbols.

Endothelial Cells Promote Cardiac Myocyte Survival and Spatial Reorganization: Implications for Cardiac Regeneration

Daria A. Narmoneva, Rada Vukmirovic, Michael E. Davis, Roger D. Kamm,  and Richard T. Lee
Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, and the Division of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA
Circulation. 2004 August 24; 110(8): 962–968.        http://dx.doi.org/10.1161/01.CIR.0000140667.37070.07

Background

Endothelial-cardiac myocyte (CM) interactions play a key role in regulating cardiac function, but the role of these interactions in CM survival is unknown. This study tested the hypothesis that endothelial cells (ECs) promote CM survival and enhance spatial organization in a 3-dimensional configuration.

Methods and Results

Microvascular ECs and neonatal CMs were seeded on peptide hydrogels in 1 of 3 experimental configurations:

  1. CMs alone,
  2. CMs mixed with ECs (coculture), or
  3. CMs seeded on preformed EC networks (prevascularized).

Capillary-like networks formed by ECs promoted marked CM reorganization along the EC structures, in contrast to limited organization of CMs cultured alone. The presence of ECs markedly inhibited CM apoptosis and necrosis at all time points. In addition, CMs on preformed EC networks resulted in significantly less CM apoptosis and necrosis compared with simultaneous EC-CM seeding (P<0.01, ANOVA). Furthermore, ECs promoted synchronized contraction of CMs as well as connexin 43 expression.

Conclusions

These results provide direct evidence for a novel role of endothelium in survival and organization of nearby CMs. Successful strategies for cardiac regeneration may therefore depend on establishing functional CM-endothelium interactions.

Keywords:  endothelium; cardiomyopathy; heart failure; tissue

Introduction

Recent studies suggest that the mammalian heart possesses some ability to regenerate itself through several potential mechanisms, including generation of new cardiomyocytes (CMs) from extracardiac progenitors, CM proliferation, or fusion with stem cells with subsequent hybrid cell division. These mechanisms are insufficient to regenerate adequate heart tissue in humans, although some vertebrates can regenerate large volumes of injured myocardium.
Several approaches in cell transplantation and cardiac tissue engineering have been investigated as potential treatments to enhance cardiac function after myocardial injury. Implantation of skeletal muscle cells, bone marrow cells, embryonic stem cell-derived CMs, and myoblasts can enhance cardiac function. Cell-seeded grafts have been used instead of isolated cells for in vitro cardiac tissue growth or in vivo transplantation. These grafts can develop a high degree of myocyte spatial organization, differentiation, and spontaneous and coordinated contractions. On implantation in vivo, cardiac grafts can integrate into the host tissue and neovascularization can develop. However, the presence of scar tissue and the death of cells in the graft can limit the amount of new myocardium formed, most likely due to ischemia. Therefore, creating a favorable environment to promote survival of transplanted cells and differentiation of progenitor cells remains one of the most important steps in regeneration of heart tissue.
One of the key factors for myocardial regeneration is revascularization of damaged tissue. In the normal heart, there is a capillary next to almost every CM, and endothelial cells (ECs) outnumber cardiomyocytes by ≈3:1. Developmental biology experiments reveal that myocardial cell maturation and function depend on the presence of endocardial endothelium at an early stage. Experiments with inactivation or overexpression of vascular endothelial growth factor (VEGF) demonstrated that at later stages, either an excess or a deficit in blood vessel formation results in lethality due to cardiac dysfunction. Both endocardium and myocardial capillaries have been shown to modulate cardiac performance, rhythmicity, and growth. In addition, a recent study showed the critical importance of CM-derived VEGF in paracrine regulation of cardiac morphogenesis. These findings and others highlight the significance of interactions between CMs and endothelium for normal cardiac function. However, little is known about the specific mechanisms for these interactions, as well as the role of a complex, 3-dimensional organization of myocytes, ECs, and fibroblasts in the maintenance of healthy cardiac muscle.
The critical relation of CMs and the microvasculature suggests that successful cardiac regeneration will require a strategy that promotes survival of both ECs and CMs. The present study explored the hypothesis that ECs (both as preexisting capillary-like structures and mixed with myocytes at the time of seeding) promote myocyte survival and enhance spatial reorganization in a 3-dimensional configuration. The results demonstrate that CM interactions with ECs markedly decrease myocyte death and show that endothelium may be important not only for the delivery of blood and oxygen but also for the formation and maintenance of myocardial structure.

Methods

  • Three-Dimensional Culture
  • Immunohistochemistry and Cell Death Assays
  • Evaluation of Contractile Areas

Results

  • EC-CM Interactions Affect Myocyte Reorganization
  • ECs Improve Survival of CMs
  • Preformed Endothelial Networks Promote Coordinated, Spontaneous Contractions
  • ECs Promote Cx43 Expression

EC-CM Interactions Affect Myocyte Reorganization

To explore interactions between CMs and ECs in 3-dimensional culture, we used peptide hydrogels, a tissue engineering scaffold. Cells seeded on the surface of the hydrogel attach and then migrate into the hydrogel. When CMs alone were used, cells attached on day 1 and then formed small clusters of cells at days 3 and 7 (Figure 1). In contrast, when CMs were seeded together with ECs, cells formed interconnected linear networks, as commonly seen with ECs in 3-dimensional culture environments, with increasing spatial organization from day 1 to day 7 (Figure 1).

Figure 1.  ECs promote CM reorganization. 

When CMs were cultured alone (left column), they aggregated into sparse clusters. When CMs were cultured with ECs (center), cells organized into capillary-like networks. There was no difference in morphological appearance between coculture or prevascularized cultures (not shown) and ECs alone (right column). Bar=100 μm. Abbreviations are as defined in text.

To establish whether preformed endothelial networks enhanced the organization of myocytes, we also seeded ECs 1 day before myocytes were added. These ECs formed similar interconnected networks in the absence of myocytes; preforming the vascular network did not lead to significant differences in morphology (data not shown). Furthermore, to exclude the possibility that the increasing cell density of added ECs caused the spatial organization, we also performed control experiments with varying numbers and combinations of cells; there was no effect of doubling or halving cell numbers, indicating that the spatial organization effect was specifically due to ECs. To establish that both myocytes and ECs were forming networks together, we performed immunofluorescence studies with specific antibodies, as well as analysis of cross sections of CM-EC cocultures, whereby cells were labeled with CellTracker dyes before seeding. Immunofluorescent staining demonstrated that >95% of CMs were present within these networks, suggesting that CMs preferentially migrate to or survive better near ECs (Figure 2).

Figure 2.  CMs appear on outside of endothelial networks.

CMs appear on outside of endothelial networks. High-magnification, double-immunofluorescence image of structures formed in EC-CM coculture at day 7 demonstrating CMs (sarcomeric actinin, red) spread on top of ECs (von Willebrand factor, green) with no myocytes present outside structure. Bar=100 μm. Abbreviations are as defined in text.

The analysis of cross sections demonstrated the presence of what appeared to be EC-derived, tubelike structures (Figure 3), with myocytes spread on the outer part of the capillary wall. Along with the capillary-like structures, clusters of intermingled cells (both myocytes and ECs) not containing the lumen were also observed (not shown). However, when the lumen was present, ECs were always on the inner side and myocytes on the outer side of the structure.

Figure 3.  ECs form tubelike structures with myocytes spreading on outer wall.

Cross section of paraffin-embedded sample of 3-day coculture of myocytes (red) and ECs (green) incubated in CellTracker dye before seeding on hydrogel. Bar=50 μm. Abbreviations are as defined in text.

In CM-fibroblast cocultures, cells rapidly (within 24 hours) formed large clusters consisting of cells of both types (not shown). At later time points, fibroblast proliferation resulted in their migration outside the clusters and spreading on the hydrogel without any pattern. However, in contrast to EC-CM cocultures, CMs remained in the clusters and demonstrated only limited spreading. Immunofluorescent staining revealed that there was no orientation of myocytes relative to the fibroblasts in the clusters. In cultures with EC-conditioned medium, myocyte morphology and spatial organization remained similar to those of myocyte controls.

ECs Improve Survival of CMs

To test the hypothesis that ECs promote CM survival, we assessed apoptosis and necrosis in the 3-dimensional cultures. Quantitative analyses of CMs positive for TUNEL and necrosis staining demonstrated significantly decreased myocyte apoptosis and necrosis when cultured with ECs, compared with CM-only cultures (Figure 4, P<0.01). This effect was observed at all 3 time points, although the decreased necrosis was most pronounced at day 1. In addition, CMs seeded on the preformed EC networks had a lower rate of apoptosis at day 1 relative to same-time seeding cultures (P<0.05, post hoc test), suggesting that early EC-CM interactions provided by the presence of well-attached and prearranged ECs may further promote CM survival. In contrast to the ECs, cardiac fibroblasts did not affect myocyte survival (P>0.05, Figure 4), with ratios for myocyte apoptosis and necrosis in the myocyte-fibroblast cocultures being similar to those for myocyte-only controls. However, addition of EC-conditioned medium resulted in a significant decrease in apoptosis and necrosis ratios of myocytes (P<0.01). Interestingly, the effect of conditioned medium on myocyte necrosis was similar in magnitude to the effect of ECs, whereas myocyte apoptosis ratios in the conditioned-medium group were only partially decreased compared with those in the presence of ECs. These results suggest that the prosurvival effect of ECs on CMs may not only be merely due to the local interactions between myocytes and ECs during myocyte attachment but may also involve direct signaling between myocytes and ECs.

Figure 4.  ECs prolong survival of CMs

Top, dual immunostaining of CMs and EC-myocyte prevascularized groups at day 3 in culture, with TUNEL-positive cells in red; green indicates sarcomeric actinin; blue, DAPI. Bottom, presence of ECs decreased CM apoptosis and necrosis, both in coculture conditions and when cultures were prevascularized by seeding with ECs 1 day before CMs (mean±SD, P<0.01). EC-conditioned medium decreased myocyte apoptosis and necrosis (P<0.01), whereas fibroblasts did not have any effect (P>0.05). *Different from myocytes alone; **different from EC-myocyte coculture and pre-vascularized. Bar=100 μm. Abbreviations are as defined in text.

Preformed Endothelial Networks Promote Coordinated, Spontaneous Contractions

In the prevascularized group with preformed vascular structures, synchronized, spontaneous contractions of large areas (Figure 5, top panels) were detected as early as days 2 to 3after seeding, in contrast to the coculture group, wherein such contractions were observed on days 6 to 7. In CM-only cultures, beating of separate cells and small cell clusters was also detected at days 2 to 3, similar to that in the prevascularized group. However, the average area of synchronized beating at day 3 in the myocyte-only group (3.5±0.5×102 μm2) was nearly 3 orders of magnitude smaller than the synchronously contracting area in the prevascularized group (4.3±2.5×105 μm2, mean±SD, n=5). These data suggest that ECs promote synchronized CM contraction, particularly when vascular networks are already formed.

Figure 5.  ECs promote large-scale, synchronized contraction of CMs.

Left, phase-contrast video of beating areas in CM-only and prevascularized groups (day 3). Right, motion analysis of video showing regions of synchronized contractions (connected areas in purple are contracting synchronously) and nonmoving areas in blue. Bars=100 μm. Abbreviations are as defined in text.

ECs Promote Cx43 Expression

Staining for Cx43 showed striking differences in the distribution pattern of this gap junction protein between EC-CM cocultures and CMs cultured alone. In myocyte-only cultures, Cx43 expression was barely detectable at day 1 (not shown); at days 3 and 7, Cx43 expression was sparse throughout the cell clusters (Figure 6). In the presence of ECs (in both coculture and prevascularized groups), Cx43 staining was evident at day 1, both between ECs and distributed among CMs. As early as day 3 in culture, patches of localized junction-like Cx43, in addition to diffuse staining, were observed for myocytes in the coculture group (Figure 6). In the prevascularized group at day 3, wherein spontaneous contractions were already observed, more junction-like patches of Cx43 were observed compared with the coculture group, indicating electrical connections between myocytes (Figure 6). In addition to junctions between myocytes, there was also evidence of Cx43 localized at the interface between ECs and myocytes (Figure 6) detected in both the coculture group (at day 7) and the preculture group (as early as day 3). When myocytes and myocyte-EC coculture groups were cultured for 3 days with or without addition of 100 ng/mL of neutralizing anti-mouse VEGF antibody (R&D Systems), we observed no differences in either apoptosis or Cx43 staining between VEGF antibody-containing cultures and controls.

Figure 6. ECs promote Cx43 expression

Cultures at 3 days immunostained for Cx43 (red) and anti-sarcomeric actinin (green); nuclei are stained with DAPI (blue). For CMs alone (left), Cx43 staining is diffuse and sparse, with no evidence of gap junctions; for coculture (center), both diffuse (yellow arrow) and patchlike (thin, white arrow) Cx43 staining is observed; for prevascularized (right), increased patchlike staining indicates presence of gap junctions. Thick arrow-heads indicate junctions between myocytes and ECs. Bar=50 μm. Abbreviations are as defined in text.

nihms-134922.jpg endothelial-myocyte figs_Image_1

nihms-134922.jpg endothelial-myocyte figs_Image_2

nihms-134922.jpg endothelial-myocyte figs_Image_3

nihms-134922.jpg endothelial-myocyte figs_Image_4

nihms-134922.jpg endothelial-myocyte figs_Image_5

nihms-134922.jpg endothelial-myocyte figs_Image_6

Endothelial-Cardiomyocyte Interactions in Cardiac Development and Repair: Implications for Cardiac Regeneration

Patrick C.H. Hsieh, Michael E. Davis, Laura K. Lisowski, and Richard T. Lee

Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA
Annu Rev Physiol.    PMC 2009 September 30

The ongoing molecular conversation between endothelial cells and cardiomyocytes is highly relevant to the recent excitement in promoting cardiac regeneration. The ultimate goal of myocardial regeneration is to rebuild a functional tissue that closely resembles mature myocardium, not just to improve systolic function transiently. Thus, regenerating myocardium will require rebuilding the vascular network along with the cardiomyocyte architecture. Here we review evidence demonstrating crucial molecular interactions between endothelial cells and cardiomyocytes. We first discuss endothelial-cardiomyocyte interactions during embryonic cardiogenesis, followed with morphological and functional characteristics of endothelial-cardiomyocyte interactions in mature myocardium. Finally, we consider strategies exploiting endothelial-cardiomyocyte interplay for cardiac regeneration.

Signaling from Cardiomyocytes to Endothelial Cells

The examples of neuregulin-1, NF1, and PDGF-B demonstrate that signals from endothelial cells regulate the formation of primary myocardium. Similarly, signaling from myocardial cells to endothelial cells is also required for cardiac development. Two examples of myocardial-to-endothelial signaling are vascular endothelial growth factor (VEGF)-A and angiopoietin-1.

VASCULAR ENDOTHELIAL GROWTH FACTOR-A

VEGF-A is a key regulator of angiogenesis during embryogenesis. In mice, a mutation in VEGF-A causes endocardial detachment from an underdeveloped myocardium. A mutation in VEGF receptor-2 (or Flk-1) also results in failure of the endocardium and myocardium to develop (18). Furthermore, cardiomyocyte-specific deletion of VEGF-A results in defects in vasculogenesis/angiogenesis and a thinned ventricular wall, further confirming reciprocal signaling from the myocardial cell to the endothelial cell during cardiac development. Interestingly, this cardiomyocyte-selective VEGF-A-deletion mouse has underdeveloped myocardial microvasculature but preserved coronary artery structure, implying a different signaling mechanism for vasculogenesis/angiogenesis in the myocardium and in the epicardial coronary arteries.
Cardiomyocyte-derived VEGF-A also inhibits cardiac endocardial-to-mesenchymal transformation. This process is essential in the formation of the cardiac cushions and requires delicate control of VEGF-A concentration. A minimal amount of VEGF initiates endocardial-to-mesenchymal transformation, whereas higher doses of VEGF-A terminate this transformation. Interestingly, this cardiomyocyte-derived VEGF-A signaling for endocardial-to-mesenchymal transformation may be controlled by an endothelial-derived feedback mechanism through the calcineurin/NFAT pathway (24), demonstrating the importance of endothelial-cardiomyocyte interactions for cardiac morphogenesis.

ANGIOPOIETIN-1

—Another mechanism of cardiomyocyte control of endothelial cells during cardiac development is the angiopoietin-Tie-2 system. Both angiopoietin-1 and angiopoietin-2 may bind to Tie-2 receptors in a competitive manner, but with opposite effects: Angiopoietin-1 activates the Tie-2 receptor and prevents vascular edema, whereas angiopoietin-2 blocks Tie-2 phosphorylation and increases vascular permeability. During angiogenesis/vasculogenesis, angiopoietin-1 is produced primarily by pericytes, and Tie-2 receptors are expressed on endothelial cells. Angiopoietin-1 regulates the stabilization and maturation of neovasculature; genetic deletion of angiopoietin-1 or Tie-2 causes a defect in early vasculogenesis/angiogenesis and is lethal.
Cardiac endocardium is one of the earliest vascular components (along with the dorsal aorta and yolk sac vessels) and the adult heart can be regarded as a fully vascularized organ, angiopoietin-Tie-2 signaling may also be required for early cardiac development. Indeed, mice with mutations in Tie-2 have underdeveloped endocardium and myocardium. These Tie-2 knockout mice display defects in the endocardium but have normal vascular morphology at E10.5, suggesting that the endocardial defect is the fundamental cause of death. In addition, a recent study showed that overexpression, and not deletion, of angiopoietin-1 from cardiomyocytes caused embryonic death between E12.5-15.5 due to cardiac hemorrhage. The mice had defects in the endocardium and myocardium and lack of coronary arteries, suggesting that, as with VEGF-A, a delicate control of angiopoietin-1 concentration is critical for early heart development.

ENDOTHELIAL-CARDIOMYOCYTE INTERACTIONS IN NORMAL CARDIAC FUNCTION

Cardiac Endothelial Cells Regulate Cardiomyocyte Contraction

The vascular endothelium senses the shear stress of flowing blood and regulates vascular smooth muscle contraction. It is therefore not surprising that cardiac endothelial cells—the endocardial endothelial cells as well as the endothelial cells of intramyocardial capillaries— regulate the contractile state of cardiomyocytes. Autocrine and paracrine signaling molecules released or activated by cardiac endothelial cells are responsible for this contractile response (Figure 2).

NITRIC OXIDE

Three different nitric oxide synthase isoenzymes synthesize nitric oxide (NO) from L-arginine. The neuronal and endothelial NO synthases (nNOS and eNOS, respectively) are expressed in normal physiological conditions, whereas the inducible NO synthase is induced by stress or cytokines. Like NO in the vessel, which causes relaxation of vascular smooth muscle, NO in the heart affects the onset of ventricular relaxation, which allows for a precise optimization of pump function beat by beat. Although NO is principally a paracrine effector secreted by cardiac endothelial cells, cardiomyocytes also express both nNOS and eNOS. Endothelial expression of eNOS exceeds that in cardiomyocytes by greater than 4:1. Cardiomyocyte autocrine eNOS signaling can regulate β-adrenergic and muscarinic control of contractile state.
Barouch et al. demonstrated that cardiomyocyte nNOS and eNOS may have opposing effects on cardiac structure and function. Using mice with nNOS or eNOS deficiency, they found that nNOS and eNOS have not only different localization in cardiomyocytes but also opposite effects on cardiomyocyte contractility; eNOS localizes to caveolae and inhibits L-type Ca2+ channels, leading to negative inotropy, whereas nNOS is targeted to the sarcoplasmic reticulum and facilitates Ca2+ release and thus positive inotropy (31). These results demonstrate that spatial confinement of different NO synthase isoforms contribute independently to the maintenance of cardiomyocyte structure and phenotype.
As indicated above, mutation of neuregulin or either of two of its cognate receptors, erbB2 and erbB4, causes embryonic death during mid-embryogenesis due to aborted development of myocardial trabeculation . Neuregulin also appears to play a role in fully developed myocardium. In adult mice, cardiomyocyte-specific deletion of erbB2 leads to dilated cardiomyopathy. Neuregulin from endothelial cells may induce a negative inotropic effect in isolated rabbit papillary muscles. This suggests that, along with NO, the neuregulin signaling pathway acts as an endothelial-derived regulator of cardiac inotropism.  In fact, the negative inotropic effect of neuregulin may require NO synthase because L-NMMA, an inhibitor of NO synthase, significantly attenuates the negative inotropy of neuregulin.

Studies to date indicate that cardiac regeneration in mammals may be feasible, but the response is inadequate to preserve myocardial function after a substantial injury. Thus, understanding how normal myocardial structure can be regenerated in adult hearts is essential. It is clear that endothelial cells play a role in cardiac morphogenesis and most likely also in survival and function of mature cardiomyocytes. Initial attempts to promote angiogenesis in myocardium were based on the premise that persistent ischemia could be alleviated. However, it is also possible that endothelial-cardiomyocyte interactions are essential in normal cardiomyocyte function and for protection from injury. Understanding the molecular and cellular mechanisms controlling these cell-cell interactions will not only enhance our understanding of the establishment of vascular network in the heart but also allow the development of new targeted therapies for cardiac regeneration by improving cardiomyocyte survival and maturation.

Endothelial-cardiomyocyte assembly

Figure 1.  Endothelial-cardiomyocyte assembly in adult mouse myocardium.
Normal adult mouse myocardium is stained with intravital perfusion techniques to demonstrate cardiomyocyte (outlined in red) and capillary (green; stained with isolectin-fluorescein) assembly. Nuclei are blue (Hoechst). Original magnification: 600X

Endothelial dysfunction

Intramyocardial Fibroblast – Myocyte Communication

Rahul Kakkar, M.D. and Richard T. Lee, M.D.
From the Cardiology Division, Massachusetts General Hospital and the Cardiovascular Division, Brigham and Women’s Hospital, Department of Medicine, Harvard Medical School, Boston, MA
Circ Res. 2010 January 8; 106(1): 47–57.    http://dx.doi.org/10.1161/CIRCRESAHA.109.207456

Cardiac fibroblasts have received relatively little attention compared to their more famous neighbors, the cardiomyocytes. Cardiac fibroblasts are often regarded as the “spotters”, nonchalantly watching the cardiomyocytes do the real weight-lifting, and waiting for a catastrophe that requires their actions. However, emerging data now reveal the fibroblast as not only a critical player in the response to injury, but also as an active participant in normal cardiac function.
Interest in cardiac fibroblasts has grown with the recognition that cardiac fibrosis is a prominent contributor to diverse forms of myocardial disease. In the early 1990’s, identification of angiotensin receptors on the surface of cardiac fibroblasts linked the renin-angiotensin-aldosterone system directly with pathologic myocardial and matrix extracellular remodeling.  Fibroblasts were also revealed as a major source of not only extracellular matrix, but the proteases that regulate and organize matrix. New research has uncovered paracrine and well as direct cell-to-cell interactions between fibroblasts and their cardiomyocyte neighbors, and cardiac fibroblasts appear to be dynamic participants in ventricular physiology and pathophysiology.
This review will focus on several aspects of fibroblast-myocyte communication, including mechanisms of paracrine communication.  Ongoing efforts at regeneration of cardiac tissue focus primarily on increasing the number of cardiomyocytes in damaged myocardium. Although getting cardiomyocytes into myocardium is an important goal, understanding intercellular paracrine communication between different cell types, including endothelial cells but also fibroblasts, may prove crucial to regenerating stable myocardium that responds to physiological conditions appropriately.

An area of active research in cardiovascular therapeutics is the attempt to engineer, ex vivo, functional myocardial tissue that may be engrafted onto areas of injured ventricle. Recent data suggests that the inclusion of cardiac fibroblasts in three-dimensional cultures greatly enhances the stability and growth of the nascent myocardium. Cardiac fibroblasts when included in polymer scaffolds seeded with myocytes and endothelial cells have the ability to promote and stabilize vascular structures. Naito and colleagues constructed three dimensional cultures of neonatal rat cell isolates on collagen type I and Matrigel (a basement membrane protein mixture), and isolates of a mixed cell population versus a myocyte-enriched population were compared. The mixed population cultures, which contained a higher fraction of cardiac fibroblasts than the myocyte-enriched cultures, displayed improved contractile force generation and greater inotropic response despite an equivalent overall cell number. Greater vascularity was also seen in the mixed-pool cultures.(160) Building on this, Nichol and colleagues demonstrated that in a self-assembling nanopeptide scaffold, embedded rat neonatal cardiomyocytes exhibit greater cellular alignment and reduced apoptosis when cardiac fibroblasts were included in the initial culture. A similar result was noted when polymer scaffolds were pre-treated with cardiac fibroblasts before myocyte seeding, suggesting a persistent paracrine effect. These data reinforce the concept that engineering functional myocardium, either in situ or ex vivo will require attention to the nature of cell-cell interactions, including fibroblasts.

To date, a broad initial sketch of cardiac fibroblast-myocyte interactions has been drawn. Future studies in this field will better describe these interactions. How do multiple paracrine factors interact to produce a cohesive and coordinated communication scheme? What are the changes in coordinated bidirectional signaling that during development promotes myocyte progenitor proliferation but have different roles in the adult? Might fibroblasts actually be required for improved cardiac repair and regeneration?
Recent studies have begun to apply genetic and cellular fate-mapping techniques to document the origins of cardiac fibroblasts, the dynamic nature of their population, and how that population may be in flux during time of injury or pressure overload. It is crucial to define on a more specific molecular basis the origins and fates of cardiac fibroblasts. Do fibroblasts that have been resident within the ventricle since development fundamentally differ from those that arise from endothelial transition or that infiltrate from the bone marrow during adulthood? Do fibroblasts with these different origins behave differently or take on different roles in the face of ventricular strain or injury?

Our understanding of the nature of the cardiac fibroblast is evolving from the concept of the fibroblast as a bystander that causes unwanted fibrosis to the picture of a more complex role of fibroblasts in the healthy as well as diseased heart. The pathways used by cardiac fibroblasts to communicate with their neighboring myocytes are only partially described, but the data to date indicate that these pathways will be important for cardiac repair and regeneration.

. Paracrine bidirectional cardiac fibroblast-myocyte crosstalk

Figure 2. Paracrine bidirectional cardiac fibroblast-myocyte crosstalk

Under biomechanical overload, cardiac fibroblasts and myocytes respond to an altered environment via multiple mechanisms including integrin-extracellular matrix interactions and renin-angiotensin-aldosterone axis activation. Cardiac fibroblasts increase synthesis of matrix proteins and secrete a variety of paracrine factors that can stimulate myocyte hypertrophy. Cardiac myocytes similarly respond by secreting a conglomerate of factors. Hormones such as TGFβ1, FGF-2, and the IL-6 family members LIF and CT-1 have all been implicated in this bidirectional fibroblast-myocyte hormonal crosstalk.

Read Full Post »

Notable Contributions to Regenerative Cardiology

Posted in Bio Instrumentation in Experimental Life Sciences Research, Cardiac & Vascular Repair Tools Subsegment, Cardiovascular Pharmacogenomics, Cell Biology, Signaling & Cell Circuits, Disease Biology, Small Molecules in Development of Therapeutic Drugs, Drug Delivery Platform Technology, Ecosystems & Industrial Concentration in the Medical Device Sector, Frontiers in Cardiology and Cardiovascular Disorders, Human Immune System in Health and in Disease, International Global Work in Pharmaceutical, Medical Imaging Technology, Image Processing/Computing, MRI, CT, Nuclear Medicine, Ultra Sound, Pharmacotherapy and Cell Activity, Proteomics, Stem Cells for Regenerative Medicine, tagged , , , , , , , , , , , on October 20, 2013| Leave a Comment »

Notable Contributions to Regenerative Cardiology by Richard T. Lee – Part I

 

Author and Curator: Larry H Bernstein, MD, FCAP

and

Article Commissioner: Aviva Lev-Ari, PhD, RD

 

Introduction

This presentation is a two part discussion of selected articles of a large body of research from Dr. Richard T. Lee, at Harvard Medical School’s Lee Laboratory and Brigham & Womens Hospital.  This work is innovative in the field of stem cell research and myocardial regeneration.  It devolves the complex cellular processes that are involved in the management of a cell transforming from a progenitor to a functional cardiomyocyte.  The cell engineering involves investigating interactions between a cell placed into the layer derived from the interstitial layer between viable cardiomyocytes.  This is only possible from a through actionable knowledge of the mechanism involved in the transformation process, which has occupied the Lee Laboratory for many years.  Part II will cover the cellular mechanisms underlying the conceptual approach to cardiac myocyte regeneration.

The Lee Laboratory uses emerging biotechnologies to discover and design new approaches to cardiovascular diseases. A central theme of the laboratory is that merging bioengineering and molecular biology approaches can yield novel approaches. Thus, the Lee Laboratory works at this interface using a broad variety of techniques in genomics, imaging, nanotechnology, physiology, cell biology, and molecular biology. The approach is to understand problems and design solutions in the laboratory and then demonstrate the effectiveness of these solutions in vivo. Ongoing projects in the laboratory include studies of cardiac regeneration, diabetic vascular disease, wound healing, heart failure, and cardiac hypertrophy.

Richard T. Lee is Professor of Medicine at Harvard Medical School and lecturer in Biological Engineering at the Massachusetts Institute of Technology. He is a 1979 graduate of Harvard College in Biochemical Sciences and received his M.D. from Cornell University Medical College in 1983.  He went on to complete his residency in 1986 and cardiology fellowship in 1989, both at Brigham and Women’s Hospital in Boston, and he obtained post-doctoral training at MIT in Bioengineering.

Dr. Lee is certified by the American Board of Internal Medicine in cardiovascular disease and is a Fellow of the American College of Cardiology. He is Leader of the Cardiovascular Program of the Harvard Stem Cell Institute.  He is a member of the Editorial Boards of the journals Circulation Research, Journal of Clinical Investigation, and Circulation, and has published over 180 peer-reviewed articles based on his research, which combines approaches in biotechnology and molecular biology to discover new avenues to manage and treat heart disease.

Regeneration of the heart

Matthew L. Steinhauser, Richard T. Lee
Division of Cardiovascular Medicine, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, and (2)             Harvard Stem Cell Institute, Cambridge, MA
EMBO Mol Med 2011; 3: 701–712   http://dx.doi.org/10.1002/emmm.201100175

The death of cardiac myocytes diminishes the heart’s pump function and is a major cause of heart failure. With the exception of heart transplantation and implantation of mechanical ventricular assist devices, current therapies do not address the central problem of decreased pumping capacity owing to a depleted pool of cardiac myocytes. The field is evolving in two important directions. First, although endogenous mammalian cardiac regeneration clearly seems to decline rapidly after birth, it may still persist in adulthood. The careful elucidation of the cellular and molecular mechanisms of endogenous heart regeneration may therefore provide an opportunity for developing therapeutic interventions that amplify this process. Second, recent breakthroughs have enabled reprogramming of cells that were apparently terminally differentiated, either by dedifferentiation into pluripotent stem cells or by trans-differentiation into cardiac myocytes.
The longstanding paradigm held that the mammalian heart is a terminally differentiated organ, incapable of replenishing any myocyte attrition. During the past decade, however, studies revealed not only that mammalian cardiac myocytes retain some capacity for division (Beltrami et al, 2001), but also identified endogenous cardiac progenitor cells in the heart (Beltrami et al, 2003) or bone marrow (Orlic et al, 2001). These cells retain some potential for differentiation into the cellular components of the heart, including endothelial cells, smooth muscle cells and cardiac myocytes.
If progenitor cells residing in the adult are capable of producing new heart cells, the therapeutic delivery of such progenitors might facilitate the generation of de novo functional myocardium. In this context, cell-based therapies for the heart have been rapidly translated into the clinic to treat heart disease, but randomized clinical trials with bone marrow progenitors have shown at best modest improvements in ventricular function (Martin-Rendon et al, 2008). In short, the promise of complete cardiac regeneration has not yet been realized.  Therefore, it is worth revisiting both the foundations of cardiac regeneration and highlight recent advances that may portend future directions in the field.
We will first define the problem, that is elucidating the scope of endogenous mammalian regeneration and, by extension, the scale of the regenerative deficit. We will then summarize current regenerative approaches, including both cell-based therapies and pharmacoregenerative strategies. In this context, we will summarize the many challenges that stand in the way of cardiac regeneration, both endogenous repair processes and exogenous regenerative therapies.
The regenerative deficit of the mammalian heart is obvious when compared with organisms such as zebrafish and newts, which demonstrate a remarkable survival capacity after removal of up to 20% of the heart by transection of the ventricular apex. Pre-existing cardiac myocytes adjacent to the site appear to undergo a process of dedifferentiation, characterized by dissolution of sarcomeric structures. This is followed by incorporation of deoxyribonucleic acid (DNA) synthesis markers (e.g. nucleotide analogues) consistent with proliferation. Ultimately, newly generated cardiac myocytes are functionally integrated with the preexisting myocardium. The heart is left with little residual evidence of the injury, thus providing a natural example of complete myocardial regeneration.

Evidence for heart regeneration in mammals

During embryonic development and the early post-natal period, mice also demonstrate a remarkable regenerative capacity. Embryos heterozygous for a cardiac myocyte-specific null mutation in the x-linked holocytochrome c synthase (Hccs) gene demonstrate cardiac myocyte replacement during foetal development (Drenckhahn et al, 2008): when one of two X-chromosomes is randomly inactivated in each female somatic cell, approximately 50% of the cardiac myocytes are rendered Hccs-null and hence dysfunctional. Proliferative functional Hccs-expressing cardiac myocytes compensate for dysfunctional Hccs-null myocytes, such that, at birth, 90% of the heart is derived from myocytes containing one functional Hccs allele. However, after the first week in post-natal mice, injured myocardium is largely replaced by fibrosis and scarring.  Distinguishing whether the adult mammalian heart is incapable of cardiac myocyte replacement or whether it retains a low-level capacity for repair is therefore fundamentally important. This is the basis for an evolving view of a more plastic mammalian heart.
Arguments against the age old view of the terminally differentiated quiescent cardiac myocyte:

  1. evidence supporting cardiac myocyte plasticity relied on mathematical modelling of the myocyte population based on cytometric indices. (the measured average volume increase of cardiac myocytes was calculated to fall short of the increase predicted by the observed volumetric changes in the whole heart
  • changes in heart volume could not be explained by hypertrophy alone, and that cardiac myocyte hyperplasia contributed to changes in heart mass, but the conclusions relied on a number of assumptions about myocyte size and DNA content.
  • detecting cell cycle markers such as Ki67 or the incorporation of nucleotide analogues (e.g. iododeoxyuridine or 3H-thymidine) into newly synthesized DNA further support the notion that the mammalian heart may generate new myocytes
  • human cardiac myocytes can reenter the cell cycle, but the described rates of this phenomenon differ by more than one order of magnitude
  • experiments, made possible by nuclear arms testing in the middle of the 20th century, provide the most convincing evidence for post-natal human cardiac myocyte turnover.
  • the period of nuclear testing serves as a historical DNA labelling pulse, and the period after the test ban treaty serves as a chase.
  • the genomic DNA of cells generated during either the pulse or the chase reflect the earth’s atmospheric 14C concentration at that point in time, which allows investigators to date the age of cardiac myocytes by measuring the concentration of 14C in their nuclei
  1. Listed are a number of problems in detecting the generation of cardiac myocytes:
  • small errors may magnify projections of absolute yearly or lifetime myocyte turnover
  • mis-identification of cellular components by light microscopy
  • autofluorescence of myocardium, which complicates any method that relies on the detection of a fluorescent signal
  • confounders could also affect the 14C dating method, because it requires the isolation of cardiac myocyte nuclei by digestion and flow cytometric sorting

The heart also presents a unique challenge compared to other organs owing to the propensity of cardiac myocytes to synthesize DNA during S-phase without completing either mitosis and/or cytokinesis (Fig 1).

Figure 1. The majority of post-natal human DNA synthesis in the heart does not lead to new myocyte formation.

Cardiac myocytes can complete S-phase, followed by mitosis and cytokinesis (centre) resulting in myocyte doubling. Cardiac myocytes can also complete mitosis without cytokinesis (left), resulting in a binucleated cell. Cardiac myocytes can also undergo chromosomal replication without completing either mitosis or cytokinesis (right), resulting in polyploidy nuclei. By the completion of post-natal development, the majority of human myocyte nuclei contain ~4n chromosomal copies.

During early post-natal development, for example, the majority of rodent cardiac myocytes and an estimated 25–57% of human cardiac myocytes become binucleated. By adulthood, most cardiac myocyte nuclei have also become polyploid with at least one or two additional rounds of chromosomal replication.

The ploidy state of cardiac myocytes may increase with myocardial hypertrophy or injury, which could be mistaken for myocyte division. Conversely, hearts that have been unloaded by implantation of a ventricular assist device may have a lower percentage of polyploid myocytes, because more 2n cardiac myocytes are being generated. These aspects of cardiac myocyte biology inevitably represent potential confounders that must be considered in any quantification of cardiac myocyte formation.

Defining the cellular source of new cardiac myocytes

The majority of reports suggest some endogenous capacity for cardiac myocyte renewal, which has generated a broad focus on finding the cellular source of newly generated cardiac myocytes.  Newly generated adult mammalian cardiac myocytes may arise from an endogenous pool of progenitor cells after injury. The Lee Laboratory developed a genetic lineage mapping approach to quantify progenitor-dependent cardiac myocyte turnover (Fig 2) (Hsieh et al, 2007). In the bitransgenic MerCreMer/ZEG inducible cardiac myocyte reporter mouse, mature cardiac myocytes undergo an irreversible genetic switch from constitutive 3-galactosidase expression to green fluorescent protein (GFP) expression upon tamoxifen pulse. During a chase period, we evaluated the effect of myocardial injury on the proportion of GFP+ or 3-gal+ cardiac myocytes. Pressure overload or myocardial infarction resulted in a significant reduction in the percentage of GFP+ cardiac myocytes and a corresponding increase in the percentage of B-gal+ cardiac myocytes, consistent with repletion of the myocyte pool by B-gal— expressing progenitors. This approach cannot directly identify the molecular identity or anatomic location of the progenitor pool.
One approach to characterizing the molecular phenotype of cardiac progenitors is to study cardiac embryologic develop-ment, guided by the assumption that developmental paradigms are recapitulated during post-natal repair. When examined through a developmental lens, an increasingly detailed picture emerges of the soluble and transcriptional signals that guide the cardiogenic programme from gastrulation (formation of distinct germ layers) through the ultimate maturation of cardiac myocytes. The induction of mesoderm posterior (MESP)-1 expression by brachyury-expressing primitive mesodermal cells is a proximal require¬ment for the ultimate production of differentiated heart cells. As the developing embryo grows beyond the germ layer phase, its developing heart receives cells from distinct anatomic progeni¬tor sources: the 1st and 2nd heart fields provide the majority of the myocardium, with some contribution from epicardial progenitors.
Also, Certain fields may be preferentially marked by specific transcription factors;

  • the first heart field by T-box transcription factor 5 (Tbx5)
  • the second heart field by
    • Lim-homeodomain protein Islet1 (Isl1)
    • and epicardial progenitors by Wilms tumour-1 (WT1) or
    • T-box transcription factor 18 (Tbx18)
    • identified by embryonic lineage tracing or analysis of gene silencing include
      • homeobox protein nkx2.5
      • myocyte enhancer factor 2C (Mef2c)
      • GATA4
      • there is no consensus yet about the molecular identity of post-natal mammalian cardiac progenitor cells or ‘adult cardiac stem cells’

Figure 2. Lineage-mapping in the adult heart.

Left: Theoretical progenitor lineage-mapping is depicted. Progenitors would be selectively marked by fluorescent protein expression. After injury, the appearance of fluorescently labelled cardiac myocytes would support the concept that these progenitors were contributing to new myocyte formation. Right: Differentiated cell (cardiac myocyte) lineage-mapping. Upon treatment of the MerCreMer-ZEG mouse with OH-tamoxifen, approximately 80% of the cardiac myocytes undergo a permanent switch from I3-galactosidase to GFP expression. The dilution of the GFPþ cardiac myocyte pool after injury is consistent with repletion by I3-galþ progenitors.

A number of laboratories have identified cell populations within the post-natal mouse, which fulfil some criteria of cardiac progenitors:

  • expression of a developmentally important gene (isl-1(Laugwitz et al, 2005))
  • specific cell surface receptor profile (c-kit (Beltrami et al, 2003)
  • or sca-1 (Oh et al, 2003))
  • capacity to actively exclude Hoechst dye (so-called side population cells (Martin et al, 2004)) or based on the outgrowth of typical spherical colonies in tissue culture 

In general, the label of ‘cardiac stem cell’ results from the observation of self-propagation and cardiac myocyte transdifferentiation when exposed to cardiogenic conditions in vitro or when delivered in vivo after injury. However, the field will benefit from careful in vivo lineage tracing studies—without ex vivo culture steps—to study if and how a given cell type contributes to cardiac myocyte replenishment during either normal homeostasis or after injury (Fig 2). The lack of such publications to date owes in part to the lack of specificity of many stem cell markers (Fig 3).

Figure 3. Possible recapitulation of developmental paradigms by endogenous post-natal cardiac stem cells.

Between mesodermal development and the emergence of cardiac myocytes, cardiovascular progenitors express a number of markers that have also been detected in the various post-natal cardiac stem cell (CSC) preparations. Expression as measured by messenger RNA (mRNA) or protein expression is denoted with (þ). Absent expression is denoted by (-). Blank1/4 untested.

Moving towards a regenerative therapy

The therapeutic challenge is considerable: a typical large myocardial infarction that leads to heart failure will kill around 1 billion cardiac myocytes,  roughly a quarter of the heart’s myocytes. A possible therapeutic approach would coax an endogenous stem cell population or an exogenously delivered cell-based therapy to replace lost cardiac myocytes in a coordinated fashion. Amongst the myriad of potential cell-based therapies, no clear winning strategy has so far emerged (Segers & Lee, 2008).

Bone marrow derived progenitors

Conflicting studies sparked excitement and also uncertainty about a possible adult cardiogenic progenitor originating outside of the heart. A post-mortem examination of male heart transplant patients who had received female donor hearts found that approximately 10% of -sarcomeric actin-positive cardiac myocytes had Y-chromosomes, and two cases in which a bone marrow cell population with a higher density of the cell surface receptor c-kit, showed repopulation of murine cardiac myocytes after experimental myocardial infarction. A number of studies that followed failed to demonstrate similar rates of chimerism in transplanted hearts or potency of bone marrow stem cell.  However, some therapeutic effect was observed even in studies with no detectable transdifferentiation.

