Feeds:
Posts
Comments

Archive for the ‘BioSimilars’ Category

Breaching Drug Disclosure on Tresiba been refused U.S. approval – Novo Nordisk A/S (NVO) Reported To Police

Reporter: Aviva Lev-Ari, PhD, RN

SOURCE

http://www.biospace.com/news_story.aspx?NewsEntityId=318189&type=email&source=GP_121013

Novo Nordisk A/S (NVO) Reported To Police For Breaching Drug Disclosure Rules

12/10/2013 7:32:19 AM

Novo Nordisk, the world’s largest insulin maker, is facing a Danish police probe after it was reported by the financial watchdog for not disclosing at once that its big new product hope Tresiba had been refused U.S. approval.

Although the probe is unlikely to have a serious financial impact on the company, the largest by market value in the Nordic region, it may tarnish its reputation and could leave it open to lawsuits from investors in the United States, where its shares also trade.

The Danish Financial Supervisory Authority (FSA) said on Tuesday Novo should have issued a statement about the U.S. decision not to approve Tresiba, its new long-acting insulin, on the evening of Friday, February 8 instead of waiting until Sunday, February 10.

 

Read Full Post »

Liver Toxicity halts Clinical Trial of IAP Antagonist for Advanced Solid Tumors

Curator: Stephen J. Williams, Ph.D.

UPDATED 8/12/2022

Athough not related to IAP Antagonists this update does report 2 deaths from IDILI or idiosynchratic drug induced liver injury from a gene therapy trial using an AAV (adeno associated virus) targeting the disease spinal muscular atrophy.  Please see below after reading about IDILI.

 

A recent press release on FierceBiotech reported the FDA had put a halt on a phase 1 study for advanced refractory solid tumors and lymphomas of Curis Inc. oral inhibitor of apoptosis (IAP) antagonist CUDC-427.  The FDA placed the trial on partial clinical hold following reports of a death of a patient from severe liver failure.  The single-agent, dose escalation Phase 1 study was designed to determine the maximum tolerated dose and recommended doses for a Phase 2 trial. The press release can be found at:

http://www.fiercebiotech.com/press-releases/curis-reports-third-quarter-2013-financial-results-and-provides-cudc-427-de.

According to the report one patient with breast cancer that had metastasized to liver, lungs, bone, and ovaries developed severe hepatotoxicity as evidenced by elevated serum transaminase activities (AST and ALT) and hyper-billirubinemia.  Serum liver enzyme activities did not attenuate upon discontinuation of CUDC-427.  This was unlike prior experience to the CUDC-427 drug, in which decreased hepatic function was reversed upon drug discontinuation.  The patient died from liver failure one month after discontinuation of CUDC-427.

It was noted that no other patient had experienced such a serious, irreversible liver dysfunction.

Although any incidence of hepatotoxicity can be cause for concern, the incidence of IDIOSYNCRATIC IRREVERSIBLE HEPATOTOXICITY warrants a higher scrutiny.

Four general concepts can explain toxicity profiles and divergences between individuals:

  1. Toxicogenomics: Small differences in the genetic makeup between individuals (such as polymorphisms (SNP) could result in differences in toxicity profile for a drug.  This ais a serious possibility as only one patient presented with such irreversible liver damage
  2. Toxicodynamics:  The toxicologic effect is an extension of the pharmacologic mechanism of action (or  lack thereof: could there have been alternate signaling pathways activated in this patient or noncanonical mechanism)
  3. Toxicokinetic:  The differences in toxicological response due to differences in absorption, distribution, metabolism, excretion etc. (kinetic parameters)
  4. Idiosyncratic: etiology is unknown; usually a minority of adverse effects

 

Since there is not enough information to investigate toxicogenomic or toxicokinetic mechanisms for this compound, the rest of this post will investigate the possible mechanisms of hepatotoxicity due to IAP antagonists and clues from other clinical trials which might shed light on a mechanism of toxicity (toxicodynamic) or idiosyncratic events.

Therefore this post curates the current understanding of drug-induced liver injury (DILI), especially focusing on a type of liver injury referred to as idiosyncratic drug-induced liver injury (IDILI) in the context of:

  1. Targeted and newer chemotherapies such as IAP antagonists
  2. Current concepts of mechanisms of IDILI including:

i)        Inflammatory responses provoked by presence of disease

ii)      Cellular stresses, provoked by disease, uncovering NONCANONICAL toxicity pathways

iii)    Pharmacogenomics risk factors of IDILI

Eventually this post aims to stimulate the discussion: 

  • Given inflammation, genetic risk factors, and cellular stresses (seen in clinical setting) have been implicated in idiosyncratic drug-induced liver injury from targeted therapies, should preclinical hepatotoxicity studies also be conducted in the presence of the metastatic disease?
  • Does inflammation and cellular stress from clinical disease unmask NONCANONICAL pharmacologic and/or toxicological mechanisms of action?

Classification of types of Cellular Liver injury:  A listing of types of cellular injury is given for review

I.     Hepatic damage after Acute Exposure

A. Cytotoxic (Necrotic):  irreversible cell death characterized by loss of cell membrane integrity, intracellular swelling, nuclear shrinkage (pyknosis) and eventual cytoplasmic breakdown of nuclear DNA (either by a process known as karyolysis or karyorhexus) localized inflammation as a result of release of cellular constituents.  Intracellular ATP levels are commonly seen in necrotic death.  Necrosis, unlike apoptosis, does not require a source of ATP.  A nice review by Yoshihide Tsujimoto describing and showing (by microscopy) the  differences between apoptosis and necrosis can be found here.

B. Cholestatic:  hepatobiliary dysfunction with bile stasis and accumulation of bile salts.  Cholestatic injury can result in lipid (particularly cholesterol) accumulation in cannicular membranes resulting in decreased permeability of the membrane, hyperbillirubinemia and is generally thought to result in metabolic defects.

C. Lipid Peroxidation: free radical generation producing peroxide of cellular lipids, generally resulting in a cytotoxic cell death

II.     Hepatic damage after Chronic Exposure

A. Chirrotic: Chronic morphologic alteration of the liver characterized by the presence of septae of collagen distributed throughout the major portion of the liver; Forms fibrous sheaths altering hepatic blood flow, resulting in a necrotic process with scar tissue; Alteration of hepatic metabolic systems.

B. Carcinogenesis

III. Idiosyncratic Drug Induced Liver Injury

The aforementioned mechanisms of hepatotoxicity are commonly referred to as the “intrinsic” (or end target-organ) toxicity mechanisms.  Idiosyncratic drug-induced liver injury (IDILI) is not well understood but can be separated into allergic and nonallergic reactions.  Although the risk of acute liver failure associated with idiosyncratic hepatotoxins is low (about 1 in ten thousand patients) there are more than 1,000 drugs and herbal products associated with this type of toxic reaction. Idiosyncratic drug induced liver failure usually gets a black box warning from the FDA. Idiosyncratic drug-induced liver injury differs from “intrinsic” toxicity in that IDILI:

  • Happens in a minority of patients (susceptible patients)
  • Not reproducible in animal models
  • Not dose-dependent
  • Variable time of onset
  • Variable liver pathology (not distinctive lesions)
  • Not related to drug’s pharmacologic mechanism of action (trovafloxacin IDILI vs. levofloxacin)

A great review in Perspectives in Pharmacology written by Robert Roth and Patricia Ganey at Michigan State University explains these differences between intrinsic and idiosyncratic drug-induced hepatotoxicity[1] (however authors do note that there are many similarities between the two mechanisms).    It is felt that drug sensitivity (allergic) and inflammatory responses (nonallergic) may contribute to the occurrence of IDILI.  For instance lipopolysaccharide (LPS) form bacteria can potentiate acetaminophen toxicity.  In fact animal models of IDILI have been somewhat successful:

  • co-treatment of rats and mice with nontoxic doses of trovafloxacin (casues IDILI in humans) and LPS resulted in marked hepatotoxicity while no hepatotoxicity seen with levofloxacin plus LPS[2]
  • correlates well with incidence of human IDILI (adapted from a review Inflammatory Stress and Idiosyncratic Hepatotoxicity: Hints from Animal Models (in Pharmacology Reviews)[3].  Idiosyncratic injury damage has been reported for diclofenac, halothane, and sulinac.  These drugs also show hepatotoxicity in the LPS model for IDILI.
  • Roth and Ganey suggest the reason why idiosyncratic hepatotoxicity is not seen  in most acute animal toxicity studies is that, in absence of stress/inflammation  IDILI occurrence is masked by lethality but stress/inflammation shifts increases sensitivity to liver injury at a point before lethality is seen

IDILdosestressrossmantheory

Figure.  Idiosyncratic toxic responses of the liver.    In the absence of stress and/or genetic factors, drug exposure may result in an idiosyncratic liver injury (IDILI) at a point (or dose) beyond the therapeutic range and lethal exposure for that drug.  Preclinical studies, usually conducted at sublethal doses, would not detect DILI .  Stress and/or genetic factors sensitize the liver to toxic effects of the drug (synergism) and DILI is detected at exposure levels closer to therapeutic range.  Note IDILI is not necessarily dose-dependent but cellular stress (like ROS or inflammation) may expose NONCANONICAL mechanisms of drug action or toxicity which result in IDILI. Model adapted from Roth and Ganey.

What Stress factors contribute to IDILI?

Various stresses including inflammation from bacterial, viral infections ,inflammatory cytokines  and stress from reactive oxygen (ROS) have been suggested as mechanisms for IDILI.

  1. Inflammation/Cytokines (also discussed in other sections of this post):  Inflammation has long been associated with human cases of DILI.    Many cytokines and inflammatory mediators have been implicated including TNFα, IL7, TGFβ, and IFNϒ (viral infection) leading some to conclude that serum measurement of cytokines could be a potential biomarker for DILI[4].  In addition, ROS (see below) is generated from inflammation and also considered a risk factor for DILI[5].
  2. Reactive Oxygen (ROS)/Reactive Metabolites: Oxidative stress, either generated from reactive drug metabolites or from mitochondrial sources, has been shown to be involved in apoptotic and necrotic cell death.  Both alterations in the enzymes involved in the generation of and protection from ROS have been implicated in increased risk to DILI including (as discussed further) alterations in mitochondrial superoxide dismutase 2 (SOD2) and glutathione S-transferases.  Both ROS and inflammatory cytokines can promote JNK signaling, which has been implicated in DILI[6].

Dr. Neil Kaplowitz suggested that we:

“develop a unifying hypothesis that involves underlying genetic or acquired mitochondrial abnormalities as a major determinant of susceptibility for a number of drugs that target mitochondria and cause DILI. The mitochondrial hypothesis, implying gradually accumulating and initially silent mitochondrial injury in heteroplasmic cells which reaches a critical threshold and abruptly triggers liver injury, is consistent with the findings that typically idiosyncratic DILI is delayed (by weeks or months), that increasing age and female gender are risk factors and that these drugs are targeted to the liver and clearly exhibit a mitochondrial hazard in vitro and in vivo. New animal models (e.g., the Sod2(+/-) mouse) provide supporting evidence for this concept. However, genetic analyses of DILI patient samples are needed to ultimately provide the proof-of-concept”[7].

Clin Infect Dis. 2004 Mar 38(Supplement 2) S44-8, Figure 1

Clin Infect Dis. 2004 Mar 38(Supplement 2) S44-8, Figure 3

Figures. Mechanisms of Drug-Induced Liver Injury and Factors related to the occurrence of  DILI (used with permission from Oxford Press; reference [7])

To this end, Dr. Brett Howell and other colleagues at the Hamner-UNC Institute for Drug Safety Sciences (IDSS) developed an in-silico model of DILI ( the DILISym™ model)which is based on  depletion of cellular ATP and reactive metabolite formation as indices of DILI.

Have there been Genetic Risk Factors identified for DILI?

Candidate-gene-associated studies (CGAS) have been able to identify several genetic risk factors for DILI including:

  1. Uridine Diphosphate Glucuronosyltransferase 2B7 (UGT2B7): variant increased susceptibility to diclofenac-induced DILI
  2. Adenosine triphosphate-binding cassette C2 (ABCC2) variant ABCC-24CT increased susceptibility to diclofenac-induced DILI
  3. Glutathione S-transferase (GSTT1): patients with a double GSTT1-GSTM1 null genotype had a significant 2.7 fold increased risk of DILI from nonsteroidal anti-inlammatory agents, troglitazone and tacrine.  GSTs are involved in the detoxification of phase 1 metabolites and also protect against cellular ROS.

Although these CGAS confirmed these genetic risk factors,  Stefan Russman suggests a priori genome-wide association studies (GWAS) might provide a more complete picture of genetic risk factors for DILI as CGAS is limited due to

  1. Candidate genes are selected based on current mechanisms and knowledge of DILI so genetic variants with no known knowledge of or mechanistic information would not be detected
  2. Many CGAS rely on analysis of a limited number of SNP and did not consider intronic regions which may control gene expression

A priori GWAS have the advantage of being hypothesis-free, and although they may produce a high number of false-positives, new studies of genetic risk factors of ximelagatran, flucioxaciliin and diclofenac-induced liver injury are using a hybrid approach which combines the whole genome and unbiased benefits of GWAS with the confirmatory and rational design of CGAS[8-10].

Even though idiosyncratic DILI is rare, the severity, unpredictable onset, and unknown etiology and risk factors have prompted investigators such as Stefan Russmann from University Hospital Zurich and Ignazio Grattagliano from University of Bari to suggest:

Identification of risk factors for rare idiosyncratic hepatotoxicity requires special networks that contribute to data collection and subsequent identification of environmental as well as genetic risk factors for clinical cases of idiosyncratic DILI[11].

Therefore, a DILI network project (DILIN) had been developed to collect samples and detailed genetic and clinical data on IDILI cases from multiple medical centers.  The project aims to identify the upstream and downstream genetic risk factors for IDILI[12].  Please see a SlideShare presentation here of the goals of the DILI network project.

Drs Colin Spraggs and Christine Hunt had reviewed possible genetic risk factors of DILI seen with various tyrosine kinase inhibitors (TKIs) including Lapatinib (Tykerb/Tyverb©, a dual inhibitor of  HER2/EGFR heterodimer) and paopanib (Votrient©; a TKI that targets VEGFR1,2,3 and PDGFRs)[13].

From a compilation of studies:

  • Elevation in serum bilirubin during treatment with lapatinib and pazopanib are associated with UGT1A1 polymorphism related to Gilbert’s syndrome (a clinically benign syndrome)
  • Anecdotal evidence shows that polymorphisms of lapatinib and pazopanib metabolizing enzymes may contribute to differences seen in onset of DILI
  • Pazopanib-induced elevations of ALT correlate with HFE variants, suggesting alterations in iron transport may predispose to DILI
  • Strong correlations between lapatinib-induced DILI and class II HLA locus suggest inflammatory stress response important in DILI

Note that these clinical findings were not evident from the preclinical tox studies. According to the European Medicines Agency assessment report for Tykerb states: “the major findings in repeat dose toxicity studies were attributed to lapatinib pharmacology (epithelial effect in skin and GI system.  The toxic events occurred at exposures close to the human exposure at the recommended dose.  Repeat-dose toxicity studies did not reveal important safety concerns than what would be expected from the mode of action”.

However, it should be noted that in high dose repeat studies in mice and rats, severe lethality was seen with hematologic, gastrointestinal toxicities in combination with altered blood chemistry parameters and yellowing of internal organs.

IAP Antagonists, Mechanism of Action, and Clinical Trials:

A few IAP antagonists which are in early stage development include:

  • Norvatis IAP Inhibitor LCL161: at 2012 San Antonia Breast Cancer Symposium, a phase 1 trial in triple negative breast cancer showed promising results when given in combination with paclitaxel.
  • Ascenta Therapeutics IAP inhibitor AT-406 in phase 1 in collaboration with Debiopharm S.A. showed antitumor efficacy in xenograft models of breast, pancreatic, prostate and lung cancer. The development of this compound is described in a paper by Cai et. al.

National Cancer Institute sponsored trials using antagonists of IAPs include

  • Phase II Study of Birinapant for Advanced Ovarian, Fallopian Tube, and Peritoneal Cancer (NCI-12-C-0191). Principle Investigator: Dr. Christina Annunziata. See the protocol summary. More open trials for this drug are located here.  Closed trials including safety studies can be found here.
  • A Phase 1 non-randomized dose escalation study to determine maximum tolerated dose (MTD) and characterize the safety for the TetraLogic compound TL32711 had just been completed. Results have not been published yet.
  • Closed Clinical trials with the IAP antagonist HGS1029 in advanced solid tumors determined that weekly i.v. administration of HGS1029 reported a safety issue for primary outcome measures

A great review on IAP proteins and their role as regulators of apoptosis and potential targets for cancer therapy [14] can be found as a part of a Special Issue in Experimental Oncology “Apoptosis: Four Decades Later”.  Human IAPs (inhibitors of apoptosis) consist of eight proteins involved in cell death, immunity, inflammation, cell cycle, and migration including:

In general, IAP proteins are directly involved in inhibiting apoptosis by binding and directly inhibiting the effector cysteine protease caspases (caspase 3/7) ultimately responsible for the apoptotic process [15].  IAPs were actually first identified in baculoviral genomes because of their ability to suppress host-cell death responses during viral infection [16]. IAP proteins are often overexpressed in cancers [17].

Apoptosis is separated into two pathways, defined by the initial stress or death signal and the caspases involved:

  1. Extrinsic pathway: initiated by TNFα and death ligand FasLigand;  involves caspase-8; process inhibited by IAP1/2
  2. Intrinsic pathway: initiated by DNA damage, irradiation, chemotherapeutics; mitochondrial pathway involving caspase 9 and cytochrome c release from mitochondria; mitochondria also releases SMAC/DIABLO, which binds and inhibits XIAP (XIAP inhibits the Intrinsic apoptotic pathway.

 intrinsicextrinsicapoptosiswikidot

 

Intrinsic and Extrinsic pathways of apoptosis. Figure photocredit (wikidot.com)

The Curis IAP antagonist (and others) is a SMAC small molecule mimetic. It is interesting to note [18, 19] that IAP antagonists can result in death by

  • Apoptosis: an IAP antagonist in presence of competent TNFα signaling
  • Necrosis: seen with IAP inhibitors in cells with altered TNFα signaling or with presence of caspase inhibitors

IAPs are also involved in the regulation of signaling pathways such as:

NF-ΚB signaling pathway

NF-ΚB is a “rapid-acting” transcription factor which has been found to be overexpressed in various cancers.  Under most circumstances NF-ΚB translocation to the nucleus results in transcription of genes related to cell proliferation and survival.  NF-ΚB signaling is broken down in two pathways

  1. Canonical:  Canonical pathway can be initiated (for example in inflammation) when TNF-α binds its receptors activating  death domains (TRADD)
  2. Noncanonical: since requires new protein synthesis takes longer than canonical signaling.  Can be initiated by other TNF like ligands like CD40

IAP1/2 is a negative regulator of the noncanonical NF-ΚB signaling pathway by promoting proteosomal degradation of the TRAF signaling complex. A wonderfully annotated list of NF-ΚB target genes can be found on the Thomas Gilmore lab site at Boston University at http://www.bu.edu/nf-kb/gene-resources/target-genes/ .

NF-ΚB has been considered a possible target for chemotherapeutic development however Drs. Veronique Baud and Michael Karin have pondered the utility of IAP antagonists as a good target in their review: Is NF-ΚB a good target for cancer therapy?: Hopes and pitfalls [20].  The authors discuss issues such that IAP antagonism induced both the classical and noncanonical NF-ΚB pathway thru NIK stabilization, resulting in stabilization of NF-ΚB signaling and thereby undoing any chemotherapeutic effect which would be desired.

AKT signaling

IAPs have been shown to interact with other proteins including a report that SIAP regulates AKT activity and caspase-3-dependent cleavage during cisplatin-induced apoptosis in human ovarian cancer cells and could be another mechanism involved in cisplatin resistance[21].   In addition there have been reports that IAPs can regulate JNK and MAPK signaling.

Therefore, IAPs are involved in CANONICAL and NONCANONICAL pathways.

IAPs can Regulate Pro-Inflammatory Cytokines

A recent 2013 JBC paper [22]showed that IAPs and their antagonists can regulate spontaneous and TNF-induced proinflammatory cytokine and chemokine production and release

  • IAP required for production of multiple TNF-induced proinflammatory mediators
  • IAP antagonism decreased TNF-mediated production of chemokines and cytokines
  • But increased spontaneous release of chemokines

In addition Rume Damgaard and Mads Gynd-Hansen have suggested that IAP antagonists may be useful in treating inflammatory diseases like Crohn’s disease as IAPs regulate innate and acquired immune responses[23].

Toxicity profiles of IAP antagonists

NOTE: In a paper in Toxicological Science from 2012[24], Rebecca Ida Erickson form Genentech reported on the toxicity profile of the IAP antagonist GDC-0152 from a study performed in dogs and rats. A dose-dependent toxicity profile from i.v. administration was consistent with TNFα-mediated toxicity with

  • Elevated plasma cytokines and an inflammatory leukogram
  • Increased serum transaminases
  • Inflammatory infiltrate and apoptosis/necrosis in multiple tissues

In a related note, a similar type of fatal idiosyncratic hepatotoxicity was reported in a 62 year-old man treated with the Raf kinase inhibitor sorafenib for renal cell carcinoma[25]: Fatal case of sorafenib-associated idiosyncratic hepatotoxicity in the adjuvant treatment of a patient with renal cell carcinoma; Case Report  in BMC Cancer.

At week four after initiation of sorafenib treatment, the patient noticed increasing fatigue, malaise, gastrointestinal discomfort and abdominal rash.  Although treatment was discontinued, jaundice developed and blood test revealed an acute hepatitis with

  • Elevated serum ALT
  • Elevated serum alkaline phosphatase
  • Increased prothrombin time
  • Increased LDH

…elevated levels seen in the case with the aforementioned IAP antagonist.  Autopsy revealed

  • Lobular hepatitis
  • Mononuclear cell infiltrate
  • Hepatocyte necrosis

These findings are in line with a drug-induced inflammation and IDILI. In addition to hepatotoxicity, renal insufficiency developed in this patient. The authors had suggested the death was probably due to “an idiosyncratic allergic reaction to sorafenib manifesting as hepatotoxicity with associated renal impairment”.  The authors also noted that genome wide association studies of idiosyncratic drug-induced liver injury support involvement of major histocompatibility complex (MHC) polymorphisms[26].  MHC involvement has also been associated with lapatanib and pazopanib hepatotoxicity [27, 28].

Curis has been involved in another novel oncology therapeutic, a first in class.

Last year Roche and Genentech had won approval for a Hedgehog pathway inhibitor vismodegib for treatment of advanced basal cell carcinoma (reported at FierceBiotech©). Vismodegib was initially developed in collaboration with Curis, Inc.  The hedgehog signaling pathway, which controls the function of Gli factors (involved in stem cell differentiation), is overactive in advanced basal cell carcinoma as well as other cancer types.

As an additional reference, the FDA National Center for Toxicological Research has developed THE LIVER TOXICITY KNOWLEDGE BASE (LTKB).

“The LTKB is a project designed to study drug-induced liver injury (DILI). Liver toxicity is the most common cause for the discontinuation of clinical trials on a drug, as well as the most common reason for an approved drug’s withdrawal from the marketplace. Because of this, DILI has been identified by the FDA’s Critical Path Initiatives as a key area of focus in a concerted effort to broaden the agency’s knowledge for better evaluation tools and safety biomarkers.”

A nice SlideShow of Toxicity of Targeted Therapies can be found here: http://www.slideshare.net/RashaHaggag/toxicities-of-targeted-therapies

Also please note that ALL GENES in this article are linked to their GENECARD 

UPDATED 8/12/2022

 

Zolgensma Gene Therapy Linked to 2 Deaths in SMA Patients, Novartis Reports

The 2 deaths, due to acute liver failure, occurred in patients treated in Kazakhstan and Russia.

Two children with spinal muscular atrophy (SMA) have died after being treated with onasemnogene abeparvovec (Zolgensma; Novartis) from acute liver failure, a known safety risk of the therapy.1

Novartis has updated the FDA and other regulatory agencies in countries that Zolgensma is approved in, including Russia and Kazakhstan, where the deaths occurred. The company will also update the labeling of Zolgensma to include the deaths.

“While this is important safety information, it is not a new safety signal and we firmly believe in the overall favorable risk/benefit profile of Zolgensma, which to date has been used to treat more than 2300 patients worldwide across clinical trials, managed access programs, and in the commercial setting,” Novartis said in an emailed statement to BioPharma Dive.2

Zolgensma’s labeling includes the risk of liver injury and instructs clinicians to assess liver function before treatment and to manage liver enzyme counts with steroid treatment. The 2 deaths occurred 5 to 6 weeks after the one-time infusion and 1 to 10 days after corticosteroid treatment was tapered, according to an initial report from Stat News.1

READ MORE: Zolgensma Shows Efficacy in SMA With 3 SMN2 Copies

An FDA advisory committee meeting that took place last fall identified risks of adeno associated virus (AAV) gene therapies including, specifically, Zolgensma.2 The committee recommended caution, but nothing that would hinder gene therapy development.

Zolgensma, which was approved in the US in May 2019, just recently demonstrated further positive data from SPR1NT (NCT03505099), a phase 3 multicenter, single-arm trial on its effect in presymptomatic children with SMA in 2 articles published in Nature Medicine.3,4

All children in both the type 1 and type 2 cohorts achieved the ability to independently sit and most achieved other age-appropriate milestones including standing and walking. None of the children in the study required respiratory support or nutritional support, and there were no serious treatment-related adverse events observed.

“The robust data from both the 2- and 3-copy SPR1NT cohorts are being published together for the first time, further supporting the significant and clinically meaningful benefit of Zolgensma in presymptomatic babies with SMA,” Shephard Mpofu, MD, SVP, chief medical officer, Novartis Gene Therapies, said in a previous statement.5 “When treated with Zolgensma prior to the onset of symptoms, not only did all 29 patients enrolled in SPR1NT survive, but were thriving—breathing and eating on their own, with most even sitting, standing, and walking without assistance.”

REFERENCE

1. Silverman E. Novartis reports two children died from acute liver failure after treatment with Zolgensma gene therapy. STAT. August 11, 2022. https://www.statnews.com/pharmalot/2022/08/11/novartis-zolgensma-liver-failure-gene-therapy-death/

2. Pagliarulo N. Novartis reports deaths of two patients treated with Zolgensma gene therapy. BioPharma Dive. August 12, 2022. https://www.biopharmadive.com/news/novartis-zolgensma-patient-death-liver-injury/629542/

3. Strauss KA, Farrar MA, Muntoni F, et al. Onasemnogeneabeparvovec for presymptomatic infants with two copies of SMN2 at risk for spinal muscular atrophy type 1: the Phase III SPR1NT trial. Nat Med. Published online June 17, 2022. doi:10.1038/s41591-022-01866-42

4. Strauss KA, Farrar MA, Muntoni F, et al. Onasemnogeneabeparvovec for presymptomatic infants with three copies of SMN2 at risk for spinal muscular atrophy: the Phase III SPR1NT trial. Nat Med. Published online June 17, 2022.doi: 10.1038/s41591-022-01867-3

5. Novartis announces Nature Medicine publication of Zolgensma data demonstrating age-appropriate milestones when treating children with SMA presymptomatically. News release. Novartis. June 17, 2022. https://firstwordpharma.com/story/5597735

 

REFERENCES

1.            Roth RA, Ganey PE: Intrinsic versus idiosyncratic drug-induced hepatotoxicity–two villains or one? The Journal of pharmacology and experimental therapeutics 2010, 332(3):692-697.