Figure 4. The challenge of regenerating the heart.

Both exogenously delivered cell therapies and progenitors in the endogenous niche encounter a similar hostile environment after myocardial injury, often including inadequate blood supply (ischemia), inflammation and fibrosis/scarring. Regenerative pathways may be activated by as yet unknown paracrine pathways, responsible for recruiting progenitors from the niche, stimulating proliferation and coaxing differentiation.  Cell-based therapy using autologous bone marrow
progenitors was rapidly translated into the clinic to treat human ischemic heart disease. A number of randomized trials, using bone marrow mononuclear cells have been performed and most studies demonstrated modest cell therapy-mediated improvements in ventricular function.

Pluripotent stem cells

Embryonic stem (ES) cells represent the prototypical stem cells with the hallmarks of clonogenicity, self-renewal and pluripotency. The potency of these cells also represents a real safety concern, given their tendency to form teratomas. One approach to overcoming this prohibitive safety problem has been to generate pluripotent-derived progenitors that have already committed to a cardiogenic pathway. As a proof-of-principle example of such a strategy, cells with an expression profile of Oct4, stage-specific embryonic antigen 1 (SSEA-1) and MESP1 demonstrated some regenerative potency when delivered therapeutically in a primate infarct model, without detectable teratoma formation. One could envision a similar strategy using cardiogenic intermediates that express any of the previously mentioned transcription factors associated with cardiac progenitors or cell surface markers such as the receptor for vascular endothelial growth factor (Flk1/KDR). Yet, such a strategy should still demonstrate both substantial preclinical efficacy without tumorigenicity before human translation. If such criteria are met, ES-derived therapies have the potential of providing ‘off-the-shelf’ cardiac myocytes to treat acute myocardial infarctions or chronic heart failure.
A second approach, which may also obviate the risk of teratomas, is to generate a pure population of ES-derived cardiac myocytes for therapeutic delivery either as a cell suspension or after ex vivo tissue engineering. There has already been enormous progress during the past decade in defining the factors and transcription signals to differentiate cardiac myocytes from ES-cells. As discussed in greater detail, cardiac myocyte development is dictated by the time and dose-dependent exposure to a series of growth factors from the wingless-type MMTV integration site (Wnt), fibroblast growth factor (FGF), bone morphogenetic protein (BMP) and nodal families. Several laboratories have successfully generated ES-derived preparations with more than 50% of functional cardiac myocytes.  The most realistic future for such technical advances may be as an unlimited source of cardiac myocytes for engineering myocardial grafts.
The generation of induced pluripotent stem (iPS) cells may overcome two important limitations of ES cells: ethical concerns about harvesting ES cells from embryos and graft rejection

  • iPS cells can be custom-engineered from a patient’s stromal cells for autologous transplantation.
  • immunogenecity in syngeneically transplanted iPS cells, suggests that the immune system cannot yet be discounted in the development of iPS-based therapies

The initial protocols for iPS cell generation involved retro-viral-mediated expression of four stem-cell genes.
But virally reprogrammed cells may harbour an associated risk of neoplastic conversion. Alternative reprogramming strategies, such as the use of small molecules (Shi et al, 2008) or non-viral gene modifying approaches (Warren et al, 2010) will probably be a necessary component of any future therapeutic strategies. However, the most important lesson from these landmark studies may be the remarkable plasticity of even the most terminally differentiated cells when exposed to the right combination of signals.

Tissue engineering

Historically, the greatest challenge in tissue engineering has been an adequate supply of oxygen and nutrients for metabolically active tissues such as the heart. One approach has been to engineer thin cardiac sheets, which can then be stacked for in vivo delivery. Although these layered sheets demonstrate some degree of electromechanical coordination and neovascularization in vivo, it is not clear yet if such an approach can be optimized to yield full-thickness myocardium with an adequate blood supply. The addition of non-myocyte cellular components, such as fibroblasts and endothelial cells, leads to the formation of primitive vascular structures within engineered grafts, but the electro-mechanical properties are not sufficient for normal functionality.

Circumventing cell-based therapy with pharmacoregeneration?

A short-term goal may be to exploit paracrine signalling to amplify the existent endogenous regenerative response. Recent cell transplantation experiments conducted in our laboratory, using an inducible cre-based genetic lineage mapping approach, tested the hypothesis that cell-based therapies might exert proregenerative effects via a paracrine mechanism (Loffredo et al, 2011) (Fig 5).  Consistent with some prior studies, we found no evidence for transdifferentiation of exogenously delivered bone marrow cells into cardiac myocytes. However, we did find increased generation of cardiac myocytes from endogenous progenitors in mice, which were administered c-kit+ bone marrow cells but not mesenchymal stem cells. This finding suggests paracrine signalling between exogenously delivered cells and endogenous resident progenitors. It provides a rationale for therapeutic interventions aimed at activating progenitors or recruiting them from their niche to the injury site.

Figure 5. Proposed of action for cell-based therapies.

In theory, exogenously delivered cells may directly differentiate into endothelial cells, smooth muscle cells and cardiac myocytes. They may also release paracrine factors which may result in non-regenerative effects, such as immunomodulation, angiogenesis or cardioprotection. Recent work from our laboratory suggests that a dominant mechanism achieved with bone marrow progenitor therapy may be via the activation of endogenous progenitor recruitment (Loffredo et al, 2011).

Controlling the mitotic activity of mononucleated cardiac myocytes may provide an alternative approach to replenishing cardiac myocytes. A major concern with systemic growth factor therapy, however, is the potential for mitogenic effects that may impact other organs. Thus, the future of pharmacologic regeneration may lie in the local delivery of engineered proteins and small molecules that target 

Future directions

In this review, we have described the current status of research on cardiac regeneration, highlighting important recent discoveries and ongoing controversies. The initial hope that a cell progenitor would emerge with the capacity to regenerate the injured mammalian heart in the same manner that bone marrow may be reconstituted has not been realized.
Cardiac myocyte regeneration may lie in the local delivery of engineered proteins and small molecules that target specific survival, growth and differentiation pathways.

Pending issues

Dissect the mechanistic differences between adult mammals with limited regenerative capacity and organisms, such as neonatal mice, zebrafish and newts, that demonstrate unambiguous cardiac myocyte regeneration. Understanding these differences may reveal new pathways that can be therapeutically targeted to achieve more robust regeneration.

Complete molecular and functional characterization of endogenous cardiac myocyte progenitors. Multiple laboratories have isolated progenitors from the heart with different molecular characteristics. What are the in vivo functional roles of these progenitors? Do the observed molecular differences between these isolated cells represent functionally distinct cell types?

Identify paracrine signalling pathways responsible for activation and recruitment of endogenous cardiac myocyte progenitors. This may facilitate a pharmacoregenerative therapy, in which treatment with a protein or small molecule would hold the promise of amplifying endogenous regeneration.

Refine reprogramming strategies to more efficiently produce mature cardiac myocytes, both in vitro and in vivo. The ultimate bioengineering goal is to produce a pure population of mature, fully functional cardiac myocytes for ex vivo tissue engineering (or) to control the proliferation and differentiation of endogenous cell populations or exogenously delivered cell therapies such that scar tissue is replaced by myocardium. These different strategies are unified by an underlying requirement to understand the fundamental pathways involved in cardiac myocyte differentiation and maturation.

There is reason for optimism for a regenerative medicine approach to heart failure, given the intense research efforts and the capacity of higher organisms, including the neonatal mouse, to regenerate myocardium. Perhaps the most important issue in this field is identifying which findings are consistently supported by multiple experimental approaches. Ultimately, the findings that are easily reproduced by most or all laboratories will most likely benefit patients.

Selected references

Hsieh et al, 2007.  Hsieh PC, Segers VF, Davis ME, MacGillivray C, Gannon J, Molkentin JD, Robbins J, Lee RT (2007) Evidence from a genetic fate-mapping study that stem cells refresh adult mammalian cardiomyocytes after injury. Nat Med 13: 970¬974
Laugwitz et al, 2005.  Laugwitz KL, Moretti A, Lam J, Gruber P, Chen Y, Woodard S, Lin LZ, Cai CL, Lu MM, Reth M et al (2005) Postnatal isl1þ cardioblasts enter fully differentiated cardiomyocyte lineages. Nature 433: 647-653
Beltrami et al, 2003.  Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K et al (2003) Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 114: 763¬776
Oh et al, 2003. Oh H, Bradfute SB, Gallardo TD, Nakamura T, Gaussin V, Mishina Y, Pocius J, Michael LH, Behringer RR, Garry DJ et al (2003) Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proc Natl Acad Sci USA 100: 12313-12318
Segers & Lee, 2008.  Segers VF, Lee RT (2008) Stem-cell therapy for cardiac disease. Nature 451:937-942
Loffredo et al, 2011.  Loffredo FS, Steinhauser ML, Gannon J, Lee RT (2011) Bone marrow-derived cell therapy stimulates endogenous cardiomyocyte progenitors and promotes cardiac repair. Cell Stem Cell 8: 389-398.
Shi et al, 2008.  Shi Y, Desponts C, Do JT, Hahm HS, Scholer HR, Ding S (2008) Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell 3: 568-574.
Warren et al, 2010.  Warren L, Manos PD, Ahfeldt T, Loh YH, Li H, Lau F, Ebina W, Mandal PK, Smith ZD, Meissner A et al (2010) Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7: 618-630.

Mammalian Heart Renewal by Preexisting Cardiomyocytes

SE Senyo, ML Steinhauser, CL Pizzimenti, VK. Yang, Lei Cai, Mei Wang, …,and Richard T. Lee
Cardiovascular and Genetics Divisions, Brigham and Women’s Hospital and Harvard Medical School,
INSERM, Orsay (Fr), Institut Curie, Laboratoire de Microscopie Ionique, Orsay (Fr), National Resource for Imaging Mass Spectrometry, Harvard Stem Cell Institute
Nature. 2013 January 17; 493(7432): 433–436.  http://dx.doi.org/10.1038/nature11682

Although recent studies have revealed that heart cells are generated in adult mammals, the frequency and source of new heart cells is unclear. Some studies suggest a high rate of stem cell activity with differentiation of progenitors to cardiomyocytes. Other studies suggest that new cardiomyocytes are born at a very low rate, and that they may be derived from division of pre-existing cardiomyocytes. Thus, the origin of cardiomyocytes in adult mammals remains unknown. Here we combined two different pulse-chase approaches — genetic fate-mapping with stable isotope labeling and Multi-isotope Imaging Mass Spectrometry (MIMS). We show that genesis of cardiomyocytes occurs at a low rate by division of pre-existing cardiomyocytes during normal aging, a process that increases by four-fold adjacent to areas of myocardial injury. Cell cycle activity during normal aging and after injury led to polyploidy and multinucleation, but also to new diploid, mononucleated cardiomyocytes. These data reveal pre-existing cardiomyocytes as the dominant source of cardiomyocyte replacement in normal mammalian myocardial homeostasis as well as after myocardial injury.

Despite intensive research, fundamental aspects of the mammalian heart’s capacity for self-renewal are actively debated. Estimates of cardiomyocyte turnover range from less than 1% per year to more than 40% per year. Turnover has been reported to either decrease or increase with age, while the source of new cardiomyocytes has been attributed to both division of existing myocytes and to progenitors residing within the heart or in exogenous niches such as bone marrow. Controversy persists regarding the plasticity of the adult heart in part due to methodological challenges associated with studying slowly replenished tissues. Toxicity attributed to radiolabeled thymidine and halogenated nucleotide analogues limits the duration of labeling and may produce direct biological effects. The challenge of measuring cardiomyocyte turnover is further compounded by the faster rate of turnover of cardiac stromal cells relative to cardiomyocytes.

We used Multi-isotope Imaging Mass Spectrometry (MIMS) to study cardiomyocyte turnover and to determine whether new cardiomyocytes are derived from preexisting myocytes or from a progenitor pool (Fig 1a). MIMS uses ion microscopy and mass spectrometry to generate high resolution quantitative mass images and localize stable isotope reporters in domains smaller than one micron cubed15,16,17. MIMS generates 14N quantitative mass images by measuring the atomic composition of the sample surface with a lateral resolution of under 50nm and a depth resolution of a few atomic layers. Cardiomyocyte cell borders and intracellular organelles were easily resolved (Fig 1b). Regions of interest can be analyzed at higher resolution, demonstrating cardiomyocyte-specific subcellular ultrastructure, including sarcomeres (Fig 1c, Supplemental Fig 1a). In all subsequent analyses, cardiomyocyte nuclei were identified by their location within sarcomere-containing cells, distinguishing them from adjacent stromal cells.
An immense advantage of MIMS is the detection of nonradioactive stable isotope tracers. As an integral part of animate and inanimate matter, they do not alter biochemical reactions and are not harmful to the organism18. MIMS localizes stable isotope tracers by simultaneously quantifying multiple masses from each analyzed domain; this enables the generation of a quantitative ratio image of two stable isotopes of the same element15. The incorporation of a tracer tagged with the rare stable isotope of nitrogen (15N) is detectable with high precision by an increase in 15N:14N above the natural ratio (0.37%). Nuclear incorporation of 15N-thymidine is evident in cells having divided during a one-week labeling period, as observed in the small intestinal epithelium, which turns over completely in 3–5 days16 (Fig 1d); in contrast, 15N-thymidine labeled cells are rarely observed in the heart (Fig 1e) after 1 week of labeling. In subsequent studies, small intestine was used as a positive control to confirm label delivery.
To evaluate for an age-related change in cell cycle activity, we administered 15N-thymidine for 8 weeks to three age groups of C57BL6 mice starting at day-4 (neonate), at 10-weeks (young adult) and at 22-months (old adult) (Supplemental Fig 2). We then performed MIMS analysis (Fig 2a, b, Supplemental Fig 3). In the neonatal group, 56% (±3% s.e.m., n=3 mice) of cardiomyocytes demonstrated 15N nuclear labeling, consistent with the well-accepted occurrence of cardiomyocyte DNA synthesis during post-natal development19. We observed a marked decline in the frequency of 15N-labeled cardiomyocyte nuclei (15N+CM) in the young adult (neonate= 1.00%15N+CM/day ±0.05 s.e.m. vs young adult=0.015% 15N+CM/ day ±0.003 s.e.m., n=3 mice/group, p<0.001) (Fig 2a, c; Supplemental Fig 3). We found a further reduction in cardiomyocyte DNA synthesis in old mice (young adult=0.015%15N+CM/day ±0.003 s.e.m. vs. old adult=0.007 %15N+CM/day ±0.002 s.e.m., n=3/group, p<0.05) (Fig 2c). The observed pattern of nuclear 15N-labeling in cardiomyocytes is consistent with the known chromatin distribution pattern in cardiomyocytes20 (Supplemental Fig 1b) and was measured at levels that could not be explained by DNA repair (Supplemental Fig 4). Extrapolating DNA synthesis measured in cardiomyocytes over 8 weeks yields a yearly rate of 5.5% in the young adult and 2.6% in the old mice. Given that cardiomyocytes are known to undergo DNA replication without completing the cell cycle19,21,22, these calculations represent the upper limit of cardiomyocyte generation under normal homeostatic conditions, indicating a low rate of cardiogenesis.
To test whether cell cycle activity occurred in preexisting cardiomyocytes or was dependent on a progenitor pool, we performed 15N-thymidine labeling of double-transgenic MerCreMer/ZEG mice, previously developed for genetic lineage mapping (Fig 3a)23,24. MerCreMer/ZEG cardiomyocytes irreversibly express green fluorescent protein (GFP) after treatment with 4OH-tamoxifen, allowing pulse labeling of existing cardiomyocytes with a reproducible efficiency of approximately 80%. Although some have reported rare GFP expression by non-cardiomyocytes with this approach25, we did not detect GFP expression in interstitial cells isolated from MerCreMer/ZEG hearts nor did we detect GFP expression by Sca1 or ckit-expressing progenitors in histological sections (Supplemental Fig 5). Thus, during a chase period, cardiomyocytes generated from progenitors should be GFP−, whereas cardiomyocytes arising from preexisting cardiomyocytes should express GFP at a frequency similar to the background rate induced by 4OH-tamoxifen. We administered 4OH-tamoxifen for two weeks to 8 wk-old mice (n=4); during a subsequent 10-week chase, mice received 15N-thymidine via osmotic minipump.

We next used MIMS and genetic fate mapping to study myocardial injury. Cardiomyocyte GFP labeling was induced in MerCreMer/ZEG mice with 4OH-tamoxifen. Mice then underwent experimental myocardial infarction or sham surgery followed by continuous labeling with 15N-thymidine for 8wks. The frequency of 15N-labeled cardiomyocytes in sham-operated mice was similar to prior experiments in unoperated mice (yearly projected rates: sham=6.8%; unoperated=4.4%), but increased significantly adjacent to infarcted myocardium (total 15N+ cardiomyocyte nuclei: MI=23.0% vs sham=1.1%, Fig 4a–b, Supplemental Fig 8). We examined GFP expression, nucleation and ploidy status of 15N-labeled cardiomyocytes and surrounding unlabeled cardiomyocytes. We found a significant dilution of the GFP+ cardiomyocyte pool at the border region as previously shown23,24 (67% vs. 79%, p<0.05, Table 2, Supplemental Fig 9); however, 15N+ myocytes demonstrated a similar frequency of GFP expression compared to unlabeled myocytes (71% vs. 67%, Fisher’s exact=n.s.), suggesting that DNA synthesis was primarily occurring in pre-existing cardiomyocytes. Of 15N-labeled cardiomyocytes, approximately 14% were mononucleated and diploid consistent with division of pre-existing cardiomyocytes (Supplemental Fig 6, 7). We observed higher DNA content (>2N) in the remaining cardiomyocytes as expected with compensatory hypertrophy after injury. Thus, in the 8wks after myocardial infarction, approximately 3.2% of the cardiomyocytes adjacent to the infarct had unambiguously undergone division (total 15N+ × mononucleated diploid fraction = 23% × 0.14 = 3.2%). The low rate of cardiomyocyte cell cycle completion is further supported by the absence of detectable Aurora B Kinase, a transiently expressed cytokinesis marker, which was detected in rapidly proliferating small intestinal cells but not in cardiomyocytes (Supplemental Fig 10). We also considered the possibility that a subset of 15N+ myocytes that were multinucleated and/or polyploid resulted from division followed by additional rounds of DNA synthesis without division. However, quantitative analysis of the 15N+ population did not identify a subpopulation that had accumulated additional 15N-label as would be expected in such a scenario (Supplemental Fig 11). Together, these data suggest that adult cardiomyocytes retain some capacity to reenter the cell cycle, but that the majority of DNA synthesis after injury occurs in preexisting cardiomyocytes without completion of cell division.
If dilution of the GFP+ cardiomyocyte pool cannot be attributed to division and differentiation of endogenous progenitors, do these data exclude a role for progenitors in the adult mammalian heart? These data could be explained by preferential loss of GFP+ cardiomyocytes after injury, a process that we have previously considered but for which we have not found supporting evidence23. Such an explanation excludes a role for endogenous progenitors in cardiac repair and would be consistent with data emerging from lower vertebrates8,26 and the neonatal mouse27 in which preexisting cardiomyocytes are the cellular source for cardiomyocyte repletion. A second possibility to explain the dilution of the GFP+ cardiomyocyte pool is that injury stimulates progenitor differentiation without division; inevitably, this would lead to exhaustion of the progenitor pool, which if true could explain the limited regenerative potential of the adult mammalian heart.

In summary, this study demonstrates birth of cardiomyocytes from preexisting cardiomyocytes at a projected rate of approximately 0.76%/year (15N+ annual rate × mononucleated diploid fraction = 4.4% × 0.17) in the young adult mouse under normal homeostatic conditions, a rate that declines with age but increases by approximately four-fold after myocardial injury in the border region. This study shows that cardiac progenitors do not play a significant role in myocardial homeostasis in mammals and suggests that their role after injury is also limited.

Engineering insulin-like growth factor-1 for local delivery

T Tokunou, R Miller, P Patwari, ME Davis, VFM Segers, AJ Grodzinsky, and RT Lee
Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA and Biological Engineering, MIT, Cambridge, MA
FASEB J. 2008 June ; 22(6): 1886–1893.   http://dx.doi.org/10.1096/fj.07-100925

Insulin-like growth factor-1 (IGF-1) is a small protein that promotes cell survival and growth, often acting over long distances. Although for decades IGF-1 has been considered to have therapeutic potential, systemic side effects of IGF-1 are significant, and local delivery of IGF-1 for tissue repair has been a long-standing challenge. In this study, we designed and purified a novel protein, heparin-binding IGF-1 (Xp-HB-IGF-1), which is a fusion protein of native IGF-1 with the heparin-binding domain of heparin-binding epidermal growth factor-like growth factor. Xp-HB-IGF-1 bound selectively to heparin as well as the cell surfaces of 3T3 fibroblasts, neonatal cardiac myocytes and differentiating ES cells. Xp-HB-IGF-1 activated the IGF-1 receptor and Akt with identical kinetics and dose response, indicating no compromise of biological activity due to the heparin-binding domain. Because cartilage is a proteoglycan-rich environment and IGF-1 is a known stimulus for chondrocyte biosynthesis, we then studied the effectiveness of Xp-HB-IGF-1 in cartilage. Xp-HB-IGF-1 was selectively retained by cartilage explants and led to sustained chondrocyte proteoglycan biosynthesis compared to IGF-1. These data show that the strategy of engineering a “long-distance” growth factor like IGF-1 for local delivery may be useful for tissue repair and minimizing systemic effects.

INSULIN-LIKE GROWTH FACTOR-1 (IGF-1) is a growth factor well known as an important mediator of cell growth and differentiation. IGF-1 stimulates several signaling pathways through the tyrosine kinase IGF-1 receptor, including phosphatidylinositol (PI) 3-kinase and mitogen-activated protein kinases (MAPKs). PI3-kinase has many downstream targets, including the kinase Akt, and activation of Akt promotes survival, proliferation, and growth.
IGF-1 has been extensively studied for its therapeutic potential in tissue repair and regeneration. IGF-1 is a small and highly diffusible protein that can act over long distances. However, systemic administration of IGF-1 has significant side effects as well as the potential to promote diabetic retinopathy and cancer. Therefore, local delivery of IGF-1 has been a longstanding challenge. Here, we describe the design of a new protein, formed by fusion of IGF-1 with the heparin-binding (HB) domain of heparin-binding epidermal growth factor-like growth factor (HB-EGF). HB-EGF binds selectively to glycosaminoglycans through its highly positively charged heparin-binding domain.

Thus, we hypothesized that engineering IGF-1 to bind to glycosaminoglycans could provide selective delivery of IGF-1 to cell surfaces or to specific tissues. We demonstrate that this heparin-binding IGF-1 (Xp-HB-IGF-1) can bind to cell surfaces as well as the proteoglycan-rich tissue of cartilage; furthermore, Xp-HB-IGF-1 prolongs the stimulation of chondrocyte biosynthesis, demonstrating its potential for tissue specific repair.

Purification of Xp-HB-IGF-1

Figure 1A—C shows the constructs for Xp-HB-IGF-1 and the control Xp-IGF-1 fusion proteins.

IGF-1 has 3 disulfide bonds and includes 70 amino acids. The IGF-1 fusion proteins both contain polyhistidine tags for protein purification and Xpress tags for protein detection. The expected molecular masses of Xp-HB-IGF-1 and Xp-IGF-1 are 14,018 and 11,548 Da, respectively. Xp-HB-IGF-1 has the HB domain on the N terminus of IGF-1. The HB domain has 21 amino acids and includes 12 positively charged amino acids. Final purification of the new fusion proteins after refolding was performed with RP-HPLC (Fig. 1D, E). Identification of the correctly folded protein was performed as described previously and confirmed with bioactivity assays. These 3 IGF-1s (Xp-HB-IGF-1, Xp-IGF-1, and unmodified IGF-1) yielded similar intensities.

Xp-HB-IGF-1 binds to heparin and cell surfaces

1. Xp-HB-IGF-1 binds selectively to heparin compared with Xp-IGF-1 (Fig. 2A).
2. Xp-HB-IGF-1 bound to 3T3 fibroblast cells when treated with 10 and 100 nM concentrations.
3. Xp-HB-IGF-1 binds with neonatal cardiac myocytes, with clear selective binding of Xp-HB-IGF-1 (Fig 2C)
4. These results are consistent with binding of this HB domain to heparan sulfate in the submicromolar range
5. Xp-HB-IGF-1 was readily detected on the surfaces of ES cells in embryoid bodies — which contain multiple cell types.
6. There is more Xpress epitope tag in Xp-HB-IGF-1 group than the Xp-IGF-1 group, suggesting that Xp-HB-IGF-1 binds with heparan sulfate on the cell surface.

Xp-HB-IGF-1 bioactivity

Bioassays for IGF-1 receptor phosphorylation and Akt activation were performed. Control IGF-1, Xp-HB-IGF-1, and Xp-IGF-1 all activated the IGF-1 receptor of neonatal cardiac myocytes dose-dependently and induced Akt phosphorylation identically (Fig. 3A), and they  activated Akt with a similar time course (Fig. 3B), indicating — addition of the heparin-binding domain does not interfere with the bioactivity of IGF-1.

  1. Xp-HB-IGF-1 transport in cartilage
  2. Cartilage is a proteoglycan-rich tissue, and chondrocytes respond to IGF-1 with increased extracellular matrix synthesis (19). Because prolonged local stimulation of IGF-1 signaling could thus be beneficial for cartilage repair, we studied the ability of Xp-HB-IGF-1 to bind to cartilage.
  3. Xp-HB-IGF-1 is selectively retained by cartilage, while Xp-IGF-1 is rapidly lost.
  4. Xp-HB-IGF-1 can bind to cartilage after chondroitin sulfate digestion

To explore the possibility of nonspecific binding of Xp-HB-IGF-1 to glycosaminoglycans other than heparan sulfate, we studied the binding of Xp-HB-IGF-1 after chondroitinase ABC digestion.
Xp-HB-IGF-1 retention is not mediated by the pool of chondroitin sulfated proteoglycans in the cartilage matrix.

  1. Xp-HB-IGF-1 increases chondrocyte biosynthesis
  2. Xp-HB-IGF-1, which is selectively retained in the cartilage, stimulates chondrocyte biosynthesis over a more sustained period.

DISCUSSION

In this study, we describe a novel IGF-1 protein, Xp-HB-IGF-1, which binds to proteoglycan-rich tissue and cell surfaces but has the same bioactivity as IGF-1. Our data indicate that Xp-HB-IGF-1 can activate the IGF-1 receptor and Akt and thus that the heparin-binding domain does not interfere with interactions of IGF-1 and its receptor. IGF-1 has four domains: B domain (aa 1–29), C domain (aa 30 – 41), A domain (aa 42–62) and D domain (aa 63–70), with the C domain playing the most important role in binding to the IGF-1 receptor. Replacement of the entire C domain causes a 30-fold decrease in affinity for the IGF-1 receptor. Thus, the addition of the heparin-binding domain to the N terminus of IGF-1 was not anticipated to interfere with interactions with the IGF-1 C domain.
Both extracellular matrix and cell surfaces are rich in proteoglycans and can serve as reservoirs for proteoglycan-binding growth factors. A classic example is the fibroblast growth factor-2 (FGF-2) system, where a low-affinity, high-capacity pool of proteoglycan receptors serves as a reservoir of FGF-2 for its high-affinity receptor. Our experiments suggest that Xp-HB-IGF-1 could function in some circumstances in a similar manner, since Xp-HB-IGF-1 is selectively retained on cell surfaces. Many growth factors are known to interact with heparan sulfate, including HB-EGF (10-12), FGF-2 (26), vascular endothelial growth factor-A (VEGF-A), transforming growth factor beta (TGF-β) (28), platelet-derived growth factors (PDGFs), and hepatocyte growth factor (HGF). However, other proteins such as nerve growth factor (NGF), which induces differentiation and reduces apoptosis of neurons, does not have the heparin-binding domain. Thus, the strategy of engineering growth factors for selective matrix or cell surface binding could be used for other growth factors.
IGF-1 can also bind with extracellular matrix via IGF binding proteins (IGFBPs); in the circulation, at least 99% of IGF-1 is bound to IGFBPs (IGFBP-1 to −6). Further experiments are necessary to determine whether addition of a heparin-binding domain to IGF-1 changes interactions with IGFBPs and whether this changes its biological activity.
IGF-1 can promote the synthesis of cartilage extracellular matrix and inhibit cartilage degradation (19); however, a practical mode of IGF-1 delivery to cartilage has yet to be developed (33). Heparan sulfate proteoglycans are prevalent in the pericellular matrix of cartilage, particularly as chains on perlecan and syndecan-2, and are known to bind other ligands such as FGF-2 (34). Our experiments suggest that Xp-HB-IGF-1 protein can bind with matrix and increase local, long-term bioavailability to chondrocytes and thus may improve cartilage repair.

Selected References

Hameed M, Orrell RW, Cobbold M, Goldspink G, Harridge SD. Expression of IGF-I splice variants in young and old human skeletal muscle after high resistance exercise. J. Physiol 2003;547:247–254. [PubMed: 12562960]
Shavlakadze T, Winn N, Rosenthal N, Grounds MD. Reconciling data from transgenic mice that overexpress IGF-I specifically in skeletal muscle. Growth Horm. IGF Res 2005;15:4–18. [PubMed: 15701567]
Milner SJ, Francis GL, Wallace JC, Magee BA, Ballard FJ. Mutations in the B-domain of insulin-like growth factor-I influence the oxidative folding to yield products with modified biological properties. Biochem. J 1995;308(Pt 3):865–871. [PubMed: 8948444]
Milner SJ, Carver JA, Ballard FJ, Francis GL. Probing the disulfide folding pathway of insulin-like growth factor-I. Biotechnol. Bioeng 1999;62:693–703. [PubMed: 9951525]
Bonassar LJ, Grodzinsky AJ, Srinivasan A, Davila SG, Trippel SB. Mechanical and physicochemical regulation of the action of insulin-like growth factor-I on articular cartilage. Arch. Biochem. Biophys 2000;379:57–63. [PubMed: 10864441]
Denley A, Cosgrove LJ, Booker GW, Wallace JC, Forbes BE. Molecular interactions of the IGF system. Cytokine Growth Factor Rev 2005;16:421–439. [PubMed: 15936977]
Musaro A, Dobrowolny G, Rosenthal N. The neuroprotective effects of a locally acting IGF-1 isoform. Exp. Gerontol 2007;42:76–80. [PubMed: 16782294]
Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim. Biophys. Acta 1986;883:173–177. [PubMed: 3091074]
Yayon A, Klagsbrun M, Esko JD, Leder P, Ornitz DM. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 1991;64:841– 848. [PubMed: 1847668]
Martin P. Wound healing—aiming for perfect skin regeneration. Science 1997;276:75–81. [PubMed: 9082989]

Figure 1. Construction and purification of a new Xp-HB-IGF-1 fusion protein.

Figure 1.  Construction and purification of a new Xp-HB-IGF-1 fusion protein.

A) The heparin binding domain of HB-EGF was inserted N-terminal to IGF-1 to generate the fusion protein. The construct included the hexahistidine and Xpress tags from the pTrcHis vector for purification and detection. B) The resulting amino acid sequence of HB-IGF-1. C) Schematic for the structure of HB-IGF-1. Red circles: positively charged amino acids; blue circles: negatively charged amino acids; yellow circles: cysteines. The arrow shows the HB domain. In this figure the epitope tags are not shown. D, E) Representative reverse-phase high-performance liquid chromatography (RP-HPLC) elution profiles with single peaks containing correctly folded protein. Readings of optical density at 214 nm are in blue; readings at 280 nm are in red; elution is by acetonitrile (ACN) gradient. F) After RP-HPLC, Coomassie blue staining and Western blot analysis demonstrate isolation of single bands containing Xpress-tagged protein. The right panel shows that the Western blot analysis of IGF-1, and the two engineered IGF-1 proteins yield similar results using an anti-IGF-1 antibody.

Protein Therapeutics for Cardiac Regeneration after Myocardial Infarction

Vincent F.M. Segers and Richard T. Lee
Provasculon Inc, 14 Cambridge Center, and Harvard Stem Cell Institute and the Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Cambridge, MA
J Cardiovasc Transl Res. 2010 October ; 3(5): 469–477.   http://dx.doi./10.1007/s12265-010-9207-5.

Although most medicines have historically been small molecules, many newly approved drugs are derived from proteins. Protein therapies have been developed for treatment of diseases in almost every organ system, including the heart. Great excitement has now arisen in the field of regenerative medicine, particularly for cardiac regeneration after myocardial infarction. Every year, millions of people suffer from acute myocardial infarction, but the adult mammalian myocardium has limited regeneration potential. Regeneration of the heart after myocardium infarction is therefore an exciting target for protein therapeutics.  

In this review, we discuss different classes of proteins that have therapeutic potential to regenerate the heart after myocardial infarction. Protein candidates have been described that induce angiogenesis, including fibroblast growth factors and vascular endothelial growth factors, although thus far clinical development has been disappointing. Chemotactic factors that attract stem cells, e.g. hepatocyte growth factor and stromal cell derived factor-1, may also be useful. Finally, neuregulins and periostin are proteins that induce cell cycle reentry of cardiomyocytes, and growth factors like IGF-1 can induce growth and differentiation of stem cells. As our knowledge of the biology of regenerative processes and the role of specific proteins in these processes increases, the use of proteins as regenerative drugs could develop as a cardiac therapy.
Keywords: protein therapeutics; myocardial infarction; regeneration; heart failure

The current standard of care for MI is early reperfusion of the occluded vessel with angioplasty or thrombolysis to reverse ischemia and increase the number of surviving myocytes. Efforts to decrease delays between onset of symptoms and reperfusion have resulted in decreased morbidity and mortality, but the maximal benefit of early reperfusion has reached a point close to practical limits. Besides early reperfusion therapy, ACE inhibitors and beta-blockers are used to prevent remodeling after MI and progression to heart failure. Both ACE inhibitors and beta-blockers improve long term survival but no therapies besides cardiac transplantation are currently available that restore cardiac function.
In the last decade, a large number of pre-clinical and clinical studies have been published on the potential use of stem cells for cardiac regeneration after MI. Different stem cell types have been shown to improve cardiac function in animal studies and can induce a small but potentially significant increase in ejection fraction in clinical studies. Stem cell therapy is a promising treatment option for heart failure, but numerous technical challenges and gaps in our understanding of stem cell behavior may limit translation to the clinic.
With the advent of biotechnology, protein and peptide drugs are becoming increasingly important in modern medicine. Drugs based on naturally-occurring proteins have the advantage of efficacy based on a mechanism of action refined by millions of years of biological evolution. Though promising as therapeutics, proteins might behave differently when used at pharmacological instead of physiological concentrations with an increase in adverse effects on other organs. Proteins used as therapeutics have been modified in different ways to limit immunogenicity and rapid degradation in plasma and tissues.
We discuss four different classes of proteins that could potentially benefit patients with MI (Figure 1); all of these proteins have been shown to improve cardiac function in animal models of MI or heart failure. They include angiogenic growth factors, proteins that increase recruitment of progenitor cells to the heart, proteins that induce mitosis of existing myocytes, and proteins that increase differentiation and growth of stem cells and myocytes. As more is learned about cardiac regeneration and why mammals lack sufficient myocardial regeneration, more proteins are likely to be added to this list of candidates.

A decade of extensive research on cardiac stem cell biology revealed 1 protein (G-CSF) that can be used to mobilize hematopoietic stem cells and just 2 proteins with chemotactic properties on stem cells: SDF-1 on endothelial progenitor cells and HGF on cardiac stem cells. Another protein that has been identified as a stem cell attractant is monocyte chemotactic protein-3 which attracts mesenchymal stem cells [42]. It is unknown if local administration of MCP-3 improves cardiac function. Identification of new stem cell chemotactic proteins is important because it could lead to the development of new and feasible therapeutics for treatment of MI and heart failure. At the same time, the true regenerative potential of most stem cells remains highly controversial; indicating that even if a chemotactic factor attracting stem cells to the heart is identified, formation of functional myocardial is still a challenging task.

Proteins like periostin and neuregulin which stimulate mitosis of surviving myocytes can partially restore the damage inflicted by MI. However, some requirements have to be met before this will result in a viable therapy. An inherent selectivity for myocytes would also allow for systemic delivery as opposed to the use of more complicated local delivery methods. An important factor to consider is the duration of the signal necessary to induce mitosis in a significant number of myocytes. A protein that induces cell cycle reentry in a significant fraction of myocytes with a single pulse has more therapeutical potential than a protein that needs sustained or repeated delivery. Ideally, pro-mitotic proteins will be not only specific for myocytes in general but might also be specific for myocytes in the border zone of the MI. This has drawbacks, among which is that formation of new myocytes, either by stem cell differentiation or by myocyte mitosis, carries an increased risk of ventricular arrhythmias.

Figure 1. Regeneration of the heart by 4 different classes of proteins

Figure 1. Regeneration of the heart by 4 different classes of proteins

See text for details. A) FGF and VEGF increase angiogenesis. B) G-CSF mobilizes bone marrow hematopoietic stem cells and SDF-1 attracts endothelial progenitor cells. HGF attracts cardiac stem cells. C) Neuregulin and periostin can induce division of adult cardiomyocytes. D) IGF-1 induces maturation and differentiation of cardiac stem cells.

Read Full Post »

Myocardial Infarction: The New Definition After Revascularization

Posted in Abdominal Aorta, Aortic Valve: TAVR, TAVI vs Open Heart Surgery, Atherogenic Processes & Pathology, Bio Instrumentation in Experimental Life Sciences Research, CABG, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, Carotid Artery, Cerebrovascular and Neurodegenerative Diseases, Frontiers in Cardiology and Cardiovascular Disorders, Heart Transplant, Heart-Lung Transplant, Mechanical Assist Devices: LVAD, RVAD, BiVAD, Artificial Heart, Medical Devices R&D and Inventions, Mitral Valve: Repair and Replacement, Origins of Cardiovascular Disease, PCI, Peripheral Arterial Disease & Peripheral Vascular Surgery, Pharmacotherapy of Cardiovascular Disease, Stents & Tools, Thoracic Aorta, Valves & Tools, tagged , , , , , , , on October 15, 2013| Leave a Comment »

Myocardial Infarction: The New Definition After Revascularization

Reporter: Aviva Lev-Ari, PhD, RN

 

UPDATED on 7/31/2014

Myocardial Ischemia Symptoms

Reporter: Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2014/07/29/myocardial-ischemia-symptoms/

 

VIEW VIDEO

Gregg Stone, MD

Co-DIrector, Medical Research & Education Division Cardiovascular Research Foundation

http://www.medpagetoday.com/Cardiology/MyocardialInfarction/42256?xid=nl_mpt_DHE_2013-10-15&goback=%2Egmr_4346921%2Egde_4346921_member_5795830612724035588#%21

Primary source: Journal of the American College of Cardiology
Source reference: Moussa I, et al “Consideration of a new definition of clinically relevant myocardial infarction after coronary revascularization: an expert consensus document from the Society for Cardiovascular Angiography and Interventions (SCAI)” J Am Coll Cardiol2013; 62: 1563-1570.

Additional source: Journal of the American College of Cardiology
Source reference:White H “Avatar of the universal definition of periprocedural myocardial infarction” J Am Coll Cardiol 2013; 62: 1571-1574.

Moussa reported that he had no conflicts of interest.

Stone is a consultant for Boston Scientific, Eli Lilly, Daiichi Sankyo, and AstraZeneca. The other authors reported relationships with Guerbet, The Medicines Company, Bristol-Myers Squibb/Sanofi, Merck, Maya Medical, AstraZeneca, Abbott Vascular, Regado Biosciences, Janssen Pharma, Lilly/Daiichi Sankyo, St. Jude Medical, Medtronic, Terumo, Bridgepoint/Boston Scientific, Gilead, Boston Scientific, Eli Lilly, and Daiichi Sankyo.

White is co-chairman for the Task Force for the Universal Definiton of Myocardial Infarction; has received research grants from sanofi-aventis, Eli Lilly, The Medicines Company, the NIH, Pfizer, Roche, Johnson & Johnson, Schering-Plough, Merck Sharpe & Dohme, AstraZeneca, GlaxoSmithKline, Daiichi Sankyo Pharma Development, and Bristol-Myers Squibb; and has served on advisory boards for AstraZeneca, Merck Sharpe & Dohme, Roche, and Regado Biosciences.

WASHINGTON, DC — A “clinically meaningful” definition of MI following PCI or CABG is urgently needed to replace the arbitrarily chosen “universal definition” proposed in recent years that has no relevance to patients and may be muddying clinical-trial results. Those are the conclusions of a new expert consensus document released Monday by the Society of Cardiovascular Angiography and Interventions (SCAI)[1].

The notion of a “universal definition of MI” was first proposed in 2000 and updated in 2007 and 2012. The 2012 document defines a PCI-related MI as an increase in cardiac troponin (cTn) of more than five times the upper limit of normal (ULN) during the first 48 hours postprocedure plus specific clinical or ECG features. Post-CABG, the definition is a cTn increase of >10 times the ULN, plus different clinical or ECG features.

The problem, lead author Dr Issam Moussa (Mayo Clinic, Jacksonville, FL) told heartwire , is that these cutoffs were arbitrarily chosen and not based on any hard evidence that these biomarker levels spelled a poor prognosis. Moreover, “overnight, the rate of MI went from 5% following these procedures to 20% to 30%!” he said.

The SCAI committee, in its new document, focuses on post-PCI procedures and highlights the importance of acquiring baseline cardiac biomarkers and differentiating between patients with elevated baseline CK-MB (or cTn) in whom biomarker levels are stable or falling, as well as those in whom it hasn’t been established whether biomarkers are changing.

SCAI’s Proposed Clinically Meaningful MI Definitions

Group Definition
Normal baseline CK-MB CK-MB rise of >10x ULN or >5x ULN with new pathologic Q-waves in at least 2 contiguous leads or new persistent left bundle branch block
OR
In the absence of baseline CK-MB, a cTn rise of >70x ULN or a rise of>35 ULN plus new pathologic Q-waves in at least 2 contiguous leads or new persistent left bundle branch block
Elevated baseline biomarkers that are stable or falling A CK-MB or cTn rise that is equal (by an absolute increment) to the definitions described for patients with normal CK-MB at baseline.
Elevated baseline biomarkers that have not been shown to be stable or falling A CK-MB or cTn rise that is equal (by an absolute increment) to the definitions described for patients with normal CK-MB at baseline
Plus
New ST-segment elevation or depression
Plus
New-onset or worsening heart failure or sustained hypotension or other signs of a clinically relevant MI.