2.            Waring JF, Liguori MJ, Luyendyk JP, Maddox JF, Ganey PE, Stachlewitz RF, North C, Blomme EA, Roth RA: Microarray analysis of lipopolysaccharide potentiation of trovafloxacin-induced liver injury in rats suggests a role for proinflammatory chemokines and neutrophils. The Journal of pharmacology and experimental therapeutics 2006, 316(3):1080-1087.

3.            Deng X, Luyendyk JP, Ganey PE, Roth RA: Inflammatory stress and idiosyncratic hepatotoxicity: hints from animal models. Pharmacological reviews 2009, 61(3):262-282.

4.            Laverty HG, Antoine DJ, Benson C, Chaponda M, Williams D, Kevin Park B: The potential of cytokines as safety biomarkers for drug-induced liver injury. European journal of clinical pharmacology 2010, 66(10):961-976.

5.            Schwabe RF, Brenner DA: Mechanisms of Liver Injury. I. TNF-alpha-induced liver injury: role of IKK, JNK, and ROS pathways. American journal of physiology Gastrointestinal and liver physiology 2006, 290(4):G583-589.

6.            Seki E, Brenner DA, Karin M: A liver full of JNK: signaling in regulation of cell function and disease pathogenesis, and clinical approaches. Gastroenterology 2012, 143(2):307-320.

7.            Kaplowitz N: Drug-induced liver injury. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 2004, 38 Suppl 2:S44-48.

8.            Kindmark A, Jawaid A, Harbron CG, Barratt BJ, Bengtsson OF, Andersson TB, Carlsson S, Cederbrant KE, Gibson NJ, Armstrong M et al: Genome-wide pharmacogenetic investigation of a hepatic adverse event without clinical signs of immunopathology suggests an underlying immune pathogenesis. The pharmacogenomics journal 2008, 8(3):186-195.

9.            Aithal GP, Ramsay L, Daly AK, Sonchit N, Leathart JB, Alexander G, Kenna JG, Caldwell J, Day CP: Hepatic adducts, circulating antibodies, and cytokine polymorphisms in patients with diclofenac hepatotoxicity. Hepatology 2004, 39(5):1430-1440.

10.          Daly AK, Aithal GP, Leathart JB, Swainsbury RA, Dang TS, Day CP: Genetic susceptibility to diclofenac-induced hepatotoxicity: contribution of UGT2B7, CYP2C8, and ABCC2 genotypes. Gastroenterology 2007, 132(1):272-281.

11.          Russmann S, Kullak-Ublick GA, Grattagliano I: Current concepts of mechanisms in drug-induced hepatotoxicity. Current medicinal chemistry 2009, 16(23):3041-3053.

12.          Fontana RJ, Watkins PB, Bonkovsky HL, Chalasani N, Davern T, Serrano J, Rochon J: Drug-Induced Liver Injury Network (DILIN) prospective study: rationale, design and conduct. Drug safety : an international journal of medical toxicology and drug experience 2009, 32(1):55-68.

13.          Spraggs CF, Xu CF, Hunt CM: Genetic characterization to improve interpretation and clinical management of hepatotoxicity caused by tyrosine kinase inhibitors. Pharmacogenomics 2013, 14(5):541-554.

14.          de Almagro MC, Vucic D: The inhibitor of apoptosis (IAP) proteins are critical regulators of signaling pathways and targets for anti-cancer therapy. Experimental oncology 2012, 34(3):200-211.

15.          Deveraux QL, Takahashi R, Salvesen GS, Reed JC: X-linked IAP is a direct inhibitor of cell-death proteases. Nature 1997, 388(6639):300-304.

16.          Crook NE, Clem RJ, Miller LK: An apoptosis-inhibiting baculovirus gene with a zinc finger-like motif. Journal of virology 1993, 67(4):2168-2174.

17.          Tamm I, Kornblau SM, Segall H, Krajewski S, Welsh K, Kitada S, Scudiero DA, Tudor G, Qui YH, Monks A et al: Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias. Clinical cancer research : an official journal of the American Association for Cancer Research 2000, 6(5):1796-1803.

18.          Laukens B, Jennewein C, Schenk B, Vanlangenakker N, Schier A, Cristofanon S, Zobel K, Deshayes K, Vucic D, Jeremias I et al: Smac mimetic bypasses apoptosis resistance in FADD- or caspase-8-deficient cells by priming for tumor necrosis factor alpha-induced necroptosis. Neoplasia 2011, 13(10):971-979.

19.          He S, Wang L, Miao L, Wang T, Du F, Zhao L, Wang X: Receptor interacting protein kinase-3 determines cellular necrotic response to TNF-alpha. Cell 2009, 137(6):1100-1111.

20.          Baud V, Karin M: Is NF-kappaB a good target for cancer therapy? Hopes and pitfalls. Nature reviews Drug discovery 2009, 8(1):33-40.

21.          Asselin E, Mills GB, Tsang BK: XIAP regulates Akt activity and caspase-3-dependent cleavage during cisplatin-induced apoptosis in human ovarian epithelial cancer cells. Cancer research 2001, 61(5):1862-1868.

22.          Kearney CJ, Sheridan C, Cullen SP, Tynan GA, Logue SE, Afonina IS, Vucic D, Lavelle EC, Martin SJ: Inhibitor of apoptosis proteins (IAPs) and their antagonists regulate spontaneous and tumor necrosis factor (TNF)-induced proinflammatory cytokine and chemokine production. The Journal of biological chemistry 2013, 288(7):4878-4890.

23.          Damgaard RB, Gyrd-Hansen M: Inhibitor of apoptosis (IAP) proteins in regulation of inflammation and innate immunity. Discovery medicine 2011, 11(58):221-231.

24.          Erickson RI, Tarrant J, Cain G, Lewin-Koh SC, Dybdal N, Wong H, Blackwood E, West K, Steigerwalt R, Mamounas M et al: Toxicity profile of small-molecule IAP antagonist GDC-0152 is linked to TNF-alpha pharmacology. Toxicological sciences : an official journal of the Society of Toxicology 2013, 131(1):247-258.

25.          Fairfax BP, Pratap S, Roberts IS, Collier J, Kaplan R, Meade AM, Ritchie AW, Eisen T, Macaulay VM, Protheroe A: Fatal case of sorafenib-associated idiosyncratic hepatotoxicity in the adjuvant treatment of a patient with renal cell carcinoma. BMC cancer 2012, 12:590.

26.          Daly AK: Drug-induced liver injury: past, present and future. Pharmacogenomics 2010, 11(5):607-611.

27.          Spraggs CF, Budde LR, Briley LP, Bing N, Cox CJ, King KS, Whittaker JC, Mooser VE, Preston AJ, Stein SH et al: HLA-DQA1*02:01 is a major risk factor for lapatinib-induced hepatotoxicity in women with advanced breast cancer. Journal of clinical oncology : official journal of the American Society of Clinical Oncology 2011, 29(6):667-673.

28.          Xu CF, Reck BH, Goodman VL, Xue Z, Huang L, Barnes MR, Koshy B, Spraggs CF, Mooser VE, Cardon LR et al: Association of the hemochromatosis gene with pazopanib-induced transaminase elevation in renal cell carcinoma. Journal of hepatology 2011, 54(6):1237-1243.

Other articles on the site about Toxicology and Pharmacology of New Classes of Cancer Chemotherapy include:

FDA Guidelines For Developmental and Reproductive Toxicology (DART) Studies for Small Molecules

Gamma Linolenic Acid (GLA) as a Therapeutic tool in the Management of Glioblastoma

DNA Methultransferases – Implications to Epigenetic Regulation and Cancer Therapy Targeting: James Shen, PhD

Molecular Profiling in Cancer Immunotherapy: Debraj GuhaThakurta, PhD

AT13148 – A Novel Oral Multi-AGC Kinase Inhibitor Has Potent Antitumor Activity

Targeting Mitochondrial-bound Hexokinase for Cancer Therapy

Breast Cancer, drug resistance, and biopharmaceutical targets

Ubiquitin-Proteosome pathway, Autophagy, the Mitochondrion, Proteolysis and Cell Apoptosis: Part III

Ubiquinin-Proteosome pathway, autophagy, the mitochondrion, proteolysis and cell apoptosis

Read Full Post »

Identifying Melanoma by Scent

Author: Tilda Barliya PhD

 

Researchers from the Monell Chemical Center developed a nano-sensor constructed of nano-size carbon nanotubes coated with DNA that could identify melanoma cells by scent (1).

The smell of cancer_MIT Technology

Currently, early detection of skin carcinoma is accomplished primarily through a visual exam,imaging techniques and biopsy of any suspected areas (1).

The biopsy is invasive and usually requires examination by a pathologist,  and the use of reflectance confocal microscopy and dermoscopy in situ for diagnosis of primary melanoma and other skin diseases, require specialized training.  Additionally, proteomics of caner-related biomarkers has also emerged in recent years. The discovery of cancer-related biomarkers using proteomic techniques has primarily focused on prognostic indicators of melanoma, i.e., examining the serum and plasma proteome for biomarkers indicative of metastases to distant sites (2,3).

Volatile cue however, such as those use to detect lung cancer (I), diabetes, COPD etc, have not yet been exploit in detecting melanoma. Rather volatile chemicals are released from melanoma tissues that can be differentiated from those of normal skin, posed a very interestingscientific questions.

Electronic nose that can sniff out cancer

It was no surprising that Dogs can identify by olfaction,melanoma on the skin of patients or melanoma samples hidden on healthy subjects, suggesting that volatile organic compounds (VOCs) from melanoma differ from those of normal skin. (4, 5).

D‘Amico et al. [6] employed gas chromatography/mass spectrometry (GC–MS) and a gas sensor array to investigate whether skin lesions of melanoma and nevi can be differentiated. In his paper, D’Amico had very promising results in which electronic nose sensors have been shown to have good sensitivity (with 80% accuracy) towards volatile organic compounds emitted by skin lesions, and the method seems to be effective for malign lesions identification (6).

Other attempts have been carried out to identify more closely the different VOCs of melanoma lesions compared to normal skin, however, environmental contamination rather than compounds from skin metabolism have failed to yield good detection methodology.

Kwak J et al, created an electronic nose (e-nose)  device employing functionalized DNA-coated carbon nanotube sensors, capable of sensitive and selective detection of compounds emitted from skin (1). These “single walled carbon nanotube field effect transistors (CNT FET’s), functionalized with single stranded DNA (DNACNT), have been shown to respond through a change in source drain current when exposed to VOCs” (7).

“The sensors show rapid response and recovery (seconds), very low signal drift, and chemical responses that are single strand DNA (ss-DNA) base sequence dependent. Single stranded-DNA is chosen for functionalization of the CNTs because it displays recognition for chemical vapors”.

The authors employed SPME and GC–MS to identify the VOCs that differentiate between human melanoma and normal melanocyte cells cultured in vitro, which may provide a model for in vivo human melanomas.  Same analysis were later conducted using GC–MS and DNACNT. Analysis of different normal melanocytes and melanoma cancer cell lines revealed: the growth media for normal melanocytes and cancer cells differed from each other in relative abundance of several compounds:

  • 3-hydroxy-2-butanone (acetoin),
  • 1-hexanol,
  • acetophenone,
  • phenylethyl alcohol
  • phenol

They also noted that dimethylsulfone, which has been reported, in preliminary fashion, as a significant indicator of basal cell carcinoma, was seen in significantly greater amounts in metastatic melanoma cells vs. normal cells.

Summary

It is well known that cancer cells have altered metabolisms, which are expected to yield a different profile of metabolites.The authors presented here suggest significant differences in the “volatile metabolome” of melanoma cells vs. normal melanocytes.

The authors posit that successful development of rapid screening techniques incorporating new e-nose technologies, fitted with nanosensors with high selectivity for endogenous melanoma biomarkers, may effectively scan the complex volatile fingerprints acquired from suspicious lesions and quickly provide an evaluation for the physician, regardless of their geographic location”.

Smelling a disease has also been examined in bladder cancer (8), ovarian cancer (9) as well as Parkinson and Alzheimer disease (10) and it may potentially be used to enable easy, fast and accurate method to scenting a disease.

Ref:

1. Kwak J, Gallagher M, Ozdener MH, Wysocki CJ, Goldsmith BR, Isamah A, Faranda A, Fakharzadeh SS, Herlyn M, Johnson AT, Preti G. Volatile biomarkers from human melanoma cells. Journal of Chromatography B, 931 (2013) 90–96. http://www.ncbi.nlm.nih.gov/pubmed/23770738

2. S.A. Hoffman, W.A. Joo, L.A. Echan, D.W. Speicher, Higher dimensional (Hi-D) separation strategies dramatically improve the potential for cancer biomarker detection in serum and plasma.  J. Chromatogr. B: Analyt. Technol. Biomed. Life Sci. 849 (2007) 43. http://www.ncbi.nlm.nih.gov/pubmed/17140865

3.  J. Solassol, A. Du-Thanh, T. Maudelonde, B. Guillot,  Serum proteomic profiling reveals potential biomarkers for cutaneous malignant melanoma. Int. J. Biol. Markers 26 (2011) 82. http://www.ncbi.nlm.nih.gov/pubmed/21607923

4. H. Williams, A. Pembroke, SNIFFER DOGS IN THE MELANOMA CLINIC? Lancet 333 (1989) 734.  http://www.sciencedirect.com/science/article/pii/S0140673689922575
5. J. Church, H. Williams, Another sniffer dog for the clinic?  Lancet 358 (2001) 930.  http://www.sciencedirect.com/science/article/pii/S0140673601060652

6. D’Amico A, Bono R, Pennazza G, Santonico M, Mantini G, Bernabei M, Zarlenga M, Roscioni C, Martinelli E, Paolesse R, Di Natale C.  Identification of melanoma with a gas sensor array. Skin Res Technol. 2008 May;14(2):226-36.  http://www.ncbi.nlm.nih.gov/pubmed/18412567

7. C. Staii, A.T. Johnson Jr., M. Chen, A. Gelperin, DNA-Decorated Carbon Nanotubes for Chemical Sensing. Nano Lett. 5 (2005) 1774. http://pubs.acs.org/doi/abs/10.1021/nl051261f

8. Written By: Ian Anglin. SMELLING CANCER: DEVICE DETECTS BLADDER CANCER FROM ODOR OF URINE. http://singularityhub.com/2013/07/31/smelling-cancer-device-detects-bladder-cancer-from-odor-of-urine/

9. Horvath G, Chilo J, Lindblad T. Different volatile signals emitted by human ovarian carcinoma and healthy tissue.Future Oncol. 2010 Jun;6(6):1043-1049. http://www.ncbi.nlm.nih.gov/pubmed/?term=Volatile+biomarkers+from+ovarian+cacner

10. Ulrike Tisch, Ilana Schlesinger, Radu Ionescu, Maria Nassar, Noa Axelrod, Dorina Robertman, Yael Tessler, Faris Azar, Abraham Marmur, Judith Aharon-Peretz and Hossam Haick. Detection of Alzheimer’s and Parkinson’s disease from exhaled breath using nanomaterial-based sensors. Nanomedicine January 2013, Vol. 8, No. 1, Pages 43-56   http://www.futuremedicine.com/doi/abs/10.2217/nnm.12.105?url_ver=Z39.88-2003&rfr_id=ori:rid:crossref.org&rfr_dat=cr_pub%3dpubmed&

Other open access article in Pharmaceutical Inteliigence

I. By: Tilda Barliya PhD. Diagnosing lung cancer in exhaled breath using gold nanoparticles.  http://pharmaceuticalintelligence.com/2012/12/01/diagnosing-lung-cancer-in-exhaled-breath-using-gold-nanoparticles/

Read Full Post »

Curator: Tilda Barliya PhD

Original article by: Philip Tinnefeld (2)

The ability to detect a single chemical at extremely low concentrations and high contamination is vital for earlier disease diagnosis (I). Detecting a single chemical does not only help to detect disease earlier, it is also vital for toxin/drug screening, athlete drug monitoring, environmental surveillance, and homeland security. 

To  detect a single molecule the observation volume must host only one molecule of  interest during the measurement (2). It is impossible to carry out single-molecule detection at concentrations exceeding the picomolar to low-nanomolar range, because the observation volume becomes populated by more than one fluorescent molecule as concentration increases.

This concentration barrier is crucial when using a Single-Molecule Technology such as:

  • protein-protein interactions
  • Enzyme-substrate analysis
  • DNA sequencing
  • etc

Jérôme Wenger and colleagues at AixMarseille Université in France, alongside collaborators at the ICFO-Institut de Ciencies Fotoniques and ICREA-Institució  Catalana de Recerca i Estudis Avançats in Spain, describe a system that brings two complementary nanophotonic approaches  together to achieve single-molecule detection with a high signal-to-noise ratio at a micromolar concentration (1, 2).

In recent years, two alternative nanophotonic approaches were used:

  1. Light is confined to the near-field using nanoapertures of subwavelength dimensions (typically holes in a thin aluminum or gold film on a silica substrate) that do not allow light to propagate through.  Figure 1a
  2. Enhance the excitation field  locally using a nanoantenna that converts  freely propagating optical radiation into localized energy in the form of surface plasmons.  By reducing the volume of the hot spot, it is possible to obtain enormous fluorescence enhancements up to more than 1,000-fold when compared with the case of an isolated fluorophore in solution Figure 1b

The first approach (Figure 1a)  limitations were that although this approach reduces the observation volume and enables single-molecule detection in the micromolar range, further reduction of nanoaperture size has detrimental effects on the fluorescence signal because of the decreased excitation intensity and fluorescence quenching caused by the metal film.

It did however, has some encouraging results: This method has been used, for instance, to monitor the activity of the 
enzyme polymerase1 and follow DNA sequencing in real time; and for visualizing a ribosome in action (3).

The second approach (Figure 1b) limitations were that this approach suffers from the background fluorescence of molecules far away from the hot spot but still within the diffraction-limited excited area.

Nanophotonic approach to enhance single molecule detection

“nanoantenna-in-box”

Wenger and colleagues synergistically combine these two approaches and place a nanoantenna within the spatial confinement of a nanoaperture (Fig. 1c), to which they called “nanoantenna-in the-box.

To demonstrate the capability of their device, they cover it with a solution containing a fluorescent dye and analyse the fluorescence signal coming out from the hot spot using fluorescence correlation spectroscopy (FCS).

The FCS technique measures the number of molecules in the effective observation volume as these diffuse in and out of it, as well as the brightness per molecule.

Limitations:

1. There are, however, a few limitations that  have to be considered. Further reduction of the gap size may result in gaps being too small for biomolecules to enter.

2. The antenna-in-box device exhibits a large surface-to-volume ratio and sticky molecules might adsorb onto the gold surface, especially in the gap, which might lead to rapid surface degradation, surfaceinduced artefacts and other background.

To overcome some of the limitations, the authors used an approach that takes advantage of a recently developed DNA-scaffolded, gap-nanoantenna might represent a viable solution. The two nanoparticles forming the gap-nanoantenna are attached to a self-assembled DNA nanostructure that provides handles to place the biomolecule of interest in the hot spot.

In summary:

“Whatever direction the research field might take, it seems as though the development of sophisticated coverslips in which nanophotonic structures such as the antenna-in-box set-up are incorporated may unlock more potential for single- molecule detection than developing more powerful microscopes”.

Ref:

I. By: Grace Rattue. Nanotechnology For Detecting Diseases Earlier.  http://www.medicalnewstoday.com/articles/245820.php

1. Deep Punj, Mathieu Mivelle, Satish Babu Moparthi, Thomas S. van Zanten, Hervé Rigneault, Niek F. van Hulst, María F. García-Parajó & Jérôme Wenger. A plasmonic ‘antenna-in-box’ platform for enhanced single-molecule analysis at micromolar concentrations. Nature Nanotechnology 8, 512–516 (2013) doi:10.1038/nnano.2013.98. http://www.nature.com/nnano/journal/v8/n7/full/nnano.2013.98.html?WT.ec_id=NNANO-201307

2. By: Philip Tinnefeld. Single-Molecule Detection: Breaking the concentration barrier.  http://www.nature.com/nnano/journal/v8/n7/full/nnano.2013.122.html

3. Sotaro Uemura.,  Colin Echeverría Aitken., , Jonas Korlach.,  Benjamin A. Flusberg., Stephen W. Turner & Joseph D. Puglisi. Real-time tRNA transit on single translating ribosomes at codon resolution. Nature 464, 1012–1017 (2010).  http://www.nature.com/nature/journal/v464/n7291/full/nature08925.html

4. G. P. Acuna, F. M. Möller, P. Holzmeister, S. Beater, B. Lalkens, P. Tinnefeld. Fluorescence Enhancement at Docking Sites of DNA-Directed Self-Assembled Nanoantennas.  Science 26 October 2012: Vol. 338 no. 6106 pp. 506-510.  http://www.sciencemag.org/content/338/6106/506.abstract

Read Full Post »

Author: Tilda Barliya PhD

Photoacoustic Tomography (PAT), also called the optoacoustic or thermoacoustic (TA), is a materials analysis technique based on the reconstruction of an internal photoacoustic source distribution from measurements acquired by scanning ultrasound detectors over a surface that encloses the source under study. Moreover, it is non-ionizing and non-invasive, and is the fastest growing new biomedical method, with clinical applications on the way.

Dr. Lihong Wang, a Distinguished Professor of Biomedical Engineering in the School of Engineering and Applied Science at Washington University in St. Louis, summarizes the state of the art in photoacoustic imaging (1).

The photoacoustic (PA) effect:

The fundamental principle of the PA effect can be simply described: an object absorbs EM radiation energy, the absorbed energy converts into heat and the temperature of the object increases. As soon as the temperature increases, thermal expansion takes place, generating acoustic pressure in the medium. However, a steady thermal expansion (time invariant heating) does not generate acoustic waves; thus, the heating source is required to be time variant.

Dr. Wang explains that “the trick of photoacoustic tomography is to convert light absorbed at depth to sound waves, which scatter a thousand times less than light, for transmission back to the surface. The tissue to be imaged is irradiated by a nanosecond-pulsed laser at an optical wavelength”.

Absorption by light by molecules beneath the surface creates a thermally induced pressure jump that launches sound waves that are measured by ultrasound receivers at the surface and reassembled to create what is, in effect, a photograph.

When comparing to other modalities, PAT has several great advantages:

Table 1 Comparison of imaging modalities.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Dr. Wang is already working with physicians at the Washington University School of Medicine to move four applications of photoacoustic tomography into clinical trials (2).

  • One is to visualize the sentinel lymph nodes that are important in breast cancer staging;
  • A second to monitor early response to chemotherapy;
  • A third to image melanomas;
  • The fourth to image the gastrointestinal tract.

Sentinel node biopsy provides a good example of the improvement photoacoustic imaging promises over current imaging practice. Sentinel nodes are the nodes nearest a tumor, such as a breast tumor, to which cancerous cells would first migrate.

Currently, sentinel node biopsy, includes injection of  a radioactive substance, a dye or both near a tumor. The body treats both substances as foreign, so they flow to the first draining node to be filtered and flushed from the body. A gamma probe or a Geiger counter is used to locate the radioactive particles and the surgeon must cut open the area and follow the dye visually to the sentinel lymph node.

Dr. Wang however, offers a simpler method: injecting an optical dye that shows up so clearly in photoacoustic images that a hollow needle can be guided directly to the sentinel lymph node and a sample of tissue taken through the needle.

Contrast agents:

Most photoacoustic (PA) contrast agents are designed for absorbing laser, especially in the NIR spectral range. However, RF contrast agents are also desirable due to the superior penetration depth of RF in the body (1).  A typical example is indocyanine green (ICG), a dye approved by FDA. ICG has high absorption in the NIR spectral region, and it has already been proved to increase the PA signal when it is injected in blood vessels. Most recently, methyline blue was used as the contrast agent to detect the sentinel lymph node (SLN) (4).

Compared with dyes, nanoparticles possess a high and tunable absorption spectrum, and longer circulation time (1). The absorption peak is tunable by changing the shape and size of the particle. In addition, nanoparticles can be used to target certain diseases by bio-conjugating them with proteins, such as antibodies.  Among different nanoparticles, gold nanoparticles are favored in optical imaging due to their exceptional optical properties in the visible and NIR spectral ranges, including scattering, absorption and photoluminescence. So far, none of the gold nanoparticles have been approved by FDA (1).

One exciting aspect of photoacoustic tomography is that images contain functional as well as structural information because color reflects the chemical composition and chemistry determines function. Photoacoustic tomography, for example, can detect the oxygen saturation of hemoglobin, which is bright red when it is carrying oxygen and turns darker red when it releases it (3), that is important, since almost all diseases, especially cancer and diabetes, cause abnormal oxygen metabolism.  For example see image 1.

Image courtesy of Junjie Yao/Lihong Wang

Image 1: melanoma tumor (MT) cells were injected into a mouse ear on day 1. By day 7, there were noticeable changes in the blood flow rate (top graph, right) and the metabolic rate of oxygen usage (bottom graph, right). Counterintuitively, the tumor did not increase the oxygen extraction fraction (middle graph). The colors correspond to depth, with blue being superficial and red deep (3).

Wang’s team demonstrated that oxygen metabolism betrayed the presence of a melanoma within few days of injections in animal models, where as Oxygen use doubled in a week.

In this aspect: photoacoustic images,  can offer several parameters such as;

  • Vessel cross-section,
  • Concentration of hemoglobin and blood flow speed,
  • and The gradient of oxygen saturation can be used to calculate the oxygen use by a region of tissue.

Analysis of oxygen use is not necessarily new and is frequently measured by positron emission tomography (PET), which requires the injection or inhalation of a radioactively labeled tracer and undesirable radiation exposure.

Photoacoustic Tomography is currently being investigated for (5):

  1. Breast cancer (microvascular).  Additionally, for further information on photoacoustic tomography please read the article by Dr. Venkat Karra (I).
  2. Skin cancer (melanin)
  3. Brain tumors
  4. Cardiac disease – myocardial infraction (6)
  5. Ophthalmology – retinal disease (7)
  6. Ostheoarthrities (8)

Summary

photoacoustic tomography perfectly complements other biomedical imaging modalities by providing unique optical absorption contrast with highly scalable spatial resolution, penetration depth, and imaging speed. In light of its capabilities and flexibilities, PAT is expected to play a more essential role in biomedical studies and clinical practice.

Reference:

1.  Changhui Li and Lihong V Wang. Photoacoustic tomography and sensing in biomedicine. Phys. Med. Biol. 2009 54 R59 doi:10.1088/0031-9155/54/19/R01  http://iopscience.iop.org/0031-9155/54/19/R01 http://iopscience.iop.org/0031-9155/54/19/R01/pdf/0031-9155_54_19_R01.pdf

2. Jiecheny Yin. Photoacoustic tomography in cancer detection. http://bme240.eng.uci.edu/students/08s/jiecheny/index.htm

3. Jim Goodwin. NEW IMAGING TECHNIQUE COULD SPEED CANCER DETECTION. http://www.siteman.wustl.edu/ContentPage.aspx?id=5788

4.  Song K H, Stein E W, Margenthaler J A and Wang L V. Noninvasive photoacoustic identification of sentinel lymph nodes containing methylene blue in vivo in a rat model J. Biomed. Opt. 2008: 13 054033–6.  http://oilab.seas.wustl.edu/epub/SongK_2008_J_Biomed_Opt_13_054033.pdf

5. Junjie Yao and Lihong V Wang.  Photoacoustic tomography: fundamentals, advances and prospects. Contrast Media Mol Imaging. 2011 September; 6(5): 332–345. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3205414/

6. Holotta M, Grossauer H, Kremser C, Torbica P, Völkl J, Degenhart G, Esterhammer R, Nuster R, Paltauf G, Jaschke W. Photoacoustic tomography of ex vivo mouse hearts with myocardial infarction. J. Biomed Opt. 2011 Mar;16(3):036007. doi: 10.1117/1.3556720. http://www.ncbi.nlm.nih.gov/pubmed/21456870

7. Hao F. Zhang, Carmen A. Puliafito, and Shuliang Jiao, Photoacoustic Ophthalmoscopy for In Vivo Retinal Imaging: Current Status and Prospects.  Ophthalmic Surg Lasers Imaging. 2011 July; 42(0): S106–S115.  http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3291958/

8. Yao Sun, Eric S. Sobel, and Huabei Jiang. First assessment of three-dimensional quantitative photoacoustic tomography for in vivo detection of osteoarthritis in the finger joints.  Med. Phys. 38, 4009 (2011); http://dx.doi.org/10.1118/1.3598113 . http://online.medphys.org/resource/1/mphya6/v38/i7/p4009_s1?isAuthorized=no

Other articles from our Open Access Journal:

I. By : Venkat Karra. Visualizing breast cancer without X-rays. http://pharmaceuticalintelligence.com/2012/05/08/visualizing-breast-cancer-without-x-rays/

II. By: Dr. Dror Nir. Ultrasound in Radiology – Results of a European Survey. http://pharmaceuticalintelligence.com/2013/07/21/ultrasound-in-radiology-results-of-a-european-survey/

III.  By: Dr. Dror Nir. Causes and imaging features of false positives and false negatives on 18F-PET/CT in oncologic imaging. http://pharmaceuticalintelligence.com/2013/05/18/causes-and-imaging-features-of-false-positives-and-false-negatives-on-18f-petct-in-oncologic-imaging/

Read Full Post »

English: This diagram shows the chromosomes of...