Moussa is quick to emphasize that these new clinically meaningful definitions have limited evidence to support them—and most of what exists supports CK-MB definitions, not cTn—but that the new document is based on the best scientific evidence available.

“We don’t want to come out with a definitive statement” saying this is the final word on MI definitions,” he stressed. “There is more science that needs to be done and there remains more uncertainty. We framed this to be inclusive and also to open the field for discussion.”

His hope is that this will lead to important changes in how patients are managed and money is spent. Currently, patients with clinically meaningless biomarker elevations may become unnecessarily panicked over news that they’ve had a “heart attack,” while hospital stays may be extended and further tests ordered on the basis of these results.

Moussa et al’s proposal also has important implications for clinical trials, he continued. Currently, for studies that include periprocedural MIs as an individual end point or as part of a composite end point, the very high number of biomarker-defined “MIs” collected in the trial could potentially overwhelm the true impact of any given therapy. “You are really using an end point that is truly not relevant to patients. . . . This could really affect the whole hypothesis.”

He’s expecting some push-back from cardiologists and academics, particularly those who championed the need for the universal definition in the first place, but believes most people will welcome a clinically meaningful definition.

“I think many in the medical community will accept this because they have not really been using the universal definition in their day-to-day practice anyhow.” What’s more, the National Cardiovascular Data Registry (NCDR) does not include the reporting of MI postangiography, in part because of concerns that the universal definition of MI overestimates the true incidence of this problem. “I think many in the community will look at this definition as more reflective of the true incidence of MI after angioplasty, and if it’s accepted, they are more likely to report it to databases like NCDR and use it to reflect quality-of-care processes.”

http://www.medscape.com/viewarticle/812533?nlid=35983_2105&src=wnl_edit_medp_card&uac=93761AJ&spon=2

  • ESC/ACCF/AHA/WHF Expert Consensus Document

Circulation.2012; 126: 2020-2035  Published online before print August 24, 2012,doi: 10.1161/​CIR.0b013e31826e1058

Third Universal Definition of Myocardial Infarction

  1. Kristian Thygesen;
  2. Joseph S. Alpert;
  3. Allan S. Jaffe;
  4. Maarten L. Simoons;
  5. Bernard R. Chaitman;
  6. Harvey D. White
  7. the Writing Group on behalf of the Joint ESC/ACCF/AHA/WHF Task Force for the Universal Definition of Myocardial Infarction
  1. *Corresponding authors/co-chairpersons: Professor Kristian Thygesen, Department of Cardiology, Aarhus University Hospital, Tage-Hansens Gade 2, DK-8000 Aarhus C, Denmark. Tel: +45 7846-7614; fax: +45 7846-7619: E-mail: kristhyg@rm.dk. Professor Joseph S. Alpert, Department of Medicine, Univ. of Arizona College of Medicine, 1501 N. Campbell Ave., P.O. Box 245037, Tucson AZ 85724, USA, Tel: +1 520 626 2763, Fax: +1 520 626 0967, E-mail: jalpert@email.arizona.edu. Professor Harvey D. White, Green Lane Cardiovascular Service, Auckland City Hospital, Private Bag 92024, 1030 Auckland, New Zealand. Tel: +64 9 630 9992, Fax: +64 9 630 9915, E-mail: harveyw@adhb.govt.nz.

Table of Contents

  • Abbreviations and Acronyms. . . . . . . . . . . . . . . . . . . .2021

  • Definition of Myocardial Infarction. . . . . . . . . . . . . . .2022

  • Criteria for Acute Myocardial Infarction. . . . . . . . . . . .2022

  • Criteria for Prior Myocardial Infarction. . . . . . . . . . . .2022

  • Introduction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2022

  • Pathological Characteristics of Myocardial Ischaemia and Infarction. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .2023

  • Biomarker Detection of Myocardial Injury With Necrosis. . .2023

  • Clinical Features of Myocardial Ischaemia and Infarction. . .2024

  • Clinical Classification of Myocardial Infarction. . . .2024

    • Spontaneous Myocardial Infarction (MI Type 1). . . .2024

    • Myocardial Infarction Secondary to an Ischaemic Imbalance (MI Type 2). . . . . . . . . . . . . . . . . . . . . . . .2024

    • Cardiac Death Due to Myocardial Infarction (MI Type 3). .2025

    • Myocardial Infarction Associated With Revascularization Procedures (MI Types 4 and 5). . . . . . . . . . . . . . . . . . …

New Definition for MI After Revascularization

Published: Oct 14, 2013 | Updated: Oct 15, 2013

By Todd Neale, Senior Staff Writer, MedPage Today
Reviewed by Zalman S. Agus, MD; Emeritus Professor, Perelman School of Medicine at the University of Pennsylvania and Dorothy Caputo, MA, BSN, RN, Nurse Planner

The Society for Cardiovascular Angiography and Interventions (SCAI) has released a new definition for myocardial infarction (MI) following coronary revascularization aimed at identifying only those events likely to be related to poorer patient outcomes.

In the new criteria — published as an expert consensus document inCatheterization and Cardiovascular Interventions and the Journal of the American College of Cardiology — creatine kinase-myocardial band (CK-MB) is the preferred cardiac biomarker over troponin, and much greater elevations are required to define a clinically relevant MI compared with the universal definition of MI proposed in 2007 and revised in 2012.

Also, the new definition uses the same biomarker elevation thresholds to identify MIs following both percutaneous coronary intervention (PCI) and coronary artery bypass grafting (CABG), whereas the universal definition has different thresholds for events following the two procedures.

“What we’ve really tried to emphasize in this classification scheme is the primary link between biomarker elevations and prognosis,” according to Gregg Stone, MD, of Columbia University Medical Center and the Cardiovascular Research Foundation in New York City, one of the authors of the document.

“In the universal definition of MI, they even acknowledged that their criteria were arbitrary,” Stone said in an interview. “We’ve tried to reduce the arbitrariness of the cutoff values that we selected so that the researcher, academician, clinician, hospital administrator, etc., can be confident that these levels that we’re recommending are the ones that are associated with a worse prognosis for patients suffering periprocedural complications.”

The Change

The existing universal definition for MI defines events following PCI according to an increase in cardiac troponin to greater than five times the 99th percentile upper reference limit (URL) within 48 hours when baseline levels are normal, with confirmation by electrocardiogram (ECG), imaging, or symptoms.

For CABG-related MI, the increase must be more than 10 times the 99th percentile URL within 48 hours when baseline levels are normal, with confirmation by ECG, angiography, or imaging.

But, Stone and colleagues wrote, the relationship between that degree of troponin elevation after a revascularization procedure and prognosis is not as strong as the association between a CK-MB elevation and patient outcomes.

Using a small elevation in troponin to define a post-procedure MI could find myocardial necrosis that is unlikely to be associated with poor clinical outcomes, which could have far-reaching implications, they wrote.

“Widespread adoption of an MI definition not clearly linked to subsequent adverse events such as mortality or heart failure may have serious consequences for the appropriate assessment of devices and therapies, may affect clinical care pathways, and may result in misinterpretation of physician competence,” they wrote.

To address that issue, the expert panel convened by SCAI sought to define clinically relevant MI after PCI or CABG.

A clinically relevant MI is defined in the new document based on an increase of at least 10 times the upper limit of normal in the level of CK-MB within 48 hours after a revascularization procedure when baseline levels are normal.

When the CK-MB level is not available, then an increase in troponin I or T of at least 70 times the upper limit of normal can be used to define a clinically relevant MI, according to the authors.

However, if an ECG shows new pathologic Q-waves in at least two contiguous leads or a new persistent left bundle branch block, then the thresholds can be lowered to at least five times and at least 35 times the upper limit of normal for CK-MB and troponin, respectively.

Further guidance is provided for identifying clinically relevant post-procedure MIs when the cardiac biomarker levels are elevated at baseline.

Dueling Definitions

Co-chairman of the Task Force for the Universal Definition of Myocardial Infarction, Harvey White, DSc, of Auckland City Hospital in Auckland, New Zealand, noted some limitations of the new definition, including the lack of a requirement for ischemic symptoms.

“Ischemic symptoms have always been a basic tenet of the diagnosis of MI, and it should be no different for a [PCI-related] MI,” he wrote in an accompanying editorial.

In addition, with the use of such large elevations in biomarker levels in the new definition, “there will be very few PCI-related events identified, and an opportunity to improve patient outcomes may be lost,” he wrote.

Troponin should remain the preferred biomarker over CK-MB, White argued, pointing to variability in and analytical issues with CK-MB assays, the need for sex-specific cutoffs for CK-MB levels, the need for higher thresholds of CK-MB to determine abnormalities because all individuals have circulating levels of the biomarker, and the reduced sensitivity and specificity of CK-MB.

Also, he said, CK-MB is becoming increasingly unavailable at medical centers.

“With CK-MB becoming obsolete, troponin will become the gold standard, and CK-MB will no longer have a role in defining PCI injury and infarction in clinical practice,” White wrote.

Stone admitted that troponin ultimately might be preferable to CK-MB because of its greater specificity, although the evidence does not yet support it.

“I think there’s a general desirability to move to troponins, although when you look at the data that’s out there it’s much stronger correlating CK-MB elevations to subsequent prognosis,” he said. “I think a lot of the troponin elevations are just noise or troponins are just too sensitive.”

Room for Both?

White noted in his editorial that “the rationale for the SCAI definition has been well articulated by its authors and may be appropriate in an individual trial, but it should not supplant the universal definition of MI,” he wrote.

When asked whether the new definition would replace the universal definition, Stone said there is a place for both sets of criteria.

“We would propose the clinically relevant definition be the one that is used to make most substantial decisions right now, [such as] trade-offs between efficacy and safety for new drugs and devices, in judging hospital systems and physicians, etc.,” he said. “But I do think there’s value in both, and they will both continue to evolve over time as new data becomes evident.”

http://www.medpagetoday.com/Cardiology/MyocardialInfarction/42256?xid=nl_mpt_DHE_2013-10-15&goback=%2Egmr_4346921%2Egde_4346921_member_5795830612724035588#%21 

Articles citing 

Third Universal Definition of Myocardial Infarction

  • Improved long-term clinical outcomes in patients with ST-elevation myocardial infarction undergoing remote ischaemic conditioning as an adjunct to primary percutaneous coronary interventionEur Heart J. 2013;0:eht369v1-eht369

  • The role of myeloperoxidase (MPO) for prognostic evaluation in sensitive cardiac troponin I negative chest pain patients in the emergency departmentEuropean Heart Journal: Acute Cardiovascular Care. 2013;2:203-210,
  • Coronary artery bypass grafting or percutaneous revascularization in acute myocardial infarction?Interact CardioVasc Thorac Surg. 2013;0:ivt381v1-ivt381,
  • Ischemic Conditioning as an Adjunct to Percutaneous Coronary InterventionCirc Cardiovasc Interv. 2013;6:484-492,
  • High sensitivity cardiac troponin in patients with chest painBMJ. 2013;347:f4222,
  • Chest Pain and Palpitations: Taking a Closer LookCirculation. 2013;128:271-277,
  • An Updated Definition of Stroke for the 21st Century: A Statement for Healthcare Professionals From the American Heart Association/American Stroke AssociationStroke. 2013;44:2064-2089,
  • Factors Influencing the 99th Percentile of Cardiac Troponin I Evaluated in Community-Dwelling Individuals at 70 and 75 Years of AgeClin. Chem.. 2013;59:1068-1073,
  • Detection and management of asymptomatic myocardial injury after noncardiac surgeryEuropean Journal of Preventive Cardiology.2013;0:2047487313494294v1-2047487313494294,
  • Postoperative Troponin Screening: A Cardiac Cassandra?Circulation. 2013;127:2253-2256,
  • Remote Ischemic Preconditioning Improves Outcome at 6 Years After Elective Percutaneous Coronary Intervention: The CRISP Stent Trial Long-term Follow-upCirc Cardiovasc Interv. 2013;6:246-251,
  • Outcomes for Clinical Studies Assessing Drug and Revascularization Therapies for Claudication and Critical Limb Ischemia in Peripheral Artery DiseaseCirculation. 2013;127:1241-1250,
  • Prevalence, Incidence, and Implications of Silent Myocardial Infarctions in Patients With Diabetes MellitusCirculation. 2013;127:965-967,
  • 2013 ACCF/AHA Key Data Elements and Definitions for Measuring the Clinical Management and Outcomes of Patients With Acute Coronary Syndromes and Coronary Artery Disease: A Report of the American College of Cardiology Foundation/American Heart Association Task Force on Clinical Data Standards (Writing Committee to Develop Acute Coronary Syndromes and Coronary Artery Disease Clinical Data Standards)Circulation. 2013;127:1052-1089,
  • Clin. Chem.. 2013;59:574-576,
  • Percutaneous Coronary Intervention Versus Optimal Medical Therapy for Prevention of Spontaneous Myocardial Infarction in Subjects With Stable Ischemic Heart DiseaseCirculation. 2013;127:769-781,
  • Frequency of Myocardial Infarction and Its Relationship to Angiographic Collateral Flow in Territories Supplied by Chronically Occluded Coronary ArteriesCirculation. 2013;127:703-709,
  • The Power of More Than OneCirculation. 2013;127:665-667,
  • The curious life of the biomarkerJournal of the American Dental Association. 2013;144:126-128,
  • Persistent Increases in Cardiac Troponin Concentrations As Measured with High-Sensitivity Assays after Acute Myocardial InfarctionClin. Chem.. 2013;59:443-445,
  • 2013 ACCF/AHA Guideline for the Management of ST-Elevation Myocardial Infarction: A Report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice GuidelinesCirculation. 2013;127:e362-e425,

Read Full Post »

Stenting for Proximal LAD Lesions

Posted in Atherogenic Processes & Pathology, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, Ecosystems & Industrial Concentration in the Medical Device Sector, Frontiers in Cardiology and Cardiovascular Disorders, Medical Devices R&D and Inventions, Origins of Cardiovascular Disease, PCI, Stents & Tools, tagged , , , , , , , , , on August 18, 2013| Leave a Comment »

Comment by Cardiologists posted on LinkedIn’s

European Cardiovascular Medical Devices Group, a subgroup of Cardiovascular Medical Devices Group

on Stenting for Proximal LAD Lesions: In Reference to the Invasive Procedure performed on former President George W. Bush

UPDATED on 8/7/2018

Long-Term Outcomes of Stenting the Proximal LAD

Mar 22, 2017

Authors:
Roguin A, Camenzind E, Kerner A, et al.
Citation:
Long-Term Outcomes of Stenting the Proximal Left Anterior Descending Artery in the PROTECT Trial. JACC Cardiovasc Interv 2017;10:548-556.
Summary By:
Debabrata Mukherjee, MD, FACC

Study Questions:

What are the outcomes of patients undergoing drug-eluting stent (DES) implantation according to lesion location within or outside the proximal left anterior descending (LAD) artery?

Methods:

Among the 8,709 patients enrolled in PROTECT (Patient Related Outcomes With Endeavor Versus Cypher Stenting Trial), a multicenter percutaneous coronary intervention (PCI) trial, the investigators compared the outcomes of 2,534 patients (29.1%; 3,871 lesions [31.5%]) with stents implanted in the proximal LAD with 6,172 patients (70.9%; 8,419 lesions [68.5%]) with stents implanted outside the proximal LAD. For each event, a multivariate model was constructed that examined the effect of several individual baseline clinical and angiographic characteristics, including proximal LAD target lesion, on outcomes (i.e., MACE [major adverse cardiac events], target vessel failure [TVF], and myocardial infarction [MI]).

Results:

At 4-year follow-up, death rates were the same (5.8% vs. 5.8%; p > 0.999), but more MIs occurred in the proximal LAD group (6.2% vs. 4.9%; p = 0.015). The rates of clinically driven TVF (14.8% vs. 13.5%; p = 0.109), MACE (15.0% vs. 13.7%; hazard ratio, 1.1; 95% CI, 0.97-1.31; p = 0.139), and stent thrombosis (2.1% vs. 2.0%; p = 0.800) were similar. DES type had no interaction with MACE or TVF. In multivariate analysis, the proximal LAD was a predictor for MI (p = 0.038), but not for TVF (p = 0.149) or MACE (p = 0.069).

Conclusions:

The authors concluded that proximal LAD location was associated with higher rates of MI during the long-term follow-up, but there were no differences in stent thrombosis, death, TVF, or overall MACE.

Perspective:

This post hoc analysis of a prospective, multicenter study reports no difference in the rates of death, MACE, or TVF at 4 years according to intervention at a proximal LAD or nonproximal LAD lesion. The occurrence of the predefined primary endpoint of stent thrombosis was also not dependent on whether a proximal LAD or nonproximal LAD site was treated. However, of note, stenting of proximal LAD lesions was associated with significantly higher rates of MI compared with stenting of nonproximal LAD lesions. Overall, these findings appear to suggest that proximal LAD lesions may not have additional risk in the contemporary DES era, but the higher risk of MI needs to be studied further. Future studies should compare longer-term clinical outcomes between proximal LAD PCI with DES and minimally invasive left internal mammary artery to LAD.

SOURCE

https://www.acc.org/latest-in-cardiology/journal-scans/2017/03/22/15/11/long-term-outcomes-of-stenting-the-proximal-lad

 

Stenting for Proximal LAD Lesions

Curator: Aviva Lev-Ari, PhD, RN

Michael Reinhardt • First, the media really should not be calling this “stent surgery” its a stent procedure just ask any post-CABG patient… Anyway it really is not possible to determine whether or not is was “unnecessary” without all the relevant patient data; which coronary vessel(s) involved, percent stenosis, etc. Actually I find it interesting that they apparently decided to stent the former president on the basis of a CT Angiogram which is not the standard of care for coronary imaging. I have to assume they performed an additional testing like a CT perfusion analysis and saw a clinically relevant defect and this support the decision to stent. Regarding the post-stent drugs cloplidigrel is not a benign drug but benefits far outweigh the downside of a sub-acute thrombosis which might result in a more serious future event = acute MI.

Rafael Beyar • This was absolutely an indicated procedure and almost all rational physician will treat a young patient with proximal LAD lesions with either a stent or bypass surgery

Dov V Shimon MD • No doubt! Proximal (‘close to origin’) LAD lesions are the leading “Widow makers”. Reestablishing of flow in the artery is saving from cardiac damage and death. Drug eluting stent have 2nd and 3rd generations with very low and acceptable reclosure rates and almost no abrupt closure (thrombosis). True, CTA is a screening test, but it astablishes the need for diagnostic and therapeutic angiogram. We, heart surgeons can provide long-term patency to the LAD using LIMA arterial bypass. The current advantage of stent is the incovenience and pain of surgery. Any responsible physician would opt the procedure even for himself, his relatives , his patients and for definitely for GW Bush.

http://www.linkedin.com/groupItem?view=&gid=3358310&type=member&item=265974376&commentID=157366758&goback=%2Egmr_3358310&report%2Esuccess=8ULbKyXO6NDvmoK7o030UNOYGZKrvdhBhypZ_w8EpQrrQI-BBjkmxwkEOwBjLE28YyDIxcyEO7_TA_giuRN#commentID_157366758

Coronary anatomy and anomalies

On the left an overview of the coronary arteries in the anterior projection.

Coronary anatomy and anomalies

RCA, LAD and Cx in the anterior projection

On the left an overview of the coronary arteries in the lateral projection.

  • Left Main or left coronary artery (LCA)
    • Left anterior descending (LAD)
      • diagonal branches (D1, D2)
      • septal branches
    • Circumflex (Cx)
      • Marginal branches (M1,M2)
  • Right coronary artery
    • Acute marginal branch (AM)
    • AV node branch
    • Posterior descending artery (PDA)

Eur J Cardiothorac Surg. 2004 Apr;25(4):567-71.

Isolated high-grade lesion of the proximal LAD: a stent or off-pump LIMA?

Source

Thoraxcentre, Groningen University Hospital, Groningen, The Netherlands.

Abstract

OBJECTIVES:

The objective of this study was to compare the long-term outcome of patients with an isolated high-grade stenosis of the left anterior descending (LAD) coronary artery randomized to percutaneous transluminal coronary angioplasty with stenting (PCI, stenting) or to off-pump coronary artery bypass grafting (surgery).

METHODS:

Patients with an isolated high-grade stenosis (American College of Cardiology/American Heart Association classification type B2/C) of the proximal LAD were randomly assigned to stenting (n=51) or to surgery (n=51) and were followed for 3-5 years (mean 4 years). Primary composite endpoint was freedom from major adverse cardiac and cerebrovascular events (MACCEs), including cardiac death, myocardial infarction, stroke and repeat target vessel revascularization. Secondary endpoints were angina pectoris status and need for anti-anginal medication at follow-up. Analysis was by intention to treat.

RESULTS:

MACCEs occurred in 27.5% after stenting and 9.8% after surgery (P=0.02; absolute risk reduction 17.7%). Freedom from angina pectoris was 67% after stenting and 85% after surgery (P=0.036). Need for anti-anginal medication was significantly lower after surgery compared to stenting (P=0.002).

CONCLUSION:

Patients with an isolated high-grade lesion of the proximal LAD have a significantly better 4-year clinical outcome after off-pump coronary bypass grafting than after PCI.

Daily Dose

08/12/2013 | 5:48 PM

Was George Bush’s stent surgery really unnecessary?

By Deborah Kotz / Globe Staff

VIEW VIDEO

Ever since President George W. Bush had stent surgery last Tuesday to open a blocked artery, leading physicians who weren’t involved in his care have wondered publically why he had this “unnecessary” procedure. Large clinical trials have demonstrated that stent placement doesn’t extend lives or prevent a future heart attack or stroke in those with stable heart disease.

What’s more, Bush could wind up with complications like a reblockage where the stent was placed or excessive bruising or internal bleeding from the blood thinners that he must take likely for the next year.

Dr Richard Besser, the chief medical correspondent for ABC News, questioned why Bush had an exercise stress test as part of his routine physical exam given that he had no symptoms like chest pain or shortness of breath. The stress test indicated signs of an artery blockage.

“In people who are not having symptoms, the American Heart Association says you should not do a stress test,” Besser said, “since the value of opening that artery is to relieve the symptoms.”

Cleveland Clinic cardiologist Dr. Steve Nissen agreed in his interview with USA Today. Bush, he said, likely “got the classical thing that happens to VIP patients, when they get so-called executive physicals and they get a lot of tests that aren’t indicated. This is American medicine at its worst.”

Two physicians wrote in an Washington Post op-ed column titled “President Bush’s unnecessary surgery” that they worry that the media coverage of Bush’s stent will lead “patients to pressure their own doctors for unwarranted and excessive care.”

But none of these doctors actually treated Bush or examined his medical records, so I’m a little surprised they’re making such firm calls.

Bush, an avid biker who recently completed a 100-kilometer ride, probably shouldn’t have had the exercise stress test if he wasn’t having any heart symptoms. “Routine stress testing used to be done 20 years ago, but isn’t recommended any longer since it doesn’t have any benefit,” said Brigham and Women’s cardiologist Dr. Christopher Cannon.

But Bush’s spokesman insisted the stent was necessary after followup heart imaging via a CT angiogram “confirmed a blockage that required opening.”

Cannon said Bush’s doctors may have seen signs that blood flow wasn’t getting to a significant part of the heart muscle, a condition known as ischemia. Researchers have found that those with moderate to severe ischemia appear to experience a reduction in fatal heart attacks when they have a stent placement along with medical therapy, rather than just taking medications alone. (Larger studies, though, are needed to confirm this finding.)

“If a blockage occurs at the very start of the artery and it’s extensive—95 percent blocked—then chances are it will cause significant ischemia,” Cannon said. While severe ischemia usually causes light-headedness or dizziness during exercise, Bush may have had more moderate ischemia that didn’t cause such symptoms.

It’s impossible to know for certain, he added, without seeing his medical records firsthand.

http://www.boston.com/lifestyle/health/blogs/daily-dose/2013/08/12/was-george-bush-stent-surgery-really-unnecessary/DzklhNCGVlgriNxgpKZtuO/blog.html

President Bush’s unnecessary heart surgery

  • By Vinay Prasad and Adam Cifu, Published: August 9

Vinay Prasad is chief fellow of medical oncology at the National Cancer Institute and the National Institutes of Health. Adam Cifu is a professor of medicine at the University of Chicago.

Former president George W. Bush, widely regarded as a model of physical fitness, received a coronary artery stent on Tuesday. Few facts are known about the case, but what is known suggests the procedure was unnecessary.

Before he underwent his annual physical, Mr. Bush reportedly had no symptoms. Quite the opposite: His exercise tolerance was astonishing for his age, 67. He rode more than 30 miles in the heat on a bike ride for veterans injured in the wars in Iraq and Afghanistan.

If Mr. Bush had visited a general internist practicing sound, evidence-based care, he would not have had cardiac testing. Instead, the doctor would have had conducted age-appropriate cancer screening. For the former president, this would include only colon cancer screening. It no longer would include even prostate-specific antigen testing for cancer. The doctor would have screened for cholesterol, checked for hypertension and made sure the patient was up to date on age-appropriate vaccinations, including those for pneumococcal pneumonia and shingles. Presumably Mr. Bush got these things, and he got the cardiac test as well.What value does a stress test add for an otherwise healthy 67-year-old?No study has shown that this examination improves outcomes. The trials that have been done for so-called routine stress testing examined higher-risk patients. They found that performing stress tests on people at high risk of cardiovascular disease may detect blockages but does not improve symptoms or survival. Routine stress testing does, however, increase the use of procedures such as coronary stenting.Unfortunately, Mr. Bush, like many VIPs, may be paying the price of these in-depth investigations. His stress test revealed an abnormality, prompting another test: a CT angiogram. This study showed a blockage, which was stented open during an invasive procedure. It is worth noting that at least two large randomized trials show that stenting these sorts of lesions does not improve survival. Because Mr. Bush had no symptoms, it is impossible that he felt better after these procedures.

Instead, George W. Bush will have to take two blood thinners, aspirin and Plavix, for at least a month and probably a year. (The amount of time a blood thinner is needed depends on the type of stent placed). While he takes these medications, he will have a higher risk of bleeding complications with no real benefit.

Although this may seem like an issue important only to the former president, consider the following: Although the price of excessive screening of so-called VIPs is usually paid for privately, follow-up tests, only “necessary” because of the initial unnecessary screening test, are usually paid for by Medicare, further stressing our health-care system. The media coverage of interventions like Mr. Bush’s also leads patients to pressure their own doctors for unwarranted and excessive care.

http://www.washingtonpost.com/opinions/president-bushs-unnecessary-heart-surgery/2013/08/09/c91c439c-0041-11e3-9a3e-916de805f65d_story.html

Read Full Post »

Alternative Designs for the Human Artificial Heart: Patients in Heart Failure – Outcomes of Transplant (donor)/Implantation (artificial) and Monitoring Technologies for the Transplant/Implant Patient in the Community

Posted in Bio Instrumentation in Experimental Life Sciences Research, Biomedical Measurement Science, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, FDA Regulatory Affairs, FDA, CE Mark & Global Regulatory Affairs: process management and strategic planning - GCP, GLP, ISO 14155, Frontiers in Cardiology and Cardiovascular Disorders, Health Economics and Outcomes Research, Heart Transplant, Human Immune System in Health and in Disease, Interviews with Scientific Leaders, ISO 10993 for Product Registration: FDA & CE Mark for Development of Medical Devices and Diagnostics, Massachusetts Niche Suppliers and National Leaders, Mechanical Assist Devices: LVAD, RVAD, BiVAD, Artificial Heart, Medical Devices R&D and Inventions, Medical Devices R&D Investment, Medical Imaging Technology, Image Processing/Computing, MRI, CT, Nuclear Medicine, Ultra Sound, Origins of Cardiovascular Disease, Regulated Clinical Trials: Design, Methods, Components and IRB related issues, Technology Transfer: Biotech and Pharmaceutical, tagged , , , , , , , , , , on August 5, 2013| 8 Comments »

Alternative Designs for the Human Artificial Heart: Patients in Heart Failure –  Outcomes of Transplant (donor)/Implantation (artificial) and Monitoring Technologies for the Transplant/Implant Patient in the Community

Authors and Curators: Larry H Bernstein, MD, FCAP and Justin D Pearlman, MD, PhD, FACC

and

Article Curator and Reporter: Aviva Lev-Ari, PhD, RN

Article ID #74: Alternative Designs for the Human Artificial Heart: Patients in Heart Failure – Outcomes of Transplant (donor)/Implantation (artificial) and Monitoring Technologies for the Transplant/Implant Patient in the Community. Published on 8/5/2013

WordCloud Image Produced by Adam Tubman

When the heart fails to function adequately, whether from large or multiple myocardial infarctions (tissue death/scarring) or from permanent inflammatory, toxic, microvascular or infectious muscle injury, it has two modes of failure: forward failure = inadequate pumping of blood to tissues, and backward failure = inadequate withdrawal of blood from the lungs, resulting in pulmonary congestion and elevated back-pressures which cause fluid to seep into air spaces (pulmonary edema) interfering with oxygen uptake. When the heart cannot be repaired, replacement is considered. Additional pumps may be placed in parallel and/or in series with the heart to assist circulation of blood. A heart from another patient (usually a patient deemed brain dead from trauma) or from a baboon may be transplanted to replace the ailing heart, or may be placed in tandem with the ailing heart, or the heart and lungs may be replaced together (heart-lung transplant). Additional options include the intra-aortic balloon pump, the Impella catheter pump, other ventricular assist devices. There is far greater demand for heart transplants than there are available suitable organs, so work continues on alternatives. Additional reasons to seek alternatives include the complications of transplantation. Transplantation requires shutting down the body defenses against foreign materials, called immune suppression, but the immune defense system protects against cancer and infection, so a one in five of the transplant patients succomb to cancer or infection, while others die of rejection due to insufficient suppression of the autoimmune system. Artificial materials exist that do not trigger autoimmune defenses, thereby avoiding that major issue, but energizing the pump, providing sufficient circulatory support and avoiding damage to the blood have been major hurdles.

This article has the following FIVE Parts:

Part I.  Alternative Models of Artificial Hearts, US and Europe

By Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part  II.  Comparison of the Cardiac Operations involved in an Organ Transplant of a Donor’s Heart vs Implantation of an Artificial Heart

By Justin D Pearlman, MD, PhD, FACC 

Part III. Comparative Analysis of Transplant Clinical Outcomes based on Data in:

Heart Transplant (HT) Indication for Heart Failure (HF): Procedure Outcomes and Research on HF, HT @ Two Nation’s Leading HF & HT Centers

By Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN 

Part IV.  Imaging Technologies in use for Clinical Monitoring of Patients with Heart Transplant: Donor Human Heart and Artificial Heart

By Justin D Pearlman, MD, PhD, FACC 

Part V. The Failure of a Heart Transplant – Pathology and Autopsy Findings

by Larry H Bernstein, MD, FCAP

Conclusions

by Larry H Bernstein, MD, FCAP

 

Part I

Alternative Models of Artificial Hearts, US and Europe

By Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

 

Latest Innovations in Alternative Models of Artificial Hearts, US and Europe

by Aviva Lev-Ari, PhD, RN

UPDATED on 12/29/2013

Total Artificial Heart Manufacturer SynCardia Secures $14M in Growth Financing

December 17, 2013

Total Artificial Heart Manufacturer SynCardia Secures $14M in Growth Financing

$10M Financed by SWK of Dallas with $4M from Athyrium Opportunities Fund

A $14 million infusion of funding will allow SynCardia Systems, Inc. to respond to the rapid growth in the number of Total Artificial Heart implants and SynCardia Certified Centers that has occurred since 2010. As of Dec. 16, 2013, there were 155 implants of the SynCardia Total Artificial Heart, making 2013 another record-breaking year.

TUCSON, Ariz., Dec. 17, 2013 /PRNewswire/ — Privately held SynCardia Systems, Inc. announced today that it had raised $14 million to fund the rapid growth of the only approved medical device that eliminates the symptoms and source of end-stage heart failure, the SynCardia temporary Total Artificial Heart. The SynCardia Total Artificial Heart is the world’s first and only FDA, Health Canada and CE (Europe) approved Total Artificial Heart.

“SWK is very pleased to provide SynCardia this new capital in order to help further the growth of the company’s Total Artificial Heart,” Brett Pope, CEO of SWK Holdings Corporation, says of its $10-million financing. “We are very gratified to help expand the availability of this lifesaving device.”

“In 2013 we are setting another record for SynCardia Heart implants, nearly double what was then our 2011 record-breaking year of 81 implants,” says Michael Garippa, President and CEO of SynCardia. “As of Dec. 16, 155 SynCardia Total Artificial Hearts have been implanted this year.”

The financing positively affects the development of the new, smaller 50cc version of the approved 70cc SynCardia Total Artificial Heart, the availability of the Freedom portable driver and the use of SynCardia technology for destination therapy.

“We are pleased to support SynCardia’s continued clinical and commercial successes,” says Laurent Hermouet, a partner at Athyrium. “This latest financing will help reinforce SynCardia’s supply chain and manufacturing capabilities ahead of new product launches and increased production levels.”

The $4 million provided by Athyrium Capital Management in last week’s funding supplemented $15 million in long-term growth capital it provided to SynCardia in March 2013.

Wedbush PacGrow Life Sciences acted as exclusive placement agent for the offering.

The new financing allows SynCardia to accelerate the development and launch of its 50cc Total Artificial Heart* through an FDA-approved clinical study. Together, the 50cc and 70cc sizes of the Total Artificial Heart will fit almost all women and men, as well as many pediatric patients. With this expanded product line, SynCardia anticipates the tripling of the market size and sales potential for the SynCardia Total Artificial Heart.

The funds also will help the company meet the increasing demand for the Freedom portable drivers. In a letter dated Oct. 21, 2013, the FDA determined that the Freedom PMA supplement is approvable with the submission of additional information. The 13.5-pound wearable Freedom driver, which powers the SynCardia Heart while giving patients nearly unrestricted mobility, is already approved by Health Canada and has a CE Mark for Europe.

SynCardia is an innovative, 85-employee company focused on advanced medical technology targeting the NYHA Class IV heart failure market. There are 93 SynCardia Certified Centers worldwide where the SynCardia Heart is immediately available with an additional 35 hospitals undergoing the company’s four-phase certification program. As of Dec. 16, 2013, there have been 1,262 total implants of the SynCardia Total Artificial Heart worldwide.

SWK Holdings Corporation is a specialized finance company with a focus on the global healthcare sector. SWK partners with ethical product marketers and royalty holders to provide flexible financing solutions at an attractive cost of capital to create long-term value for both SWK’s business partners and its investors. SWK believes its financing structures achieve an optimal partnership for companies, institutions and inventors seeking capital for expansion or capital and estate planning by allowing its partners to monetize future cash flow with minimal dilution to their equity stakes. Additional information on the life science finance market is available on the company’s website at http://www.swkhold.com.

Athyrium Capital Management, LLC is an asset management company formed in 2008 to focus on investment opportunities in the global healthcare sector. Athyrium invests across all healthcare verticals including biopharma, medical devices and products and healthcare services, and partners with management teams to implement creative financing solutions to companies’ capital needs. The Athyrium team has substantial investment experience in the healthcare sector across a wide range of asset classes, including public equity, private equity, fixed income, royalties and other structured securities. Athyrium has over $600 million under management as of Sept. 30, 2013. The firm’s investors include public and corporate pension funds, charitable endowments, insurance companies, funds-of-funds, family offices and university endowments. For more information, please visit http://www.athyrium.com.

*The 50cc Total Artificial Heart is designed for use as a bridge to transplant in patients of smaller stature, including women and adolescents. It has been designated as a Humanitarian Use Device (HUD) by the FDA for destination therapy in adults and as a bridge to transplant in pediatric patients. Prior to clinical study, an Investigational Device Exemption (IDE) application that includes each indication must be approved by the FDA.
** CAUTION – The Freedom portable driver is an investigational device, limited by United States law to investigational use.
About the SynCardia temporary Total Artificial Heart
For additional information, please visit: http://www.syncardia.com
Like SynCardia on Facebook
Follow SynCardia on Twitter – @SynCardia
Connect with SynCardia on LinkedIn

SOURCE

SynCardia Systems, Inc.

Read more: Total Artificial Heart Manufacturer SynCardia Secures $14M in Growth Financing – FierceMedicalDevices http://www.fiercemedicaldevices.com/press-releases/total-artificial-heart-manufacturer-syncardia-secures-14m-growth-financing#ixzz2otlLCH8I
Subscribe at FierceMedicalDevices

UPDATED on 12/23/2013

First Carmat artificial heart implanted in human in France

http://medcitynews.com/2013/12/first-artificial-heart-implanted-human/

UPDATED on 3/27/2014

Carmat Investigates Death of First Artificial Heart Recipient

Posted in Cardiovascular by Stephen Levy on March 18, 2014

French artificial heart maker Carmat says it will not perform another human implant until it has determined the cause of death of the first patient fitted with the device.

That first patient, a 76-year-old man suffering from terminal heat failure, died March 2. He received the implanted artificial heart 75 days before, on December 18. The Georges Pompidou European Hospital in Paris, where the implantation was performed, announced the death.

 

Carmat
Artificial heart internals (Courtesy Carmat)

Alain Carpentier, MD, the inventor of the heart, told the Journal du Dimanche on March 16 that the heart had stopped after a short circuit, although the exact reasons behind the death were still unknown.

“We are trying to understand where this electronic problem came from and why,” Carpentier told the French weekly. “Our engineers are working night and day to understand, and they will find (the reason).”

Velizy Villacoublay, France–based Carmat said in a news release on March 17 that it is continuing to analyze the data from the first implanted prosthesis. The company further stated that it will continue the clinical trial once it has obtained the results of the data from the first implantation.

Reuters reports that Philippe Pouletty, director general of Truffle Capital, one of Carmat’s main shareholders, told i>Tele television, “Patients are still being chosen, but of course we will wait to hear a little more on the causes of the death of the first patient before transplanting another artificial heart.”

The company explained that its detailed analysis of the data is still being carried out. More than 4000 pieces of data are recorded every second, it said. These include inputs from the artificial heart itself, its control console, and their respective power supplies.

Also of great interest are the very complex interactions between the weakened heart of the patient and the prosthesis. At the current time, Carmat says, there is no single explanation, only hypotheses that will be substantiated or not in the coming weeks by in-house and external experts. The results of the analyses of the first implantation, and the subsequent implantations, will be reviewed by the Data and Safety Monitoring Board (DSMB).

From the company’s point of view, the first implantation was a success. The patient survived for 74 days within the framework of a trial where the benchmark for success was 30 days. Carmat says that the approved medical centers are continuing to assess next patients for the ongoing clinical trial.

Pouletty said that the data analysis would be complete within “a few weeks.” The company has previously stated that if it passed this first safety test, it intends to fit the device into about 20 more patients with less severe heart failure later this year. It hopes to apply for CE Marking to market its device in Europe by 2015.

Stephen Levy is a contributor to Qmed and MPMN.

SOURCE

http://www.qmed.com/news/carmat-investigates-death-first-artificial-heart-recipient?cid=nl.qmed02

 

UPDATED on 3/6/2014

Artificial heart patient in France dies – Frenchman died 75 days after surgery

Thomson Reuters Posted: Mar 04, 2014 5:11 PM ET Last Updated: Mar 04, 2014 5:12 PM ET

The first patient fitted with an artificial heart made by the French company Carmat has died, the hospital that had performed the transplant in December has announced.

Carmat artificial heartCarmat’s bioprosthetic device is designed to replace the real heart for as much as five years, mimicking nature’s work using biological materials and sensors. (Benoit Tessier/Reuters)

The 76-year-old man died on Sunday, 75 days after the operation, the Georges Pompidou European Hospital in Paris said in a statement, adding that the cause of his death could not be known for sure at this stage.

When he was fitted with the device, the man was suffering from terminal heart failure, when the sick heart can no longer pump enough blood to sustain the body, and was said to have only a few weeks, or even days, to live.

Carmat’s bioprosthetic device is designed to replace the real heart for as much as five years, mimicking nature’s work using biological materials and sensors. It aims to help the thousands of patients who die each year while awaiting a donor, and reducing the side-effects associated with transplants.

“Carmat wishes to pay tribute to the courage and the pioneering role of this patient and his family, as well as the medical team’s dedication,” a company spokeswoman said.

She stressed that it was premature to draw any conclusions on Carmat’s artificial heart at this stage.

Three more patients in France with terminal heart failure are due to be fitted with the device. The clinical trial will be considered a success if the patients survive with the implant for at least a month.

If it passes the test, Carmat has said it would fit the device into about 20 patients with less severe heart failure.

Extending life

“The doctors directly involved in the post-surgical care wish to highlight the value of the lessons learned from this first clinical trial, with regard to the selection of the patient, his surveillance, the prevention and treatment of difficulties encountered,” the hospital said in its statement.

An in-depth analysis of the medical and technical data gathered since the patient’s operation will be needed to establish the cause of his death, the hospital added.

Carmat estimates around 100,000 patients in the United States and Europe could benefit from its artificial heart, a market worth more than $12 billion.

Among Carmat’s competitors for artificial heart implants are privately-held SynCardia Systems and Abiomed, both of the United States.

SynCardia’s artificial heart is the only one approved both in the United States and the European Union and has been implanted in more than 1,200 patients to keep them waiting for a heart from a matching donor. The longest a patient has lived with the device is just under four years prior to a transplant.

Carmat’s heart is designed to serve not as a bridge to transplant but as a permanent implant, extending life for terminally ill patients who cannot hope for a real organ, generally because they are too old and donors too scarce.

Carmat’s shares, which have risen nearly five-fold since floating on the Paris stock market in 2010, closed at 95 euros before Monday’s news, giving the company a market capitalization of around 407 million euros

SOURCE

 

December 20, 2013 12:11 pm by 

healthy heartPARIS (Reuters) – France’s Carmat said on Friday it had carried out the first human implantation of its artificial heart.The operation, performed on Wednesday at the Georges Pompidou European Hospital in Paris, went smoothly, Carmat said in a statement, adding that the patient was being monitored in the intensive care unit but was awake and talking.(Reporting by Natalie Huet; editing by Mark John)

Read more: http://medcitynews.com/2013/12/first-artificial-heart-implanted-human/#ixzz2oLlFRyDG

An artificial heart from a French company is to be tested in patients in four countries.