This diagram shows the chromosomes of Drosophila melanogaster approximately to scale. Chromosome sizes were based on basepair lengths given on the NCBI map viewer, and A. B. Carvalho, 2002. Curr. Op. Genet. & Devel. 12:664-668. Centimorgan distances were derived from selected loci listed in the NCBI website. (credit  Wikipedia)

Introduction

Generally speaking sexually reproducing species are composed of individuals of two complementary mating types or sexes.  An essential aspect of the developmental history of each individual is thus sex determination and differentiation. There exist two sex determination mechanisms, somatic and germline, that based on the chromosomal mechanism in the Drosophila melanogaster.  In the somatic sex determination mechanism, each individual assesses the ratio of X-chromosomes to autosomal chromosome sets), the X:A ratio provides the primary sex-determining signal   (reviewed by Cline and Meyer, 1996).  When X:A=1, female differentiation ensues (Bridges, 1925), along with the male-mode of X-chromosome dosage compensation.  The X:A ratio is calculated within each cell of the developing embryo, 2 hrs after fertilization. The X:A ratio determines the sex in Drosophila (Bridges, 1916, 1921, 1925) in a somatic-cell-autonomous manner that occurs early in embryonic development (Baker and Belote, 1983; Baker, 1989). Females possess two X-chromosomes, and males possess one X-chromosome and one Y-chromosome.   The Y-chromosome is required only for spermatogenesis (Lindsley and Tokuyasu 1980; Bridges 1986), and will not be considered further.  The number of X-chromosomes is counted through a mechanism involving positive-acting X-chromosome-encoded transcription factors, termed X-numerator elements (Cline, 1988), negative-acting autosome-encoded transcription factors or denominators, and signal transduction factors provided maternally.  Among the X-numerators are sisterless-a, sisterless-b (sis-b), sisterless-c, and runt (Schurpbach, 1985; Cline, 1986, 1988; Steinmann-Zwicky et al., 1989; Parkhurst et al., 1990; Ericson and Cline, 1991, 1993; Estes, 1995; Hoshijima et al., 1995; reviewed by Cline, 1993).

The best candidate for a denominator gene is the deadpan (dpn) locus.  Both daughterless (da) and extramacrochaete (emc) fulfill the role of maternally contributed transduction loci (Cline, 1976; Cronmiller et al., 1988).  Both in vitro biochemical evidence and in vivo genetic evidence support the idea that transcription factors of the basic-helix-loop-helix (bHLH) family are able to form homo- and hetero-dimers; thus the X:A ratio counting mechanism seems to involve the relative affinities and chromosome-dependent stoiciometries of the bHLH proteins SIS-B, DA, EMC, and DPN.  When X:A=1, sufficient SIS-B protein is synthesized so that it can effectively compete with the EMC and DPN proteins for binding to DA protein.  DA:SIS:B heterodimers then bind to so-called establishment promoter (Pe) elements of the SXL gene and activates its transcription, resulting in an early burst of SXL protein that sets splicing and dosage compensation in to female-specific modes.  When X:A=0.5, too little SIS-B is produced, and DA protein remains sequestered with EMC and DPN.  The Sxl Pe remains inactive, and splicing and dosage compensation enters male-specific modes. In response to X:A ratio=1, an embryo specific promoter of the gene called Sex-lethal (Sxl) is activated (Keyes et al., 1932).

Sxl protein that acts as a master gene for the somatic germline sex determination, has three somatic functions. First, Sxl protein carries out autoregulation at the level of pre-mRNA splicing.  Second, Sxl controls female-specific differentiation at the level of pre-RNA splicing and polyadenylation at least two genes that code for transcription factors that effect terminal differentiation. Third, Sxl protein negatively regulates X-chromosome dosage compensation.  It does so in two ways, by alternative RNA splicing of a normally male-specific gene, and by translation-level regulation of many X-chromosomal transcripts during embryogenesis. In the male, with Sxl in the off state, male differentiation occurs because tra is in the off state and therefore the differentiation-effector transcription factors are produced in alternative male-specific modes.  Dosage compensation is active, and the male X-chromosome is decorated by a minimum of four proteins and two RNA molecules that form a complex along the entire chromosome (reviewed by Cline and Meyer, 1996).  Transcription of the male X-chromosome is elevated two-fold, and it produces the same amount of RNA per template as found in females.

Germline pathway for sex determination and dosage compensation is different than the somatic sex determination mechanism.  (Figure 1) Figure 1: Sex determination of D. melanogaster (1998)The vast majority of somatic sex determination loci have no function in germline cells.  For example, none of the X-chromosome numerators is required for proper oogenesis (Granadino et al., 1989, 1992; Steinmann-Zwicky 1991), despite the fact that proper oogenesis requires that X:A =1 in the germline (Schupbach, 1982, 1985) nor are tra, tra-2, and dsxF required for oogenesis.  Sxl and snf have germline functions but the former is not a binary switch gene between oogenesis and spermatogenesis (Despande et al., 1996; Bopp et al., 1993, 1995; Hager et al., 1997). Systematic screens for female-sterile mutations have identified a large number of genes required for normal oogenesis (e.g. Gans et al., 1975; Mohler, 1977; Perrimon et al., 1986; Schupbach and Wieschaus, 19889, 1991).  Female-sterility can arise in diverse ways, but one interesting class of mutations is germline-dependent and causes an “ovarian tumor” phenotype.  “Ovarian tumor” mutations cause under-developed ovaries, in which egg chambers and ovarioles are filled with an excess of undifferentiated germ cells that have adopted male-like characteristics that include a prominent spherical nucleus, assembly of mitocondria around the nucleus, and mis-expression of male-specific marker genes (Oliver et al., 1988, 1990, 1993; Steinmann-Zwicky, 1988, 1992; Bopp et al., 1993; Pauli et al., Wei et al., 1994).  Among the “ovarian tumor” class of genes are ovo, ovarian tumor (otu), fused, and two genes with somatic phenotypes, namely snf and Sxl. Strong mutations at the ovo and otu loci result in ovaries totally devoid of germ cells (King and Killey, 1982; Busson et al., 1983; Oliver et al., 1987; Mevel-Ninio et al., 1989; Rodesh et al., 1995), Weaker mutations at both loci result in viable germline cells that have abnormal male-like splicing at the Sxl gene (Oliver et al, 1993). The overall conclusion is that oogenesis requires a chromosomally female germline is wild type for ovo, otu, Sxl, and snf.  If one of these genes is defective, either the germline will die or male-like differentiation and tumor formation ensure.

However, there are soma-germline interactions for a normal sex determination. (Figure 2) Figure 2: Somatic-Germline Interactions. (1998)Unlike the somatic regulatory hierarchy, which genetic mosaic experiments clearly showed functions in cell-autonomous fashion, sexual differentiation of the germline requires inductive signaling from somatic cells.  This was shown by use of pole cell transplantation, the method of making mosaics in which germline cells surgically transferred from donor embryos  (Schubach. 1985; Steinmann-Zwicky et al., 1989).  These experiments show that proper germline differentiation requires a combination of germline-autonomous chromosomal cues and proper signaling from the soma.  Evidence with tra and dsx mutant somatic hosts indicates these soma-germline interactions have detectable effects by larval stages (Steinmann-Zwicky., 1996).

The ovo gene is genetically complex.  At least three transcripts are produced from the ovo region (Mevel-Ninio et al, 1991, 1995, 1996; Garfinkel et al., 1992, 1994).  Two of these are germline-specific and correspond to the ovo function, while the third corresponds to the somatic-epidermal, non-sex-specific shavenbaby (svb) function.  (For a schematic of the gene map please refer to Figure3) 

 The ovo function is transcribed from two closely spaced germline-specific promoters, ovo a and ovob, give rise to 5-kb mRNAs (Mevel-Ninio et al., 1991, 1995; Garfinkel et al., 1992, 1994).   First identified  promoter was ovob  Garfinkel et al., (1994)  and the leader exon it forms is called Exon 1b, 1028-codon-long open reading frame that contains four Cys2-His2 fingers at the carboxy terminus; protein MW of 110.6 kD.  A second germline promoter, ovoa, was identified by Mevel-Ninio et al (1995), 1400 codons long, and predicts a 150.8-kD protein.  This Exon 1a contains an in-frame AUG upstream of the translation start in Exon 2 utilized by the OvoB open reading frame.  The OvoB mRNA isoforms is predominant during adult life, with the OvoA isoforms only appearing during Stage 14 of oogenesis (Mevel-Ninio et al., 1991, 1996; Garfinkel., 1994).  The ovo zinc finger domain binds to its own germline promoter regions, to the otu promoter region (Garfinkel et al., 1997; Lee, 1998; Lee and Garfinkel 1998).  This is consistent with ovo playing an important role in a sex determination hierarchy operating in germline cells that involves these other genes. The svb function is transcribed from an incompletely characterized somatic promoter that forms a 7.1 kb poly(A)+ mRNA (Garfinkel et al., 1994).  This transcript accumulates 9-12-hr post-fertilization, in the somatic tissues that later in embryogenesis form the cuticular structures affected by svb mutations.  Wieschaus et al. (1984) observed that ventral denticle belts and dorsal hairs are defective in svb mutations; hence the name, and svb mutations are polyphasic larval lethals. Exons and exon segments that are found in all mRNA forms coded by the region correspond to genomic DNA where so-called svb-ovo- mutations map (Mevel-Ninio et al., 1989; Garfinkel 1992).  Finally, somatic-specific exons, exon segments, and transcriptional regions correspond to region mutable to the svb- ovo- phenotype.  Since al known mRNA forms utilize the same splice junctions to join Exon3 to Exon4, all protein forms coded by the locus are believed to contain the same four zinc fingers at the carboxy terminus.   A wide variety of evidence points to ovo playing a critical role in germline sex determination.  High-level of ovo transcription in germline cells, as detected with Xgal staining of ovo promoter-lacZ constructs requires that they have a female karyotype (Oliver et al., 1994).  Chromosomally male germline cells have low levels of ovo transcription even if the soma is transformed towards female through the use of hs-traF cDNA minigenes.  Likewise, chromosomally female germline cells have high levels of ovo transcription even if the soma is anatomically male through the action of tra loss-of-function mutations.  This argues that high-level of ovo transcription is a germline X: A ratio-autonomous property, and stands in contrast to related experiments with otu.  In the case of otu, there is evidence that chromosomally male germline cells, which normally have no need of otu+ function at all, require otu- for proliferation when they are in a female host (Nagoshi et al., 1995). The D. melanogaster ovo gene is required for cell viability and differentiation of female germ cells, apparently playing a role in germline sex determination.  While female X: A ratio in germline cells is required for high levels of ovo germline promoters.  Therefore we undertook to identify trans-acting regulatory regions of the X-chromosome, with a particular interest in identifying candidate germline X-chromosome numerator elements. In this study, I screened  X-chromosome using 45 deficiency strains, I found that these trans-regulating regions were grouped into 12 loci based on overlapping cytology.  Five regions were trans-regulating activators, and seven were trans-regulating repressors; extrapolating to the entire genome, this result predicts nearly 85 loci.  A subset of the dozen X-chromosomal regions correlated with previously identified E(ovoD) and Su(ovoD) loci (Pauli et al., 1995).  

Materials and Methods

 

Fly Strains and Growth Flies were maintained on standard yeast/cornmeal medium and kept at 25oC and 18oC unless otherwise indicated.  Mutants are described in Lindsley and Zimm (1992).  The ovo3U21 and ovo4B8 were obtained from Brian Oliver of NIH;  OvoD1rS1 FM3 is from the Garfinkel lab collection.  The remaining stocks were obtained from the Bloomington Stock Center (see Table 2.1 for the list of stocks that had been used and Figure 2.1 for their location on the X Chromosome). 

Outcrosses Outcrosses were designed to create transgenic flies so that screening of the X chromosome for trans-regulators of ovo in the germline can be done.   Virgin female flies were collected 14 hour long windows at 18oC or 8 hour long windows at 25oC, during which newly emerged males remained immature.  Collected females were kept 3-5 days to make sure they are virgin before outcrossing them.  Heterozygous virgin females (5-7), carrying deficiency X-chromosomes balanced over first chromosome balancers were mated with males homozygous for either of two P-element transformation constructs of a lacZ reporter gene fused to the ovo promoter.  Both events were inserted on third chromosome.  They were grown at 25oC unless otherwise noted. The control class of F1 progeny has a complete X-chromosome pair, whereas the experimental class has one complete and one deficient X chromosome in its genome.  The [ovo::lacZ constructs] were designed by Oliver et al., (1994).  In this study two of their strains, ovo4B8 (pCOW+1.9) and ovo3U21 (pCOW-2.1) respectively, were used to determine the ovo promoter activity.

Outcrosses to Remove Duplications Several X-chromosome deficiencies in the Bloomington collection are carried in males, with compensatory duplications of X material on an autosome.  These had to be crossed to eliminate the duplications (Fig 2.4).  This was done as follows:  FM3/FM7a virgin flies were mated to Df/Y; Dp males.  Among the F1 progeny, half of the Df/(FM3 or FM7a) daughters will carry the unwanted duplication, and half will be free of the duplication.  In some cases, presence of the duplication could be determined from the females’ phenotypes.  In other cases, up to twenty individuals virgin Df(FM3 or FM7) F1 progeny were backcrossed to FM7a/Y males to establish stocks.  In the F2, absence of the duplication could be established by examining sons; in all cases, the Df is male-lethal unless “rescued” by the duplication.  Also FM3 is itself male lethal.  Thus, single-female stocks that produce only FM7a sons had the desired genotypes and were kept for experiments.

X-Gal Staining In this assay ovaries from two-day-old adults were dissected in Drosophila Ringer’s solution (182 mM KCl, 46 mM NaCl, 3 mM CaCl2, 10mM TrisHCl, pH 6.8).  Then, these tissues were transferred to a microtiter plate and fixed in 1% gluteraldehyde, 50mM Na-cacodylyte acid solution for 15 minutes. After rinsing the tissues, three times for 5 minutes each staining buffer (7.2 mM Na2HPO4, 2.8 mM NaH2PO4, 1.0 mM MgCl2, 0.15 mM NaCl), they were transferred to incubation buffer (staining buffer, 5 mM Fe2 (CN)3, 5 mM Fe3 (CN)2, 0.2% X-Gal) for an hour at 37oC.  Next, tissues were washed three times 5 minutes each in washing buffer, which is a 1 mM EDTA, added PBS (130 mM NaCl, 7 mM Na2HPO4*2H2O, 3 mM NaH2PO4*2H2O, pH 7.0) solution.  Finally, the tissues were dehydrated in ethanol solutions of increasing concentrations (50%, 75%, 95%) and mounted on a slide in Permount.  Preparate concentrations were examined under a compound microscope to make correlations between staining and gene activity. Although it was easy to determine positive and negative controls, but this assay wasn’t sensitive enough to see subtle differences due to effects of deleted regions on ovo promoters driving LacZ.

Histochemical Assay of LacZ Activity This method allowed us to make quantitative measurements of lacZ activity due to ovo promoter function in animals heterozygous for X-chromosome deletions.  Emerging F1 flies were collected and aged for two days before dissecting ovaries under a dissecting microscope.  For each soluble assay, 10 flies were dissected.  This is repeated at least seven assays (N, sample number) completed per stock for each construct.  Ovaries from ten dissected outcrossed flies were out into eppendorf tubes containing 100ml of Assay Buffer (50 mM K-phosphate, 1 mM MgCl2 at pH 7.8) and homogenized about 20 strokes.  For each dissected pair of ovaries 100 ml  of assay buffer was used and the volume was completed to appropriate amount.  After centrifuging for one minute, 20 ml of the supernatant was transferred into 980 ml of assay buffer (Simon and Lis, 1987; Ashburner, 1989) to make 2mM chlorophenol red-beta-D-galactopyranoside (CPRG).  Absorbance at 574 nm was measured at half hour time intervals starting from zero to two hours hydrolysis of CPRG by chlorophenol (red CPRG).  CPR has a molar extinction coefficient of 75,000 M-1 cm-1 (Boehringer-Manheim data sheet) and this is a very easily detected product of b-galactoside enzyme activity. Range finding experiments showed that 2mM of CPRG gives linear data for 2-3 hours often, color changes could be seen with the unaided eye. Two controls are shown in Figure 2.8 that validates CPRG for this work.  Ovaries from a non-transformed strain (y w RD) were used to prepare soluble extracts.  A near zero-absorbance at 574 nm was observed that did not appreciably change over several hours.  In contrast, ovarian extracts from the ovo promoter-lacZ transformant strain ovo3U21 and ovo4B8 (Oliver et al, 1994) showed a steep linear increase in A 574 during the same period.  The slopes of these lines were proportional to the amount of ovo3U21 and ovo4B8 extract added.

Bradford (1976) Assay For Protein This protein determination method is based on the binding of Coomasie Brilliant Blue G-250 to the protein.  Preparation of protein reagent was done according to Bradford (1976).  After 100 mg of Coomasie Brilliant Blue G-250 was dissolved in 50 ml 95% ethanol, and then 100 ml 85% (w/v) phosphoric acid was added.  The resulting solution was diluted to a final volume of 1 liter [final concentrations in the reagent were 0.01% (w/v) Coomasie Brilliant Blue G-250, 4.7% (w/v) ethanol, and 8.5% (w/v) phosphoric acid].  20ml of prepared soluble extract from the dissected tissues were used.  This volume is diluted to 0.1ml with ddH2O, then 5ml of protein reagent was added to the test tube and contents were mixed.  The absorbance at 595nm was measured after 2 min and before 1 hr in 3 ml cuvettes against a reagent blank prepared from 0.1 ml of the appropriate buffer and 5 ml of protein reagent.  A standard curve using known quantities of bovine serum albumin (BSA) was constructed.  Soluble extract absorbances were plotted on the standard curve and protein amount interpolated.

Statistical Analysis Average specific activity is calculated as nanomoles of substrate used per hour per nanogram protein expressed (nmole CPRG liberated /ng / hr).  Sample number (N) always exceeded seven.  Mean specific activity and standard error of the mean (SEM) were calculated for each experimental and control class.  The F test was used to determine whether variances were equal, and therefore,, which type of student’s t-test calculation was appropriate.  A significant difference between experimental and control values was identified by a P < 0.05 for the t-test score.

RESULTS

In this study and ovo mechanism study, the X-chromosome was screened, using 56 different deficiency strains    Table 1: List of Stocks for X-chromosome Screening (1998), Table 2: Stocks Made in This Study for X-Chromosome Screening , Table 1: Stocks for Negative Autoregulation of ovo (1998)  to identify transregulation of ovo Table 3: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo3U21, Table 4: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo4B8 (Results). 

The results are given in three sections: X chromosome deficiency screening, negative autoregulation of ovo exhibited by deficiencies removing ovo, and gene dose analysis using P element transformants carrying extra copies of ovo.

X Chromosome Screening The presence of polytene chromosomes in the salivary glands, which have distinctive, banding patterns allows the map positions of genes to be correlated with physical features of the chromosomes.  Breakpoint locations rearrangements, and the locations of cloned sequences can be easily established.  Each of the major chromosome arms is divided into 20 numbered segments, except chromosome 4, which is divided into 4 regions.  Each numbered region is then divided into six consecutive lettered regions, and each lettered region into numbered bands, for example 4E1. The precise relationship between physical length and the numbering scheme depends on local topography (Lefevre, 1976).  In the summary tables, each deficiency listed according to cytological positions. The map of the X chromosome, including the deficiencies used in this study is given in Materials and Methods (Fig 1). Figure 1: Sex determination of D. melanogaster (1998) In Drosophila melanogaster germ cells, ovo has a primary role in female sex specific cell viability, proliferation and differentiation.  Ovo responds to the number of X-chromosomes as assessed by high level expression (Oliver et al., 1994).  Thus, the ovo promoter may be dependent upon X germline numerator elements.  To identify possible trans-regulators of the ovo germline promoter (and, I hope, to identify germline numerators) I undertook deficiency screen for quantitative effects on ovo::lacZ reporter constructs.  Determination of trans-regulation effect by any of the deletion mutant, was based on two general rules.  If the excised part of the X chromosomes has any genes with the positive regulatory effects on ovo gene activity, then the levels of LacZ reporter gene function will be reduced in experimentals compared to control siblings.  If the experimental class results in the elevation of the LacZ activity by producing high levels of enzyme compared to controls, the elevated region having removed a repression locus. Significant effects were determined by statistical analysis, which using a student’s t-test P value is less than or equal to 0.05.  X-chromosome screening results are presented in Table 3.1 and 3.2.  The entire X-chromosome deficiency set was tested twice: once with a 3.3kb ovo promoter fragment driving LacZ (strain ovo3u21), and separately with a 3.1kb ovo promoter (ovo4B8).  Of  45 deficiencies that represent about 70% of the X-chromosome 17 deficiencies had significant effects in both ovo3U21 and ovo4B8 reporter activity, 1 deficiency had significant effects on only ovo3U21 and only 1 deficiency effect on ovo4B8.  Some of these deficiencies partly overlap, allowing the identification of 11 regions that apparently contain trans-acting modifiers of ovo promoter activity six are positive regulators and five are negative.

Region 1-4.  This region covers the eight overlapping deficiency lines, Df(1) BA1, Df(1)sc14, Df(1)64c18, Df(1)JC19, Df(1)dm75e19, Df(1)N8, Df(1)A113, DF(1)JC70.  For three of them, Df(1)A113, Df(1)JC70, and Df(1)BA1, the student’s t-test probabilities show a significant difference between control and experimental siblings.  The remaining strain has no significant trans-regulation effect on ovo gene activity.  Df(1)BA1 enhanced the ovo gene expression activity about 20% when either ovo3U21 or ovo4B8 is used.  It was suggested that a suppressor of ovoD (1F-2B+ locus) maps within 1E3-4 to 2B3-4 because of the dramatic gene dose effect of this region on the development of ovoD2/+ ovaries (Pauli et al, 1995).  In contrast, it was found that Df(1)A113 and Df(1)JC70 have repressing effects on ovo expression.  Df(1)A113 (3D6-E1; 4F5) removes several genes beside ovo, showed a very significant repression effect in outcrosses, about 82% and 47% (e/C), in ovo3U21 and ovo4B8 respectively.  That data obtained in Df/+ females has a particular quantitative significance, which implies that the missing loci have the complementary effect. It was shown that this region is contains a gene or genes resulting in genetic unbalance (Cline et al., 1987).  Also, Oliver et al., (1988) show that in deficiency lines, which they have used, strains removing both ovo and snf together are reducing viability of the progeny, that is, there is a synergistic interaction between ovo and snf.  

Region 5-8.  Twelve overlapping deletions have been tested in this region.  Two deletions Df(1)N73 (5C3-5;5E-8) and Df(1)Lz90b24 (8B-D) caused very significant repressing effects, implying the presence of trans-activating loci, one deletion Df(1)RA2 (7D10;8A4-5) resulted in heterozygous experimentals with significant elevation in LacZ compared to siblings, implying a trans-repressor locus.  It has been reposted that Df(1)RA2 strongly enhances ovoD  phenotypes due to the function of otu+ in germline sex determination (Pauli et al., 1993).  However, since out protein is cytoplasmic, it is unlikely that the Df(1)RA2 effect on ovo::lacZ promoter activity is due to changing dosage of otu.  It is also suggested that there is a synergistic interaction between ovo and lozenge, eye phenotype, which is deleted by Df(1)Lz90b24, and here the data showed a trans-activating effect due to this deletion.  The other deletions do not cause any significant effect on gene activity.

Region 9-10.  In this cytological position nine deficiency lines had been tested.  Since this region was very dense for putative trans-regulation repressors, it was group in a small region.  Among nine of the deficiencies were used six of them showed a repressor effect.  These effective regions were: Df91)vL15, Df(1)N110, Df(1)HC133, Df(1)vL11, Df(1)KA7, and Df(1)N71.  This region seems to have a very important effect on ovo, since in the 9Bto 10F interval there are various levels of repressor effect.  Two common overlapping regions were found; one was from 9C4 to 9D1-2, and the other was from 10A to10F6.  Other repressor effects from strongest to weakest was Df(1)vL11 (9C4;10A1-2), Df(1)HC133 (9B9-10;9E-F), Df(1)N110 (9B3-4;9D1-2), and Df(1)v-L15 (9B1-2;10A1-2), Df(1)KA7 (10A9;10F6-7) breakpoint was outside the first loci in the examined region.  Df(1)Ka7 and Df(1)vL15 show about 20% increase in the heterozygous siblings, the longest and the shortest breakpoints, respectively.  Three out of five repressing effect intervals, Df(1)v-L11 (9C4; 10A1-2), Df (1)HC133 (9B9-10; 9E-F), Df(1) N110 (9C4; 10A1-2) is the strongest of all in Df/+ and bearing the common region among the five strains, which is 9C4; 10A1-2.  

Region 11-13.     Eight deficiency lines were in this region, Df(1)JA26, Df(1)HF368, Df(1)N12, Df(1)C246, Df(1)g, Df(1) RK2, Df(1)RK4, and Df(1) sd 72b   .  It has been found that this region involves five overlapping deletions that gave rise to repressing effect on ovo gene expression.  According to common regions of the cytological positions, these overlapping deletions were grouped into three loci.  These three common regions, which are responsible from trans-regulation activity of ovo, reside on 11D0F; 12B-D, and 13F-B regions of the X-chromosome.  Df(1)N12 (11D12;11F1-2) and Df(1)C246 (11D-E; 12A1-2) were in the 11D-F loci, Df(1)g (12B;12E8) and Df(1)RK2 (12D2-E1; 13A2-5) were in the 12B0D region, and Df(1)sd72B (13F1-14B1) in the 13B-14B loci, all of which in this examined region showed a repressor activity. The strongest effect among the X-chromosome screening was located in 11D1-11F1-2 excised region of X-chromosome, this deletion corresponds to Df(1)N12 strain, which shows a significant effect as well as high gene activity repression, Around 140% to 240% E/C in Df/+ flies for both ovo::LacZ constructs.  In addition, it has been reported that reduced dose of the 11D-F region results in synergistic mutant phenotypes with a number of somatic sex determination genes (Belote et., 1985).  Furthermore, Flybase reports that this region seems to include locus involved in early sex determination examined by Scott and baker (1986). However, ambiguities in deficiency breakpoint assignments complicate interpretation.  For example, first loci, which includes Df(1)N12 and Df(1)C246 due to uncertainty at the distal end breakpoints of Df(1)C246 (12D-e; 12A1-2); the trans-acting repressor of ovo maybe located in 11E-F rather than 11D-F. Similarly, for the second loci in this region ambiguity at the distal breakpoint of Df(1)RK2 also cause a dilemma about the location of the trans-acting repressor, since the question was the common region between Df(1)g and Df(1)RK2 was whether in the 12D-E or in the 2E1-2E8 of X-chromosome. On the other hand, the last loci were determined by the only one deficiency strain.  In this case, the problem was whether determination of the loci was accurate enough, or whether another locus is involved in repressing of ovo reporter activity which Df(1)sd72b (13F1–14B1) may have a common region with.  This deficiency removes several lethal mutations, Myb, sd (scalloped), shi (shibiri), and exd (extradenticle).  Two genes previously cloned in the 13F cytological region are the Drosophila c-myb oncogene homolog (Katzen et al, 1985) and a G protein b-subunit (Yarfitz et al 1988).  It has been suggested that the sd+ gene might be associated with more than one product (perhaps a differential processing) or it might reflect differential tissue and/or temporal regulation (Campbell et al., 1991).