ArtificialHeart

By ANNE EISENBERG
Published: July 13, 2013 – The New York Times, Novelties

SCIENTISTS have long searched for a durable artificial heart that can work as efficiently as the one supplied by nature.

Carmat

Cow tissue will be used on surfaces of membranes — represented by elliptical shapes in this rendering — that touch the blood.

Now Carmat, a company based in Paris, has designed an artificial heart fashioned in part from cow tissue. The device, soon to be tested in patients with heart failure, is regulated by sensors, software and microelectronics.  Its power will come from two external, wearable lithium-ion batteries.

Fifteen years in development, the heart has been approved for clinical trials at cardiac surgery centers in Belgium, Poland, Saudi Arabia and Slovenia, where staff members are receiving training and patients are being screened, said Dr. Piet Jansen, medical director at Carmat.

In France, where the device is not yet cleared for human implantation, regulators have requested more animal tests, Dr. Jansen said; those tests are continuing.

Artificial hearts aren’t new, of course, but the Carmat heart is unusual in its design, said Dr. Joseph Rogers, an associate professor at Duke University and medical director of its cardiac transplant and mechanical circulatory support program. Surfaces in the new heart that touch human blood are made from cow tissue instead of artificial materials like plastic that can cause problems like clotting.

“The way they’ve incorporated biological surfaces for any place that contacts blood is a really nice advantage,” Dr. Rogers said. “If they have this design right, this could be a game changer.” He added that it could lessen the need for anticoagulation medicines. (Dr. Rogers has no financial connections to Carmat.)

This is the first artificial heart to use cow-derived materials — specifically, tissue from the pericardial sac that surrounds the heart. Biological tissue has been used in earlier mechanical blood pumps only in valves, Dr. Rogers said.

Thousands of people in the United States need a replacement heart, said Dr. Lynne Warner Stevenson, a professor at Harvard Medical School and director of the cardiomyopathy and heart-failure program at Brigham and Women’s Hospital in Boston. “It’s estimated that if we had enough donor hearts to go around, 100,000 to 150,000 people in the United States with heart failure would benefit,” she said. “Transplants work best, but we have only 2,000 or so adult hearts” that are available each year, she said. “It’s a huge problem.”

There are long-established options for patients while they await transplants, Dr. Stevenson said, including installing an artificial heart made by SynCardia until a donor heart is available.

When the natural heart is partly damaged or diseased, patients might keep it and have a mechanical aid implanted to bolster blood flow. Such pumps — especially those that aid the left side of the heart (LVAD)— are in wide use both as a bridge to a transplant and for lifetime therapy.

A totally artificial heart for extended use would be of great value, but it’s far too early to know if the Carmat heart, as yet untried in humans, will be that device. “The whole history of mechanical devices is that people thought they had devices where blood wouldn’t clot. But they didn’t,” Dr. Stevenson said.

Dr. Jansen said that the cost of the Carmat heart would be about $200,000 and that he did not expect it to be brought to market in Europe before the end of 2014. Once the company gains momentum with its European clinical studies, he said, it plans to start working through the regulatory process in the United States.

The Carmat heart has two chambers, each divided by a membrane. That membrane has cow tissue on one side — the side that is in contact with blood — and polyurethane on the other side, which touches the miniaturized pumping system of motors and hydraulic fluids that changes the membrane’s shape. (The motion of the membrane pushes the blood out to the body.) The embedded electronics and software adjust the rate of blood flow. Patients can wear the batteries under the arm in a holster, or in a belt, among other options.

Cow tissue is also used for the heart’s artificial valves, which were created by Dr. Alain Carpentier, a cardiac surgeon and a pioneer of heart valve repair who is also a co-founder of Carmat and its scientific director. Such valves have been used in heart-valve replacement surgery for decades. The cow tissue is chemically treated so that it is sterile and biologically inert.

The heart’s design and development relied heavily on aerospace testing strategies by EADS, the European Aeronautic Defense and Space Company, one of Carmat’s backers, Dr. Jansen said. Even so, duplicating the durability of a human heart will not be easy, said Dr. Robert Kormos, director of the artificial heart program at the University of Pittsburgh Medical Center and co-director of its heart transplant program.

“We can test these pumps on the bench in the laboratory, and in animals, but there is no true long-term data until you implant them in people for trials,” he said.

DR. JANSEN said that one design requirement for the heart was that it last five years. The company has been doing bench tests to see whether the new heart will stand up to that level of wear and tear. “Whether it lasts five years in the patient we will have to prove clinically,” he said.

Dr. Stevenson of Harvard is optimistic about the new device.

“Innovation is what we need,” she said. “This new device is exciting. I applaud the pioneers who developed it, and the patients and families who will go down this path for the first time.”

A version of this article appeared in print on July 14, 2013, on page BU3 of the New York edition with the headline: The Artificial Heart Is Getting a Bovine Boost.

SOURCE
An American designed Artificial Heart by ABIOMED, the Symphony model, assists in remodeling of heart tissue cells by design, as described in

Mechanical Circulatory Assist Devices as a Bridge to Heart Transplantation or as “Destination Therapy“: Options for Patients in Advanced Heart Failure

By Larry H Bernstein, MD, FCAP

A total artificial heart (TAH) is a device that replaces the two ventricles of the heart. Those who benefit from a TAH usually have end-stage heart failure. Since the condition is so severe that the heart can’t pump enough blood to meet the body’s needs, all treatments, except heart transplant, have failed.

The TAH is attached the atria, and mechanical valves are between the TAH and the atria functioning like the heart’s valves, controlling the flow of blood in pulmonary and systemic circulation.

Currently, the two types of TAHs are the CardioWest and the AbioCor. The main difference between these TAHs is that the CardioWest is connected to an outside power source.  The CardioWest has tubes that, through holes in the abdomen, run from inside the chest to an outside power source.

CardioWest Total Artificial Heart

Figure A shows a CardioWest TAH. Tubes exit the body and connect to a machine that powers the TAH and controls how it works.

Cardiowest_TAHt_Photo

The AbioCor TAH is completely contained inside the chest. A battery powers this TAH, and the battery is charged through the skin with a special magnetic charger. Energy from the external charger reaches the internal battery through an energy transfer device called transcutaneous energy transmission, or TET. An implanted TET device is connected to the implanted battery. An external TET coil is connected to the external charger. Also, an implanted controller monitors and controls the pumping speed of the heart.

AbioCor Total Artificial Heart

Figure B shows an AbioCor TAH and the internal devices that control how it works.

Abiomed_AB5000

A TAH usually extends life for months beyond what is expected with end-stage heart failure. It can keep one alive while waiting for a donor heart.  It is a challenge for surgeons to implant, and it can cause complications.  TAHs are devices used only in a small number of people.

There is a Difference Between Artificial Heart & Ventricular Assist Device

(see Michael Paul Maupin, eHow Contributor)

http://www.ehow.com/facts_6713118_difference-_amp_-ventricular-assist-devices.html#ixzz2a5BH465n

A ventricular assist device (VAD) utilizes the patient’s own heart, and it operates as a bridge device until a donor heart is procured for transplant. A TAH replaces a patient’s explanted heart.  The VAD is grafted onto a patient’s left ventricle, boosting the impaired ventricular function.  A VAD is either continuous or pulsatile in function. In a continuous VAD, blood is circulated through the heart like water through a hose.  A pulsatile VAD more mimics the expulsion of blood in rhythmic patterns.

http://www.ehow.com/facts_6713118_difference-_amp_-ventricular-assist-devices.html#ixzz2a5Bcbszh

On the other hand, an artificial heart completely replaces the human heart. The device functions in every way a healthy human heart would in the absence of cardiac disease.  The TAH creates the same pattern of squeeze-and-release seen in a real heart.

http://www.ehow.com/facts_6713118_difference-_amp_-ventricular-assist-devices.html#ixzz2a5Bn6xaR

As of 2010, the longest any human being has lived with an artificial heart is 21 months. In comparison, documentation exists in which a VAD recipient was still enjoying a vigorous quality of life after seven years.

Read more: http://www.ehow.com/facts_6713118_difference-_amp_-ventricular-assist-devices.html#ixzz2a5C1cPFV

The SynCardia temporary Total Artificial Heart

(An artificial heart displayed at the London Science Museum)

200px-Artificial-heart-london

http://www.wikipedia.com/Artificial Heart

An artificial heart is a device is typically used to bridge the time to heart transplantation, or to permanently replace the heart in case heart transplantation is impossible. The first artificial heart to be successfully implanted in a human was the Jarvik-7, designed and implemented by Robert Jarvik in 1982, but the first two patients to receive these hearts survived 112 (4 m) and 620 (21 m) days beyond their surgeries, respectively.[1]

Jarvik-7

It has already been stated that a TAH is distinct from a VAD, both used to support a failing heart. It is also distinct from a cardiopulmonary bypass machine, which is an external device used to provide the functions of both the heart and lungs, and it is used for only a few hours during cardiac bypass surgery.

Origin and Development of the Heart-Lung Bypass

A synthetic replacement for the severely failing heart would be expected to lower the need for heart transplants, because the demand for organs always greatly exceeds supply.  However, the first devices had problems with reactivity to synthetic materials and power supplies. For example, the Jarvik models were not created of a material that the human body would accept. This problem was improved when Dayton, Ohio’s Ival O. Salyer, along with various colleagues, developed a polymer material that the human body would not necessarily reject.

Prior to Jarvik-7, 41-year-old Henry Opitek made medical history in 1952 at Harper Hospital, Wayne State University in Detroit, Michigan when Dr. Forest Dewey Dodrill used the Dodrill-GMR heart machine to bypass Henry Opitek’s left ventricle for 50 minutes while he repaired the mitral valve. [2][3]  In this case In Dr. Dodrill’s post-operative report, he notes, “To our knowledge, this is the first instance of survival of a patient when a mechanical heart mechanism was used to take over the complete body function of maintaining the blood supply of the body while the heart was open and operated on.”[4]  A heart-lung machine was used in 1953 during a successful open heart surgery by Dr. John Heysham Gibbon, the inventor, who  performed the operation with the heart-lung substitute (distinct from an artificial heart substitute).

Designs of total artificial hearts

A precursor to the modern artificial heart pump was built by doctors William Sewell and William Glenn of the Yale School of Medicine in 1949 using an assortment of parts, and successfully bypassed the heart of a dog for more than an hour.[5]

The first patent for an artificial heart was held by Paul Winchell invented and Dr. Henry Heimlich (of the Heimlich Maneuver), which preceded the Jarvik heart.  On December 12, 1957, Dr. Willem Johan Kolff, the world’s most prolific inventor of artificial organs, implanted an artificial heart into a dog at Cleveland Clinic before he relocated to Salt Lake City, Utah, where there was established an Institute for artificial organs.  There, more than 200 physicians, engineers, students and faculty at the University of Utah Division of Artificial Organs developed, tested and improved Dr. Kolff’s artificial heart. To help manage his many endeavors, Dr. Kolff assigned project managers. Each project was named after its manager. Graduate student Robert Jarvik was the project manager for the artificial heart, which was subsequently renamed the Jarvik 7.

In 1958, Domingo Liotta initiated the studies of TAH replacement at Lyon, France, and in 1959–60 at the National University of Córdoba, Argentina. He presented his work at the meeting of the American Society for Artificial Internal Organs held in Atlantic City in March 1961. At that meeting, Dr. Liotta described the implantation of three types of orthotopic (inside the pericardial sac) TAHs in dogs, each of which used a different source of external energy: an implantable electric motor, an implantable rotating pump with an external electric motor, and a pneumatic pump.[6][7]

In 1964, the National Institutes of Health started the Artificial Heart Program, with the goal of putting a man-made organ into a human by the end of the decade.[8]  The first success followed in February 1966, when Dr. Adrian Kantrowitz performed the world’s first permanent implantation of a partial mechanical heart (left ventricular assist device) at Maimonides Medical Center, Brooklyn, NY.[9]  He relocated to Detroit’s Sinai and Wayne Stae University.

In 1981, Dr. William DeVries submitted a request to the FDA to implant the Jarvik 7 into a human being. On December 2, 1982, Dr. Kolff implanted the Jarvik 7 artificial heart into Barney Clark, who was suffering from severe congestive heart failure. With Clark tethered to an external 400 lb pneumatic compressor, he suffered prolonged periods of confusion, a number of instances of bleeding, and asked several times to be allowed to die.[10]

Total Artificial Heart (TAH)

On April 4, 1969, Domingo Liotta and Denton A. Cooley replaced a dying man’s heart with a mechanical heart inside the chest at The Texas Heart Institute in Houston as a bridge for a transplant. The patient woke up and recovered well. After 64 hours, the pneumatic-powered artificial heart was removed and replaced by a donor heart. However thirty-two hours after transplantation, the patient died of what was later proved to be an acute pulmonary infection, extended to both lungs, caused by fungi, most likely caused by an immunosuppressive drug complication.[11]

The original prototype of Liotta-Cooley artificial heart used in this historic operation is prominently displayed in the Smithsonian Institution’s National Museum of American History “Treasures of American History” exhibit in Washington, D.C..[12]

Permanent Pneumatic Total Artificial Heart (TAH)

The eighty-fifth clinical use of an artificial heart designed for permanent implantation rather than a bridge to transplant occurred in 1982 at the University of Utah. Artificial kidney pioneer Dr. Willem Johan Kolff started the Utah artificial organs program in 1967.[13] There, physician-engineer Dr. Clifford Kwan-Gett invented two components of an integrated pneumatic artificial heart system: a ventricle with hemispherical diaphragms that did not crush red blood cells (a problem with previous artificial hearts) and an external heart driver that inherently regulated blood flow without needing complex control systems.[14]   Dr. Robert Jarvik combined several modifications of the original: an ovoid shape to fit inside the human chest, a more blood-compatible polyurethane developed by biomedical engineer Dr. Donald Lyman, and a fabrication method by Kwan-Gett that made the inside of the ventricles smooth and seamless to reduce dangerous stroke-causing blood clots.[16]

Today, the modern version of the Jarvik 7 is known as the SynCardia temporary CardioWest Total Artificial Heart. It has been implanted in more than 800 people as a bridge to transplantation.

Artificial Heart Cardiowest TAH-t (improvement of Jarvik-7)

In the mid-1980s, artificial hearts were powered by dishwasher-sized pneumatic power sources whose lineage went back to Alpha-Laval milking machines and required two catheters to cross the abdominal wall to carry the pneumatic pulses to the implanted heart. The National Heart, Lung, and Blood Institute opened a competition for implantable electrically powered artificial hearts funding  Cleveland Clinic in Cleveland, Ohio; the College of Medicine of Pennsylvania State University (Penn State Hershey Medical Center) in Hershey, Pennsylvania; and AbioMed, Inc. of Danvers, Massachusetts.

Abiomed_AB5000

Polymeric trileaflet valves ensure unidirectional blood flow with a low pressure gradient and good longevity. State-of-the-art transcutaneous energy transfer eliminates the need for electric wires crossing the chest wall.

AbioCor

The first AbioCor to be surgically implanted in a patient was on July 3, 2001.[17] The AbioCor is made of titanium and plastic with a weight of two pounds, and its internal battery can be recharged with a transduction device that sends power through the skin.[17] The internal battery lasts for a half hour, and a wearable external battery pack lasts for four hours.[18] The FDA announced on September 5, 2006, that the AbioCor, intended for critically ill patients who can not receive a heart transplant[19]  could be implanted after the device had been tested on 15 patients.[19]  But limitations of the current AbioCor are that its size makes it suitable for only about 50% of the male population, and its useful life is only 1–2 years.[20]  AbioMed designed a smaller, more stable heart, the AbioCor II, by combining its valved ventricles with the control technology and roller screw developed at Penn State. This pump, which should be implantable in most men and 50% of women with a life span of up to five years,[20] had animal trials in 2005, and the company hoped to get FDA approval for human use in 2008.[21]

Intrathoracic Pump (LVAD)

On July 19, 1963, E. Stanley Crawford and Domingo Liotta implanted the first clinical Left Ventricular Assist Device (LVAD) at The Methodist Hospital in Houston, Texas, in a patient who had a cardiac arrest after surgery. The patient survived for four days under mechanical support but did not recover from the complications of the cardiac arrest.

On April 21, 1966, Michael DeBakey and Liotta implanted the first clinical LVAD in a paracorporeal position (where the external pump rests at the side of the patient) at The Methodist Hospital in Houston, in a patient experiencing cardiogenic shock after heart surgery. The patient developed neurological and pulmonary complications and died after few days of mechanical support. In October 1966, DeBakey and Liotta implanted the paracorporeal Liotta-DeBakey LVAD in a new patient who recovered well and was discharged from the hospital after 10 days, marking the first successful use of an LVAD for postcardiotomy shock.

Recent developments

In June 1996, a 46-year-old Taiwanese American Mr. Yao ST received the world’s first total artificial heart implantation done by Dr. Jeng Wei at Cheng-Hsin General Hospital[26] in the Republic of China (Taiwan). This technologically advanced pneumatic Phoenix-7 Total Artificial Heart was manufactured by a Taiwanese dentist Kelvin K. Cheng, a Chinese physican T. M. Kao and colleagues at the Taiwan TAH Research Center in Tainan, Republic of China (Taiwan). With this experimental artificial heart, the patient’s BP was maintained at 90-100/40-55 mmHg and cardiac output at 4.2-5.8 L/min. After 15 days of bridging, Mr. Yao received combined heart and kidney transplantation. As of March 2013, he is still very well and is currently living in San Francisco, USA. Mr. Yao ST is the world first successful combined heart and kidney transplantation patient after bridging with total artificial heart.[27]

In August 2006, an artificial heart was implanted into a 15-year-old girl at the Stollery Children’s Hospital in Edmonton, Alberta. It was intended to act as a temporary fixture until a donor heart could be found. Instead, the artificial heart (called a Berlin Heart) allowed for natural processes to occur and her heart healed on its own. After 146 days, the Berlin Heart was removed, and the girl’s heart was able to function properly on its own.[22]

On December 16, 2011 the Berlin Heart, a ventricular assist intended for children age 16 and under, gained U.S. FDA approval. The device has since been successfully implanted in several children including a 4-year-old Honduran girl at Children’s Hospital Boston.[23]

In 2012, a study published in the New England Journal of Medicine compared the Berlin Heart to extracorporeal membrane oxygenation (ECMO) and concluded that “a ventricular assist device available in several sizes for use in children as a bridge to heart transplantation [such as the Berlin Heart] was associated with a significantly higher rate of survival as compared with ECMO.”[24] The study’s primary author, Dr. Charles D. Fraser, Jr., surgeon in chief at Texas Children’s Hospital, explained: “With the Berlin Heart, we have a more effective therapy to offer patients earlier in the management of their heart failure. ..This is a giant step forward.” [25]

Total artificial heart (TAH) invention abroad

On October 27, 2008, French professor and leading heart transplant specialist Alain F. Carpentier announced that a fully implantable artificial heart will be ready for clinical trial by 2011 and for alternative transplant in 2013. It was developed and will be manufactured by him, biomedical firm CARMAT SA, and venture capital firm Truffle Capital. The prototype uses embedded electronic sensors and is made from chemically treated animal tissues, called “biomaterials”, or a “pseudo-skin” of biosynthetic, microporous materials.[28] According to an interview of the professor Alain Carpentier in Paris (2011), a number of leading cardiac clinics already conducted successful partial replacement of the organic components of the artificial heart, for example, replacing valves, large vessels, atria, ventricles. In addition to cardio-surgery, there is the medico-psychological aspect of an artificial heart. A quarter of patients in the postoperative period after prosthetic valvular surgery developed specific psychopathological symptoms, which later received the name Skumin syndrome in 1978. It is possible that a similar problem will be discovered when conducting large-scale operations to implant an artificial heart.[29]

Another U.S. team with a prototype called 2005 MagScrew Total Artificial Heart, including Japan and South Korea researchers are racing to produce similar projects.[30][31][32]

In August 2010, 50-year-old Angelo Tigano of Fairfield, New South Wales, Australia, had his failing heart removed in a five-hour operation and it was replaced with the SynCardia temporary Total Artificial Heart by surgeon Dr Phillip Spratt, head of the heart transplant unit at St Vincent’s Hospital, Sydney.[33]

On 12 March 2011, an experimental artificial heart was implanted in 55-year-old Craig Lewis at The Texas Heart Institute in Houston by Drs. O. H. Frazier and William Cohn. The device is a combination of two modified HeartMate II pumps that is currently undergoing bovine trials.[34]

On 9 June 2011, 40 year old Matthew Green was implanted with the SynCardia temporary Total Artificial Heart in a seven hour operation at Papworth Hospital. He was the first Briton to leave hospital supported by an artificial Heart on 2 August 2011.[35]

A centrifugal pump[36][37] or an axial-flow pump[38][39] can be used as an artificial heart, resulting in the patient being alive without a pulse.

Imachi et al. described a centrifugal artificial heart which alternately pumps the pulmonary circulation and the systemic circulation, causing a pulse.[40]

Heart Assist Devices

Patients who have some remaining heart function but who can no longer live normally may be candidates for ventricular assist devices (VAD), which do not replace the human heart but complement it by taking up much of the function.

The first Left Ventricular Assist Device (LVAD) system was created by Domingo Liotta at Baylor College of Medicine in Houston in 1962.[41]

Another VAD, the Kantrowitz CardioVad, designed by Adrian Kantrowitz boosts the native heart by taking up over 50% of its function.[42] Additionally, the VAD can help patients on the wait list for a heart transplant. In a young person, this device could delay the need for a transplant by 10–15 years, or even allow the heart to recover, in which case the VAD can be removed.[42] The artificial heart is powered by a battery that needs to be changed several times while still working.

The first heart assist device was approved by the FDA in 1994, and two more received approval in 1998.[43] While the original assist devices emulated the pulsating heart, newer versions, such as the Heartmate II,[44] developed by The Texas Heart Institute of Houston, provide continuous flow. These pumps (which may be centrifugal or axial flow) are smaller and potentially more durable and last longer than the current generation of total heart replacement pumps. A major advantage of a VAD is that the patient keeps the natural heart, which may provide enough support to keep the patient alive until a solution to the problem is implemented.

Impella 2.5 cardiac assist device in LV

Suffering from end-stage heart failure, former Vice President Dick Cheney underwent a procedure in July 2010 to have a VAD implanted at INOVA Fairfax Hospital, in Fairfax Virginia. In 2012, he received a heart transplant at age 71 after 20 months on a waiting list.

REFERENCES

1^ American Heart Association. The Mechanical Heart celebrates 50 lifesaving years. 22 10 2002. 9 Feb 2008 <http://www.americanheart.org/presenter.jhtml;jsessionid=EFNP3NSFUBXLICQFCXQCDSQ?identifier=3005888>

2^ Stephenson, Larry W, et al. “The Michigan Heart: The World’s First Successful Open Heart Operation?” Journal of Cardiac Surgery 17.3 (2002): 238–246.

3^ Lavietes, Stuart. William Glenn, 88, Surgeon Who Invented Heart Procedure, The New York Times, March 17, 2003. Accessed May 21, 2009.

4^ Artificial Heart in the chest: Preliminary report. Trans. Amer. Soc. Inter. Organs, 1961, 7:318

5^ Ablation experimentale et replacement du coeur par un coer artificial intra-thoracique. Lyon Cirurgical, 1961, 57:704

6^ Sandeep Jauhar, M.D., Ph.D.: The Artificial Heart. New England Journal of Medicine (2004): 542–544.

7^ http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2676518/, NCBI In Memoriam Dr. Adrian Kantrowitz

8^ Barron H. Lerner, MD, PhD (December 1, 2007). “The 25th Anniversary of Barney Clark’s Artificial Heart”. Celebrity Health. HealthDiaries.com. Retrieved 15 November 2010.

9^ Orthotopic cardiac prosthesis for two-staged cardiac replacement. Am J Cardio 1969; 24:723–730.

10^ “Treasures of American History”, National Museum of American History

11^ Spare Parts: Organ Replacement in American Society. Renee C. Fox and Judith P. Swazey. New York: Oxford University Press; 1992, pp. 102–104

12^ Kwan-Gett CS, Van Kampen KR, Kawai J, Eastwood N, Kolff WJ. “Results of total artificial heart implantation in calves.” Journal of Thoracic and Cardiovascular Surgery. 1971 Dec; 62(6):880–889.

13^ “Winchell’s Heart”. Time. March 12, 1973. Retrieved April 25, 2010.

14^ Kolff

15^ a b “Patient gets first totally implanted artificial heart”. CNN.com. 2001-07-03. Archived from the original on 7 June 2008. Retrieved 2008-07-13.

16^ “AbioCor FAQs”. AbioMed. Archived from the original on 3 July 2008. Retrieved 2008-07-13.

17^ a b “FDA Approves First Totally Implanted Permanent Artificial Heart for Humanitarian Uses”. FDA.gov. 2006-09-05. Retrieved 2008-07-13.

18^ a b “Will We Merge With Machines?”. popsci.com. 2005-08-01. Archived from the original on 19 July 2008. Retrieved 2008-07-13.

19^ “14th Artificial Heart Patient Dies: A Newsmaker Interview With Robert Kung, PhD”. medscape.com. 2004-11-11. Retrieved 2008-07-13.

20^ Capital Health: One year later: Berlin Heart bridges patient back to health (August 28, 2007), Capital Health, Edmonton (archived from [1] the original) on 2007-10-01).

21^ approved Berlin Heart helps patients waiting for a transplant (December 30, 2011), Children’s Hospital Boston.

22^ http://www.nejm.org/doi/pdf/10.1056/NEJMoa1014164

23^ http://www.texaschildrens.org/About-Us/News/Berlin-Heart-NEJM-2012/

24^ Cheng-Hsin General Hospital

25^ J. Wei, K. K. Cheng, D. Y. Tung, C. Y. Chang, W. M. Wan, Y. C. Chuang: Successful Use of Phoenix-7 Total Artificial Heart. Transplantation Proceedings, 1998, 30:3403-4

26^ The Carmat Heart,- The technology behind the prosthesis

27^ “About artificial heart”. Heart For Your Soul. Retrieved 2011-02-19.

28^ Total artificial heart to be ready by 2011: research team, news.yahoo.com

29^ Scientists develop artificial heart that beats like the real thing, timesonline.co.uk

30-^ Total artificial heart to be ready by 2011: research team, afp.google.com

31^ Sydney man receives Total Artificial Heart, dailyTelegraph.com.au

32^ Berger, Eric. “New artificial heart ‘a leap forward'”. Houston Chronicle. Retrieved 23 March 2011.

33^ “Plastic heart gives dad Matthew Green new lease of life”. BBC News. August 2, 2011.

34^ Black, Rosemary (January 5, 2011). “Former vice president Dick Cheney now has no pulse”. Daily News (New York).

35^ http://www.scribd.com/doc/21241693/Pulseless-Pumps-Artificial-Hearts

36^ The pulseless life

37^ Dan Baum: No Pulse: How Doctors Reinvented The Human Heart. 2012-02-29.

38^ ‘#A new pulsatile total artificial heart using a single centrifugal pump., K. Imachi, T. Chinzei, Y. Abe, K. Mabuchi, K. Imanishi, T. Yonezawa, A. Kouno, T. Ono, K. Atsumi, T. Isoyama, et al.. Institute of Medical Electronics, Faculty of Medicine, University of Tokyo, Japan.

39^ Prolonged Assisted circulation after cardiac or aortic surgery. Prolonged partial left ventricular bypass by means of intracorporeal circulation. This paper was finalist in The Young Investigators Award Contest of the American College of Cardiology. Denver, May 1962 Am. J. Cardiol. 1963, 12:399–404

40^ a b Mitka, Mike. “Midwest Trials of Heart-Assist Device.” Journal of the American Medical Association 286.21 (2001): 2661.

41^ FDA APPROVES TWO PORTABLE HEART-ASSIST DEVICES at FDA.gov

42^ An Artificial Heart That Doesn’t Beat at TechnologyReview.com

How does an artificial heart work?

The development and operation of these life-saving devices requires understanding and application of a combination of biology, materials science and physics.
Institute of Physics website  http://www.physics.org/article-questions.asp?id=74

The artficial heart

Image: Syncardia Systems

The right atrium collects blood and the right ventricle then pumps it to the lungs where it is oxygenated. The blood is then picked up by the left atrium and distributed around the body and brain by the left ventricle. Each side of the heart has a pair of valves – one pair per lung – controlling the flow of blood.

Artificial hearts can now completely, if temporarily, replace the ventricles and valves with a device made of plastic or other man-made materials, which does the job of pumping blood around.

The type of artificial heart made by Syncardia Systems, works by using a pump carried externally in a backpack – previously, patients would have to be connected to a large, immobile pump and would not have the freedom to move around.

Cardiowest_TAHt_Photo

The NHS Choices website explains that tubes connecting the heart to the pump “send pulses of air into two expandable, balloon-like sacs in the artificial ventricles, forcing out blood in much the same way that a beating heart would”.

Other models such as that produced by AbioMed use an internal pump and battery, which can be charged via transcutaneous energy transmission – a method of transferring power under the skin without having to penetrate it, thereby decreasing the chance of infection.

Energy transmission

In the artificial hearts produced by AbioMed, an electronics package is implanted in the abdomen of the recipient of the transplant to monitor and control the pumping of the heart.

Power is supplied from an external source to components under the skin, without penetrating it, using inductive electromagnetic coupling – the same principle as used by transformers to transfer electricity between different circuits, as in the national grid.

At their simplest, systems of transcutaneous energy transmission will use an external power supply connected to an external coil of wire, generating a magnetic field in it. This, in turn, produces an induced voltage in a second coil implanted under the skin, and a rectifier is used to change this alternating current into direct current that can be used to power the electronics of the heart and its controller.

Though simple in theory, in practice there are complications that arise from the need to keep the two coils aligned correctly as the patient moves, in delivering the correct level of power so that there is no excess dissipated as heat to potentially damage surrounding tissue in the patient’s body, and in making the components small enough to be carried around without too much discomfort.

Monitoring blood flow

A replacement heart needs to be able to monitor the flow of blood to regulate its pumping and ensure that the correct amount of blood is delivered around the body.

Quicker pumping is required when the transplant recipient is more active, whereas the opposite is true while he or she is resting.

Blood-flow monitors make use of ultrasound – they bounce high-frequency sound waves off blood cells coming out of the heart, the volume and speed can be measured using similar basic principles to those behind radar.

Ultrasound is used because it can monitor the flow of blood without having to be in contact with it.

Appropriate materials

Artificial hearts need to be made of light but durable materials – the Syncardia version is plastic whereas that made by AbioMed is a combination of titanium and a specially developed polyurethane, called ‘Angioflex’.

Although the Abiomed heart is designed to have as few moving parts as possible, those that it does have are made from Angioflex and are tested to ensure that they are safe for contact with blood and capable of withstanding beating 100 000 times a day for years on end.

Materials scientists can develop substances with specific properties by manipulating the constituent elements and the way in which they are processed. Materials are characterised using various techniques from condensed-matter physics including electron microscopy, x-ray diffraction and neutron diffraction.

Because they were still quite large, the first devices produced were limited to around half the male population – those with the largest chest cavities. A newer, smaller, model is intended to extend their availability to smaller people.

An artificial heart being produced by the French medical company Carmat and expected to be available by 2013 will use chemically treated animal tissue to help avoid rejection by the host’s immune system. Aerospace engineers from Airbus were also involved in its development.

Artificial hearts combine, and improve upon, many existing physics ideas to produce a piece of technology that saves lives – although they are currently only approved as a stopgap until a donor heart can be found.

Expressions of Experience: Heart Assist Devices

Video interview with O. H. “Bud” Frazier, MD; Chief, Center for Cardiac Support; Director, Cardiovascular Surgery Research; and Co-Director, Cullen Cardiovascular Research Laboratories, at Texas Heart Institute.

 O. H. “Bud” Frazier, MD, on his inspiration for developing treatments for heart failure at the Texas Heart Institute.

The Texas Heart Institute is a world leader in the development, testing and application of heart assist devices. Our goal for the surgical research conducted here is to develop and determine the best assist device to use for each individual patient. Devices may be referred to as mechanical assist devices, ventricular assist devices (VAD), left ventricular assist devices (LVAD), total artificial hearts (TAH), or simply heart pumps.

January 23, 2013

Keeping hearts pumping   Dr. Bud Frazier and Dr. Billy Cohn with heart pump BiVacor. [Photo credit Mayra Beltran, Houston Chronicle]

Doctors push the limits of heart-pump technology in an effort to save lives. Dr. Bud Frazier often tells a story about when he was a medical student in the 1960s . . . Frazier had this thought: If I can keep a man alive with my hand, why can’t we make a pump that we can pull off of the shelf to do the same thing? Dr. Billy Cohn, another physician who works at the cutting edge of heart pump technology, likes to use the history of human flight as an analogy for the evolution in his field. Experimenters in both domains had to give up the idea of bio-mimicry to advance the technology. “It is similar to when man first tried to build a flying machine with flapping wings that mimic the birds. It is obvious now that fixed wings were the way to go,” he says. “We think it is the same with the nonpulsatile pump, which, because it has only one moving part, is much more durable.” – Houston Chronicle [Photo credit Mayra Beltran]

January 13, 2013

BiVACOR artificial heart device

Australian engineer Daniel Timm’s revolutionary device to be developed at THI. “I think we’re beyond the Kitty Hawk stage with this,” – Drs. Bud Frazier and Billy Cohn. Read Eric Berger’s Houston Chronicle article.

November 20, 2012

FDA Approves HeartWare LVAD for HF

The FDA gave the green light for the HeartWare Ventricular Assist System as a bridge to heart transplantation in patients with heart failure. “The miniaturized device with an integrated inflow cannula is placed within the pericardial sac . . . simplifying the surgical insertion,” said O.H. “Bud” Frazier, MD, of Texas Heart Institute. Read the full story from medpagetoday.com.

Drs. Bud Frazier & Billy Cohn TEDMED 2012

Is this the future of artificial hearts?

At TEDMED 2012, Bud Frazier and Billy Cohn of the Texas Heart Institute preview a continuous-flow heart pump with minimal parts that works via a screw pump. Watch the VIDEO.

Cameron Engineers, THI researchers collaborate on heart pump

Engineers and scientists at Cameron Manufacturing & Engineering have worked with THI researchers in developing a new heart pump. On March 1, 2012, Cameron donated $500,000 to Texas Heart Institute at St. Luke’s Episcopal Hospital to develop a prototype heart pump which could save countless lives.

Can Tiny Heart Pump Limit Heart Muscle Damage after STEMI?

Interventional cardiologists affiliated with THI at St. Luke’s recently implanted the first two patients in the nation with a tiny heart pump in a feasibility trial to determine the pump’s potential to limit damage to heart muscle following a STEMI (ST-elevation myocardial infarction). Read the full news release to learn about the FDA-approved trial and the first enrolled patients. (November 2011)

Miniature Heart Pump: Smaller May Be Better!

Dr. William “Billy” Cohn discusses recent advances in left ventricular assist devices (LVADs) and other mechanical circulatory blood pumps as they get smaller and more adaptable to individual patients. View the video of his presentation at the Pumps & Pipes Conference (15 minutes, December 2010).

Video: Artificial hearts giving hope, saving lives. (August 19, 2011)

imeplla-LD-video

Companion 2 and Freedom Drivers

C2 Driver Supports Total Artificial Heart Patients in the Hospital Until They Are Stable and Eligible for the Freedom® Portable Driver

The Companion 2 Driver, which can be docked in the Hospital Cart or Caddy, powers the SynCardia Total Artificial Heart from implant until the patient’s condition stabilizes. Once stable, patients who are eligible can be switched to the smaller, wearable Freedom® portable driver. The Companion 2 Driver, which can be docked in the Hospital Cart or Caddy, powers the SynCardia Total Artificial Heart from implant until the patient’s condition stabilizes. Once stable, patients who are eligible can be switched to the smaller, wearable Freedom® portable driver.

The Companion 2 (C2) Driver System, which powers the SynCardia temporary Total Artificial Heart in the hospital, was selected as the Silver Winner in the Critical-Care and Emergency Medicine Products category of the Medical Design Excellence Awards (MDEA) held on June 19 in Philadelphia.

“It is a tremendous honor to have one of our products selected as a winner for the second consecutive year,” said Michael Garippa, SynCardia Chairman/CEO/President. “Our Freedom® portable driver, the world’s first wearable power supply for the Total Artificial Heart, was selected as the Bronze Winner in the same category last year. These drivers support Total Artificial Heart patients from implant with the C2 through discharge with the Freedom.”

Once stable, patients who are eligible can be switched to the 13.5-pound Freedom portable driver. Patients who meet discharge criteria can then leave the hospital and wait for a matching donor heart at home and in their communities.

The Medical Design Excellence Awards are the industry’s premier design awards competition and is the only awards program exclusively recognizing contributions and advances in the design of medical products. Entries were evaluated on the basis of their design and engineering features, including innovative use of materials, user-related functions that improve healthcare delivery and change traditional medical attitudes or practices, features that provide enhanced benefits to the patient, and the ability to overcome design and engineering challenges to meet clinical objectives.

About the SynCardia temporary Total Artificial Heart

The SynCardia Total Artificial Heart is currently approved as a bridge to transplant for people suffering from end-stage heart failure affecting both sides of the heart (biventricular failure). There have been more than 1,200 implants of the Total Artificial Heart, accounting for more than 315 patient years of life on the device. It is the only device that eliminates the symptoms and source of end-stage biventricular failure. The TAH provides immediate, safe blood flow of up to 9.5 liters per minute through each ventricle. This high volume of blood flow helps speed the recovery of vital organs, helping make the patient a better transplant candidate.

Artificial Heart Devices used at Barnes-Jewish Hospital Washington University, St. Louis

The cardiac surgeons at the Barnes-Jewish & Washington University Heart & Vascular Center are one of the leading heart surgery teams in the nation. Our permanent and temporary artificial heart devices can dramatically improve symptoms of late-stage heart failure, and sometimes even provide long-term treatment.

Mechanical Circulatory Support

The field of mechanical circulatory support in the management of patients with heart failure has seen significant advances over the past few years.  The heart failure program at Washington University and Barnes-Jewish Hospital utilizes the latest technology for both temporary and long-term mechanical support of the heart failure patient.

Temporary Support

Patients that experience severe symptoms of heart failure that cannot be stabilized with medical therapy may require a temporary support device. These implantable devices are usually placed in a cardiac catheterization lab by interventional cardiologists and/or cardiac surgeons. Temporary support devices typically serve to stabilize the patient until long-term mechanical support can be introduced. These devices include:

  • intra-aortic balloon pump
  • Impella 2.5, 4.0 and 5.0
  • TandemHeart
  • Thoratec CentriMag

Long-Term Mechanical Support

Patients may require long-term circulatory support either as a bridge to a heart transplant (bridge-to-transplant, or BTT) or as long-term treatment of heart failure in non-transplant candidates (destination therapy, or DT).  The mechanical assist device program at Barnes-Jewish & Washington University Heart & Vascular Center is one of the largest programs in the country. The program has a multidisciplinary group of dedicated specialists to ensure excellent outcomes in this patient population. Currently available devices include both left ventricular assist devices (LVAD) and the total artificial heart:

  • HeartMate II
  • HeartWare HVAD
  • Syncardia Total Artificial Heart 

The cardiac surgeons at the Barnes-Jewish & Washington University Heart & Vascular Center are one of only 13 surgical teams in the country to implant the CardioWest™ temporary Total Artificial Heart (TAH-t) as a bridge-to-transplantation in specific heart transplant candidates.

The CardioWest™ TAH-t is an improved version of the Jarvik-7 Artificial Heart, which was first implanted in 1982. This unique technology allows us to treat patients who would not survive without full circulatory support.  The CardioWest™ TAH-t completely replaces the patient’s diseased heart with a goal of restoring normal blood pressure, increasing cardiac output and giving organs such as the kidney and liver a chance to recover. As a result, patients become better candidates for transplantation.  The program is currently involved in testing the Freedom portable driver which will allow patients to leave the hospital following implantation of the TAH.

cardiowest_tah

An American designed Artificial Heart by ABIOMED, the Symphony model, assists in remodeling of heart tissue cells by design, as described in

Impella_Thumb_small 5.0 for heart failure

Heart Remodeling by Design – Implantable Synchronized Cardiac Assist Device:Abiomed’s Symphony

Table IABT vs Impella

SOURCE

Heart Remodeling by Design – Implantable Synchronized Cardiac Assist Device:Abiomed’s Symphony

Part  II  

Comparison of the Cardiac Operations involved in an Organ Transplant of a Donor’s Heart vs Implantation of an Artificial Heart

By Justin D Pearlman, MD, PhD, FACC 

A heart donor is a patient deemed brain dead who had forethought (a designation on the driver’s license) or a designated decision-maker (Healthcare Proxy) elected to make the heart available to help save another person’s life. Every tissue in the body has proteins that render a unique signature or “smell” and every patient has a limited set of markers it will accept without a fight (the histocompatibility complex, and in particular, the human leukocyte antigen).  The immune system is a major part of the body’s defenses against infection and abnormal tissues (cancer) which consists of cells trained to attack foreign protein chemistry and/or mark it for destruction with anti-bodies.

I. Heart Transplant of a Human Donor

The steps for heart transplant include:

(1) demonstration of need,

(2) identification of suitable donors,

(3) surviving while waiting for a suitable donor,

(4) surviving the removal of the damaged heart or heart and lungs to make room for the replacement (accomplished with a bypass pump),

(5) survival of the donor heart (or heart and lungs) pending preparation of the patient for receipt of the transplant,

(6) inserting the donor heart (or heart and lungs),

(7) taking the patient off the bypass pump and directing circulation through the transplant,

(8) recovery and healing,

(9) establishing and maintaining sufficient immune suppression to avoid rejection of the transplant,

(10) monitoring for functional losses or rejection.

(11) monitoring for cancer or infection,

(12) resuming enjoyment of life. Each year in the United states 800 patients die waiting for a transplant, while 2300 receive transplants.

The first heart transplant is credited to Vladimer Demikhov when he transplanted dog hearts in 1946; Dr. Shumway reported successful transplantation of the heart in 1966, and Dr. Christiaan Barnard performed the operation successfully on humans in 1967 (that patient lived 18 days). Replacing the heart with a donor heart is called orthotopic (true location) heart transplantation.  Durability of a transplant improved markedly with the approval of the immune suppression medication ciclosporine. NOVA has created a shockwave video demonstrating the heart transplant operation: view video.

The actual transplantation requires only five or six lines of sutures (stitches):

  • inferior and superior vena cava (venous input to the right ventricle),
  • the main (or left and right) pulmonary arteries (delivery of blood from right ventricle to the lungs),
  • the upper half of the original left atrium to route the 3-5 pulmonary veins to the left ventricle (return of blood from the lungs), and the
  • aorta (to route blood from the left ventricle to the brain and body).

The donor heart harvesting typically includes a segment of the superior and inferior vena cava which feed

  • the right atrium,
  • the four pulmonary veins which feed the left atrium, and
  • a portion of the pulmonary artery, and
  • the aorta.

The heart is chilled to minimized its metabolic demands while it is disconnected and transferred.

The recipient heart explantation (removal of the bad heart) after the patient is supported by a bypass pump involves:

  • cannulation (tubing placement) into the aorta,
  • the superior vena cava and
  • the inferior vena cava, then
  • explantation leaving the posterior aspect of the left atrium and the posterolateral aspect of the right atrium in the recipient patient.

The left and right pulmonary veins of the donor are divided and the veins are threaded into the retained portion of the recipient left atrium. The inferor vena cava, superior vena cava, pulmonary artery, and aorta are respectively anastomosed (sewed onto the truncated portion of the corresponding native vessels end-to-end). Clots and air are flushed out and the patient is taken off bypass pump.

II. Artificial Heart:  Implant of an Assist Device

Implantation of ventricular assist device or an artificial heart is easier than a heart transplant, but it has been challenging to match nature’s ability to place the pump and keep it powered and regulated. Also durability is a major issue. The most common ventricular assist device, the intra-aortic balloon pump, is a temporizing tool to sustain a patient for just a few days while alternatives are evaluated and pursued.The steps for implanting a ventricular assist pump can be as simple as:

(1) cleaning and applying antiseptics to the skin,

(2) placing a needle in the femoral artery at the groin area,

(3) threading a wire into the artery,

(4) threading a series of hollow tubes over the wire (dilators) and leaving the largest in place (introducer),

(5) threading a catheter-pump  through the introducer and up the aorta to the desired location,

(6) synchronizing the pump the the cardiac cycle by electrocardiogram.

If the device is an intra-aortic balloon pump (IABP) then the device is advanced to the aortic arch so that an inflatable balloon expands and contracts within the aorta from the aortic arch down to just above the renal arteries. The IABP is designed to deflate when the heart contracts (systole), to make space for blood ejecting from the failing heart (afterload reduction), then inflate when the heart relaxes (diastole), effectively converting a blood pressure of 120/80 to 80/120. The coronary arteries are stressed during systole and receive their blood supply during diastole, so the diastolic augmentation (inflation of the balloon during heart relaxation) markedly improves blood delivery to the coronary arteries, which is very helpful when the coronary arteries are diseased and not well suited for immediate repair. The actions of the balloon damage blood cells and can rupture the aorta. The blood cell damage activates clotting, so full anticoagulation is required.
If the device is an Impella catheter pump, then the distal end (farthest into the patient) crosses the aortic valve into the left ventricle to draw blood from there and deliver it beyond the heart in the descending aorta.
  The ins and outs of the IABP. Shows diastole and systole. The IABP rapidly shuttles helium gas in and out of the balloon, which is located in the descending aorta. The balloon is inflated at the onsetImpellaIABP  www.fda.gov/MedicalDevices/Safety                           Impella  www.abiomed.com

Devices draw their input from

  • arterial blood (aorta or femoral artery)
  • venous blood (vena cava), or
  • a puncture wound created in the apex of the left ventricle of the heart

The next example of a ventricular assist device to consider during open heart surgery, is the bypass pump that is used during most cardiovascular surgeries, and in particular during heart or heart-lung transplant. The bypass pump relies on a tube (cannula) placed in a large source of deoxygenated blood

  • the right atrium,
  • the inferior vena cava or
  • the femoral vein

to draw its input blood from there (diverting it from the heart), and a second cannula placed in a large artery (the aorta or the femoral artery) for output. The blood passes out of the patient (extra-corporeal) to a very large mechanical pump, that typically consists of compressible tubing and rollers to minimize trauma to the blood, passing the red cells of the blood by membranes that enable uptake of oxygen. Despite the attempts not to damage the blood, blood does get damaged, so full anti-coagulation is required. The anti-coagulation consists of intravenous heparin to bind the coagulation factors. When the patient comes off the pump, the heparinization of the blood is counteracted by intravenous protamine sulfate. Also the blood is cooled because low temperatures slow down metabolism and make the cells of the body less needy during the sub-optimal circulation support. Cooled blood has increased viscosity, offset by dilution of the blood with saline (Normal Saline, isotonic solution,  w/v of NaCl, about 300 mOsm/L or 9.0 g per liter). As the pump takes over circulation, the blood supply to the heart is clamped off (cross-clamp), at which point the surgeon can work to repair the heart (valve repair, valve replacement, aorta graft, coronary grafts) or replace the heart or heart and lungs.

Artificial hearts are extensions of the concepts above, and differ primarily in

  • how the pump in energized and
  • how the pump is regulated.

An artificial heart is designed for long term use so it must be more gentle on the blood. In Part I: Alternative Models of Artificial Hearts, US and Europe, in this article, we reported on the Latest Innovations in Alternative Models of Artificial Hearts, the Carmat Heart, it is unusual in its design, said Dr. Joseph Rogers, an associate professor at Duke University and medical director of its cardiac transplant and mechanical circulatory support program. Surfaces in the new heart that touch human blood are made from cow tissue instead of artificial materials like plastic that can cause problems like clotting, it will decrease the anticoagulation dependence by design.

Artificial hearts  must accommodate changes in demands of the body, not just in the chilled low metabolic state imposed by cardiovascular surgeons. The demands of the heart are measured by oxygen consumption in units of metabolic equivalents (METS) where 1 MET represents basal metabolism (awake at rest). MET values of activities range from 0.9 (sleeping) to 23 or more (running at 14 miles/hour = 22.5 km/hour). Thus, the artificial heart should be capable of increasing its output 2300% without damage the blood cells or running out of power. The goal of long term use generally is met by linking to an external power supply that is considered portable (on wheels), or in some cases, wearable

In contrast to Transplant of a human donor’s heart, described above, we present below the procedure for implantation of:

  • Left Ventricular Assist Device (LVAD)
  • Right Ventricular Assist Device (RVAD)
  • Bi-Ventricular Assist Device (BiVAD)
  • Total artificial heart
 Heartmate II (Thoratec, Pleasanton, CA). HeartHeartmate II (Thoratec, Pleasanton, CA).  http://thenatureofhiking.com/heartless-man.html#.UiPybNKsh8E
A left ventricular assist device has two aims:
(1) reduce the work on an ailing heart and
(2) boost the forward circulation to the brain and other vital organs.
Those goals require access to the aorta and/or the left ventricle. Most LVAD devices use the apex of the left ventricle (LV) to draw blood into the pump and they deliver the blood to the aorta (for example, Heartmate II (Thoratec, Pleasanton, CA). Thus an LVAD has the following components:
(A) Input conduit,
(B) Pump,
(C) Control lines and power drive lines (may be bundled or separate),
(D) Outflow conduit and
(E) Controller and power source (may be bundled or separate, generally external).
The connections require opening the chest to gain access to the LV apex for (A) and the aorta for (E). A cannula (hollow tube conduit) is inserted through incisions in each, and secured to those two targets. The other ends of those tubes can exit the chest wall through holes created for the purpose, but a short path to the outside invites infection. Therefore longer tunnels may be created to provide a longer passage beneath the skin for body defenses against infection, or a tunnel may be created alongside the esophagus down alongside the stomach so the pump can sit in the abdomen.  Power and control for the pump (C) may require a tunnel to the surface to reach (E) (length provides greater opportunity for the skin to defend against infection), or energy transfer may be accomplished by magnetic induction (a loop of wire below the skin paired with a loop outside the patient, well aligned) and control can also be wireless.

Complications related to Open Heart Surgery

Early complications include
  • perioperative hemorrhage,
  • air embolism, and
  • ventricular failure.
Late complications include
  • infection,
  • thromboembolism, and
  • device failure.  If the power drive is connected to a power line, the patient is tethered. Alternatively, the power may be provided by a battery pack that the patient may wear or wheel alongside.

Open Heart Surgery and Reoperative Sternotomy

The e-Reader is recommended to review the Authors’ article on this topic:

Pearlman, JD and A. Lev-Ari 7/23/2013 Cardiovascular Complications: Death from Reoperative Sternotomy after prior CABG, MVR, AVR, or Radiation; Complications of PCI; Sepsis from Cardiovascular Interventions

http://pharmaceuticalintelligence.com/2013/07/23/cardiovascular-complications-of-multiple-etiologies-repeat-sternotomy-post-cabg-or-avr-post-pci-pad-endoscopy-andor-resultant-of-systemic-sepsis/

Similar to the intra-aortic balloon pump, the role of the LVAD does not require access to the left ventricle. Both goals (afterload reduction and improved forward circulation) can be accomplished in the aorta: the afterload on the left ventricle can be reduced by removing volume from the aorta during contraction of the ailing heart (systole), thereby facilitating its forward emptying. Next, both
  • perfusion of the heart and
  • promotion of circulation
can be boosted by delivering volume to the aorta during relaxation of the ailing heart (diastole).
Alternatively, there is experimentation with a continuous pump rather than mimicking the pulsation of the native heart.
A Right ventricular assist device (RVAD) draws blood from either the right atrium or the right ventricle and delivers it to the pulmonary artery. Otherwise, it has the same components and the analogous surgical requirements.
A Biventricular assist device (BiVAD) is used when neither ventricle can perform adequately. It consists of the two devices, LVAD plus RVAD, with opportunity to share components (may share the controller system, the power drive system, and even share a single pump with two circulation channels can serve as RVAD plus LVAD).

III. Implant of a Total Artificial Heart

  • A total artificial heart is similar to a BiVAD except for the option that it can replace most of the native heart instead of connecting in tandem to it
  • If a total artificial heart is placed in tandem, the procedure is basically the same as for an RVAD plus and LVAD.
  • If the total artificial heart replaces the native heart, the surgery is very similar to the heart transplant procedure explained above, plus handling for
– pump placement,
– power drive, and
– controller as for LVAD.
As a heart replacement,
  • the native right atrium connects to the right intake of the total artificial heart,
  • the main pulmonary artery connects to the right output,
  • the native left atrium connects to the left input, and
  • the aorta connects to the left output.
The so-called “heartless man”  walked more than 400 miles (six miles every day) after a SynCardia Total Artificial Heart was placed, powered by a Freedom(R) portable backpack device.

REFERENCES

  1. Shumway NE, Lower RR, Stofer RC. Transplantation of the heart. Adv Surg 1966;2:265-84.
  2. Gilles Dreyfus G, Jebara V, Mihaileanu S, Carpentier AF.  Total orthotopic heart transplantation: An alternative to the standard technique. The Annals of Thoracic Surgery Volume 52, Issue 5 , Pages 1181-1184, November 1991
  3. Angermann CE, Spes CH, Tammew A, et al. Anatomic characteristics and valvular function of the transplanted heart:
    transthoracic versus transoesophageal echocardiographic findings. J Heart Transplant 1990;9:331-8.
  4. Griepp RB, Ergin MA. The history of experimental heart transplantation. J Heart Transplant. 1984;3:145.
  5. Copeland JG, Emery RW, Levinson MM, et al. Selection of patients for cardiac transplantation. Circulation. Jan 1987;75(1):2-9. [Medline].
  6. Ramakrishna H, Jaroszewski DE, Arabia FA. Adult cardiac transplantation: A review of perioperative management Part – I. Ann Card Anaesth. Jan-Jun 2009;12(1):71-8. [Medline]
  7. Hill JD. Bridging to cardiac transplantation. Ann Thorac Surg. Jan 1989;47(1):167-71. [Medline].
  8. Portner PM, Oyer PE, Pennington DG, et al. Implantable electrical left ventricular assist system: bridge to transplantation and the future. Ann Thorac Surg. Jan 1989;47(1):142-50. [Medline].
  9. Holman WL, Kormos RL, Naftel DC, Miller MA, Pagani FD, Blume E, et al. Predictors of death and transplant in patients with a mechanical circulatory support device: a multi-institutional study. J Heart Lung Transplant. Jan 2009;28(1):44-50. [Medline].
  10. Overcast TD, Evans RW, Bowen LE, et al. Problems in the identification of potential organ donors. Misconceptions and fallacies associated with donor cards. JAMA. Mar 23-30 1984;251(12):1559-62.[Medline].
  11. Reichart B, Brandl U. 40 years of heart transplantation and the DFG-Transregio Research Group Xenotransplantation. Xenotransplantation. Sep 2008;15(5):293-294. [Medline].
  12. Moriguchi J, Davis S, Jocson R, Esmailian F, Ardehali A, Laks H, et al. Successful use of a pneumatic biventricular assist device as a bridge to transplantation in cardiogenic shock. J Heart Lung Transplant. Oct 2011;30(10):1143-7. [Medline].
  13. Kilic A, Conte JV, Shah AS, Yuh DD. Orthotopic Heart Transplantation in Patients With Metabolic Risk Factors. Ann Thorac Surg. Feb 2 2012;[Medline].
  14. Arnaoutakis GJ, George TJ, Allen JG, Russell SD, Shah AS, Conte JV, et al. Institutional volume and the effect of recipient risk on short-term mortality after orthotopic heart transplant. J Thorac Cardiovasc Surg. Jan 2012;143(1):157-67, 167.e1. [Medline].
  15. Lee I, Localio R, Brensinger CM, Blumberg EA, Lautenbach E, Gasink L, et al. Decreased post-transplant survival among heart transplant recipients with pre-transplant hepatitis C virus positivity. J Heart Lung Transplant. Nov 2011;30(11):1266-74. [Medline].
  16. Caves PK, Stinson EB, Billingham M, Shumway NE. Percutaneous transvenous endomyocardial biopsy in human heart recipients. Experience with a new technique. Ann Thorac Surg. Oct 1973;16(4):325-36.[Medline].
  17. Hunt J, Lerman M, Magee MJ, et al. Improvement of renal dysfunction by conversion from calcineurin inhibitors to sirolimus after heart transplantation. J Heart Lung Transplant. Nov 2005;24(11):1863-7.[Medline].
  18. Pedotti P, Mattucci DA, Gabbrielli F, Venettoni S, Costa AN, Taioli E. Analysis of the complex effect of donor’s age on survival of subjects who underwent heart transplantation. Transplantation. Oct 27 2005;80(8):1026-32. [Medline].
  19. Griffith BP, Hardesty RL, Deeb GM, et al. Cardiac transplantation with cyclosporin A and prednisone. Ann Surg. Sep 1982;196(3):324-9. [Medline].
  20. Ye F, Ying-Bin X, Yu-Guo W, Hetzer R. Tacrolimus versus cyclosporine microemulsion for heart transplant recipients: a meta-analysis. J Heart Lung Transplant. Jan 2009;28(1):58-66. [Medline].
  21. Khan MS, Mery CM, Zafar F, Adachi I, Heinle JS, Cabrera AG, et al. Is mechanically bridging patients with a failing cardiac graft to retransplantation an effective therapy? Analysis of the United Network of Organ Sharing database. J Heart Lung Transplant. Aug 17 2012;[Medline].
  22. Hofflin JM, Potasman I, Baldwin JC, et al. Infectious complications in heart transplant recipients receiving cyclosporine and corticosteroids. Ann Intern Med. Feb 1987;106(2):209-16. [Medline].
  23. Tambur AR, Pamboukian SV, Costanzo MR, et al. The presence of HLA-directed antibodies after heart transplantation is associated with poor allograft outcome. Transplantation. Oct 27 2005;80(8):1019-25.[Medline].
  24. Kfoury AG, Renlund DG, Snow GL, Stehlik J, Folsom JW, Fisher PW, et al. A clinical correlation study of severity of antibody-mediated rejection and cardiovascular mortality in heart transplantation. J Heart Lung Transplant. Jan 2009;28(1):51-7. [Medline].
  25. Sweeney MS, Macris MP, Frazier OH, et al. The treatment of advanced cardiac allograft rejection. Ann Thorac Surg. Oct 1988;46(4):378-81. [Medline].
  26. Ford MA, Almond CS, Gauvreau K, Piercey G, Blume ED, Smoot LB, et al. Association of graft ischemic time with survival after heart transplant among children in the United States. J Heart Lung Transplant. Nov 2011;30(11):1244-9. [Medline].

Part III

Comparative Analysis of Transplant Clinical Outcomes based on Data in: Heart Transplant (HT) Indication for Heart Failure (HF): Procedure Outcomes and Research on HF, HT @ Two Nation’s Leading HF & HT Centers

By Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN 

 

Procedures Outcomes of Heart Transplant (HT) Indication for Heart Failure (HF)Center for Heart Failure @Cleveland Clinic, and Transplant Center @Mayo Clinic

Center for Heart Failure @Cleveland Clinic: Institution Profile

The treatment of heart failure requires a specialized multidisciplinary approach to manage the overall patient care plan.   The Kaufman Center for Heart Failure Team brings together clinicians that specialize in cardiomyopathies and ischemic heart failure for patients with:

  • All types of heart failure
  • Dilated Cardiomyopathy
  • Restrictive Cardiomyopathy
  • Arrhythmogenic Right Ventricular Dysplasia (ARVD)

Heart Failure – National Hospital Quality Measures
Cleveland Clinic, 2011 (N = 1,163) 96.9%
UHC Top Decile, 2011 99.2%
SOURCE
University Health System Consortium (UHC) Comparative Database, January through November 2011 discharges.

The Centers for Medicare and Medicaid Services (CMS) calculates two heart failure outcome measures:

  • all-cause mortality and
  • all-cause readmission rates,

each based on Medicare claims and enrollment information.

Heart Failure All-Cause 30-Day Mortality (N = 762)  July 2008 – June 2011
Cleveland Clinic 9.2%
National Average 11.6%
Heart Failure All-Cause 30-Day Readmission (N = 1,)  July 2008 – June 2011
Cleveland Clinic 27.3%
National Average 24.7%
SOURCE:
hospitalcompare.hhs.gov

The results for risk-adjusted all-cause mortality is 2% lower than the National Average and 30-day risk-adjuted readmission rates for 2008-2011 are 2% higher than the National Average.  There is no definitive information provided to explain the higher readmission rate.  One might consider that they take most difficult referrals.  The heart failure risk-adjusted readmission rate is higher than the national average; and both differences are statistically significant. To further reduce this rate, a multidisciplinary team was tasked with improving transitions from hospital to home or post-acute care facility. Specific initiatives have been implemented in each of these focus areas: communication, education and follow-up.  There is no data for comparing 1-month, 1-year, and 3-year survivals.
http://my.clevelandclinic.org/Documents/outcomes/2011/outcomes

Additional Cleveland Clinic Data is provided related to Pre- and Post-operative conditions

Preoperative patient characteristics

Prob

Diabetes mellitus 499 (21.5%) 61 (26.4%)

0.084

Congestive heart failure 758 (32.6%) 89 (38.5%)

0.069

III-IV 1830 (78.8%) 184 (84.0%)

Previous operation No injury (2324) Injury (231) P

CABG 1375 (59.2%) 162 (70.1%)

0.001

Current operation No injury (2324) Injury (231) P

CABG 897 (38.6%) 104 (45.0%)

0.056

Aortic valve surgery 1020 (43.9%) 118 (51.1%)

0.036

Tricuspid valve surgery 414 (17.8%) 52 (22.5%)

0.078

Aortic surgery 232 (10.0%) 37 (16.0%)

0.004

Postoperative results

No injury (2324) —  Injury (231) – P

PRCs 4.5  7.2 6.5  8.9

0.046

ICU stay (h) 102.3  228.6 146.3 +/- 346.9

<.001

Reoperation for bleeding 127 (5.5%) 21 (9.1%)

0.024

Sepsis 86 (3.7%) 16 (6.9%)

0.017

Stroke 56 (2.4%) 11 (4.8%)

0.033

Prolonged ventilation 505 (21.7%) 97 (42.0%)

<.001

Pneumonia 123 (5.3%) 25 (10.8%)

<.001

ARDS 32 (1.4%) 8 (3.5%)

0.015

Postoperative renal failure 237 (10.2%) 51 (22.1%)

<.001

Multisystem failure 45 (1.9%) 13 (5.6%)

<.001

Hospital death 151 (6.5%) 43 (18.6%)

<.001

Cleveland Clinic
LVAD mortality 2007-2011   5%
VAD mortality   2011
Obs 10%  Exp   17.5%  N 56
HF- NHQM
2010    1194    93.9%
2011    1163    96.9%
UHC Top decile, 2011   99.2%

Transplant Center @ Mayo Clinic: Alternative Solutions to Treatment of Heart Failure.  Mayo Clinic performs has pre-eminent adult and pediatric transplant programs.

Success Measures   2009-2011

1 mo

1 year

3 year

Heart Transplant Patient Survival — Adult
Mayo – Phoenix, AZ (n=40)

97.50%

94.63%

82.22%
Mayo – Jacksonville, FL (n=61)

95.08%

91.50%

81.82%
Saint Marys Hospital – Rochester, MN (n=48)

95.83%

95.83%

82.61%
National Average

95.89%

90.21%

81.79%
Heart Transplant – Children
Saint Marys Hospital – Rochester, MN (n=5)

100%

100%

60%
Adult Heart Organ (Graft)
Mayo – Phoenix, AZ (n=41)

97.56%

94.77%

82.22%
Mayo – Jacksonville, FL (n=61)

95.08%

91.50%

80.00%
Mayo -Rochester, MN (n=49)

93.88%

93.88%

82.61%
National Average

95.71%

89.91%

80.92%

Standards for Comparison:  SRTR function, data acquisition, analysis, and reporting.

Curator: Larry H Bernstein, MD and Curator: Aviva Lev-Ari, PhD, RN
Source: Program Specific Reprting, by S Everson [SRTR]

http://srtr.transplant.hrsa.gov/

The Scientific Registry of Transplant Recipients

supports the ongoing evaluation of solid organ transplantation in the United States. SRTR designs and carries out data analyses and maintains two websites to disseminate organ transplant information.

This site is srtr.transplant.hrsa.gov. Here you will find the OPTN/SRTR Annual Data Report, which publishes organ transplant statistics and is produced each year by SRTR staff and staff of the national Organ Procurement and Transplantation Network (OPTN).

At www.srtr.org, you will find older (pre-2010) annual data reports, current and past reports on organ procurement organizations and transplant programs, and information for researchers (including additional data tables and information about SRTR data and statistical methods).

Both sites aim to inform transplant programs, organ procurement organizations, policy makers, transplant professionals, transplant recipients, organ donors and donor families, and the general public about the current state of solid organ transplantation in the US.

SRTR also helps facilitate transplant research by providing access to data for qualified researchers interested in studying various aspects of solid organ transplantation.

The SRTR supports ongoing evaluation of the scientific and clinical status of solid organ transplantation and it provides data on all solid organ transplants and donations in the United States with oversight and funding from the Health Resources and Services Administration (HRSA), a division of the US Department of Health and Human Services, and is admionitered by the Chronic Disease Research Group of the Minneapolis Medical Research Foundation.
How SRTR differs from the Organ Procurement and Transplantation Network (OPTN).
Program-Specific Reports and their intended audience.
  1. Timeline and cohort selection.
  2. Patients who are lost to follow-up: censoring and extra ascertainment.
  3. Expected survival and risk-adjustment.
  4. Comparison points: norms versus targets.
Interpretation of survival statistics: what is important to whom? 
SRTR Products and Responsibilities: Inferential Analyses to Support Policymaking and Patient Care
*Analytic support for policy committees (OPTN, Advisory Committee on Organ Transplantation [ACOT]).
*OPTN/SRTR Annual Report.
Publications
*Report to Congress.
Journal articles and scientific presentations.
Public release data files for researchers.
*Program-specific analyses (Program-Specific Reports, Organ Procurement Organization [OPO] reports, etc).
Inferential requests.
Primary data from OPTN, supplemented with other sources.
*legislatively mandated
^Primary data source is the transplant center, submitting data through the OPTN system. Includes WL and organ allocation, tiedi, match runs.
  1. Range of other data here are incorporated either on a person-level matching basis or on an aggregate basis for comparison.
  2. Primary data source is the transplant center, submitting data through the OPTN system. Includes WL and organ allocation, tiedi, match runs.
  3. Range of other data here are incorporated either on a person-level matching basis or on an aggregate basis for comparison.
  4. Primary data source is the transplant center, submitting data through the OPTN system. Includes WL and organ allocation, tiedi, match runs.
  5. Range of other data here are incorporated either on a person-level matching basis or on an aggregate basis for comparison.
  6. National Death Index is not be used for analyses, but is used to evaluate completeness of extra ascertainment.
Each month, the SRTR receives an updated version of all data submitted by transplant centers, organ procurement organizations, and histocompatibility laboratories, along with data produced by the OPTN itself regarding organ offers, match runs, and the like.  Data linkages are used to add patient-level data, and additional ascertainment of mortality events is provided via linkage to the Social Security Death Master File.   Analysis files optimized for research are created and merged with analysis variables from the National Center for Health Statistics and the annual survey of the American Hospital Association to produce a set of Standard Analysis Files.  These are the data files used for SRTR analyses.
Regularly scheduled analyses are produced, including those available to the public such as the center-specific reports of transplant programs and OPOs, reports to the OPTN Membership and Professional Standards Committee, and the standardized insurance request for information data reports.  Program-Specific Reporting (http://www.srtr.org) uses different formats for different audiences. Feedback from centers enables data fixes and data quality improvements to occur over time.
Additional research is presented in the form of journal articles, the SRTR Report on the State of Transplantation published each year in the American Journal of Transplantation, conference proceedings, reports to OPTN and ACOT committees, an Annual Report published on the web and on CD, and a Biennial Report to Congress.  The same Standard Analysis Files that are used by SRTR are available to all researchers and can be obtained via submission of an analysis plan and completion of a Data Use Agreement.
Using SRTR-calculated center-specific statistics provides several advantages – for each audience of the CSR — over having each center self-report these characteristics:
  • Uniform methodology: The SRTR provides a uniform methodology of calculation. These methods are standard and accepted within the statistical and medical communities, however they are not the only ones available.
  • Audited data collection: All data on which these statistics are based are audited by the OPTN. The United Network for Organ Sharing (UNOS), the contractor for the OPTN, works to ensure the accuracy and reliability of these data.
  • Extra ascertainment of mortality: The SRTR helps find information about patients who become lost-to-follow-up that may be unavailable to transplanting centers, or very difficult to find.
  • Risk adjustment: Comparison of outcomes should be based on risk-adjusted models that account for the types of patients treated. Without national data, it is impossible for centers to calculate risk-adjusted comparison points.

Program-Specific Reporting –  different formats for different audiences: What we choose to focus on 

 

 Percent survival at one year, three years.

  1. What choices do our patients have?
  2. How well are we doing?

*Report Contents – Focus on patient outcomes

 Report Tables [10-11]– 
  1. Graft and patient survival rates compared with expected values
  2. Updated every 6 months (January, July).
  3. Patient and graft survival tables report 1-month, 1-year, and 3-year outcomes for 2.5-year cohorts of recipients.

Calculating Survival

 

Transplant Month Follow-up Group A: Transplant > 1 Y Group B:Transplant 6-12 Mo All
Months 0-6 Transplants
Deaths		 100
10		 100
14		 200
24
Survival 90% 86% 88%
Months 7-12 At-Risk
Deaths
Survival		 90
18
80%		 Not yet observed,
Use 80%		 .88*.80 = 70.4%or  (72 + 68.8)/2 = 70.4
1 Year Survival .90 * .80 = 72% .86*.80 = 68.8%

Incomplete Data and Loss to Follow-Up

  • Censoring (Kaplan Meier/Cox) works only if “lost” patients have similar failure rates as followed patients (unbiased).
  • Censoring can produce unstable estimates for small samples
  • NDI study indicates that the SRTR identifies > 99% of deaths
  • Observed rates are compared with rates that would be expected based on characteristics of recipients and donors at each center.
  • Allows fair comparison among centers that treat different types of patients
  • Is the difference we see between the observed survival of 87.78% and the expected rate of 89.41% large enough to be meaningful? The answer may depend perspective.

The percent surviving at one year is only 2% lower than expected, an apparently small difference. However, the same difference appears more consequential when comparing the percent died that implied by subtracting survival percents from 100: the percent of patients who had died by the end of the first year was a full 15% higher than expected. Finally, in our example center that performed 90 transplants during a 2.5-year period, the count of deaths observed during follow-up was 30% higher, accounting for 2.5 deaths more than we would expect during time these patients were followed.

The difference between each of these is stark. The first change from a 2% difference to a 15% difference reflects the change in denominator: a small percentage point difference is a much smaller fraction of survival (usually a large number at one year) than of mortality (usually a small number). Several years after transplant, when survival rates may be close to 50%, the contrast would not be as evident.

The difference between the percent died and death count is more subtle: the expected number of deaths is calculated according to the time that patients are followed after transplant, so a patient whose follow-up ends immediately after transplant – for any reason, including death — is smaller than the expected number of deaths for a patient who died after ten months. Therefore, this last statistic accounts for the difference between a patient who survives only briefly during follow-up, and one who survives nearly the entire period, despite the fact that they have both died in the end-of-period accounting of “percent died”.

Survival time -expected deaths

Risk Adjustment

What rate would be expected for patients at this center if their outcomes were comparable to national outcomes for similar patients?
“Similar” defined by characteristics that affect the rate, such as:

  • Demographics
  • Etiology
  • Severity of illness

Differences between observed and expected outcomes are not due to these adjustment factors.

*notion of a “similar” patient: have in-common characteristics that may influence the outcome –
include basic demographic factors such as age, etiology of disease, and the patient’s severity of illness.

journal.pmed.0020133.g001 Global Mortality and Burden of Disease Attributable to Cardiovascular Diseases and Their Major Risk Factors for People 30 y of Age and Older

278px-Preventable_causes_of_death
Causes_of_death_by_age_group

Adjusted odds ratios comparing the results of CABG and PCI-stenting in the various prespecified subsets.

50-Graph-4-33_2012 Hospitalization Rates for Heart Failure, Ages 45–64 and 65 and Older, U.S., 1971–2010

48-Graph-4-30_2012 Age-Adjusted Prevalence of Cardiovascular Disease Risk Factors in Adults, U.S., 1961–2011

Risk-Adjustment Models

Each risk-adjustment model is published one month in advance of the PSRs (Figure 5). These tables serve not only as a list of all characteristics incorporated, but also tell the reader:

  1. The beta, or calculated coefficient, tells what was the effect of that characteristic on expected risk of dying or failed transplant?
  2. The standard error and p-value tell how much random variance there was around this estimate, and how sure we are that there is a real effect of this characteristic.
  3. Models are repeated for a series of three different cohorts of transplants, allowing a comparison of how stable the coefficients are across time.
  4. The index of concordance, for each model, tells the percent of variation in the order of events (deaths or graft failures) that is accurately predicted by the model. A index of 100% would suggest that the model perfectly predicts the order of events; 50% would suggest that the order is random with regard to predictors.

*Odds Ratio >1 = Failure/Death More Likely = Lower Expected;
Odds Ratio <1 = Failure/Death Less Likely = Higher Expected

Adjusting for Age

Nationally: Average survival, 85%.

  • 50% of patients are young with 95% survival.
  • 50% of patients are old with 75% survival.

Center A treats only older patients, 80% survival:
Center survival of 80% worse than national average of 85%.
100% are older patients with expected 75% survival.
Center A patients have better expected survival compared with similar patients nationwide
Center X Treats More Older Recipients than the National Average

more older recipients

Adjustment: Account for Case Mix

The older recipient age at Center X (along with other factors) gives Center X an expected 13.1% deaths, compared with the national average of 9.5%.
Use ratio of observed/expected deaths.

Adjustment: Random Variation

Obs/Exp Deaths: Center X = 1.1 (0.88-1.37); National Ave = 1.0
The confidence interval for Center X, reflecting random variation in this measure over time, overlaps the national average.
Do not flag Center X.

Concepts: Actionable, Important, and Significant

The first principle in these criteria is that all comparisons should be based on observed and expected events during the time a patient is actually followed either by the center or, in the case of patient survival, by extra ascertainment; no imputed survival should be used. They should also account for the difference in outcomes between a patient who dies in the 1st week after transplant versus 51st week.
The following criteria, applied by the MPSC, are based on comparison of counts of observed and expected deaths (graft failures) as presented in “Deaths during follow-up period”. To be identified for further review by the MPSC, differences between observed and expected must meet all of the following criteria:
Actionable: the magnitude of the problem, in terms of potential lives saved, should be sufficient to take action
  1. MPSC Criteria: Observed (O) – Expected (E) greater than 3, O – E > 3
  2. Interpretation: 3 excess deaths per 2-year transplant cohort
Important: a clinically significant pattern, suggesting that it may be changeable, indicated by a high fraction of excess deaths
  1. MPSC Criteria: Standardized Mortality Ratio (SMR) > 1.5; O / E > 1.5
  2. Interpretation: 50% more deaths than expected
Significant: it should be unlikely that the difference occurred by random chance alone
  1. MPSC Criteria: one-sided p-value less than .05
  2. Interpretation: there is less than a 5 percent chance that a poor outcome occurred by simple random variation

Important: More than 3 excess deaths

more than 3 excess deaths

Actionable: More than 50% excess deaths

more than s 50% excess deaths

excess deaths unlikely due to hance

MPSC Flagging Boundaries

1-s2.0-S0194599809003301-gr1 action statement may be classified as an option, recommendation, or strong recommendation

Part IV

Imaging Technologies in use for Clinical Monitoring of Patients with Heart Transplant: Donor Human Heart and Artificial Heart

By Justin D Pearlman, MD, PhD, FACC

Imaging of the heart monitors success and viability of the transplanted heart in terms of

what fraction of the contents of each ventricle moves out of the heart (ejection fraction),

  • what volumes the heart sees
  1. end-diastolic volume, or EDV, and
  2. end-diastolic diameter, or
  3. LVIDd,
  4. end systolic volume or ESV),
  5. how well the walls move (wall motion) and
  6. wall thickening analysis,
  • tissue character
  1. visual evidence for changes in the heart muscle,
  2. perfusion (delivery of nutrient blood supply to the heart muscle), and
  3. various means to detect coronary artery disease (obstructions to blood delivery to the heart muscle).

Clinical tools for imaging the heart include:

  1. The major tool – ultrasound (echocardiography),
  2. cardiac magnetic resonance (CMR),
  3. computed xray tomography (CT),
  4. catheterization with xray imaging (coronary angiography and ventriculography),
  5. metabolic marker distribution by positron emission tomography (PET), and
  6. radioactive marker distribution (nuclear imaging, SPECT).

Ultrasound applies alternating current to a piezoelectric crystal (lead zirconate) to produce compressions and expansions of material as a wave pattern that relies on tissue elastic properties to propagate into the tissue, reflecting back when the wave encounters a change of properties (acoustic impedance mismatch). Display of signal versus time on an oscilloscope (like an ECG monitor) constitutes “A-mode”(amplitude) display, whereby the distance between peaks corresponds to distances along the path that can report thickness of the left ventricle, and diameter of the left ventricular cavity. Time translates to distance because the speed of sound through tissue is fairely constant, ~1540 meters/second. Collapsing the peaks to bright dots represents the same data in “B-mode” (brightness) which reduces the data to a line of variable intensity with bright dots marking changes in tissue (e.g., muscle versus blood). Attaching a position sensor to the handle of the sound source (the transducer) enabled plotting the B-mode signal on a 2D screen to indicate the position of the sound beam. Gynecologists showed that a steady sweep of the transducer (C-mode, composite) then generated 2D images that delineated the shape of a fetal head, and as quality improved, the gender prior to birth. The invention of phased-array crystal sets (multiple sources electrically activated sequentially with specific timing) enabled generation of a composite beam that is electronically swept in an arc with no mechanically moving parts. That is now the main method of ultrasound imaging, called phased-array sector scanning. More advanced phased arrays sweep in a 2D pattern to generate 3D imaging (4D or dynamic 3D, when you include repeating over time).

The e-Reader is encourage to review Cardiovascular Imaging Chapters in each of the three volumes.

For new technological developments in achieving Optimal PCI Outcomes and for Visual Tools for Characterization of endovascular tissue affecting Coronary Circulation, review the following article:

Coronary Circulation Combined Assessment: Optical Coherence Tomography (OCT), Near-Infrared Spectroscopy (NIRS) and Intravascular Ultrasound (IVUS) – Detection of Lipid-Rich Plaque and Prevention of ACS

Part V

The Failure of a Heart Transplant – Pathology and Autopsy Findings

by Larry H Bernstein, MD, FCAP 

Section A.  SRTR Graft and Patient Survival Data

Table 1.  Transplant Survivals, 2011, and related conditions

Activities    2011 Numbers
Deceased donor transplants (n=number) 2,322
Adult graft survival (based on 4595  transplants) 89.91 (%)
Adult patient survival (based on 4449 transplants) 90.21 (%)
Pediatric graft survival (based on 886  transplants) 90.74 (%)
Pediatric patient survival (based on 829  transplants) 91.31 (%)
Primary Disease (%) of Waitlist
Cardiomyopathy 49.4
Coronary Artery Disease 34.7
Retransplant/Graft Failure   4.4
Valvular Heart Disease   1.7
Congenital Heart Disease   8.4

Table 2.  Recipient Condition at Transplant (%)

Not Hospitalized 54.0
Hospitalized 14.6
ICU 31.0
No Support Mechanism 25.2
Devices 42.4
Other Support Mechanism 32.2

Table 3.  Donor Characteristics

Cause of Death (%)
Stroke 20.9
MVA 23.4
Other 55.7
Age (years)
18-34 48.8
35-49 24.5
12-17 9.4
Cold ischemic time 1.5-4.5 h 85.3

Table 4.  Graft and Patient Survival

Survival by… time since transplant
1 mo 1 yr 3 yrs
Adult (Age 18+)
Graft survival (%)   95.7   89.9   80.9
# failures

197

 442

847
Patient survival (%)   95.9   90.2   81.8
# deaths

183

 415

783
Pediatric (Age < 18)
Graft Survival (%)   96.3   90.7   82.0
Graft Failures

  33

   80

151
Patient Survival (%)

  96.4

   91.3

 82.93
Deaths

  30

   70 134

* 07/01/2006 and 12/31/2008 for the 3 Year Model

Table 4.    Risk Model Documentation – Adult, Three−Year Graft Survival

Characteristic Level Estimate Std. Err. P−Value
Bilirubin at Transplant mg/dL 0.0364 0.008 <0.0001
Dialysis at Transplant Yes 0.8026 0.169 <0.0001
Donor Age 0−17 −0.5789 0.140 <0.0001
18−34 −0.3098 0.074 <0.0001
Ischemic Time hrs 0.1298 0.033 <0.0001
Previous Transplant Yes 0.4251 0.157 0.0069
Recipient DX Cardiomyopathy −0.1933 0.078 0.0130
Recipient Age 18-34 0.2806 0.110 0.0107
65+ 0.2694 0.101 0.0074
Recipient Race Black 0.4104 0.086 <0.0001
Recipient SCrea >1 & <=1.5 mg/dL 0.0115 0.086 0.8933
>1.5 mg/dL 0.4316 0.095 <0.0001
Recipient on VAD Yes 0.2777 0.086 0.0013
Recipient on Vent Yes 0.7014 0.169 <0.0001

* SRTR Program−Specific Report   July 12, 2012

Table 5.  Risk Model Documentation  Adult, Three−Year Patient Survival

Characteristic Level Estimate Std. Err. P−Value
Donor Age 0−17 −0.4758 0.1452 0.0010
18−34 −0.3066 0.0764 0.0001
Ischemic Time hrs 0.1400 0.0344 <0.0001
Most Recent CPRA/PRA% 0.0039 0.0019 0.0359
Recipient Age 18−34 0.3041 0.1157 0.0086
65+ 0.3089 0.1013 0.0023
Recipient DX Cardiomyopathy −0.2151 0.0809 0.0078
Congen Heart Dis 0.5504 0.2085 0.0083
Recipient Race Black 0.4942 0.0895 <0.0001
Recipient SCrea >1 and <=1.5 0.0245 0.0887 0.7827
>1.5 mg/dL 0.5053 0.0991 <0.0001
Recipient on VAD Yes 0.2559 0.0816 0.0017
Recipient on Vent Yes 0.7340 0.1852 0.0001

Note the following: 

1. The most common transplant recipients in adults are cardiomyopathy and CAD, and congenital heart disease in children.
2.  recipient on VAD or on vantilator is significant
3.  ischemic time for donor heart is usually 1.5-4.5 hours, but longer time has an effect on graft and patient survival
4. Recipient serum creatinine exceeding 1.5 mg/dl is unfavorable, but considering BMI and age related renal nephron loss, eGFR would be a better measure.5.  African-American has an effect, but it is not at all clear whether sickle cell trait or disease is a factor.
6. Half the recipients are not hospitalized, and they might coincide with no or other support.

Section B.  Special Concerns

Topic 1

Cellular repopulation of myocardial infarction in patients with sex-mismatched heart transplantation
Source: Georg-August-University G€ottingen.  c2004, Eur Soc Cardiol

Recent studies have suggested that human extracardiac progenitor cells are capable of differentiating into cardiomyocytes. In animal studies, myocardial infarction attracted bone marrow stem cells and enhanced their differentiation into cardiomyocytes.
Myocardial infarction enhances the invasion of extracardiac progenitor cells and their  regeneration of endothelial cells. However, a significant differentiation into cardiomyocytes as a physiological mechanism of postischaemic regeneration does not occur in transplanted patients.