Region 14-20.   In this region eight deficiency strains, Df(1)4b18, Df(1)rD1, Df(1)B, Df(1)N19, Df(1)JA27, Df(1)HF396, DF(1)DCB1, and Df(1) A-209, were tested.  According to measured specific activities Df(1)4b18 (14B8; 14C1) and DF(1) B (15F9=16A6-7) showed significant activating effect on ovo promoter, activity of the former was weaker than that of latter.  Since there is no common region between these two putative trans-acting activators, interpretations of the results gave rise to two loci, 14B8-14C1 and 15F-16A1; 16A6-9. In addition, the Flybase report for Df(1) shows that 70 deletion that breaks within the second exon of the non A (no on or transient A) gene from Stanewsky et al (1993). As a result of X-chromosome screening, 45 deficiency strains were tested and found 17 regions were trans-regulating ovo promoter.  These regions were classified into 12 loci according to their overlapping common regions.  Among these, six, of which were showing trans-acting activator effect, and seven, of which were responsible for trans-acting repressor effect on ovo promoter.   Furthermore, one deficiency strain, Df(1)sc14, showed a significant trans-acting repressor effect in only ovo4B8 strain but not in ovo3U21 strain.  This maybe explained by position effect of P[ovo::LacZ] construct due to landing on P element transposase onto insertion site or by difference between the size of the ovo::LacZ constructs, e.g. ovo3U21 carries 200 bp longer than ovo4B8 at the N-terminal end that may cause a better translation product.  Consequently, among the X-chromosome screening data, it was found that two of the deficiency lines. Df(1)A113 and Df(1)JC70, which are removing ovo and snf along with the several genes due to deletions, and correspond to one loci acting as an repressor, were taking into more detailed investigations.  These results suggested a negative autoregulation mechanism in the ovo promoter.  Therefore, negative autoregulation of ovo was examined with three approaches: ovo point mutations, more defined deficiency strain, and downstream genes.

DISCUSSION

  The sex determination involves complex set of mechanisms.  The fly is chosen to be studied since Drosophila is inexpensive to rear, generates large numbers of progeny, and has nearly a century of accumulated data upon which to design experiments.  Mutational analysis of cell biological and developmental process is relatively simple, even if the resulting mutations are organism-lethal when homozygous.  This is decided advantage over mammalian genetics, in which lethal mutations often die in utero, which complicates the ability to examine and interpret mutant phenotypes. The Drosophila genome is one-twentieth the size of the mammalian genome, making insertional mutagenesis and positional cloning much less difficult.  Additionally, mammalian genetics lacks genetic tools such as balancers that make the maintenance of sterile and lethal-mutations nearly trouble free in Drosophila.  Nematodes have many of the same conveniences as Drosophila, with the added advantage of a highly stereotyped pattern of embryonic (and post-hatching) cell lineages.  The more-regulative character of Drosophila development induces complications lacking from worm genetics, with respect to cellular level analysis of mutant phenotypes.  Perhaps, the most compelling reason to take advantage of the specialized properties of Drosophila, is the extent to which prior studies have shown that genes, proteins, and developmental pathways and processes are conserved among metazoan groups.  We can, with high confidence, study sex determination in Drosophila with a reasonable confidence that what we learn can be extrapolated to other species, including man and his clinical diseases.

  The deletion mapping technique was used to identify the locations of genes that are required for ovo trans-regulation.  Each deficiency line removes several to many genes from the genome.  A sufficiently complete set of overlapping deletions can allow, potentially, every individual trans-acting gene to be localized. Seventeen deficiencies that have effects on the ovo germline promoters are shown in Table 4.1.  Twelve deficiencies showed repressor effects, and five deficiencies showed activator effects.  Deleted regions may affect any of several processes, such as numerator elements, cell viability and differentiation, dosage compensation, and response to inductive signals from soma.  Determination of which gene within a specific region is responsible for the effect on ovo requires more defined deletions or having null alleles for each gene. Estimation of the Number of Trans-Regulators.  Among the seventeen deficiencies in Table 4.1, overlapping common regions identify seven that function as trans-acting repressor loci, and five that function as trans-acting activator loci.  Thus, the entire euchromatic X-chromosome may have as many as ≈10 repressor genes and ≈7 activator genes for the ovo germline promoters.  If these results were extrapolated to the entire fly genome, ≈50 repressors and ≈35 activators of ovo transcription are predicted.  These are underestimates from the data, since any given deleted common region need not remove exactly one relevant gene. Is it reasonable for nearly 85 genes to be involved in regulating the ovo germline promoters?  Precedents from other developmental control systems suggest this is not an implausibly high number.

Regulation of the master sex determination gene Sxl is complex.  To establish somatic sex determination in the early embryo, nine genes are required to activate the Sxl early promoter.  These are sis-a, sis-b, sis-c, run, da, emc, gro, dpn, and her.  In biochemical terms, most are DNA-binding proteins.  In genetic terms, some are positive and are others are negative regulators.  Maintenance of Sxl expression involves positive autoregulation at the level of pre-mRNA alternative splicing.  At least five genes are known to play specific roles in this process: Sxl itself, snf, vir, her, and fl(2)d.  Function of Sxl in the germline is regulated in several ways.  Germline-specific transcriptional control of Sxl is still conjectural, but it is clear that the somatic functioning numerator elements play no role in the germline.  It is possible that ovo may play an important role in germline transcriptional control of Sxl (e.g., Lee. 1998); certainly it has an indirect role (e.g., Oliver et al., 1993).  Splicing-level autoregulation of Sxl is active in the female germline, and it involves the same genes that function in this process in somatic cells.  Once Sxl protein is produced in female germline cells, the otu protein plays an important role in this relocalization into the nucleus.  Thus, a minimum of sixteen genes is required for proper regulation of Sxl.

Establishment of the body plan in Drosophila is also under complex transcriptional control.  Maternally localized RNA and protein molecules establish the gross body axes: anterior-posterior and dorsal-ventral.  Hierarchically organized sets of zygotically activated genes are transcribed, and their protein products serve to refine the body axes into progressively finer-grained structures.  The metameric anterior-posterior body axis is specified by so-called gap genes, pair rule genes, and segment polarity genes, which create the segment-sized repeating units of the body.  Homeotic genes encoded by the Antennapedia Complex (ANT-C) and bithorax Complex (BX-C) then confer position-specific identities upon each segment. During the cellular blastoderm stage, gap genes and maternal coordinate genes regulated the activation of primary pair rule genes such as even-skipped (eve).  These are expressed in seven one-segment-wide stripes that alternate with on-segment-wide regions of non-expressing cells.  For example, the second stripe of eve expression is positively regulated by hunchback and bicoid, and negatively regulated by giant and Kruppel.  All four proteins directly bind to a 500-bp-long “eve-stripe 2 enhancer.”  Binding have giant and Kruppel is competitive with binding of hunchback  and bicoid, and vice versa.  Thus, spatially controlled concentrations of giant, Kruppel, bicoid, and hunchback proteins result in spatially restricted activation or repression of the eve stripe 2 enhancer.  The remaining six stripes of eve expression are similarly controlled by other DNA-binding proteins, which are acting another discrete stripe-specific enhancers. Ectopic expression of homeotic genes can have disastrous effects on development.  Thus, a special heterochromatin-like mechanism functions to ensure that ANT-C and BX-C genes are inactive in cells and tissues that do not require their expression.  Stable repression is mediated by the Polycomb class of proteins, which number over forty. Each of these examples illustrates that developmental control of individual gene transcription is mediated by both positive and negative effectors, and that sometimes the number of such upstream regulators numbers between one and several dozen.  Thus, our estimate of 85 regulators of the ovo germline promoters is not out of line with other developmentally regulated systems.

Evaluation of Candidate Loci Within Common Regions.   Based overlapping cytology, seventeen deficiencies that affected the ovo germline promoter fell into twelve common regions.  Each of these will be discussed in turn below. Of particular interest was the relationship each of our trans-acting may have with Su(ovoD) and E(ovoD) loci identified in a generic screen by Pauli et al. (1995).  In general, it is not straightforward to suggest identities between Su(ovoD) or E(ovoD) loci and our trans-acting repressor or activator loci because of the dissimilar means of assaying these gene-dose-sensitive interactions.  We use quantitative measures of LacZ reporter activity as a proxy for ovo transcription, while Pauli et al. (1995) use semi-quantitative measures of vitellogenesis.

Region 1 (polytene bands 1A1; 2A1-4):  The distal region of the X-chromosome showed a trans-regulating activator effect on the ovo promoters.  This region includes the acheate-scute complex (AS-C), home of the X-chromosome numerator element sis-b (Cline, 1988; Parkhurst and Ish-Horowicz, 1990), also known as scute-T4.  This numerator has no function in the female germline (Granadino et al., 1989).  Pauli et al., (1995), using other deficiency strains affecting this section of the X-chromosome, identified a strong Su(ovoD) locus in the polytene region 1E3-4; 2B3-4 that may correspond with our trans-activator.  Flybase indicates that this region contains over 100 genes, among them 23 unassigned open reading frames, 33 genes defined by apparent visible mutations, 53 lethal genes,, and two female sterile loci.

Region 2 (polytene bands 4C15-16; 4F15):  This region includes the ovo and snf loci, and was identified by Pauli et al., (1995) as a strong E(ovoD) due to the effects of these loci.  Further discussion is deferred to mechanism of ovo autoregulation, which deal with ovo negative regulation. Region 3 (polytene bands 5C3-5; 5E8):  This region has a trans-regulatory activation effect on the ovo germline promoters.  Deficiency for this region showed no interaction with ovoD in the vitellogenesis assay (Pauli et al., 1995).  Examination of Flybase records for this region reveals over twenty genes, and no strong candidates that may account for the interaction with the ovo promoters.

Region 4 (polytene bands 7D10; 8A4-5):  Results  showed that this region contains a transacting-repressor of ovo germline promoter activity.  This region reported by Pauli et al. (1995) to contain a strong E(ovoD) locus, which was identified as the ovarian tumor gene (Pauli et al., 1993, 1995).  It is virtually certain that the repressor-of-ovo is distinct from otu.  First, the otu protein is cytoplasmic and plays a role in egg chamber cytoskeletal function (Nagoshi et al., 1997).  Second, the ovo protein binds to the otu promoter in vitro (Garfinkel et al., 1997; Lee, 1998, Lee and Garfinkel 1998; Lu et al., 1998).  Third, under certain conditions, in vivo activity of the otu promoter is dependent upon ovo protein production (Hager and Cline, 1997; Lu et al., 1998).  Examination of Flybase reveals that this region contains fifty genes mutable to lethal, visible, or female-sterile phenotypes, but none appear to be a strong candidate for the repressor-of-ovo locus.

Region 5 (polytene bands 8B5-8; 8DE):  This region also has an apparent repressor of ovo germline promoter activity.  Deficiency for this region showed no interaction with ovoD mutations in the Pauli et al. (1995) vitellogenesis assay.  Examination of Flybase reveals that this region contains thirty genes mutable to lethal, visible, or female sterile phenotypes.  One gene stands out as a candidate for the repressor, namely, lozenge.  This is a complex locus that is mutable to female sterility (Green and Green, 1949, 1956), and it is named for a reduced-eye, smoothened-eye, mutant phenotypes.  Interestingly, certain ovo-mutant alleles are called “lozenge-like” in recognition of a similar eye defect (Oliver et al., 1987; Mevel-Ninio et al., 1989; Garfinkel et al., 1992).  The lz gene codes for a transcription factor (Dag et al., 1996). Region 6 (polytene bands 9C4; 9D1-2):  The cytological assignment of this region is based on the overlap of three deficiencies:  Df(1)N110, Df(1)H133, and Df(1)v L11.  Together, they mark a trans-acting repressor of ovo promoter activity.  According to  Pauli et al. (1995), only two of these three deficiencies behaved as if they exposed an E(ovoD) locus, while the third had no effect.  In combination with positive results from other deficiencies, Pauli et al. positioned the E(ovoD) locus at cytological region 9E-F.  Thus, it is again possible that the repressor-of-ovo we identified is distinct from a nearby E(ovoD) locus, and is among the half-dozen loci identified by Flybase as mapping into this interval.

Region 7 (polytene bands 10A6; 10F6-7):  This region contains a trans-acting repressor of ovo promoter activity.  According to Pauli et al. (1995), the defining deficiency had no significant interaction with ovoD alleles.  Examination of Flybase reveals that this region includes the somatic X-chromosome numerator element sis-a, which also has no function in germline development (Granadino et al., 1989, 1990, 1997).  Given the extent of this region, it is not  surprising that Flybase identifies 65 genes with diverse phenotypes and biochemical roles; however no strong candidate locus that may count for the repressor-of-ovo locus is apparent.