Topic 2

Five-year follow-up of hepatitis C-naïve heart transplant recipients who received hepatitis C-positive donor hearts.
G S Gudmundsson, K Malinowska, J A Robinson, B A Pisani, J C Mendez, B K Foy, G M Mullen
Advanced Heart Failure/Heart Transplant Program, Loyola University, Maywood, Illinois, USA.
Transplantation Proceedings (impact factor: 1). 07/2003; 35(4):1536-8.
Source: PubMed

Due to the risk of transmission of hepatitis C virus, the use of hepatitis C seropositive donors in heart transplantation is controversial. The transmission rate of hepatitis C in this patient population is estimated to range from 67% to 80%. Long-term clinical outcomes of heart transplant recipients of hepatitis C-positive donor hearts are not well described. We report the 5-year long-term outcome of seven hepatitis C-naïve heart transplant recipients who received hepatitis C-positive donor hearts.

Seven hearts transplant recipients, six men and one woman were included in our study. After a mean follow-up of 63.3 +/- 20.4 months (range 28.2 to 85.9), four of seven (57.1%) patients are hepatitis C-negative, have normal liver function tests, and no clinical evidence of hepatitis. Three of seven (43%) have been diagnosed with hepatitis C by liver biopsy or the HCV-RNA reverse transcriptase polymerase chain reaction at a mean follow-up of 35.1 months (18.8 months posttransplantation). One had an accelerated course of hepatitis that was ultimately fatal, one was successfully treated with interferon, and the third died from other causes than liver injury. Overall, the 5-year survival was 71.4%.

Topic 3

Cryptococcus neoformans Infection in Organ Transplant Recipients: Variables Influencing Clinical Characteristics and Outcome
Shahid Husain, Marilyn M. Wagener, and Nina Singh
Veterans Affairs Medical Center and University of Pittsburgh
Thomas E. Starzl Transplantation Institute, Pittsburgh, Pennsylvania, USA
Emerging Infectious Diseases 376 Vol. 7, No. 3, May–June 2001

Unique clinical characteristics and other variables influencing the outcome of Cryptococcus neoformans infection in organ transplant recipients have not been well defined. From a review of published reports, we found that C. neoformans infection was documented in 2.8% of organ transplant recipients (overall death rate 42%). The type of primary immunosuppressive agent used in transplantation influenced the predominant clinical manifestation of cryptococcosis. Patients receiving tacrolimus were significantly less likely to have central nervous system involvement (78% versus 11%, p =0.001) and more likely to have skin, soft-tissue, and osteoarticular involvement (66% versus 21%, p = 0.006) than patients receiving nontacrolimus-based immunosuppression. Renal failure at admission was the only independently significant predictor of death in these patients (odds ratio 16.4, 95% CI 1.9–143, p = 0.004). Hypotheses based on these data may elucidate the pathogenesis and may ultimately guide the management of C. neoformans infection in organ transplant recipients.

Patients were 12 to 67 years of age (median 44 years); 78% were male. The mean incidence of C. neoformans infection was 2.8 per 100 transplants (0.3 to 5.3 per 100). The overall incidence was 2.4% in liver, 2.0% in lung, 3.0% in heart, and 2.8% in renal transplant recipients. Of 127 transplant recipients who could be evaluated, 100 (79%) had azathioprine as the primary immunosuppressive agent, 9 (7%) had tacrolimus, 11 (9%) had cyclosporine, and 7 (6%) had cyclosporine and azathioprine. Of these 127 patients, 78 were also receiving prednisone in various dosages. The incidence of cryptococcosis was 4.5 per 100 transplants in patients who received tacrolimus, 2.4 per 100 transplants in patients who received cyclosporine, and 3.4 per 100 transplants in patients who received azathioprine. These rates did not differ significantly. Rejection episodes preceding cryptococcal infection were documented in 17 (25%) of 67 patients; rejection had occurred a median of 7 months (from 5 days to 49 months) before onset of infection.

Cryptococcosis occurred a median of 1.6 years (from 2 days to 12 years) after transplantation. Overall, 14 (15%) of 94 cases occurred within 3 months, 10 (11%) of 94 in 3 to 6 months, 15 (16%) of 94 in 6 to 12 months, and 55 (59%) of 94 >12 months after transplantation.  The median time to onset after transplantation was 35 months for kidney, 25 months for heart, 8.8 months for liver, and 3 months for lung transplant recipients (p = 0.001). Overall, cryptococcosis developed in 100% of the lung, 75% of the liver, 33% of the heart, and 30% of the kidney transplant recipients within 12 months of transplantation (p = 0.002).

Topic 4

Diagnostic Accuracy of Mortality on a Population of Heart Transplant Patients
M AMUCHÁSTEGUI, AE CONTRERAS, O SALOMONE, A DILLER, et al.
Hospital Privado Centro Médico de Córdoba
REV ARGENT CARDIOL 2008;76:292-294.

Although morbidity and mortality rates in heart transplant have been extensively analyzed, most mortality studies and mortality registries in heart transplant patients are based on clinical data.
Between January 1990 and January 2005 all dead transplant patients were included. The final diagnosis of the cause of death was confirmed with necropsy or biopsy of a solid organ. The causes of death assessed were early graft failure, cellular rejection, graft vascular disease, neoplasms and others.
Seventy three patients underwent heart transplantation during the study period. Thirty one patients died. The cause of death was certified in 61% of cases by 12 necropsies and 7 solid organ biopsies.

  • Cellular rejection greater than grade III was the most frequent cause of death.
  • Histopathology studies differed from the clinically suspected cause of death in 12.9% of cases.

Clinical and pathological information derived from post mortem studies is an indicator of the reality of our practice and constitutes an underlying mainstay for understanding transplant patients and for their further management; in this sense, performing necropsies is of vital importance for these patients.

Topic 5

How do Heart Failure patients die?
S. Orn and K. Dickstein
Central Hospital in Rogaland, Stavanger, Norway
European Heart Journal Supplements (2002) 4 (Supplement D), D59-D65
http://eurheartjsupp.oxfordjournals.org/

Approximately 90% of heart failure patients die from cardiovascular causes. Fifty per cent die from progressive heart failure, and the remainder die suddenly from arrhythmias and ischaemic events. Autopsy reveals the presence of an acute ischaemic event inapproximately 50% of sudden deaths and in 35% of all deaths among patients with ischaemic heart failure.

An accurate description of the cause and mode of death is important if we are to elucidate the mechanisms that are operative in the heart failure population.

At present, the most accurate data on mode of death are obtained from large randomized heart failure trials. They indicate that current treatment strategies for heart failure prolong life expectancy, but have relatively little impact on the proportion of heart failure patients who die from cardiovascular causes. The ultimate goal of intervention is to shift the balance toward more deaths from non-cardiovascular causes. (Eur Heart J Supplements 2002; 4 (Suppl D): D59-D65)
The heterogeneity of the heart failure population is reflected in the different ways in which these patients die.

  • Some deteriorate progressively, whereas others
  • die after acute episodes of decompensation.
  • Others die suddenly and unexpectedly, and some (relatively few)
  • die from noncardiac causes.

Before the angiotensin-converting enzyme (ACE) inhibitor era, it was estimated that

  • 90% of the total deaths in heart failure patients were from cardiovascular causes,
  • 49% were related to worsening heart failure,
  • 22% to arrhythmias and
  • 11% to acute myocardial infarction[S].

It is conventional to categorise death according to mode and cause of death.

  • Cause of death addresses the mechanisms by which death occurs, such as arrhythmia, acute myocardial infarction or progressive heart failure (Table 1).
  • Mode of death is perhaps easier to categorise.
  • Mode and cause of death are not the same, although they are often used interchangeably.

Sudden death has various underlying causes, such as

  • arrhythmia,
  • acute myocardial infarction,
  • pulmonary embolism,
  • myocardial or aortic rupture, and
  • stroke.

Sudden cardiac death is defined as natural death due to cardiac causes, heralded by abrupt loss of consciousness within 1 h of the onset of acute symptoms[2].

In order to avoid confusion in terminology, some clinical trials subclassify death without using the term ’cause of death’ and end-point committees focus instead on mode and place of death (Table 1)[31]. However, although it is more difficult to classify cause of death than mode of death, it is nevertheless productive to examine the causes of death among heart failure patients. The cause of death reflects the underlying pathophysiology of the disease, and helps us to understand the mechanisms responsible for its progression. Unravelling the mechanisms that lead to death is clinically relevant and may reveal potential new treatment targets. Effective treatment may alter the cause of death, and should ideally shift the operative mechanism from cardiovascular to noncardiovascular. Most of our knowledge of the cause and mode of death in heart failure comes from the

  • large randomized mortality trials and from
  • official death registries.

However, both of these sources of information have their problems.

A simplified classification of heart failure deaths

  • Cardiovascular
  • Non-cardiovascular
  • Cardiac
  • Myocardial infarction
  • Progressive heart failure
  • Other cardiac
  • Sudden death
  • Non-cardiac
  • Stroke
  • Other
  • Procedure-related

Conclusions

by Larry H Bernstein, MD, FCAP 

Part I

Leading Causes of Death

Number of Deaths – Leading Causes
Heart disease

597,689
Cancer

574,743
Chronic Lung Disease

138,080
Stroke

129,476
Accidents

120,859
Alzheimer’s

83,494
Diabetes

69,071
Kidney disease

50,476
Influenza and Pneumonia

50,097
Suicide

38,364
*National Vital Statistics Report (NVSR) “Deaths: Final Data for 2010.”   MortalityData@cdc.gov.

WHO Leading Causes of Death
Low income countries

Deaths (mil)

% of deaths
Lower respiratory infections

1.05

11.3
Diarrheal diseases

0.76

8.2
HIV/AIDS

0.72

7.8
Ischemic heart disease

0.57

6.1
Malaria

0.48

5.2
High-income countries

Deaths (mil)

% of deaths
Ischemic heart disease

1.42

15.6
Cerebrovascular disease

0.79

8.7
Bronchioepithelial cancers

0.54

5.9
Alzheimer and dementias

0.37

4.1
Pneumonias

0.35

3.8
High-income countries

Deaths (mil)

% of deaths
Ischemic heart disease

5.27

13.7
Stroke

4.91

12.8
COPD

2.79

7.2
Lower respiratory infections

2.07

5.4
Diarrheal diseases

1.68

4.4
World

Deaths (mil)

% of deaths
Ischaemic heart disease

7.25

12.8
Stroke

6.15

10.8
Pneumonias

3.46

6.1
COPD

3.28

5.8
Diarrheal diseases

2.46

4.3
HIV/AIDS

1.78

3.1

Q: What is the number one cause of death throughout the world?
Cardiovascular diseases kill more people each year than any others. In 2008, 7.3 million people died of ischaemic heart disease, 6.2 million from stroke or another form of cerebrovascular disease.

Q: Isn’t smoking a top cause of death?
Tobacco use is a major cause of many of the world’s top killer diseases – including cardiovascular disease, chronic obstructive lung disease and lung cancer.

Deaths across the globe: an overview

Imagine a diverse international group of 1000 individuals representative of the women, men and children from all over the globe who died in 2008. Of those 1000 people,

  • 159 would have come from high-income countries,
  • 677 from middle-income countries and
  • 163 from low-income countries.

What would be the top 10 causes of their deaths?
Low income countries
http://who.int/entity/mediacentre/factsheets/fs310_graph3.gif
Middle income countries
http://who.int/entity/mediacentre/factsheets/fs310_graph3.gif
High income countries
http://who.int/entity/mediacentre/factsheets/fs310_graph3.gif

Note: In this fact sheet, we use low-, middle- and high-income categories as defined by the World Bank. Countries are grouped based on their 2009 gross national income. See World health statistics 2011 for more information.

SOURCE

World health statistics 2011

Part II

Advances in Imaging Technology

This document discusses the advances in cardiac surgery assisted by rapid advances in cardiac imaging technology over the last 15 years.  This portion concentrates on the treatments for advanced and disabling congestive heart failure as the age expectancy has increased to a range of early 8th and mid-9th decade, depending on patient related comorbidities, nutrition and activity status.  Many of the patients who require a heart transplant have coincident metabolic syndrome, advanced coronary artery circulation compromise, and/or atherosclerotic disease at the aortic arch.  The advances in cardiothoracic technique has enabled a parallel advance in ventricular assist devices and a total artificial heart, which has allowed the maintenance of patients on waitlists until a suitable donor can be found, which is usually under a 5 year period.  The ventricular assist device is selected for those patients who have sufficient reserve of left ventricular function. The cardiac and cardiosurgical advances have been advanced by the development of vastly improved imaging for both diagnosis and for enabling safety of procedures.

Cardiac magnetic resonance imaging is a noninvasive technique for assessing heart structure and function without the need for ionizing radiation. Its ability to precisely outline regions of myocardial ischemia and infarction gives it an important role in guiding interventional cardiologists in revascularization. Its ability to characterize and precisely quantify abnormal regurgitant flow volumes or abnormal shunts also makes it a valuable tool for many noncoronary interventions. The evidence is sufficient to show that cardiac magnetic resonance in guiding complex therapies in the catheter laboratory, as well as practical issues that need to be addressed to allow the application of this powerful tool to an increasing number of patients.  But this advantage extends as well to the transplantation arena.1 (Cardiac magnetic resonance imaging for the interventional cardiologist. GA Figtree, JLønborg, SM Grieve, MR Ward, RBhindi. University of Sydney, Sydney, Australia.  PubMed 02/2011; 4(2):137-48.  http://dx.doi.org/10.1016/j.jcin.2010.09.026.)

Further, A novel approach to three-dimensional (3D) visualization of high quality, respiratory compensated cardiac magnetic resonance (MR) data is presented with the purpose of assisting the cardiovascular surgeon and the invasive cardiologist in the pre-operative planning2. Developments included:

(1) optimization of 3D, MR scan protocols;
(2) dedicated segmentation software;
(3) optimization of model generation algorithms;
(4) interactive, virtual reality visualization.

The approach is based on a tool for interactive, real-time visualization of 3D cardiac MR datasets in the form of 3D heart models displayed on virtual reality equipment. This allows the cardiac surgeon and the cardiologist to examine the model as if they were actually holding it in their hands. To secure relevant examination of all details related to cardiac morphology, the model can be re-scaled and the viewpoint can be set to any point inside the heart. Finally, the original, raw MR images can be examined on line as textures in cut-planes through the heart models3. (A new virtual reality approach for planning of cardiac interventions. T S Sørensen, SV Therkildsen, P Makowski, JL Knudsen, EM Pedersen. University of Aarhus Abogade 34, 8200 N, Arhus, Denmark. PubMed 07/2001; 22(3):193-214.

In addition, TeraRecon, (www.terarecon.com), the largest dedicated provider of advanced visualization and decision support solutions for medical imaging, showcased iNtuitionREVIEW™, a powerful new multi-modality, multi-monitor review and collaboration tool at the 24th European Congress Of Radiology4, held at the Austria Center, Vienna, Austria, March 8th-11th 2013. iNtuitionREVIEW is part of the iNtuition™ solution suite for advanced image management and quantitative decision support.

iNtuition has always complemented PACS with advanced functionality to resolve specialized use cases and workflow challenges not adequately addressed by existing PACS solutions.  Features relevant to this discussion are:

  • Time-Volume Analysis – Enhanced support for Cardiac MRI image acquisitions
  • 3D/4D Visualization – Enhanced TAVI (transcatheter valve implantation) analysis
  • Lesion-Specific Analysis – Support for research into downstream impact of stenosis

Editorial5: Seeing the heart; the success story of cardiac imaging
European Heart Journal 2000; 21(16): 1281–1288
http://dx.doi.org/10.1053/euhj.2000.2299

In 1896 a large audience at the Wurzburg Physical Medical Society attended a lecture and a demonstration, published a paper in 1895 ‘Eine Neue Art von Strahlen’ in the Annals of the Society. He showed an image of the hand of the famous anatomist F. Von Kolliker (1817– 1905). He was awarded the first Nobel prize laureate in Physics in 1901.  FH Williams (1852–1936) began lecturing on the use of X-rays in visualization of the heart. In his paper ‘A method for more fully determining the outline of the heart by means of a fluoroscope together with otheruses of this instrument in medicine, he laid the basis for quantitative cardiac measurements from the chest X-ray.

To make angiocardiography of the heart possible, the feasibility of human cardiac catheterization had to be demonstrated. In 1929 W. Forssman (1904–1979) introduced ‘. . . a well oiled 65 cm long ureteral catheter’ into his antecubital vein to reach the right atrium. Soon thereafter he performed the first cardiac angiocardiogram on himself using 20 cc of 25% sodium iodide. Forssman shared the Nobel Prize for Medicine with A. Cournard and D. Richards in 1956.

The modern era of cardiac X-ray imaging began after the Second World War. G. Hounsfield of EMI Ltd tested their mathematical solutions and constructed the first clinical CT, which was installed in the Atkinson Morle Hospital in London in 1971 for brain scanning. This instrument revolutionized radiological imaging. Electronic and computer developments resulted in the image intensifier in 1952, which was a critical tool for analysing internal cardiac anatomy and the performing of selective coronary arteriography. Cormack and Hounsfield received the Nobel Prize for Physiology in 1979.  Subsequent major advances have been the dramatic increase in the speed of scanning and image reconstruction and improved image quality as a result of faster and more sophisticated computers. At the Mayo Clinic, dynamic volume scanning was achieved in 1975 with the dynamic spatial reconstructor which is based on multiple X-ray sources  and multiplex detectors for scanning the heart using the mathematical principles of CT.  Fast computed tomography, or electron beam tomography of the heart, was introduced by D. Boyd and co-workers in 1979 at Imatron. Contrary to the conventional CT scanner, this instrument has no moving parts and can acquire an image in as little as 50 ms, obviating the need for ECG-gating. By successively steering a small focal spot size electron beam at four tungsten target rings, producing a moving beam 180o about the patient, with a 180o ring of detectors, the heart is imaged virtually free of motion artifacts.

The existence of ultrasound was recognized by L. Spallanzani (1729–1799). He demonstrated that bats who are blind navigate by means of echo reflection using inaudible sound. In 1880, Jacques and Pierre Curie discovered the piezo-electric effect, a peculiar phenomenon observed in certain quartz crystals, which were the basis of early ultrasound systems and were later replaced by ferroelectric materials. The first suggestion that submerged objects could be located by echo-reflection probably came after theTitanic disaster in 1912. During World War I, P.Langevin (1872–1946) conceived the idea in 1917 of using a piezo-electric quartz crystal as both transmitter and receiver, and this ultimately led to the development of sonar which was completed with the invention of the cathode ray tube, extensively used in World War II for ship navigation and remote submarine detection.  In 1950, the German W. D. Keidel, also using an echo-transmission technique, performed the first cardiac examinations in an attempt to measure cardiac output.

In the late 1960s, the fibreoptic recorder, a spin-off from space technology, was introduced allowing the M-mode recording of all structures along the ultrasound beam: this constituted the definitive breakthrough in echocardiography. Today, M-mode echocardiography remains an important part of a complete cardiac ultrasound examination because of its high temporal resolution.  J Griffith and W Henry introduced the mechanical sector-scanner in 1974, in the same year that FL Thurstone and OT.von Ramm constructed their electronic phased-array scanner. Today, phased-array scanners are the most widely available tomographic imaging instruments with a tremendous impact on cardiac diagnosis. Recently, new computer technologies have enabled the development of volume-rendered data which display tissue information possible even in real-time.   The mono- and biplane electronic phased-array probes developed by J. Souquet in 1982 and his multiplane probe in 1985 represented the definitive clinical breakthrough of transoesophageal echocardiography.

The pulsed-wave Doppler technique allowed depth selection for blood flow velocity interrogation, but the major step forward for its clinical acceptance was its combination with imaging: the duplex scanner, reported by F. E. Barber et al. in 1974[35]. This development ultimately led to the integration of pulsed-wave Doppler with two-dimensional phased-array systems and allowed blood flow to be studied at selected regions within the image plane. The Bernouilli equation is now the cornerstone for Doppler assessment of cardiac haemodynamics and was published by the Dutch born D. Bernouilli (1700–1782) in his treatise ‘Hydrodynamica’ in 1738.  The rapid progress in interventional cardiology renewed the interest in imaging devices, allowing circumferential imaging of the arterial wall under the endothelial surface. Both mechanical single-element and multi-element electronic systems are now increasingly used.

De Hevesy introduced the red cell blood volume measurement and the1284 anniversary ‘dilution principle’ in humans using the first man-made radioisotope 32P produced by the cyclotron in Berkeley, a milestone invention by EO Lawrence in 1931 for which he received the Nobel Prize in 1939. With the cyclotron it was now possible to artificially produce radiopharmaceuticals and radionuclides, which became increasingly available for clinical research. Diagnostic nuclear imaging techniques can be divided into four general groups, depending on localization, dilution, flow or diffusion and biochemical and metabolic properties. Most of these basic principles were first demonstrated by de Hevesy using cyclotron-produced radioisotopes and techniques that he had described many years before—he should therefore be considered the ‘father of nuclear medicine’. It was the introduction of technetium-99m which spurred on the growth of nuclear medicine because of its ideal properties for gamma camera imaging, its short half life and the possibility of producing it in a hospital radiopharmacy. There are now radiopharmaceuticals labelled with 99mTc for almost every application in nuclear medicine. However, the clinical application of nuclear imaging required both counting and detection of radioisotope emissions. Modern counting equipment dates back to 1908 when H Geiger made his first electron counting tube, the precursor of the 1928 Geiger counter. The major breakthrough in radioisotope emission detection was the development of the scintillation scanner by B. Cassen in Los Angeles in 1949, an instrument rapidly followed by refinements. The scintillation camera was designed by Anger based on a concept proposed by DE Copeland and EW Benjamin and was followed by the electronic gamma camera in 1952, which is still the basis of the scintillation camera used today.

Single photon emission tomography (SPET) is based on the pioneering work of Kuhl and Edwards and the first clinical system became available in 1953. However, digital computer technology was necessary for emission tomography as we use it today and put the ‘C’ in SPECT. Tomographic capabilities have proved invaluable in the clinical use of nuclear imaging of the heart. Clinical application rapidly followed technical advances. Although Wren et al. laid the foundation of PET in 1951 it was Sweet and Brownell of Massachusetts General Hospital who conceived the idea of positron imaging which relies on the annihilation radiation emitted at 180o when positrons and electrons meet. PET has a clinical role in defining myocardial viability in patients with ischemic left  ventricular dysfunction who may benefit from revascularization rather than transplantation. It allows the sympathetic nervous system to be studied as regards the development of a number of cardiac disorders by receptor imaging. Although PET was developed before SPECT, it is less accessible because it requires direct access to a cyclotron to produce the short-lived positron emitting tracers and a radiopharmaceutical laboratory, which is not required for SPECT.

F Bloch et al. at Stanford and E Purcell et al. at Harvard in 1946 published a paper on the nuclear magnetic resonance (NMR) phenomenon in bulk matter for which they received the Nobel Prize in Physics in 1952. Initially, the major limitation to NMR spectroscopy in intact living systems was the small bore of the superconducting magnets. In the early 1980s, the Oxford Instrument Company started to produce superconducting magnets with increasing bores and extremely uniform and intense magnetic fields allowing the whole human body to be studied.  The major advantages of MRI are that contrary to ultrasound, the images are not degraded by overlying bony structures, that there is a high natural contrast between flowing blood and soft tissue, the wide field of view, and that cross-sections of the heart can be obtained in any arbitrary orientation. The ideal cardiovascular imaging technique would provide the cardiologist with integrated information on structure function, myocardial characteristics, perfusion and metabolism. Potentially, magnetic resonance imaging offers all this and will probably become the one-stop non-invasive diagnostic test of cardiology.

Real-time dynamic display of registered 4D cardiac MR and ultrasound images using a GQ Zhanga,

X Huanga, R Eagleson,G. Guiraudona, and TM Peters

University of Western Ontario, London, ON, Canada

In minimally invasive image-guided surgical interventions, different imaging modalities, such as magnetic resonance imaging (MRI) or computed tomography (CT), and real-time three-dimensional (3D) ultrasound (US), can provide complementary, multi-spectral image information. Multimodality dynamic image registration is a well-established approach that permits real-time diagnostic information to be enhanced by placing lower-quality real-time images within a high quality anatomical context. For the guidance of cardiac procedures, it would be valuable to register dynamic MRI or CT with intraoperative US. However, in practice, either the high computational cost prohibits such real-time visualization of volumetric multimodal images in a real-world medical environment, or else the resulting image quality is not satisfactory for accurate guidance during the intervention. Modern graphics processing units (GPUs) provide the programmability, parallelism and increased computational precision to begin to address this problem.

The Use of Rapid Prototyping in Clinical Applications

G Biglino, S Schievano and AM Taylor
UCL Institute of Cardiovascular Sciences, London
http://www.intechopen.com

Rapid prototyping broadly indicates the fabrication of a three-dimensional (3D) model from a computer-aided design (CAD), traditionally built layer by layer according to the 3D input (Laoui & Shaik, 2003). Rapid prototyping has also been indicated as solid free-form, computer-automated or layer manufacturing (Rengier et al., 2008). The development of this technique in the clinical world has been rendered possible by the concomitant advances in all its three fundamental steps:

1. Medical imaging (data acquisition),
2. Image processing (image segmentation and reconstruction by means of appropriate software) and
3. Rapid prototyping itself (3D printing).

Particular advantages in this discussion are:

1. Customised implants: Instead of using a standard implant and adapting it to the implantation site during the surgical procedure, rapid prototyping enables the fabrication of patient-specific implants, ensuring better fitting and reduced operation time.

2.  Microelectromechanical systems (MEMS): These are micro-sized objects that are fabricated by the same technique as integrated circuits. MEMS can have different. applications, including diagnostics (used in catheters, ultrasound intravascular diagnostics, angioplasty, ECG), pumping systems, drug delivery systems, monitoring, artificial organs, minimally invasive surgery.

Example: Stages of rapid prototyping in a clinical setting. From left to right: data acquisition (in this case with magnetic resonance (MR) imaging), image processing, 3D volume reconstruction with appropriate software (in this case, Mimics®, Materialise, Leuven, Belgium) and final 3D model printed in a transparent resin.

Despite its clinical use to the present day is still somewhat limited, considering the potential and flexibility of this technique, it is likely that applications of rapid prototyping such as individual patient care and academic research will be increasingly utilised (Rengier et al., 2010).

Nuclear Cardiology — In the Era of the Interventional Cardiology

B Baskot, I Ivanov, D Kovacevic, S Obradovic, N Ratkovic and M Zivkovic
Chap 10, InTech.  http://dx.doi.org/10.5772/55484

The strength and breadth of nuclear cardiology lie in its great potential for future creative growth. This growth involves the development of new biologically derived radiopharmaceuticals, advanced imaging techologies, and a broad/based set of research and clinical applications involving diagnosis, functional categorization, prognosis, evaluation of therapeutic interventions, and the ability to deal with many of the major investigative issues in contemporary cardiology such as myocardial hibernation, stunning, and viability. The past decade has been characterized by major advances in nuclear cardiology that have greatly enhanced the clinical utility of the various radionuclide techniques used for the assessment of regional myocardial perfusion and regional and global left ventricular function under resting and stress conditions. Despite the emergence of alternative noninvasive techniques for the diagnosis of coronary aretry disease (CAD) and the assessment of prognosis of viability, such as ergo- stress tests, stress echocardiography, the use and application of nuclear cardiology techniques have continued to increase.

For many years, planar imaging and SPECT with 201Tl (201 Thalium) constituted the only scintigraphic techniques available for detecting CAD and assessing prognosis in patients undergoing stress perfusion imaging. The major limitation of 201Tl scintigraphy is the high false/positive rate observed in many laboratories, which is attributed predominantly to image attenuation artefact and variants of normal that are interpreted as defects consequent to a significant coronary artery stenoses.

In recent years, new 99mTc (technetium) labeled perfusion agents have been introduced into clinical practice to enhance the specificity of Single Photon Emission Cumputed Tomography (SPECT) and to provide additional information regarding and global left ventricular systolic function via ECG gating of images [3, 4, 8]. It was immediately apparent that the quality of images obtained with these 99mTc-labeled radionuclides was superior to that images obtained with 201Tl because of the more favorable psysical characteristic of 99mTc imaging with gamma camera. Perhaps most importantly, 99mTc imaging allows easy gated acquisition, permitting simultaneous evaluation of regional systolic thickening, global left ventricular function (LVEF), and myocardial perfusion. One the most significant avdances in myocardial perfusion imaging in the past decade is the development of quantitative SPECT perfusion imaging.

Indications for nuclear cardiology procedures

CAD is still the single greatest cause of death of men and women in the world, despite a declining total death rate. The reduction of the morbidity and mortality due to CAD is thus primary importance. The first step in evaluating patients for CAD involves the assessment of the presence of traditional risk factors. Symptoms suggestive of CAD, in addition to other risk factors, drive decisions for further testing.
In patients able to exercise, the diagnostic accuracy of stress myocardial perfusion imaging (MPI) is significantly higher than the ETT alone and provides greater risk stratification for predicting the future cardiac events.

Nuclear cardiology –practical applications

  • ETT exercise treadmill test
  • DIP-ECHO dipyridamole echocardiography
  • DOB-ECHO dobutamine echocardiography
  • DIP- MIBI dipyridamole myocardial perfusion imaging with Tc-99m MIBI
  • DOB-MIBI dobutamine myocardial perfusion imaging with Tc-99m MIBI

Evaluating and determination CULPRIT lesion, an indication for interventional cardiology


One of the most powerfull uses of MPI is the evaluation of the risk for future events in patients with suspected or known CAD. Over the years, MPI has evolved as an essential tool in the evaluation and assessment of patient prior to coronary revascularization. It has a dual role. Prior to coronary angiography, MPI is extremely useful in documenting ischemia and determining the functional impact of single or multiple lesions subsequently identified. Despite some limitations in the setting of multivessel disease, MPI remains the test of choice for identifying the lesion responsible for the ischemic symptoms.  The primary objective of those study is to determine and localize the culprit lesion. The authors introduce parameters SRS (summary reversible score) and ISRS (index of summary reversible score), under the angiographically detected coronary narrowing ≥75% for the least one coronary artery. Coronary angiography, considered the “gold standard” for the diagnosis of CAD, often does not provide information about the physiologic significance of atherosclerotic lesions, especially in borderline lesions. More importantly, it does not provide a clear marker of risk of adverse events, especially in patients with moderate disease severity.  The presence of normal scintigraphic MPI study at a high level of stress ( ≥ 85 % of maximum predicted heart rate) or proper pharmacologic stress carries a very benign prognosis, with mortality rate less than 0.5% per year. This finding has been reproduced in many studies. Iskander and Iskandiran, pooling the results of SPECT imaging from more than 12000 patients in 14 studies, demonstrated that the events rate (death/MI) for patients with normal MPI finding is 0.6%, whereas abnormal study carries 7.4% per year event rate, a 12-fold increase.

The size and severity of the perfusion abnormality provide powerful prognostic information and has been shown to directly relate to outcome. MPI perfusion imaging and determination of culprit lesion is more predicitble of cardiac events than coronary angiography. As MPI imaging may identify those patients at high risk for subsequent cardiac events, perfusion imaging may be used to help guide further testing and revascularization procedures. Myocardial perfusion imaging provides information on the extent and location  of myocardial ischemia. The assessment of jeopardized myocardium may be performed and provides a measure of the relative value of PTCA in terms of the amount of jeopardized myocardium. The location of the stenosis may dictate the area at risk: extent and severity of perfusion defects were significantly smaller in patients with proximal compared with distal coronary artery occlusions.

The aim of the study Baskot at al.(*)  was to determine and localize culprit lesion by MPI in cases of angiographically detected coronary narrowing ≥ 75% of at least one coronary artery. In the study four hundred and thirty-seven [437] patients were studied. Angiographically detected significant coronary narrowing (≥ 75% luminal stenosis) was found in all before PCI. All the patients were submitted to MPI 99mTc-MIBI, with pharmacologic dipyridamole stress protocol with concomitant low level bicycle exercise 50 W (DipyEX). We measured relative uptake 99mTc-MIBI for each myocardial segment using short-axis tomogram study. A 5-point scoring system was used to assess the difference between uptake degree in stress and rest studies for the same segment, and we created two indices: Sum reversible score (SRS), Index of sum reversibility score (ISRS). In the results a total 1311 vascular territories (7429 segments) were analyzed before elective percutaneous coronary intervention (ePCI). Overall sensitivity, specificity and accuracy using SRS were 89.7%, 86, 7%, and 88, 2%, with a positive predictive value of 92, 7%. Overall sensitivity, specificity and accuracy using ISRS were 92.8%, 89.1%, and 92.3%, and the positive predictive value was 93.7%.

Pathophysiology and investigation of coronary artery disease

Ever D Grech
University of Manitoba, Winnipeg
BMJ 2003;326:1027–30

In affluent societies, coronary artery disease causes severe disability and more death than any other disease, including cancer. It manifests as angina, silent ischemia, unstable angina, myocardial infarction, arrhythmias, heart failure, and sudden death.  Coronary artery disease is almost always due to atheromatous narrowing and subsequent occlusion of the vessel. A mature plaque is composed of two constituents, each associated with a particular cell population. The lipid core is mainly released from necrotic “foam cells”—monocyte derived macrophages, which migrate into the intima and ingest lipids. The connective tissue matrix is derived from smooth muscle cells, which migrate from the media into the intima, where they proliferate and change their phenotype to form a fibrous capsule around the lipid core.

Stress echocardiography

Stress induced impairment of myocardial contraction is a sensitive marker of ischemia and precedes electrocardiographic changes and angina. Cross sectional echocardiography can be used to evaluate regional and global left ventricular impairment during ischaemia, which can be induced by exercise or an intravenous infusion of drugs that increase myocardial contraction and heart rate (such as dobutamine) or dilate coronary arterioles (such as dipyridamole or adenosine).

Radionuclide myocardial perfusion imaging

Thallium-201 or technetium-99m (99mTc-sestamibi, 99mTc-tetrofosmin) is injected intravenously at peak stress, and its myocardial distribution relates to coronary flow. Images are acquired with a gamma camera. This test can distinguish between reversible and irreversible ischemia (the latter signifying infarcted tissue). Although it is expensive and requires specialised equipment, it is useful in patients whose exercise test is non-diagnostic or whose exercise ability is limited.

A multigated acquisition (MUGA) scan assesses left ventricular function and can reveal salvageable myocardium in patients with chronic coronary artery disease. It can be performed with either thallium scintigraphy at rest or metabolic imaging with fluorodeoxyglucose by means of either positron emission tomography (PET) or single photon emission computed tomography (SPECT).

Intravascular ultrasound (IVUS)

In contrast to angiography, which gives a two dimensional luminal silhouette with little information about the vessel wall, intravascular ultrasound provides a cross sectional, three dimensional image of the full circumference of the artery. It allows precise measurement of plaque length and thickness and minimum lumen diameter, and it may also characterise the plaque’s composition. It is often used to clarify ambiguous angiographic findings and to identify wall dissections or thrombus. It is most useful during percutaneous coronary intervention, when target lesions can be assessed before, during, and after the procedure and at follow up. The procedure can also show that stents which seem to be well deployed on angiography are, in fact, suboptimally expanded.

Interventional Cardiology for Structural Heart Disease

Georgios Parcharidis
Hellenic J Cardiol 2012; 53: 403-404

Many questions arise from this “explosion” of new technologies. Is all this enthusiasm justified and supported by robust scientific evidence? Which is the best way to implement these new treatment options? What is the role of “traditional” surgical treatment? How can we decide which patient should be treated percutaneously and which surgically? What level of training and experience should an interventional cardiologist (or a centre) have in order to perform structural and/or congenital heart disease interventions?

With regard to the scientific evidence, it should be noted that, currently, the number of randomized clinical trials and the duration of follow up is quite limited. Thus, great caution should be exercised in patient selection and planning for these complex procedures. In addition, careful data collection and, ideally, inclusion in a patient registry would increase surveillance and, therefore, patient safety.

Notably, for the majority of structural and congenital heart diseases, surgery is still considered the “gold standard”. It is now globally accepted that decision making for patients with cardiovascular disease should be done in the context of a “Heart Team”, with close collaboration between cardiologists, cardiothoracic surgeons, anesthesiologists, imaging specialists and, occasionally, other specialists. Some patients will benefit more from transcatheter interventions whereas others will do better with surgery. Based on specific criteria, the role of the Heart Team is to identify (and treat) those patients.

PET vs. SPECT: Will PET Dominate Over the Next Decade?

DAIC  July/August 2013  pp28-31.  www. DIcardiology.com

The future success of PET may be grounded in its inherently better image resolution. In cardiac scanning, it has generally been reported that PET offers a resolution of 5 to 7 mm, compared with a cardiac SPECT resolution of 12 to 15 mm. Better performance has allowed data to emerge suggesting that as many as one in 10 scans interpreted as normal on SPECT would have been abnormal if done on PET due to the presence of unseen microvascular, triple-vessel disease. PET’s superior diagnostic capability is achieved partly through advances in hardware, particularly quantification, which leverages numerical precision to identify global perfusion defects in the heart that otherwise might be hidden from qualitative SPECT scans.

A big difference between the two technologies is the half-life of the isotope that each radiopharmaceutical tracer uses. SPECT tracers have a relatively long half-life (technetium-99m has a half-life of six hours), whereas rubidium-82 is only 75 seconds. This short half-life is a limitation of the current front-line cardiac PET radiotracer, which does not leave much room for error when imaging and presents the inability to do exercise stress testing. New iterative reconstruction (IR) software such as UltaSPECT is improving SPECT image quality by boosting the signal-to-noise ratio. Just as in CT scans, IR can also help reduce dose by enhancing lower-quality scans.

Part III

Heart Failure Patients

Heart Failure Complicating Non–ST-Segment Elevation Acute Coronary Syndrome -Timing, Predictors, and Clinical Outcomes

MC Bahit, RD Lopes, RM Clare, LK Newby,KS Pieper, et al.
J Am Coll Cardiol HF 2013;1(3): 223–9This study sought to describe the occurrence and timing of heart failure (HF), associated clinical factors, and 30-day outcomes in patients with non–ST-segment elevation acute coronary syndromes (NSTE-ACS). Using pooled patient-level data from 7 clinical trials from 1994 to 2008, we describe the occurrence and timing of HF,associated clinical factors, and 30-day outcomes in NSTE-ACS patients. HF at presentation was defined as Killip classes II to III; patients with Killip class IV or cardiogenic shock were excluded. New in-hospital cases of HF included new pulmonary edema. After adjusting for baseline variables, we created logistic regression models to identify clinical factors associated with HF at presentation and to determine the association between HF and 30-day mortality.Of 46,519 NSTE-ACS patients, 4,910 (10.6%) had HF at presentation. Of the 41,609 with no HF at presentation, 1,194 (2.9%) developed HF during hospitalization. A total of 40,415 (86.9%) had no HF at any time. Patients presenting with or developing HF during hospitalization were older, more often female, and had a higher risk of death at 30 days than patients without HF (adjusted odds ratio [OR]: 1.74; 95% confidence interval: 1.35 to 2.26). Older age, higher presenting heart rate, diabetes, prior myocardial infarction (MI), and enrolling MI were significantly associated with HF during hospitalization. In this large cohort of NSTE-ACS patients, presenting with or developing HF during hospitalization was associated with an increased risk of 30-day mortality.

Outcomes Following Heart Transplantation among Those Bridged with VAD

Jeffrey Shuhaiber MD
University of Cincinnati and Cincinnati Children’s Hospital
www.intechopen.com

Clinical assessment of outcome for post heart transplant recipients who were bridged with ventricular assist device is essential for service evaluation, device evaluation and audit. We will review the clinical outcomes measured so far in the field of heart transplant recipients who were bridged with VAD. In this chapter we will review the ongoing methods of assessment of outcomes for transplant recipients bridged by VAD and discuss the potential challenges facing the clinicians. We will finalize with brief conclusions and future directions.

Survival following heart transplantation: Does VAD Type matter?

There have been many clinical studies comparing outcomes following heart transplantation. Only one has been done in a multicenter fashion with clinically relevant as well as a robust risk-adjustment. In 2006 we asked the question- does survival differ between those who did and did not receive the left ventricular assist device (LVAD) following heart transplantation? And in summary we found that survival following heart transplantation for patients who received an LVAD prior to transplantation was comparable to those who did not receive an LVAD. The results of this study were published as lead research article in the British Medical Journal earlier this year (Shuhaiber).

We reviewed all patients above 18 years of age who received heart transplants registered in the United Network for Organ Sharing (UNOS) Registry from 1996 to 2004. The study included 2786 status 1/1A/1B heart transplant patients. We used the entry data for all patients who received LVAD pulsatile device. Our study design included a prospective cohort study in which post-transplant survival between patients who received an LVAD and those who did not receive an LVAD was compared.

1:1 propensity score matching analysis was also performed. Comparisons of survival distributions were made using the Kaplan-Meier method and the risk ratios were estimated using Cox proportional model. Our primary outcomes as well as risks and exposures included survival following heart transplantation in heart transplant recipients who did or did not receive ventricular assist device. The strength of the study was in adopting a robust statistical methodology that can adequately control for confounding variables. A stratified  propensity score analysis of data revealed that the risk of death following heart transplantation in an LVAD patient was not significantly different from those who did not have an LVAD within each stratum (see table for estimated hazard ratios and their 95% confidence intervals). A 1:1 propensity score matching analysis also revealed no significant difference in post heart transplant survival between the two groups (hazard ratio = 1.18, 95% CIs=0.75 to1.86). The propensity score matching was performed in order to control potential selection biases that can lead to a false association (or false lack of association) between LVAD and survival.

Part IV

Mechanical Heart Devices

The treatment of heart failure at end stage myocardial function has depended on having patients on waiting lists until the time that a donor heart becomes available.  Waiting times are within 1.5 to 4.5 years.  This required the development for mechanical support until a suitable donor is found.  The expectation for future devices will be that suitable mechanical heart assist devices for selected patients will possibly alleviate the need for a donor heart.

There are two main types of mechanical assist devices.  One type ios actually a total artificial heart, and the other is an assist that in complementary to the still functioning weak left ventricle.  The VAD was just discussed in the preceding discussion.  It has a pump that is attached to the atria and the pump controls the flow of blood through the pulmonary circulation.  This device is extremely important for patients who have sufficient LV function to not require a TAH.

The total artificial heart  (TAH) has been dominated by use of either of two models – the Syncardia temporary artificial heart, and the AbiCor.  The difference between them is that one has an externalization outside the thorax to an electrical source.  The Syncardia model is a modern day improvement of Jarvik-7.
The controlled flow is a miniature motor that has a rotor that moves the blood forward.  Of course, it presents a problem with respect to blood cell damage and anemia.  One of the innovations to the blood flow control has been that it flows without a heart beat.  The most significant innovation is the entry into the market of a new model, the Carmat, from France.  The Carmat would reduce the hemolysis that is associated with the flow of RBCs along a synthetic lining.  How?  It has the blood in contact with a cow skin lining.

Part V

Heart Transplant


The heart transplant is a technique that has been mastered at a number of excellent cardiothoracic surgical sites, and the facilities are being replaced by Hybrid Units that accommodate cardiology and surgical interventions. This brings to fruition the concept of a “Heart Team”.  The procedure has risks of complication, either in the patient condition, or in environmental, or other factors the surgeon has no control over.

These factors include, associated comorbidities, such as

  • diabetes mellitus
  • Late NYHF Stage 4
  • Late stage renal disease
  • mismatch of Graft vs Host
  • infection

Other related articles published on this Open Access Online Scientific Journal, include the following: 

Pearlman, JD and A. Lev-Ari, Cardiovascular Complications: Death from Reoperative Sternotomy after prior CABG, MVR, AVR, or Radiation; Complications of PCI; Sepsis from Cardiovascular Interventions

http://pharmaceuticalintelligence.com/2013/07/23/cardiovascular-complications-of-multiple-etiologies-repeat-sternotomy-post-cabg-or-avr-post-pci-pad-endoscopy-andor-resultant-of-systemic-sepsis/

Larry H Bernstein, Advanced Topics in Sepsis and the Cardiovascular System at its End Stage

http://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-sepsis-and-the-cardiovascular-system-at-its-end-stage/

Pearlman, JD and A. Lev-Ari  Cardiac Resynchronization Therapy (CRT) to Arrhythmias: Pacemaker/Implantable Cardioverter Defibrillator (ICD) Insertion

http://pharmaceuticalintelligence.com/2013/07/22/cardiac-resynchronization-therapy-crt-to-arrhythmias-pacemakerimplantable-cardioverter-defibrillator-icd-insertion/

Lev-Ari, A.  3D Cardiovascular Theater – Hybrid Cath Lab/OR Suite, Hybrid Surgery, Complications Post PCI and Repeat Sternotomy

http://pharmaceuticalintelligence.com/2013/07/19/3d-cardiovascular-theater-hybrid-cath-labor-suite-hybrid-surgery-complications-post-pci-and-repeat-sternotomy/

Read Full Post »

Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Posted in Bio Instrumentation in Experimental Life Sciences Research, Biological Networks, Gene Regulation and Evolution, Biomarkers & Medical Diagnostics, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, Cell Biology, Signaling & Cell Circuits, Chemical Biology and its relations to Metabolic Disease, Chemical Genetics, Drug Delivery Platform Technology, FDA Regulatory Affairs, Frontiers in Cardiology and Cardiovascular Disorders, Genome Biology, Interviews with Scientific Leaders, Medical and Population Genetics, Medical Devices R&D Investment, Molecular Genetics & Pharmaceutical, Origins of Cardiovascular Disease, PCI, Personalized and Precision Medicine & Genomic Research, Pharmaceutical R&D Investment, Pharmacogenomics, Population Health Management, Genetics & Pharmaceutical, Proteomics, Regulated Clinical Trials: Design, Methods, Components and IRB related issues, Stem Cells for Regenerative Medicine, Technology Transfer: Biotech and Pharmaceutical, tagged , , , , , , , , , , , , , , on August 1, 2013| 11 Comments »

Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Curator: Aviva Lev-Ari, PhD, RN

This image has an empty alt attribute; its file name is ArticleID-73.png

WordCloud Image Produced by Adam Tubman

Article VI Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart

Image created by Adina Hazan 06/30/2021

This article is Part VI in a Series of articles on Calcium Release Mechanism, the series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IX: Calcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

This article has THREE parts:

Part I: Scientific Leader in Cardiology, Contributions by Roger J. Hajjar, MD to Gene Therapy

Part II: Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension

Part III: Cardiac Gene Therapy: Percutaneous Intra-coronary Artery Infusion for Heart Failure

The following two discoveries in Cardiac Gene Therapies represent the FRONTIER IN CARDIOLOGY for 2012 – 2013: Solution Advancement for Improving Myocardial Contractility

Part I: Scientific Leader in Cardiology, Contributions by Roger J. Hajjar, MD to Gene Therapy

Roger J. Hajjar, MD, a pioneering Mount Sinai researcher who has published cutting-edge studies on heart failure, has been named the recipient of the 2013 BCVS Distinguished Achievement Award by theAmerican Heart Association and the Council on Basic Cardiovascular Sciences. Dr. Hajjar, who is The Arthur and Janet C. Ross Professor of Medicine and Director of The Helmsley Trust Translational Research Center, will be honored at the American Heart Association’s Scientific Sessions Annual Conference later this year.

“Dr. Hajjar will receive the award for his groundbreaking contributions to developing gene therapy treatments for cardiac disease,” says Joshua Hare, MD, who is President-elect of the Council on Basic Cardiovascular Sciences. He will also be recognized for his work on behalf of the Council.

Over the years, Dr. Hajjar’s laboratory has made important basic science discoveries that were translated into clinical trials. Most recently, Dr. Hajjar and his researchers identified a possible new drug target for treating or preventing heart failure. Says Mark A. Sussman, PhD, a former president of the Council, “Dr. Hajjar was among the first, and certainly the most successful, in combining gene therapy and treatment of heart failure. He shows a relentless pursuit of translating basic science into real-world treatment of heart disease.”

This article was first published in Inside Mount Sinai.

http://blog.mountsinai.org/blog/roger-j-hajjar-md-to-be-honored-for-research/

John Hopkins, Distinguished Alumnus Award 2011

Roger J. Hajjar, Engr ’86
Dr. Roger Hajjar received his bachelor’s degree in biomedical engineering from Johns Hopkins University in 1986. A cardiologist and translational scientist, he is a leader in gene therapy techniques and model testing for cardiovascular diseases. Dr. Hajjar is professor of medicine and cardiology, and professor of gene and cell medicine at Mount Sinai Medical Center in New York, as well as research director of Mount Sinai’s Wiener Family Cardiovascular Research Laboratories. Dr. Hajjar was recruited to Mt. Sinai from Harvard Medical School where he was assistant professor of medicine and staff cardiologist in the Heart Failure & Cardiac Transplantation Center. He received his medical degree from Harvard Medical School and trained in internal medicine and cardiology at Massachusetts General Hospital in Boston. Dr. Hajjar has concentrated his research efforts on understanding the basic mechanisms of heart failure. He has developed gene transfer methods and techniques in the heart to improve contractility. Dr. Hajjar’s laboratory focuses on targeting signaling pathways in cardiac myocytes to improve contractile function in heart failure and to block signaling pathways in hypertrophy and apoptosis. Dr. Hajjar has significant expertise in gene therapy. In 1996, he won the Young Investigator Award of the American Heart Association (Council on Circulation). In 1999, Dr. Hajjar was awarded the prestigious Doris Duke Clinical Scientist award and won first prize at the Astra Zeneca Young Investigator Forum. Dr. Hajjar holds a number of NIH grants.

http://alumni.jhu.edu/distinguishedalumni2011

Dr Hajjar is the Director of the Cardiovascular Research Center, and the Arthur & Janet C. Ross Professor of Medicine at Mount Sinai School of Medicine, New York, NY. He received his BS in Biomedical Engineering from Johns Hopkins University and his MD from Harvard Medical School and the Harvard-MIT Division of Health Sciences & Technology. He completed his training in internal medicine, cardiology and research fellowships at Massachusetts General Hospital in Boston.

Dr. Hajjar is an internationally renowned scientific leader in the field of cardiac gene therapy for heart failure. His laboratory focuses on molecular mechanisms of heart failure and has validated the cardiac sarcoplasmic reticulum calcium ATPase pump, SERCA2a, as a target in heart failure, developed methodologies for cardiac directed gene transfer that are currently used by investigators throughout the world, and examined the functional consequences of SERCA2a gene transfer in failing hearts. His basic science laboratory remains one of the preeminent laboratories for the investigation of calcium cycling in failing hearts and targeted gene transfer in various animal models. The significance of Dr Hajjar’s research has been recognized with the initiation and recent successful completion of phase 1 and phase 2 First-in-Man clinical trials of SERCA2a gene transfer in patients with advanced heart failure under his guidance.

Prior to joining Mount Sinai, Dr. Hajjar served as Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging at Massachusetts General Hospital and Associate Professor of Medicine at Harvard Medical School. Dr. Hajjar has also been a staff cardiologist in the Heart Failure & Cardiac Transplantation Center at Massachusetts General Hospital.

Dr. Hajjar has won numerous awards and distinctions, including the Young Investigator Award of the American Heart Association. He was awarded a Doris Duke Clinical Scientist award and has won first prize at the Astra Zeneca Young Investigator Forum. He is a member of the American Society for Clinical Investigation. He was recently awarded the Distinguished Alumnus Award from Johns Hopkins University and the Mount Sinai Dean’s award for Excellence in Translational Science. He has authored over 260 peer-reviewed publications.

http://heart.sdsu.edu/~website/IRRI/Pages/faculty/roger-hajjar-md.html

Meet the Director of Mount Sinai’s Cardiovascular Research Center

“Cardiovascular diseases are the number one cause of death globally. In order to tackle them in all aspects, we must unite improved diagnostic techniques with more refined therapies.”

Roger J. Hajjar, MD, Director of the Cardiovascular Research Center, the Arthur & Janet C. Ross Professor of Medicine, Professor of Gene & Cell Medicine, Director of the Cardiology Fellowship Program, and Co-Director of the Transatlantic Cardiovascular Research Center, which combines Mount Sinai Cardiology Laboratories with those of the Universite de Paris – Madame Curie.

In the late 1990s, the possibility that discoveries in genetics and genomics could have a positive impact on the diagnosis, treatment, and prevention of cardiovascular diseases seemed to be just a distant promise. Today, a little more than a decade later, the promise is beginning to take shape. Roger J. Hajjar, MD and his multidisciplinary team of investigators are beginning to translate scientific findings into real therapies for cardiovascular diseases. As Director of the Cardiovascular Research Institute and a cardiologist by training, Dr. Hajjar guides the growth of a cutting-edge translational research laboratory, which is positioning Mount Sinai as the leader in cardiovascular genomics.

An internationally recognized scientific leader in the field of cardiac gene therapy for heart failure, Dr. Hajjar is expanding studies of the basic mechanisms of cardiac diseases and identification of high-risk groups and genomic predictors so that they can be part of the daily clinical care of patients. Unique biorepositories combined with cardiovascular areas of excellence across Mount Sinai make possible crucial genetic studies.

First Gene Therapy for Heart Failure

Under Dr. Hajjar’s leadership, the Cardiovascular Research Center has already developed the world’s first potential gene therapy for heart failure. Known as AAV1.SERCA2a, this therapy actually revives heart tissue that has stopped working properly. It has led to new treatment possibilities for patients with advanced heart failure, whose options used to be severely limited. The significance of this research has been recognized with the initiation and successful completion Phase 1 and Phase 2 First-in-Man clinical trials of SERCA2a gene transfer in patients with advanced heart failure. Phase 3 validation begins in 2011.

The Cardiovascular Research Center’s next research projects, already underway, focus on using novel gene therapy vectors to target diastolic heart failure, ventricular arrhythmias, pulmonary hypertension, and myocardial infarctions.

In addition to targeting signaling pathways to aid failing heart cells, ongoing work at the Cardiovascular Research Center involves studying how to block signaling pathways in cardiac hypertrophy as well as apoptosis. The laboratory team is also targeting a number of signaling pathways in the aging heart to improve dystolic function.

Prior to joining Mount Sinai in 2007, Dr. Hajjar served as Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging at Massachusetts General Hospital and Associate Professor of Medicine at Harvard Medical School. Dr. Hajjar has also been a staff cardiologist in the Heart Failure & Cardiac Transplantation Center at Massachusetts General Hospital. After earning a bachelors of science degree in Biomedical Engineering from Johns Hopkins University and a medical degree from Harvard Medical School and the Harvard-MIT Division of Health Sciences and Technology, he completed his training in internal medicine, cardiology and research fellowships at Massachusetts General Hospital in Boston.

Scientific Advisors
Roger J. Hajjar, MD, Co-Founder and a Scientific Advisor of Celladon Co, plans to commercialize AAV1.SERCA2a for the treatment of heart failure.
Dr. Roger J. Hajjar is the Director of the Cardiovascular Research Center at the Mt. Sinai School of Medicine. Previously, he was the Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging at Massachusetts General Hospital (MGH) and Associate Professor of Medicine at Harvard Medical School. Dr. Hajjar has an active basic science laboratory and concentrates his research efforts on understanding the basic mechanisms of heart failure. He has developed gene transfer methods and techniques targeting the heart as a therapeutic modality to improve contractility in heart failure. Dr. Hajjar’s laboratory focuses on targeting signaling pathways in cardiac myocytes to improve contractile function in heart failure and to block signaling pathways in hypertrophy and apoptosis.

Gene Therapy: Volume 19, Issue 6 (June 2012)

Special Issue: Cardiovascular Gene Therapy

Guest Editor

Roger J Hajjar MD, Mount Sinai School of Medicine, New York, NY Director, Cardiovascular Research Institute, Arthur & Janet C Ross Professor of Medicine

SDF-1 in myocardial repair  

M S Penn, J Pastore, T Miller and R Aras

Gene Ther 19: 583-587; doi:10.1038/gt.2012.32

Abstract | Full Text | PDF

Gene- and cell-based bio-artificial pacemaker: what basic and translational lessons have we learned?  

R A Li

Gene Ther 19: 588-595; doi:10.1038/gt.2012.33

Abstract | Full Text | PDF

Sarcoplasmic reticulum and calcium cycling targeting by gene therapy  

J-S Hulot, G Senyei and R J Hajjar

Gene Ther 19: 596-599; advance online publication, May 17, 2012; doi:10.1038/gt.2012.34

Abstract | Full Text | PDF

Gene therapy for ventricular tachyarrhythmias  

J K Donahue

Gene Ther 19: 600-605; advance online publication, April 26, 2012; doi:10.1038/gt.2012.35

Abstract | Full Text | PDF

Prospects for gene transfer for clinical heart failure  

T Tang, M H Gao and H Kirk Hammond

Gene Ther 19: 606-612; advance online publication, April 26, 2012; doi:10.1038/gt.2012.36

Abstract | Full Text | PDF

Targeting S100A1 in heart failure  

J Ritterhoff and P Most

Gene Ther 19: 613-621; advance online publication, February 16, 2012; doi:10.1038/gt.2012.8

Abstract | Full Text | PDF

VEGF gene therapy: therapeutic angiogenesis in the clinic and beyond  

M Giacca and S Zacchigna

Gene Ther 19: 622-629; advance online publication, March 1, 2012; doi:10.1038/gt.2012.17

Abstract | Full Text | PDF

Vein graft failure: current clinical practice and potential for gene therapeutics  

S Wan, S J George, C Berry and A H Baker

Gene Ther 19: 630-636; advance online publication, March 29, 2012; doi:10.1038/gt.2012.29

Abstract | Full Text | PDF

Percutaneous methods of vector delivery in preclinical models  

D Ladage, K Ishikawa, L Tilemann, J Müller-Ehmsen and Y Kawase

Gene Ther 19: 637-641; advance online publication, March 15, 2012; doi:10.1038/gt.2012.14

Abstract | Full Text | PDF

Lentiviral vectors and cardiovascular diseases: a genetic tool for manipulating cardiomyocyte differentiation and function  

E Di Pasquale, M V G Latronico, G S Jotti and G Condorelli

Gene Ther 19: 642-648; advance online publication, March 1, 2012; doi:10.1038/gt.2012.19

Abstract | Full Text | PDF

Intracellular transport of recombinant adeno-associated virus vectors  

M Nonnenmacher and T Weber

Gene Ther 19: 649-658; advance online publication, February 23, 2012; doi:10.1038/gt.2012.6

Abstract | Full Text | PDF

Gene delivery technologies for cardiac applications  

M G Katz, A S Fargnoli, L A Pritchette and C R Bridges

Gene Ther 19: 659-669; advance online publication, March 15, 2012; doi:10.1038/gt.2012.11

Abstract | Full Text | PDF

Cardiac gene therapy in large animals: bridge from bench to bedside  

K Ishikawa, L Tilemann, D Ladage, J Aguero, L Leonardson, K Fish and Y Kawase

Gene Ther 19: 670-677; advance online publication, February 2, 2012; doi:10.1038/gt.2012.3

Abstract | Full Text | PDF

Progress in gene therapy of dystrophic heart disease  

Y Lai and D Duan

Gene Ther 19: 678-685; advance online publication, February 9, 2012; doi:10.1038/gt.2012.10

Abstract | Full Text | PDF

Targeting GRK2 by gene therapy for heart failure: benefits above β-blockade  

J Reinkober, H Tscheschner, S T Pleger, P Most, H A Katus, W J Koch and P W J Raake

Gene Ther 19: 686-693; advance online publication, February 16, 2012; doi:10.1038/gt.2012.9

Abstract | Full Text | PDF

Directed evolution of novel adeno-associated viruses for therapeutic gene delivery  

M A Bartel, J R Weinstein and D V Schaffer

Gene Ther 19: 694-700; advance online publication, March 8, 2012; doi:10.1038/gt.2012.20

Abstract | Full Text | PDF

http://www.nature.com/gt/journal/v19/n6/index.html

Part II: Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension

Public release date: 30-Jul-2013

Contact: Lauren Woods
lauren.woods@mountsinai.org
212-241-2836
The Mount Sinai Hospital / Mount Sinai School of Medicine

Inhalable gene therapy may help pulmonary arterial hypertension patients

Gene therapy when inhaled may restore function of a crucial enzyme in the lungs to reverse deadly PAH

The deadly condition known as pulmonary arterial hypertension (PAH), which afflicts up to 150,000 Americans each year, may be reversible by using an inhalable gene therapy, report an international team of researchers led by investigators at the Cardiovascular Research Center at Icahn School of Medicine at Mount Sinai.

In their new study, reported in the July 30 issue of the journal Circulation, scientists demonstrated that gene therapy administered through a nebulizer-like inhalation device can completely reverse PAH in rat models of the disease. In the lab, researchers also showed in pulmonary artery PAH patient tissue samples reduced expression of the SERCA2a, an enzyme critical for proper pumping of calcium in calcium compartments within the cells. SERCA2a gene therapy could be sought as a promising therapeutic intervention in PAH.

“The gene therapy could be delivered very easily to patients through simple inhalation — just like the way nebulizers work to treat asthma,” says study co-senior investigator Roger J. Hajjar, MD, Director of the Cardiovascular Research Center and the Arthur & Janet C. Ross Professor of Medicine and Professor of Gene & Cell at Icahn School of Medicine at Mount Sinai. “We are excited about testing this therapy in PAH patients who are in critical need of intervention.”

This same SERCA2a dysfunction also occurs in heart failure. This new study utilizes the same gene therapy currently being tested in patients to reverse congestive heart failure in a large phase III clinical trial in the United States and Europe.

“What we have shown is that gene therapy restores function of this crucial enzyme in diseased lungs,” says Dr. Hajjar. “We are delighted with these new findings because it suggests that a gene therapy that is already showing great benefit in congestive heart failure patients may be able to help PAH patients who currently have no good treatment options — and are in critical need of a life sustaining therapy.”

When SERCA2a is down-regulated, calcium stays longer in the cells than it should, and it induces pathways that lead to overgrowth of new and enlarged cells. According to researchers, the delivery of the SERCA2a gene produces SERCA2a enzymes, which helps both heart and lung cells restore their proper use of calcium.

“We are now on a path toward PAH patient clinical trials in the near future,” says Dr. Hajjar, who developed the gene therapy approach. Studies in large animal models are now underway. SERCA2a gene therapy has already been approved by the National Institutes of Health for human study.

A Simple Inhalation Corrects Deadly Dysfunction

PAH most commonly results from heart failure in the left side of the heart or from a pulmonary embolism, when clots in the legs travel to the lungs and cause blockages. When the lung is damaged from these conditions, the tissue starts to quickly produce new and enlarged cells, which narrows pulmonary arteries. This increases the pressure inside them. The high pressure in these arteries resists the heart’s effort to pump through them and the blood flow between the heart and lungs is reduced. The right side of the heart then must overcome the resistance and work harder to push the blood through the pulmonary arteries into the lungs. Over time, the right ventricle becomes thickened and enlarged and heart failure develops.

The gene therapy that Dr. Hajjar developed uses a modified adeno-associated viral-vector that is derived from a parvovirus. It works by introducing a healthy SERCA2a gene into cells, but this gene does not incorporate into a patient’s chromosome, according to the study’s lead author, Lahouaria Hadri, PhD, an Instructor of Medicine in Cardiology at Icahn School of Medicine at Mount Sinai.

“The clinical trials in congestive heart failure have shown already that the gene therapy is very safe,” says Dr. Hadri. Between 40-50 percent of individuals have antecedent antibodies to the adeno-associated vectors, so potential patients need to be screened before gene therapy to make sure they are eligible to receive the vectors. In patients without antibodies, the restorative enzyme gene therapy does not cause an immune response, according to Dr. Hadri.

The clinical application of the gene therapy for patients with PAH will most likely differ from those with heart failure. The replacement gene needs to be injected through the coronary arteries of heart failure patients using catheters, while in PAH patients, the gene will need to be administered through inhalation.

This study was supported by National Institutes of Health grants (K01HL103176, K08111207, R01 HL078691, HL057263, HL071763, HL080498, HL083156, and R01 HL105301).

Other study co-authors include Razmig G. Kratlian, MD, Ludovic Benard, PhD, Kiyotake Ishikawa, MD, Jaume Aguero, MD, Dennis Ladage, MD, Irene C.Turnbull, MD, Erik Kohlbrenner, BA, Lifan Liang, MD, Jean-Sébastien Hulot, MD, PhD, and Yoshiaki Kawase, MD, from Icahn School of Medicine at Mount Sinai; Bradley A. Maron, MD and the study’s co-senior author Jane A. Leopold, MD, from Brigham and Women’s Hospital and Harvard Medical School in Boston, MA; Christophe Guignabert, PhD, from Hôpital Antoine-Béclère, Clamart, France; Peter Dorfmüller, MD, PhD, and Marc Humbert, MD, PhD, both of the Hôpital Antoine-Béclère and INSERM U999, Centre Chirurgical Marie-Lannelongue, Le Plessis-Robinson, France; Borja Ibanez, MD, from Fundación Centro Nacional de Investigaciones Cardiovasculares, Carlos III (CNIC), Madrid, Spain; and Krisztina Zsebo, PhD, of Celladon Corporation, San Diego, CA.

  • Dr. Hajjar and co-author Dr. Zsebo, have ownership interest in Celladon Corporation, which is developing AAV1.SERCA2a for the treatment of heart failure. Also,
  • Dr. Hajjar and co-authors Dr. Kawase and Dr. Ladage hold intellectual property around SERCA2a gene transfer as a treatment modality for PAH. In addition,
  • co-author Dr. Maron receives funding from Gilead Sciences, Inc. to study experimental pulmonary hypertension.
  • Other study co-authors have no financial interests to declare.

Therapeutic Efficacy of AAV1.SERCA2a in Monocrotaline-Induced Pulmonary Arterial Hypertension

  1. Lahouaria Hadri, PhD;
  2. Razmig G. Kratlian, MD;
  3. Ludovic Benard, PhD;
  4. Bradley A. Maron, MD;
  5. Peter Dorfmüller, MD, PhD;
  6. Dennis Ladage, MD;
  7. Christophe Guignabert, PhD;
  8. Kiyotake Ishikawa, MD;
  9. Jaume Aguero, MD;
  10. Borja Ibanez, MD;
  11. Irene C. Turnbull, MD;
  12. Erik Kohlbrenner, BA;
  13. Lifan Liang, MD;
  14. Krisztina Zsebo, PhD;
  15. Marc Humbert, MD, PhD;
  16. Jean-Sébastien Hulot, MD, PhD;
  17. Yoshiaki Kawase, MD;
  18. Roger J. Hajjar, MD*;
  19. Jane A. Leopold, MD*

+Author Affiliations


  1. From the Cardiovascular Research Center, Icahn School of Medicine at Mount Sinai, New York, NY (L.H., R.G.K., L.B., D.L., K.I., J.A., I.C.T., E.K., L.L., J.-S.H., Y.K., R.J.H.); Cardiovascular Medicine Division, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA (B.A.M., J.A.L.); Hôpital Antoine-Béclère, Clamart, France (P.D., C.G., M.H.); INSERM U999, Centre Chirurgical Marie-Lannelongue, Le Plessis-Robinson, France (P.D., M.H.); Fundación Centro Nacional de Investigaciones Cardiovasculares, Carlos III (CNIC), Madrid, Spain (B.I.); and Celladon Corporation, San Diego, CA (K.Z.).
  1. Correspondence to Lahouaria Hadri, PhD, Cardiovascular Research Center, Box 1030, Icahn School of Medicine at Mount Sinai, 1470 Madison Ave, New York, NY 10029. E-mail lahouaria.hadri@mssm.edu

Abstract

Background—Pulmonary arterial hypertension (PAH) is characterized by dysregulated proliferation of pulmonary artery smooth muscle cells leading to (mal)adaptive vascular remodeling. In the systemic circulation, vascular injury is associated with downregulation of sarcoplasmic reticulum Ca2+-ATPase 2a (SERCA2a) and alterations in Ca2+homeostasis in vascular smooth muscle cells that stimulate proliferation. We, therefore, hypothesized that downregulation of SERCA2a is permissive for pulmonary vascular remodeling and the development of PAH.

Methods and Results—SERCA2a expression was decreased significantly in remodeled pulmonary arteries from patients with PAH and the rat monocrotaline model of PAH in comparison with controls. In human pulmonary artery smooth muscle cells in vitro, SERCA2a overexpression by gene transfer decreased proliferation and migration significantly by inhibiting NFAT/STAT3. Overexpresion of SERCA2a in human pulmonary artery endothelial cells in vitro increased endothelial nitric oxide synthase expression and activation. In monocrotaline rats with established PAH, gene transfer of SERCA2a via intratracheal delivery of aerosolized adeno-associated virus serotype 1 (AAV1) carrying the human SERCA2a gene (AAV1.SERCA2a) decreased pulmonary artery pressure, vascular remodeling, right ventricular hypertrophy, and fibrosis in comparison with monocrotaline-PAH rats treated with a control AAV1 carrying β-galactosidase or saline. In a prevention protocol, aerosolized AAV1.SERCA2a delivered at the time of monocrotaline administration limited adverse hemodynamic profiles and indices of pulmonary and cardiac remodeling in comparison with rats administered AAV1 carrying β-galactosidase or saline.

Conclusions—Downregulation of SERCA2a plays a critical role in modulating the vascular and right ventricular pathophenotype associated with PAH. Selective pulmonary SERCA2a gene transfer may offer benefit as a therapeutic intervention in PAH.

Key Words:

  • Received January 24, 2013.
  • Accepted June 13, 2013.

http://circ.ahajournals.org/content/128/5/512.abstract?sid=9b3b4fcc-e158-4e5d-bb8b-125586e2ec12

Circulation.2013; 128: 512-523 Published online before print June 26, 2013,doi: 10.1161/​CIRCULATIONAHA.113.001585

Part III: Cardiac Gene Therapy: Percutaneous Intra-coronary Artery Infusion for Heart Failure

Etiology of Heart Failure

  • Alcoholic
  • Hypertensive
  • Idiopathic
  • Inflammatory
  • Ischemic
  • Pregnancy-related
  • Toxic
  • Valvular Heart DIsease

Administration of Cardiac Gene Therapy for Heart Failure: via Percutaneous Intra-coronary Artery Infusion

  • Gene delivery to viable myocardium

dominance and coronary artery anatomy from angiography determines infusion scenario

  • Antegrade epicardial coronary artery infusion over 10 minutes

60 mL divided into 1,2,3 infusions depending on anatomy

Delivered via commercially available angiographic injection system & guide or diagnostic catheters

Dr. Roger J. Hajjar of the Mount Sinai School of Medicine will present at the ASGCT 15th Annual Meeting during a Scientific Symposium entitled: Cell and Gene Therapy in Cardiovascular Disease on Wednesday, May 16, 2012 at 8:00 am. Below is a brief preview of his presentation.

Roger J. Hajjar, MD

Mount Sinai School of Medicine

New York, NY

Novel Developments in Gene Therapy for Cardiovascular Diseases

Chronic heart failure is a leading cause of hospitalization affecting nearly 6 million people in the U.S. with 670,000 new cases diagnosed every year. Heart failure leads to about 280,000 deaths annually.

Congestive heart failure remains a progressive disease with a desperate need for innovative therapies to reverse the course of ventricular dysfunction. The most common symptoms of heart failure are shortness of breath, feeling tired and swelling in the ankles, feet, legs and sometimes the abdomen. Recent advances in understanding the molecular basis of myocardial dysfunction, together with the evolution of increasingly efficient gene transfer technology have placed heart failure within reach of gene-based therapies.

One of the key abnormalities in both human and experimental HF is a defect in sarcoplasmic reticulum (SR) function, which controls Ca2+ handling in cardiac myocytes on a beat to beat basis. Deficient SR Ca2+ uptake during relaxation has been identified in failing hearts from both humans and animal models and has been associated with a decrease in the activity of the SR Ca2+-ATPase (SERCA2a).

Over the last ten years we have undertaken a program of targeting important calcium cycling proteins in experimental models of heart by somatic gene transfer. This has led to the completion of a first-in-man phase 1 clinical trial of gene therapy for heart failure using adeno-associated vector (AAV) type 1 carrying SERCA2a. In this Phase I trial, there was evidence of clinically meaningful improvements in functional status and/or cardiac function which were observed in the majority of patients at various time points. The safety profile of AAV gene therapy along with the positive biological signals obtained from this phase 1 trial has led to the initiation and recent completion of a phase 2 trial of AAV1.SERCA2a in NYHA class III/IV patients. In the phase 2 trial, gene transfer of SERCA2a was found to be safe and associated with benefit in clinical outcomes, symptoms, functional status, NT-proBNP and cardiac structure.

The 12 month data presented showed that heart failure, which is a progressive disease, became stabilized in high dose AAV1.SERCA2a-treated patients: heart failure symptoms, exercise tolerance, serum biomarkers and cardiac function essentially improved or remained the same while these parameters deteriorated substantially in patients treated with placebo and concurrent optimal drug and device therapy. More recently, the 2-year CUPID data from long-term follow-up demonstrate a durable benefit in preventing major cardiovascular events.

The recent successful and safe completion of the CUPID trial along with the start of more recent phase 1 trials usher a new era for gene therapy for the treatment of heart failure. Furthermore, novel AAV derivatives with high cardiotropism and resistant to neutralizing antibodies are being developed to target a large number of cardiovascular diseases.

http://www.execinc.com/hosted/emails/asgct/file/Hajjar2(1).pdf

Power Point Presentation on Cardiac Gene Therapy –

VIEW SLIDE SHOW

http://my.americanheart.org/idc/groups/heart-public/@wcm/@global/documents/downloadable/ucm_311680.pdf

Gene Therapy for Heart Failure

  1. Lisa Tilemann,
  2. Kiyotake Ishikawa,
  3. Thomas Weber,
  4. Roger J. Hajjar

+Author Affiliations


  1. From the Cardiovascular Research Center, Mount Sinai Medical Center, New York, NY.
  1. Correspondence to Roger J. Hajjar, MD, Mount Sinai Medical Center, One Gustave Levy Place, Box 1030, New York, NY 10029. E-mail roger.hajjar@mssm.edu

Abstract

Congestive heart failure accounts for half a million deaths per year in the United States. Despite its place among the leading causes of morbidity, pharmacological and mechanic remedies have only been able to slow the progression of the disease. Today’s science has yet to provide a cure, and there are few therapeutic modalities available for patients with advanced heart failure. There is a critical need to explore new therapeutic approaches in heart failure, and gene therapy has emerged as a viable alternative. Recent advances in understanding of the molecular basis of myocardial dysfunction, together with the evolution of increasingly efficient gene transfer technology, have placed heart failure within reach of gene-based therapy. The recent successful and safe completion of a phase 2 trial targeting the sarcoplasmic reticulum calcium ATPase pump (SERCA2a), along with the start of more recent phase 1 trials, opens a new era for gene therapy for the treatment of heart failure.

Circulation Research.2012; 110: 777-793 doi: 10.1161/​CIRCRESAHA.111.252981

Key Words:

  • Received December 8, 2011.
  • Revision received January 29, 2012.
  • Accepted January 30, 2012.

Conclusions 

With a better understanding of the molecular mechanisms associated with heart failure and improved vectors with cardiotropic properties, gene therapy can now be considered as a viable adjunctive treatment to mechanical and pharmacological therapies for heart failure. In the coming years, more targets will emerge that are amenable to genetic manipulations, along with more advanced vector systems, which will undoubtedly lead to safer and more effective clinical trials in gene therapy for heart failure.

http://circres.ahajournals.org/content/110/5/777.full.pdf+html

Hijjar1
Figure 1.

AAV entry. 1 indicates receptor binding and endocytosis; 2, escape into cytoplasm; 3, nuclear import; 4, capsid disassembly; 5, double-strand synthesis; and 6, transcription.

Hijjar2

Figure 2.

Generation of mutant AAV library and directed evolution to identify cardiotropic AAVs. A, Creation of a library of AAVs through DNA shuffling.B, Selection of cardiotropic AAVs through directed evolution.

Hijjar3

Figure 3.

Antegrade coronary artery infusion. A, Coronary artery infusion. The vector is injected through a catheter without interruption of the coronary flow. B, Coronary artery infusion with occlusion of a coronary artery: The vector is injected through the lumen of an inflated angioplasty catheter. C, Coronary artery infusion with simultaneous blocking of a coronary artery and a coronary vein: The vector is injected through an inflated angioplasty catheter and resides in the coronary circulation until both balloons are deflated.

Hijjar4

Figure 4.

V-Focus system and retrograde coronary venous infusion. A, Recirculating antegrade coronary artery infusion: The vector is injected into a coronary artery, collected from the coronary sinus and after oxygenation readministered into the coronary artery. B, Retrograde coronary venous infusion with simultaneous blocking of a coronary artery and a coronary vein: The vector is injected into a coronary vein and resides in the coronary circulation until both balloons are deflated.

Hijjar5

Figure 5.

Direct myocardial injection and pericardial injection. A, Percutaneous myocardial injection: The vector is injected with an injection catheter via an endocardial approach.B, Surgical myocardial injection: The vector is injected via an epicardial approach. C, Percutaneous pericardial injection: The vector is injected via a substernal approach.

Hijjar6

Figure 6.

Excitation-contraction coupling in cardiac myocytes provides multiple targets for gene therapy.

SOURCE

http://circres.ahajournals.org/content/110/5/777.figures-only

Articles citing this article

  • ‘Ryanopathy’: causes and manifestations of RyR2 dysfunction in heart failureCardiovasc Res. 2013;98:240-247,
  • Up-regulation of sarcoplasmic reticulum Ca2+ uptake leads to cardiac hypertrophy, contractile dysfunction and early mortality in mice deficient in CASQ2Cardiovasc Res. 2013;98:297-306,
  • Myocardial Delivery of Stromal Cell-Derived Factor 1 in Patients With Ischemic Heart Disease: Safe and PromisingCirc. Res.. 2013;112:746-747,
  • Circulation Research Thematic Synopsis: Cardiovascular GeneticsCirc. Res.. 2013;112:e34-e50,
  • Gene and cytokine therapy for heart failure: molecular mechanisms in the improvement of cardiac functionAm. J. Physiol. Heart Circ. Physiol.. 2012;303:H501-H512,
  • Ryanodine Receptor Phosphorylation and Heart Failure: Phasing Out S2808 and “Criminalizing” S2814Circ. Res.. 2012;110:1398-1402,

http://circres.ahajournals.org/content/110/5/777.figures-only

For 154 References on Cardiac Gene Therapy

http://circres.ahajournals.org/content/110/5/777.full.pdf+html

Read Full Post »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Posted in Advanced Drug Manufacturing Technology, Biomedical Measurement Science, BioSimilars, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, Cardiovascular Pharmacogenomics, Cell Biology, Signaling & Cell Circuits, Coagulation Therapy and Internal Bleeding, Disease Biology, Small Molecules in Development of Therapeutic Drugs, Drug Delivery Platform Technology, Frontiers in Cardiology and Cardiovascular Disorders, Population Health Management, Genetics & Pharmaceutical, Uncategorized, tagged , , , , , , , , , , , , , on July 20, 2013| 1 Comment »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and Pathology2  Duke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »

3D Cardiovascular Theater – Hybrid Cath Lab/OR Suite, Hybrid Surgery, Complications Post PCI and Repeat Sternotomy

Posted in Abdominal Aorta, Aortic Valve: TAVR, TAVI vs Open Heart Surgery, Atherogenic Processes & Pathology, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, Ecosystems & Industrial Concentration in the Medical Device Sector, Frontiers in Cardiology and Cardiovascular Disorders, Interviews with Scientific Leaders, Medical Devices R&D and Inventions, Medical Devices R&D Investment, Medical Imaging Technology, Image Processing/Computing, MRI, CT, Nuclear Medicine, Ultra Sound, Mitral Valve: Repair and Replacement, Origins of Cardiovascular Disease, PCI, Peripheral Arterial Disease & Peripheral Vascular Surgery, Pharmacotherapy of Cardiovascular Disease, Renal Denervation, Stents & Tools, Thoracic Aorta, Valves & Tools, tagged , , , , , , , , on July 19, 2013| 3 Comments »

3D Cardiovascular Theater – Hybrid Cath Lab/OR Suite, Hybrid Surgery, Complications Post PCI and Repeat Sternotomy

Curator: Aviva Lev-Ari, PhD, RN

Article ID #70: Cardiovascular Original Research: Cases in Methodology Design for Content Curation and Co-Curation. Published on 7/19/2013

WordCloud Image Produced by Adam Tubman

This article has THREE Parts: 

Part One:  Hybrid Cath Lab/OR Suite for Hybrid Surgery

Part Two: Cardiac Surgery 

Part Three: Invasive Interventions with Complications

1. Repeat Sternotomy Post CABG and/or Aortic Valve Replacement

2. Complications Post PCI – Pump Catheter in Use

The voice of Series A Content Consultant, Justin D Pearlman, MD, PhD, FACC

The leading cause of death and disability from any cause is cardiovascular disease, principally, heart attacks and strokes. Both the heart and brain typically allow only 10 minutes or so of inadequate blood supply before starting a committed course of permanent tissue injury, progressing in severity as time goes by without successful interruption of the disease process. Thus there is great time urgency to get patients to a definitive treatment that can stop the injury and restore adequate nutrient blood supply. Many patients can benefit from a catheterization to identify blockages and insert a small balloon within the blockage to expand the narrow channel, often followed by placement of a stent (wire cage) to maintain the expanded vessel diameter. Chemicals released over time from drug-eluting stents can prevent tissue in growth that may obstruct stents. These emergeny interventions are not always successful. There may be complications from the attempt to access an entry artery, and the blockages may not be amenable to a balloon. When such limitations are encountered, the next chance to help is surgical, with continued time pressure.

The fastest way to make the transition from a diagnostic catheterization to a timely intervention is a hybrid intervention suite that offers non-invasive imaging, catheterization and surgery all in one location. The following articles present the current state of hybrid “do it all” intervention suites. Additional articles address the risks of bad outcomes from such interventions.

Part One 

Hybrid Cath Lab/OR Suite for Hybrid Surgery

In ACC.10 and i2 Summit, 59th Annual Scientific Session, 3/14-3/16, 2010, Alfred A. Bove, M.D., Ph.D., F.A.C.C., ACC President addressed the conference attendees:

Welcome to the all-new Hybrid Cath Lab/OR and 3D CV Theater. Recent developments in cardiac surgery and interventional cardiology have led to the creation of integrated, hybrid cath lab/operating rooms (OR), which provide significant advantages in the diagnosis and treatment of patients requiring cardiac procedures—helping to facilitate a rapid-response approach. These multimodality rooms are designed to support a variety of integrated surgical and endovascular procedures. We are excited to provide you with this opportunity to get a first-hand look—and feel—of the latest technologies. We hope you take the time to explore this interactive, multivendor venue. Learning is at the core of the ACC Annual Scientific Session and we invite you to expand your educational experience in this dynamic learning environment.

In the Hybrid Cath Lab/OR Suite, you’ll discover how integrating cutting edge angiographic and surgical equipment and technologies can facilitate a broad range of procedures within one location. Additionally, you will learn how hybrid suites are providing solutions that enable interventionalists and surgeons to work collaboratively to provide the best treatment options for patients. The adjoining 3D CV Theater features presentations by physicians currently performing intravascular and surgical procedures in hybrid suites. Each live presentation pairs a cardiologist with a surgeon, allowing you to hear perspectives from both sides on a variety of hybrid suite procedures and cases. In addition, the Theater offers video presentations of cases from around the world.

The ACC thanks the supporters of the Hybrid Suite for providing us with the opportunity to share this unique learning destination with you.

http://www.expo.acc.org/acc12/CUSTOM/images/ACC12/ACC.10%20Hybrid%20Suite%20Directory.pdf

Hybrid Cath Lab/OR Suite for Hybrid Surgery

Procedures Performed in a Hybrid Suite

The treatment of cardiovascular diseases has undergone a paradigm shift within the last few years, from

  • open surgery to minimally invasive surgical procedures and from
  • limited percutaneous catheter-based interventions to hybrid interventions for the entire cardiovascular tree.

The Hybrid Suite

are perfect examples of procedures that could, and should, be carried out in a hybrid OR. High-risk patients who require less invasive interventions are the best candidates for treatment in a hybrid suite.

As cardiac surgery becomes less invasive, incisions are becoming smaller and smaller, and even totally endoscopic heart surgery is now possible. Cardiac surgeons have started to perform procedures that include catheter-based skills, such as transapical valve replacement. For these operations, surgeons need more sophisticated imaging techniques, fluoroscopy and contrast injections. The hybrid OR offers all these facilities. Perhaps the most obvious and easiest procedure that can be performed in a hybrid OR is coronary revascularization combining coronary artery bypass grafting with on-table intra-operative completion angiography for quality control. If the surgeon detects a problem during the procedure, he or she can revise the graft immediately and thereby prevent potential perioperative and long-term complications. Currently, cardiologists and cardiovascular surgeons have shown special interest in so-called hybrid coronary interventions, which are combinations of minimally invasive coronary artery bypass grafting and percutaneous coronary interventions. In these procedures, cardiovascular surgeons place a left-internal mammary artery bypass graft to the left-anterior descending artery through small incisions (MIDCAB) or completely endoscopically (TECAB), while any remaining obstructed coronary arteries are treated with stents by an interventional cardiologist. This procedure is an attractive alternative to multivessel open coronary artery bypass grafting. Transcatheter heart-valve replacement and repair are especially suited to a hybrid suite because percutaneous transfemoral and transapical aortic valve repairs include risks that can only be treated successfully by immediate surgical intervention, such as coronary artery obstruction, aortic dissection and aortic perforations.

In addition, endovascular aortic stent grafting for the repair of abdominal aortic aneurysms is a suitable procedure for a hybrid operating room. Endovascular aneurysm repair has become an established alternative to open repair and is increasingly used for thoracic aorta repair as well. Some

  • emergency procedures for traumatic lesions of the thoracic aorta and
  • fulminant pulmonary embolism may also be performed in a hybrid OR. Several
  • pediatric interventions can be carried out in a hybrid suite as well, such as implantation of closure devices for atrial and ventricular septal defects in small children and
  • treatments for hypoplastic left-heart syndrome.

http://www.expo.acc.org/acc12/CUSTOM/images/ACC12/ACC.10%20Hybrid%20Suite%20Directory.pdf

In a recent article we reported on the Change in Requirement for Surgical Support by Cath Labs for performance of Nonemergent PCI without Surgical Backup, that increases the autonomy of Interventional Cardiologists. In the Hybrid OR that change is irrelevant since the presence of a Cardiac Surgeon is a fact of the division of labor between the two types of specialties. Cardiac Surgeons are involved with  percutaneous transfemoral and transapical aortic valve repairs and intervention for endoscopic aorta, AAA and Thoracic AA grafting.

AHA, ACC Change in Requirement for Surgical Support:  Class IIb -> Class III, Level of Evidence A: Supports Nonemergent PCI without Surgical Backup (Change of class IIb, level of Evidence B).

What is a Cardiovascular Hybrid Suite?

Cardiovascular hybrid suite is a state-of-the-art operating room equipped with a fully functional catheterization laboratory, thus allowing surgical procedures and catheter-based interventions to be carried out in the same room. Hybrid suites provide a place where treatments traditionally available only in a cath lab and procedures only available in an operating room can be performed together to provide patients with the best available combination of therapies for cardiovascular disease. These multidisciplinary, integrated cardiovascular procedural suites bring the best of two worlds together by combining all the advantages of a modern cath lab with an up-to-date cardiovascular surgery operating room (OR).

Hybrid suites began to evolve in the mid to late 1990s, when some groups of interventional cardiologists started sharing operating rooms with cardiovascular surgeons. The appeal of the hybrid suite concept has grown as have catheter based devices (stents, coils, balloons and lasers) have been developed that enable interventional cardiologists to advance the invasiveness and effectiveness and applications of percutaneous transcatheter interventions. The interest in these suites has also increased as cardiovascular surgeons have developed a variety of techniques for

  • Minimally invasive procedures, such as minimally invasive direct coronary artery bypass grafting (MIDCAB) or
  • Totally endoscopic coronary artery bypass grafting (TECAB).

With the advent of more tools, interventional cardiologists are becoming more like surgeons, and with less invasive tools, cardiovascular surgeons are becoming more like interventionalists. Rather than separating surgical procedures from interventional procedures performed in traditional operating rooms and cath labs, hybrid suites provide a high-tech environment that allows cardiologists and surgeons to work together to offer patients complex, minimally invasive therapies.

Some experts believe that hybrid suites represent the wave of the future in cardiovascular care and that most heart centers will eventually install hybrid suites to offer patients the latest cardiovascular procedures safely and effectively with minimal surgical trauma. The rooms can be costly to build and equip, but if a medical center is considering building a new operating room or cath lab, setting up a hybrid suite makes sense. Medical centers that have a hybrid suite available can clearly differentiate themselves in a positive way from centers that do not have such capabilities.

The Benefits of a Hybrid Suite for Medical Centers

While building a hybrid suite is more expensive than building a traditional operating room or cath lab, a hybrid suite can potentially be used for all types of cardiovascular procedures, including

  • traditional cardiac and vascular surgery,
  • interventional coronary procedures,
  • endovascular aortic procedures and
  • electrophysiology procedures.

Hybrid suites reinforce the trend in cardiovascular care toward less invasive, comprehensive hybrid procedures. Once a hybrid suite is in place, the demand for its use will likely grow due to increasing indications and referrals for these innovative treatments, many of which are increasingly covered by third-party payers.

http://www.expo.acc.org/acc12/CUSTOM/images/ACC12/ACC.10%20Hybrid%20Suite%20Directory.pdf

What Equipment is Needed?

Interventional cath labs usually have excellent imaging capabilities but lack the sterile facilities and staff needed for a formal OR, while operating rooms frequently lack high-level imaging equipment. Some of the essential equipment for a hybrid suite includes:

• A state-of-the-art imaging system capable of performing 3D rotational angiography, CT scanning, and ultrasound is advantageous. Floor-mounted and ceiling-mounted systems are available, but many hospitals use ceiling-mounted systems because access to the patient is slightly easier. Some ceiling-mounted systems provide 3D imaging from the surgeon’s position perpendicular to the patient. However, some hospitals prefer floor-mounted systems because having mechanical parts running above the operative field may cause dust to fall, resulting in infections. An important aspect is that the C-arm can be parked away when it is not used. This especially enhances access of the anesthesia team to the patient.

• An operating table that meets the needs of both surgeons and interventionalists by electronically integrating the table with the imaging system is also essential. These tables should have retractable rails for retractors and other surgical tools. To perform 3D imaging on the operating table, the C-arm of the imaging system should allow fast and precise rotation around the patient.

• A variety of other surgical and interventional systems and equipment may also be needed, including a robotic surgical system, a heart-lung machine, an image integration system, an endoscopic imaging system, a radiology display system, an audiovisual system to move images to different monitors and an anesthesia monitoring system, including transesophageal echocardiography. Some equipment like the integrated OR table and the angiography unit need to be fixed parts of the hybrid OR. Some equipment will be mobile in order to maintain some flexibility in workflow.

Hybrid1

Hybrid2

Hybrid3

Hybrid4

Hybrid5

Who are the Equipment Vendors?

Philips Healthcare

Phone: 800-934-7372

Email: healthcare@philips.com

Web: http://www.philips.com/healthcare

Philips is one of the world’s leading technology companies, with a long history of practical innovation and visionary design. In healthcare, we are committed to understanding the human and technological needs of patients and caregivers. We believe this understanding will help us deliver solutions that not only enable more confident diagnoses and more efficient delivery of care, but also improve the overall experience of care. We offer equipment, software and services for imaging, patient monitoring, resuscitation and much more.  A Hybrid OR can help make life simpler for the interdisciplinary teams who operate in this environment every day. As a world leader in cardiovascular X-ray, Philips has the experience and expertise to deliver the first class technology you need to perform minimally invasive procedures with speed, accuracy and confidence. A long history of innovation has enabled Philips to develop pioneering imaging solutions that really make a difference.

For example, Philips Allura Xper cardiovascular X-ray systems are designed to deliver enhanced imaging with superb performance for all cardiac projections, and our iE33 ultrasound system with Live 3D TEE and QLAB can assist interventional procedures and provide comprehensive quantitative information to support critical decisions. Our cardiology informatics solutions help you manage patient information throughout the cardiovascular care continuum. Philips solutions allow minimally invasive and catheter-based procedures to take place in the same suite as conventional cardiac surgery.

Phillips EchoNavigator – X-Ray and 3-D Ultrasound is described in:

Minimally Invasive Structural CVD Repairs: FDA grants 510(k) Clearance to Philips’ EchoNavigator – X-ray and 3-D Ultrasound Image Fused.

Intuitive Surgical, Inc. 

da Vinci.Surgery by Intuitive Surgical, Inc. 

Phone: 800-876-1310

Email: info@intusurg.com

Web: http://www.intuitivesurgical.com

Intuitive Surgical, Inc. is the global technology leader in robotic-assisted, minimally invasive surgery. The company’s da Vinci® Surgical System offers breakthrough capabilities that enable cardiac surgeons to use a minimally invasive approach and avoid median sternotomy.

Content of FDA Warning Letter, following  FDA Inspection on dates 04/01/2013 – 05/30/2013 – it discussed in

Hybrid Cath Lab/OR Suite’s da Vinci Surgical Robot of Intuitive Surgical gets FDA Warning Letter on Robot Track Record

 

MAVIG GmbH 

Phone: 631-266-2229,

585-247-1212 ext. 60

Email: info@mavig.com

Web: http://www.mavig.com

MAVIG’s specialty is ceiling/boom suspension systems for lighting (exam, surgical and LED), monitor-suspension systems—single, multibank (one to eight) systems and widescreen, overhead radiation shielding and contrast injector adapters. MAVIG also manufactures radiation protection products such as aprons, gloves, table-attachable lower body shields, adjustable- and fixed-height mobile and modular barriers.

Toshiba America Medical Systems, Inc.

Phone: 714-730-5000

Email: mktgcomm@tams.com

Web: http://www.medical.toshiba.com

Creating a hybrid lab may be complicated, but having an experienced partner that listens makes all the difference. Toshiba’s unique blend of hybrid experience and industry recognized Infinix™-i imaging systems for the Cath Lab.

Hybrid Cath Lab/OR Suite in Leading Hospitals in the US

  • The  Hybrid Cath Lab/OR Suite at New York Presbyterian Hospital/Columbia University Medical Center, New York, NY is presented in

Becoming a Cardiothoracic Surgeon: An Emerging Profile in the Surgery Theater and through Scientific Publications

  • The  Hybrid Cath Lab/OR Suite at Cleveland Clinic, Cleveland, Ohio is presented in

Heart Transplant (HT) Indication for Heart Failure (HF): Procedure Outcomes and Research on HF, HT @ Two Nation’s Leading HF & HT Centers

Speakers at 3D CV Theater, 2010 are working in Hospitals where Hybrid Cath Lab/OR Suite are in operations at the present time. The list include the following Hospitals with a Hybrid Cath Lab/OR Suite:

  • Vanderbilt Medical Center, Nashville, TN
  • University of Maryland Heart Center, Baltimore, MD
  • The Heart Center at Nationwide Children’s Hospital, Columbus, Ohio
  • The Robotic Surgical Center, East Carolina University Department of Surgery, Greenville, N.C.
  • University of Washington Medicine Regional Heart Center, Seattle, WA
  • Brigham and Women’s Hospital, Boston, MA
  • Saint Joseph’s Hospital and Peachtree Cardiovascular and Thoracic Surgery, Atlanta, GA
  • Emory University Hospital, Atlanta, GA
  • Beth Israel Deaconess Medical Center, Boston, MA
  • Boston Medical Center, Boston, MA
  • Mayo Graduate School of Medicine, Mayo Clinic, Rochester, MN
  • Lankenau Hospital, Lancaster, PA
  • Cardiac Non-Invasive Laboratory at Cedars-Sinai Medical Center, Los Angeles, CA
  • Robotic Surgery at St. Joseph’s Hospital, Atlanta, GA

Speakers at 3D CV Theater, 2010, included the following Cardiovascular Interventionists leading the adoption process of Hybrid Surgery in Hybrid Cath Lab/OR Suite into care modalities for cardiovascular disease:

Johannes O. Bonatti, M.D., is professor of surgery and director of coronary surgery and advanced coronary interventions at the University of Maryland Heart Center, Baltimore. He received his training in general surgery and cardiac surgery at the department of surgery at Innsbruck Medical University in Austria. Prior to his arrival at the University of Maryland, he worked at this institution as an attending surgeon and associate professor. Dr. Bonatti’s main interest is the development of minimally invasive, totally endoscopic coronary artery bypass grafting (TECAB) procedures using robotic technology.

As one of the international leaders in this field, he performed the largest series of robotic TECAB on the arrested heart, including single-, double- and triple-vessel TECAB. He has published significantly on procedure development and the implementation process of completely endoscopic coronary surgery using the da Vinci robotic system. Together with colleagues from interventional cardiology, Dr. Bonatti is working on integrated concepts for treatment of coronary artery disease. He was the first to perform a simultaneous hybrid coronary intervention using TECAB and placement of a coronary stent. He is organizing international meetings on hybrid interventions in cardiovascular medicine (http://www.icrworkshop.com). He has trained heart surgeons from around the world in the use of the da Vinci robot for heart surgery and he has introduced TECAB procedures in Austria, the Czech Republic, Greece, Turkey, India and Australia.

John G. Byrne, M.D., is the William S. Stoney Professor of Cardiac Surgery at Vanderbilt University School of Medicine and chair of the department of cardiac surgery at Vanderbilt Medical Center, Nashville, TN.

Before moving to Vanderbilt, he was associate chief and residency program director in the division of cardiac surgery at Brigham and Women’s Hospital, and associate professor of surgery at Harvard Medical School, Cambridge, MA. A graduate of the University of California, Davis, he received his medical degree in 1987 from Boston University. His postdoctoral training was completed at the University of Illinois affiliated hospitals and Brigham and Women’s Hospital in Boston.

Dr. Byrne is the author of more than 100 scientific articles on cardiac surgery and related areas. His patient care emphasis is

  • aortic root surgery,
  • coronary artery disease and
  • valve surgery

He is board-certified in general surgery and thoracic surgery.

John P. Cheatham, M.D., is director of cardiac catheterization and interventional therapy and codirector of The Heart Center at Nationwide Children’s Hospital, Columbus, Ohio. He is also the George H. Dunlap Endowed Chair in Interventional Cardiology and professor of pediatrics and internal medicine at The Ohio State University College of Medicine. Dr. Cheatham’s area of expertise is transcatheter intervention and hybrid therapy of newborns, children and adults with complex congenital heart disease. He has pioneered several new techniques and devices in non-surgical intervention and is a leader in developing hybrid therapies. He has been a principal investigator in numerous FDA-sponsored clinical trials evaluating non-surgical closure devices and stent therapy over the past two decades. Additionally, Dr. Cheatham designed the first hybrid cardiac catheterization suites and advanced imaging equipment at Nationwide Children’s Hospital. He serves as a consultant to various medical companies and proctors new transcatheter techniques and devices to other physicians around the world. Dr. Cheatham has implemented a formal physician exchange program with two of the leading medical institutions in China. In cooperation with China Red Cross, he is also the foreign director of the International Training Center for treatment of congenital heart disease in poor children. Dr. Cheatham has written more than 120 manuscripts, 16 book chapters, 300 national and international presentations and is co-editor of the book, Complications in Percutaneous Interventions for Congenital and Structural Heart Disease. After graduating from the University of Oklahoma College of Medicine, he completed his residency at Boston Children’s Hospital, followed by a fellowship in Pediatric Cardiology at Texas Children’s Hospital in Houston.

W. Randolph Chitwood, Jr., M.D., is senior associate vice chancellor for health sciences and chief of cardiovascular services at East Carolina University Department of Surgery, Greenville, N.C. Dr. Chitwood is a leading international pioneer in minimally invasive and robotic heart surgery. The Robotic Surgical Center at East Carolina University has trained more than 350 surgeons. His research activities relate to myocardial preservation, simulation in surgery and endoscopic/robotic cardiac surgery. He was the principal investigator of the FDA robotic mitral valve trials that led to approval for use in the U.S. He is the son and grandson of “southwestern Virginia mountain doctors” who set the guidelines for his professional life. He graduated from Hampden-Sydney College and received his medical degree from the University of Virginia. After medical school, he completed the surgical residency at Duke University Medical Center under David C. Sabiston, M.D., an influential surgical educator of the era. At Duke he spent 10 years training in general and cardiothoracic surgery, as well as basic science research.

After his chief residency at Duke in 1984, he was selected to begin and head the new cardiac surgery program at the East Carolina University School of Medicine. Because of his prolific publication record as a resident and clinical acumen, his initial appointment was as a full professor of surgery. Except for a two-year hiatus as the chief of cardiothoracic surgery at the University of Kentucky, he has spent his entire career at East Carolina University, where he also served as chairman of the department of surgery. In 2003, he was named to be in charge of the development of the East Carolina Heart Institute, which now includes an integrated department of cardiovascular sciences as well as a $200 million heart hospital, outpatient, research and education center.

Larry S. Dean, M.D., is director of the University of Washington Medicine Regional Heart Center and is professor of medicine and of surgery at the University of Washington School of Medicine, Seattle. In addition to general cardiology, he is an expert in cardiac catheterization and interventional cardiology. He also conducts research on stents to keep blocked heart arteries open and on ways to prevent restenosis after stents are inserted. He is currently involved in the evaluation of percutaneous aortic valve replacement. Dr. Dean earned his M.D. from the University of Alabama School of Medicine, Birmingham, and served his internship and residency at the University of Washington. He then returned to the University of Alabama Hospital for fellowships in cardiovascular disease and in angioplasty. After nearly 15 years as a faculty member at the University of Alabama, he returned to the University of Washington to direct the Regional Heart Center. He is a fellow of the American College of Cardiology and is board-certified in internal medicine, cardiovascular disease and interventional cardiology. He is also a fellow of the American Heart Association and president-elect of the Society of Cardiovascular Angiography and Interventions.

Andrew Craig Eisenhauer, M.D., is director of the interventional cardiovascular medicine service at Brigham and Women’s Hospital and assistant professor of medicine at Harvard Medical School. His specialties are

  • interventional cardiology,
  • vascular medicine and
  • congenital and inherited diseases.

He earned his medical degree at New York University School of Medicine and served a residency at Peter Bent Brigham Hospital and a fellowship at Massachusetts General Hospital. He is certified in internal medicine, cardiovascular disease and interventional cardiology. His clinical interests are

  • endovascular therapy,
  • complex coronary disease,
  • peripheral vascular disease,
  • cerebrovascular disease,
  • congenital heart disease and structural heart disease

Douglas A. Murphy, M.D., is chief of cardiothoracic surgery at Saint Joseph’s Hospital and a cardiothoracic surgeon at Peachtree Cardiovascular and Thoracic Surgery, Atlanta. His areas of interest are robotically assisted heart surgery with an emphasis on repairing the mitral valve rather than replacing it. A graduate of the University of Pennsylvania Medical School, Philadelphia, he served an internship and residency at Massachusetts General Hospital, Boston, and at Emory University, Atlanta.

Khusrow Niazi, M.D., is an assistant professor at Emory University School of Medicine and director of peripheral and carotid intervention at Emory University Hospital Midtown, Atlanta. He earned his medical degree at King Edward Medical College, Lahore, Pakistan, and served an internship at Kettering Medical Center, Dayton, Ohio, and a fellowship at William Beaumont Hospital, Royal Oak, MI. He has published papers on stenting following rotational atherectomy, small vessel stenting for coronary arteries, imaging of lower extremities and treatment of peripheral arterial disease.

Jeffrey J. Popma, M.D., is director of innovations in interventional cardiology, a senior attending physician at Beth Israel Deaconess Medical Center and an associate professor of medicine at Harvard Medical School in Boston. Dr. Popma received his bachelor’s degree in economics from Stanford University, and his M.D. from Indiana University School of Medicine. He completed his internship, residency, chief residency and fellowship at University of Texas Southwestern Medical Center. He also completed an interventional cardiology fellowship at the University of Michigan. Dr. Popma is the past president of the Society for Cardiac Angiography and Intervention and is the co-chair of the ACC Interventional Council. He sits on the editorial boards of several publications, and reviews for several cardiology periodicals. Dr. Popma has more than 300 published peer-reviewed manuscripts.

Dr. Popma also directs the BIDMC Angiographic Core Laboratory and is principal investigator for more than 65 ongoing multicenter device studies within the research laboratory. Over the past 15 years, these trials have included a broad array of new technology, including bare-metal stents, drug-eluting stents, distal-protection devices, total-occlusion devices and carotid and peripheral revascularization procedures. His primary clinical interest currently is the use of percutaneous aortic valve replacement for patients with high-risk aortic stenosis.

Robert S. Poston, M.D., is chief of cardiac surgery at Boston Medical Center and associate professor of cardiothoracic surgery at Boston University School of Medicine. He has a strong background in minimally invasive cardiac bypass surgery and is a pioneer in using robotics, specifically the da Vinci Surgical System, to treat coronary artery disease. A graduate of the Johns Hopkins School of Medicine, Baltimore, Dr. Poston completed a residency in general surgery at the University of California, San Francisco, and continued his training with a research fellowship in cardiothoracic surgery at Stanford University School of Medicine, Palo Alto, CA, and a cardiothoracic residency at the University of Pittsburgh Medical Center.

Charanjit S. Rihal, M.D., is professor of medicine and director of the cardiac catheterization laboratory at Mayo Graduate School of Medicine, Mayo Clinic, Rochester, MN. A graduate of the University of Winnipeg, Dr. Rihal did his residency and fellowship at the Mayo Graduate School of Medicine and also earned an MBA at the Carlson School of Management, University of Minnesota. His medical interests are interventional cardiology, structural heart disease interventions and the management of quality and costs in healthcare.

Timothy A. Shapiro, M.D., is director of the Interventional Cardiology Fellowship Program and campus chief, interventional cardiology, at Lankenau Hospital, Lancaster, PA. A graduate of Yale University School of Medicine, he served his residency and a fellowship at the Hospital of the University of Pennsylvania.

Robert J. Siegel, M.D., is director of the Cardiac Non-Invasive Laboratory at Cedars-Sinai Medical Center, cardiology director of the Cedars-Sinai Marfan Center, and Rexford S. Kennamer, M.D., chair in cardiac ultrasound at Cedars-Sinai Medical Center, Los Angeles. Dr. Siegel is also professor of medicine in residence at the David Geffen School of Medicine at University of California, Los Angeles. He previously served as senior staff fellow in cardiac pathology at the Heart, Lung and Blood Institute of the National Institutes of Health, Bethesda, MD. Internationally recognized as one of the leading experts in the field of cardiovascular ultrasound, Dr. Siegel specializes in cardiovascular ultrasound, including transthoracic, transesophageal and intravascular methodologies. His research interests include

  • valvular heart disease,
  • therapeutic applications of ultrasound energy,
  • transesophageal and intraoperative echocardiography, and the
  • development and use of hand-held portable echocardiographic systems for clinical innovations.

In addition, he is involved with clinical research studies related to the diagnosis, assessment and management of patients with

  • Marfan syndrome,
  • hypertrophic cardiomyopathy and
  • pericardial and valvular heart disease.

Dr. Siegel is a fellow, and has previously served as the president of the California Chapter of the American College of Cardiology and president of the Los Angeles Society of Echocardiography. He has been active in numerous cardiovascular societies, including the American Heart Association, the American College of Cardiology and the American Society of Echocardiography. Dr. Siegel received his medical degree at Baylor College of Medicine, Houston, where he developed an interest in cardiology. He completed his medical residency at Emory University and at Los Angeles County + USC Medical Center. He completed his cardiology fellowship at Harbor-UCLA Medical Center.

Over the last two years Dr. Siegel has worked extensively with live 3D transesophageal echo in the cardiac intervention center and the operating room. He and his echocardiologist colleagues, doctors Shiota, Biner, Tolstrup and Gurudevan, have worked closely at Cedars-Sinai Medical Center in Los Angeles with the interventional cardiologists, doctors Kar and Makkar, as well as with the cardiac surgeons, doctors Trento and Fontana. They use live 3D TEE extensively for the assessment of structural heart disease. In addition, it is used on a regular basis for the guidance of percutaneous procedures for mitral valve e-clip repair, mitral balloon valvuloplasty, aortic and pulmonic valve replacement, left atrial appendage exclusion by the Watchman device as well as for ASD closure.

Sudhir P. Srivastava, M.D., president of the International College of Robotic Surgery at St. Joseph’s Hospital, Atlanta, is a pioneer in performing beating heart totally endoscopic coronary artery bypass surgeries. Previously, he was assistant professor of surgery and director of robotic and minimally invasive cardiac surgery at the University of Chicago Medical Center. Dr. Srivastava specializes in robotically assisted totally endoscopic coronary artery bypass surgery. He has performed approximately 1,000 robotic cardiothoracic surgical procedures, of which 450  have been single- and multivessel beating heart totally endoscopic coronary bypass (BH TECAB) procedures. He has keen interest in hybrid coronary revascularization in TECAB patients to achieve complete revascularization.

Dr. Srivastava has helped launch robotic revascularization programs throughout the world. He has performed numerous live BH TECAB demonstrations both in the U.S. and abroad, and continues to be a presenter and invited speaker at numerous national and international scientific meetings. He earned his medical degree at the Jawahar Lal Nehru Medical College in Ajmer, India and immigrated to the U.S. in 1972. He completed his cardiothoracic surgery residency at the hospitals associated with the University of British Columbia, Vancouver, Canada.

Francis P. Sutter, D.O., F.A.C.S., is clinical professor of surgery at Thomas Jefferson University-Jefferson Medical College, Philadelphia, and chief of cardiothoracic surgery at Lankenau Hospital, Main Line Health System, Wynnewood, PA. A graduate of Philadelphia College of Osteopathic Medicine, his surgical residency and a cardiothoracic fellowship were completed at Thomas Jefferson University Hospital.

Mark R. Vesely, M.D., is an assistant professor of medicine at the University of Maryland School of Medicine. He completed medical school at the George Washington University and postgraduate training—an internal medicine residency and fellowships in cardiovascular disease and interventional cardiology—at the University of Maryland. He is board-certified in internal medicine, cardiovascular disease, nuclear cardiology and interventional cardiology. Dr. Vesely is the associate program director of the Interventional Cardiology fellowship at University of Maryland. His special interests include the partnered approach (interventional cardiologists and cardiac surgeons) for hybrid coronary revascularization and structural heart disease interventions. Additional research interests include investigation of techniques to minimize acute myocardial infarction injury with ventricular-assist devices and adult stem cell therapies.

David X. M. Zhao, M.D., Ph.D., is an associate professor of medicine and cardiac surgery, Harry and Shelley Page Chair in Interventional Cardiology, director of the Cardiac Catheterization Laboratories and interventional cardiology director of the Interventional Cardiology Fellowship Training Program, Vanderbilt University School of Medicine, Nashville, TN. He earned his medical degree at Shanghai Medical University, Shanghai, P.R. China, and his Ph.D. in immunology at Queensland University, Brisbane, Australia. His postdoctoral training was at Zhongshan Hospital, Shanghai Medical University, Shanghai, P.R. China, The Prince Charles Hospital, Brisbane, Australia, and Brigham and Women’s Hospital, Boston.

http://www.expo.acc.org/acc12/CUSTOM/images/ACC12/ACC.10%20Hybrid%20Suite%20Directory.pdf

Part Two

Cardiac Surgery

 

Cardiac Surgery @ Cleveland Clinic: Traditional OR & Hybrid Cath Lab/OR Suite

Nation #1 for 19 consecutive years – The Heart Center: Miller Family Heart & Vascular Institute @ Cleveland Clinic

The Sydell and Arnold Miller Family Heart & Vascular Institute is one of the largest, most experienced cardiovascular specialty groups in the world. Our physicians are committed to providing the most advanced diagnostic and treatment options, better outcomes and improved quality of life. U.S.News & World Reporthas ranked Cleveland Clinic as the No.1 heart program in America every year since 1995.

Departments & Centers:

Below we present two articles on Cardiac Surgery @ Mayo Clinic 

Cardiac Surgery @ Mayo Clinic: Traditional OR & Hybrid Cath Lab/OR Suite 

Coronary Reperfusion Therapies: CABG vs PCI – Mayo Clinic preprocedure Risk Score (MCRS) for Prediction of in-Hospital Mortality after CABG or PCI

Larry H. Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Comparison of the 10-year and 15-year survivals after CABG demonstrated benefit from a change in graft sources used at the Mayo Clinic and widely adapted by others: vascular grafts from the left internal mammary artery (LIMA) instead of just leg veins, for multiple grafts (up to 3), LIMA-to-LAD plus grafts using LIMA or radial artery vs LIMA/saphenous vein (SV).

CABG Survival in Multivessel Disease Patients: Comparison of Arterial Bypass Grafts vs Saphenous Venous Grafts

Larry H. Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part Three 

Invasive Interventions with Complications

In the following article we covered multiple etiologies for cardiovascular complications related to invasive interventions: cardiovascular and peripheral arterial or peri- and post- cardiac surgery of the open heart type.

Cardiovascular Complications: Death from Reoperative Sternotomy after prior CABG, MVR, AVR, or Radiation; Complications of PCI; Sepsis from Cardiovascular Interventions

Justin D Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/07/23/cardiovascular-complications-of-multiple-etiologies-repeat-sternotomy-post-cabg-or-avr-post-pci-pad-endoscopy-andor-resultant-of-systemic-sepsis/

This article covers types of Cardiovascular Complications derived from the following THREE types of assault on the Human body, two related to cardiac invasive interventions, the last due to its systemic nature is taking a fatal Cardiac toll: the Sepsis condition causing cardiac failure.

Three types of Cardiovascular Complications:

I. Risk of Injury During Repeat Sternotomy – following CABG orAortic Valve Replacement, both done in Open Heart Surgery

II. Complications After Percutaneous Coronary intervention (PCI) and endovascular surgery for Peripheral Artery Disease (PAD)

  • (a) Post PCI, and
  • (b) PAD Endovascular Interventions: Carotid Artery Endarterectomy

III. Cardiac Failure During Systemic Sepsis

This article does NOT cover the following two types of Cardiovascular Complications:

1. Trauma Injury causing cardiac arrest, lung collapse or cardiogenic shock

2. Surgical Complication of Non-cardiac surgery type causing cardiac arrest, i.e, Surgery of Joint Replacement causing sepsis causing death or death caused by complications of surgery i.e., blood loss, viral infection, emboli, thrombus, stroke, or cardiogenic shock not related to Cardiovascular and Cardiac invasive interventions

The e-Reader is advised to consider the following expansion on the subject matter carrying the discussion to additional related clinical issues:

Larry H Bernstein, Advanced Topics in Sepsis and the Cardiovascular System at its End Stage

http://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-sepsis-and-the-cardiovascular-system-at-its-end-stage/

Bernstein, HL, Pearlman, JD and A. Lev-Ari  Alternative Designs for the Human Artificial Heart: The Patients in Heart Failure – Outcomes of Transplant (donor)/Implantation (artificial) and Monitoring Technologies for the Transplant/Implant Patient in the Community

http://pharmaceuticalintelligence.com/2013/08/05/alternative-designs-for-the-human-artificial-heart-the-patients-in-heart-failure-outcomes-of-transplant-donorimplantation-artificial-and-monitoring-technologies-for-the-transplantimplant-pat/

Pearlman, JD and A. Lev-Ari Cardiac Resynchronization Therapy (CRT) to Arrhythmias: Pacemaker/Implantable Cardioverter Defibrillator (ICD) Insertion

http://pharmaceuticalintelligence.com/2013/07/22/cardiac-resynchronization-therapy-crt-to-arrhythmias-pacemakerimplantable-cardioverter-defibrillator-icd-insertion/

Read Full Post »

AHA, ACC Change in Requirement for Surgical Support for PCI Performance: Class IIb -> Class III, Level of Evidence A: Support Nonemergent PCI without Surgical Backup (Change of class IIb, Level of evidence B).

Posted in Biomedical Measurement Science, Cardiac & Vascular Repair Tools Subsegment, Cardiac and Cardiovascular Surgical Procedures, Ecosystems & Industrial Concentration in the Medical Device Sector, FDA Regulatory Affairs, FDA, CE Mark & Global Regulatory Affairs: process management and strategic planning - GCP, GLP, ISO 14155, Frontiers in Cardiology and Cardiovascular Disorders, Health Law & Patient Safety, Interviews with Scientific Leaders, ISO 10993 for Product Registration: FDA & CE Mark for Development of Medical Devices and Diagnostics, Massachusetts Niche Suppliers and National Leaders, Medical Devices R&D and Inventions, Medical Devices R&D Investment, Medical Imaging Technology, Image Processing/Computing, MRI, CT, Nuclear Medicine, Ultra Sound, Origins of Cardiovascular Disease, PCI, Regulated Clinical Trials: Design, Methods, Components and IRB related issues, Statistical Methods for Research Evaluation, Stents & Tools, tagged , , , , , , , , , , on July 17, 2013| 2 Comments »

AHA, ACC Change in Requirement for Surgical Support:  Class IIb -> Class III, Level of Evidence A: Supports Nonemergent PCI without Surgical Backup (Change of class IIb, Level of Evidence B).

Larry H Bernstein, MD, FCAP, Author, Curator, Volumes 1,2,3,4,5,6 Co-Editor and Author, Volume Two & Five, Co-Editor and Justin Pearlman, MD, PhD, FACC, Content Consultant to Six-Volume e-SERIES A: Cardiovascular Diseases

Article ID #68: AHA, ACC Change in Requirement for Surgical Support for PCI Performance: Class IIb -> Class III, Level of Evidence A: Support Nonemergent PCI without Surgical Backup (Change of class IIb, Level of evidence B). Published on 7/17/2013

WordCloud Image Produced by Adam Tubman

 

Voice of content consultant: Justin Pearlman, MD, PhD, FACC

The American Heart Association (AHA) and the American College of Cardiology (ACC) have convened teams of experts to summarize evidence and opinion regarding a wide range of decisions relevant to cardiovascular disease. The system accounts for some of the short comings of “evidence based medicine” by allowing for expert opinion in areas where evidence is not sufficient. The main argument for evidence-based medicine is the existence of surprises, where a plausible decision does not actually appear to work as desired when it is tested. A major problem with adhesion to evidence based medicine is that it can impede adaptation to individual needs (we are all genetically and socially/environmentally unique) and impede innovation. Large studies carry statistical weight but do not necessary consider all relevant factors. Commonly, the AFFIRM trial is interpreted as support that rate control suffices for most atrial fibrillation (AFIB), but half of those randomized to rhythm control were taken off anticoagulation without teaching patients to check their pulse daily for recurrence of AFIB. Thus the endorsed “evidence” may have more to do with the benefits of anticoagulation for both persisting and recurring AFIB and rhythm control may yet prove better than rate control. However, with wide acceptance of a particular conclusion, randomizing to another treatment may be deemed unethical, or may simply not get a large trial due to lack of economic incentive, leaving only the large trial products as the endorsed options. A medication without patent protection, such as bismuth salts for H Pylori infection, lacks financial backing for large trials.

The American Heart Association Evidence-Based Scoring System
Classification of Recommendations

● Class I: Conditions for which there is evidence, general

agreement, or both that a given procedure or treatment is

useful and effective.

● Class II: Conditions for which there is conflicting evidence,

a divergence of opinion, or both about the usefulness/

efficacy of a procedure or treatment.

● Class IIa: Weight of evidence/opinion is in favor of

usefulness/efficacy.

● Class IIb: Usefulness/efficacy is less well established by

evidence/opinion.

● Class III: Conditions for which there is evidence, general

agreement, or both that the procedure/treatment is not useful/

effective and in some cases may be harmful.

Level of Evidence

● Level of Evidence A: Data derived from multiple randomized

clinical trials

● Level of Evidence B: Data derived from a single randomized

trial or nonrandomized studies

● Level of Evidence C: Consensus opinion of experts

Circulation 2006 114: 1761 – 1791.

Assessment of Coronary Artery Disease by Cardiac Computed Tomography

A Scientific Statement From the American Heart Association Committee on Cardiovascular Imaging and Intervention, Council on Cardiovascular Radiology and Intervention, and Committee on Cardiac Imaging, Council on Clinical Cardiology

Reported by Chris Kaiser, Cardiology Editor, MedPage  7/2013  

 

Action Points

  1. Patients with indications for nonemergency PCI who presented at hospitals without on-site cardiac surgery, were randomly assigned to undergo PCI at a hospital without on-site cardiac surgery or at a hospital with on-site cardiac surgery.
  2. The rates of death, myocardial infarction, repeat revascularization, and stroke did not differ significantly between the groups.
  3. Community hospitals without surgical services can safely perform percutaneous coronary intervention (PCI) in low-risk patients — and not refuse higher-risk patients either, the MASS COMM trial found.

Summary

  • The co-primary endpoint of major adverse cardiac events (MACE) at 30 days occurred at a rate of 9.5% in the 10 hospitals without surgical backup versus 9.4% in the seven hospitals with onsite surgery (P<0.001 for noninferiority), Alice K. Jacobs, MD, of Boston University School of Medicine, and colleagues found.
  • The other co-primary endpoint of MACE at 12 months was also significant, occurring in 17.3% of patients in hospitals without backup versus 17.8% in centers with surgical services (P<0.001 for non-inferiority), they reported in the study published online by the New England Journal of Medicine. The findings were also reported at the American College of Cardiology meeting.

Study Characteristics and Results

Primary Endpoints

  1. death
  2. myocardial infarction
  3. repeat revascularization
  4. stroke
no significant differences between the two groups at 30 days and at 12 months.

Rate of stent thrombosis at 30 days

similar in both groups (0.6% versus 0.8%) and at 12 months (1.1% versus 2.1%).
Jacobs and colleagues noted that the 2011 PCI guidelines lacked evidence to fully support nonemergent PCI without surgical backup (class IIb, level of evidence B).

CPORT – E trial

Even though those guidelines came out before the results of the CPORT-E trial were published, CPORT-E trial showed similar non-inferiority at 9 months between centers that perform PCI with or without surgical backup in a cohort of nearly 19,000 non-emergent patients. The CPORT-E results were published in the March 2012 issue of the New England Journal of Medicine, and in May three cardiology organizations published an update to cath lab standards allowing for PCI without surgical.

 MASS COMM study

To further the evidence, Jacobs and colleagues in 2006  had designed and carried out the Randomized Trial to Compare Percutaneous Coronary Intervention between Massachusetts Hospitals with Cardiac Surgery On-Site and Community Hospitals without Cardiac Surgery On-Site (MASS COMM) in collaboration with the Massachusetts Department of Public Health who collaborated to obtain “evidence on which to base regulatory policy decisions about performing non-emergent PCI in hospitals without on-site cardiac surgery.”

  • Hospitals without backup surgery were required to perform at least 300 diagnostic catheterizations per year, and operators were mandated to have performed a minimum of 75 PCI procedures per year.
  • The researchers randomized 3,691 patients to each arm in a 3:1 ratio (without/with backup). The median follow-up was about 1 year.
  • The median age of patients was 64, one-third were women, and 92% were white. Both groups had similar median ejection fractions at baseline (55%).
  • The mean number of vessels treated was 1.17 and most patients (84%) had one vessel treated. The mean number of lesions treated was 1.45 and most patients (67%) had one lesion treated.

The indications for PCI were:

1. ST-segment elevated MI (>72 hours before PCI of infarct-related or non–infarct-related artery — 19% and 17%
2. Unstable angina — 45% and 47%
3. Stable angina — 27% and 28%
4. Silent ischemia — 5% and 6%
5. Other — 2.5% and 2.8%
Regarding secondary endpoints, both groups had similar rates of emergency CABG and urgent or emergent PCI at 30 days. Results at 30 days and 12 months were similar for rates of ischemia-driven target-vessel revascularization and target-lesion revascularization. Other endpoints as well were similar at both time points, including
  • all-cause death
  • repeat revascularization
  • stroke
  • definite or probable stent thrombosis
  • major vascular complications
Researchers adjusted for a 1.3 greater chance of MACE occurring at a randomly selected hospital compared with another randomly selected hospital and found
  • the relative risks at 30 days and 12 months “were consistent with those of the primary results” (RR 1.02 and 0.98, respectively).

However, they cautioned that new sites perhaps should be monitored as they gain experience.

A prespecified angiographic review of 376 patients who were in the PCI-without-backup arm and 87 in the other arm showed no differences in
  1. rates of procedural success,
  2. proportion with complete revascularization, or
  3. the proportion of guideline-indicated appropriate lesions for PCI.
Such results show consistent practice patterns between the groups, they noted.
The study had several limitations including the
  • loss of data for 13% of patients, the
  • exclusion of some patients for certain clinical and anatomical features, and
  • not having the power to detect non-inferiority in the separate components of the primary endpoint, researchers wrote.

Cardio Notes: Score Predicts PCI Readmission

Published: Jul 15, 2013

By Chris Kaiser, Cardiology Editor, MedPage Today
  

A simple calculation of patient variables before PCI may help stem the tide of readmission within the first month. Also this week, two blood pressure drugs that benefit diabetics and imaging cardiac sympathetic innervation.

Pre-PCI Factors Predict Return Trip

A new 30-day readmission risk prediction model for patients undergoing percutaneous coronary intervention (PCI) showed it’s possible to predict risk using only variables known before PCI, according to a study published online in Circulation: Cardiovascular Quality and Outcomes.

After multivariable adjustment, the 10 pre-PCI variables that predicted 30-day readmission were older age (mean age 68 in this study), female sex, insurance type (Medicare, state, or unknown), GFR category (less than 30 and 30-60 mL/min per 1.73m2), current or history of heart failure, chronic lung disease, peripheral vascular disease, cardiogenic shock at presentation, admit source (acute and non-acute care facility or emergency department), and previous coronary artery bypass graft surgery.

Additional significant variables post-discharge that predicted 30-day readmission were beta-blocker prescribed at discharge, post-PCI vascular or bleeding complications, discharge location, African American race, diabetes status and modality of treatment, any drug-eluting stent during the index procedure, and extended length of stay.

A risk score calculator using the pre-PCI variables will be available online soon, according to Robert W. Yeh, MD, MSc, of Massachusetts General Hospital in Boston, and colleagues.

RELATED ARTICLES
English: Patient Positioning for a Left Anteri...

English: Patient Positioning for a Left Anterior Thoracotomy (Photo credit: Wikipedia)

A coronary angiogram that shows the LMCA, LAD ...

A coronary angiogram that shows the LMCA, LAD and LCX. (Photo credit: Wikipedia)

Read Full Post »

« Newer Posts - Older Posts »