Region 8 (polytene bands11D1-2; 11F1-2):   This region contains perhaps the strongest trans-acting repressor of ovo promoter activity in the survey: deficiency heterozygous experimentals had 2-2.5 fold more lacZ specific activity in their ovaries that the balancer carrying controls.  According to Pauli et al (1995), one of the two deficiencies defining this common region showed a statistically weak enhancement of ovoDalleles, while the other had a significant Su(ovoD) phenotype.  Likewise, Belote et al. (1985) and Scott and Baker (1986) reported that the same deficiency later shown to have Su(ovoD) activity also interacted with loci in the somatic sex determination pathway.  It is an open question how these three results relate to one another.  Among sixteen genes that map into this region are two signal transduction loci: the Mek3 gene, a serine-threonine-specific protein kinase in the MAP kinase pathway, and a beta subunit of the heterotrimeric GTP-binding protein. A solitary female-sterile, fs(1) K4, also maps roughly into this region; it is germline-dependent, and yields fragile eggs, a phenotype occasionally seen in the eggs laid by ovoD3/+ females.

Region 9 (polytene bands 12D2-12E1; 12E8):  This region contains a trans-acting repressor of ovo promoter activity.  According to Pauli et al. (1995), neither deficiency defining this common region interacted with ovoDalleles.  This region contains the yolkless gene (DiMario et al., 1987), which has been cloned and codes for a member of 35 known genes, including a cluster of tRNA genes, the male-germline-specific Stellate genes, and several lethal and female-sterile genes.

Region 10 (polytene bands 13F1; 14B1):  This region contains a trans-acting repressor of ovo promoter activity.  Again, no significant interaction with ovoD allel4es was observed by Pauli et al. (1995).  Podry, Katzen and others have extensively mutagenized this region due to its containing shibiri (the Drosophila homolog of dynamin), c-myb, another Gb subunit, and the homeodomain protein extradenticle.  Their work revealed a total of twenty lethal genes, ten apparent visibles, and over a half-dozen unassigned open reading frames.

Region 11 (polytene bands 14B8; 14C1):  This region contains a trans-acting activator of ovo promoter activity.  According to Pauli et al., (1995), the defining deficiency had no significant interaction with ovoD alleles.  This region is surprisingly dense genetically, as it apparently contains over forty genes.  Several behavioral genes coding for neuronal functions map here, including nonA, paralytic, and easily shocked.  The nonA gene codes for an RNA-binding protein, and is mutable to a variety of phenotypes including recessive lethality, male-courtship-strong abnormalities, and defective vision.  The location of para (a sodium channel) is particularly intriguing since parats mutations fail to complement certain napts alleles, and nap genetically overlaps the dosage compensation function maleless.  Mutations in maleless are unique among the known dosage compensation loci in having a mutant phenotype in germline clones, and they are said to suppress the female-germline-lethality of ovo null mutations.  The easily shocked locus codes for ethanolmine kinase, and mutations at this locus also interact with mle.

Region 12 (polytene bands 15F9-16A1; 16A7):  This region contains a trans-acting activator of ovo promoter activity.  According to Pauli et al. (1995), the defining deficiency had no significant interaction with ovoDalleles.  Examination of Flybase reveals that this region contains at least a dozen female-sterile loci, a dozen lethal loci (including the Bar homeodomain protein gene). There is an ambiguity in compared mean of activities.  According to the negative autoregulation mechanism, there suppose to be a linear decrease pattern correlated to increase in copy of ovo.  However, the pattern of the gene dose was reaching plato, when three copies of ovo were present in the genome. Yet, this also shows that there is a protection mechanism that counts the number of ovo versus number of X chromosome exists.  Therefore, the sex determination mechanism turns off the extra ovo in the system immediately. 

Consequently, the system prohibits more wrong information to be processed according to its default setting where if the X:A ratio equals to one the outcome is going to be prepared as female, if not turn off the mechanism towards male-like, sterile mode, or death at the embryonic stage.  This discontinuity in the linear correlation may be due to position effect of P[w+ ovo+].  Future Directions and Concluding Remarks The results of this study suggest that the ovo germline promoters are regulated by a large set of upstream factors.  Nearly a dozen of these maps to the X-chromosome, some to region that are well characterized genetically.  Further deficiency mapping experiments, and assessment of the phenotypes of single-P insertion lines with female-sterile or perhaps lethal phenotypes, would be required to identify the relevant genes.  Some regions contain candidate loci that have been cloned (e.g. lozenge); in this example, either in vitro DNA-binding experiments using Lz protein and the ovo promoter region, or computational assessment of the likelihood that the ovo promoter contains binding sites for Lz can be done. Another potential upstream factor not assessed in these experiments is the ecdysone regulatory hierarchy.  The steroid ecdysone is the endocrine hormone that controls molting and metamorphosis in arthropods.  It is an allosteric effector for a heterodimeric receptor of the steroid-receptor superfamily.  The ovaries of adult females manufacture their own ecdysone, and the gene for the rate-limiting steroidogenic enzyme transcribed beginning in Stage 7-8 egg chambers.  This stage immediately precedes the onset of the highest level of ovo transcription (Mevel-Ninio et al., 1991; Garfinkel et al., 1994).  Mutations in the E74 and E75 genes, when made homozygous in germline clones, cause arrest of oogenesis at Stage 7-8, as if egg chambers are unable to respond to endogenous ecdysone and continue differentiation.  Both E74 and E75 code for transcription factors that are induced as immediate-early primary responses to added ecdysone both in-vivo and in tissue culture assays.  Thus, it is reasonable to suggest that one or both of these proteins will bind to the ovo germline promoter in an in vivo effect on expression of the ovo::lacZ reporter using the methods established in this dissertation.  

Acknowledgement:  This work had been comppleted in the laboratory of Dr. Mark Garfinkel at Illinois Institute of Technology.   Dr. Demet Sag initiated the project with her own  ideas, was fully supported by Turkish National Merit Fellowship, and  earned NATO Advanced Science institute  Grant on Genome Structure and Functional Genomics, Elba Island, Italy, accepted to work with Dr. Mevel Ninio, based on the proposal submitted by Demet Sag on Molecular Mechanism of  ovo, through EMBO long term scholarship in France.

BIBLIOGRAPHY
  1. Ashburner, M., Drosophila Laboratory Manual, Cold Spring Harbor Laboratory Press, pp. 317-318, 1989
  2. Baker, B.S., “Sex in flies: the splice of life,” Nature 340, pp.521-524, 1989.
  3.  Baker, B.S. and Belote, J.M., “Sex determination an dosage compensation in Drosophila melanogaster” Ann. Rev of Genetics 17, pp345-393, 1983.
  4. Baker B.S. and Ridge, K.A., “Sex and the single cell I. On the action of major loci affecting sex determination in Drosophila melanogaster,” Genetics 94, pp.383-423, 1980.
  5.  Bell, L.R. Horabin, J.I., Schedl, P., and Cline, T.W., “Sex-lethal, a Drosophila sex determination switch gene, exhibits sex specific RNA spilicing and sequence similarity to RNA binding proteins,” Cell 55, pp.1037-1046, 1988.
  6. Bell, L.R. Horabin, J.I., Schedl, P., and Cline, T.W., Positive autoregulation of Sex-lethal by alternative spilicing maintains the female determined state in Drosophila, Cell Vol 65, pp.229-239, 1991.
  7.  Belote, J.M., Handler, A.M., Wolfner, M.F., Livak, K.J., and Baker, B.S., Sex-specific regulation of yolk protein expression in Drosophila, Cell 40, pp.339-348, 1985.
  8.  Bohringer- Manheim Product Support, Chloroform Red-beta-D_Galactopyranoside sodium salt (CPRG) provided by ID#0223p, June 1986 dated information, fax received on 2/26/1996.
  9.  Bopp, D., Bell, L.R., Cline, T.W., Schedl, P. Developmental distribution of female specific Sex-Lethal proteins in Drosophila melanogaster, Genes and Development 5, pp.403-415,, 1991.
  10.  Bopp, D., Sex-specific control of Sex-lethal is a conserved mechanism for sex determination in the genus Drosophila, Development 122, pp.971-982, 1996.
  11.  Bopp, D., Horabin, J.I., Lersch, R.A., Cline, T.W., Schedl, P., Expression of the Sex-lethal gene is controlled at multiple levels during Drosophila oogenesis, Development 118, pp.797-812, 1993.
  12.  Bradford, M. M., A Rapid and sensitive method for the Qantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding, Analytical Biochemistry 72, pp.248-254, 1976.
  13.  Bridges, C.B., Sex in relation to chromosomes, Am. Nat.59, pp.127-137, 1925.
  14.  Bridges, C.B., Triploid intersexes in Drosophila melanogaster, Science 54, pp.252-254, 1921.
  15.  Bridges, C.B., Non-disjunction as proof of the chromosome theory of heredity, Genetics 1, pp.1-52, 1916.
  16.  Burtis, K.C. and Baker, B.S., Drosophila doublesex gene controls somatic sexual differentiation by producing alternatively spliced mRNAs encoded related sex-specific yolk protein gene enhancer, The EMBO J., Vol. 10, No. 9, pp.2557-2582, 1991.
  17.  Busson, D., Gans, M., Komitopoulou, and Masson, M., Genetic Analysis of three dominant female-sterile mutations located on the X-chromosome of Drosophila melanogaster, Genetics 105, pp.309-325, 1983.
  18.  Campbell, S.D., Duttoroy, A., Katzen, A.L., and Chovnick, A., Cloning and characterization of the scalloped region of Drosophila melanogaster, Genetics 127, pp.367-380, 1991.
  19.  Cline, T.W., The Drosophila sex determination signals: how do flies count two?, Ann. Rev. Genet 30, pp637-702, 1996.
  20.  Cline, T.W., Evidence that sisterless-a and sisterless-b are two of several discrete numerator elements of the X/A ratio sex-determination signal in Drosophila that switch Sxl between two alternative stable expression states, Genetics 119, pp.829-862, 1988.
  21.  Cline, T.W., Re-evaluation of the functional relationship in Drosophila between a small region on the X-chromosome (3E8-4F11) and the sex determination gene, Sex-lethal, Genetics 116, s:12, 1987.
  22.  Cline, T.W., A female specific lethal lesion in an X-linked positive regulator of the Drosophila sex determination gene, Sex-lethal, Genetics 113, pp.641-663, 1986.
  23.  Cline, T.W., Autoregulatory functioning of a Drosophila gene product that establishes and maintains the sexuality determined state, Genetics 107, pp.231-277, 1984.
  24.  Cline, T.W., Functioning of the gene daughterless and Sex-lethal in Drosophila germ cells, Genetics 107, s16-17, 1983.
  25.  Cline, T.W., A sex specific temperature-sensitive maternal effect of the daughterless mutation of Drosophila melanogaster, Genetics 84, pp.723-742, 1976.
  26.  Cronmiller, C., Schedl, P., Cline, T.W., Molecular characterization of daughterless, a Drosophila sex determination gene with multiple roles in development, Genes Dev. 2: 155-167, 1988.
  27.  Despande, G., Samuels., M.E., and Schedl, P.D. “Sex-lethal interacts with splicing in vitro and in vivo, Molecular and Cellular Biology, Vol. 16, No 8, pp. 5036-5047, 1996.
  28.  Despande, Stukey, J., and Schedl, P., scute (sis-b) function in Drosophila sex determination, Moll. Cell Biology 15, pp. 4430-4440, 1995.
  29.  DiMario, P.J., and Mahowald, A.P., Female sterile (1) yolkless: A recessive female sterile mutation in Drosophila melanogaster with depressed numbers of coated pits and coated vesicles within the developing oocytes, J. Cell Biology 105: 199-206, 1987.
  30.  Erickson, J.W. and Cline, T.W., A bZIP protein, sisterless-a, collaborates with bHLH transcription factors early in Drosophila development to determine sex, Genes and Dev. 7: 1688-1702, 1993.
  31.  Erickson, J.W. and Cline, T.W., Molecular nature of the Drosophila sex determination signal and its link to neuorogenesis, Science 251, pp. 1071-1074, 1991.
  32.  Estes, P.A., Keyes, L.N., and Schedl, P., Multiple response elements in the sex-lethal early promoter ensure its female-specific expression pattern, Mol Cell Biol 15, pp. 904-917, 1995.
  33.  Flickinger, T.W. and Salz, H.K., The Drosophila sex determination gene snf encodes a nuclear protein with sequence and functional similarity to the mammalian U1A snRNP, Gene and Development 8, pp. 914-925, 1994.
  34.  Flybase, The Drosophila genetic database, http://www.flybase.bio.indiana.edu, 1998.
  35.  Gans, M.C., Audit and Massson, M., Isolation and characterization of sex-linked female-sterile mutations in Drosophila melanogaster, Genetics 81, pp. 683-704, 1975.
  36.  Garfinkel, M.D., Lee, S., and Sigar, I., DNA-binding targets of the Drosophila melanogaster OVO protein, 38th Annual Drosophila Research Conference, Chicago, IL, 1997.
  37.  Garfinkel, M.D., Wang, J., Liang, Y., and Mahowald, A. P., Multiple products from the shavenbaby-ovo gene region of Drosophila melanogaster: relationship to genetic complexity, Molecular and Cell Biology, Vol. 14, No., 10, pp. 6809-6818, 1994.
  38.  Garfinkel, M.D., Lohe, A.H., and Mahowald, A.P., Molecular genetics of the Drosophila melanogaster ovo locus, a gene required for sex determination of germline cells, Genetics 130, pp. 791-803, 1992.
  39.  Gollin, S. M. and King, R. C., Studies on fs(1)1621, a mutation producing ovarian tumors in Drosophila melanogaster, Developmental Genetics 2, pp. 203-218, 1981.
  40.  Granadino, B., Compuzano, S., and Sanchez, L., The Drosophila melanogaster fl(2)d, a gene needed for Sex-lethal expression in Drosophila melanogaster, Genetics 130, pp. 597-612, 1990.
  41.  Granadino, B., Santamaria, P., and Sanchez, L., Sex-determination in the germ line of Drosophila melanogaster: activation of the gene Sex-lethal, Development 118, pp. 813-816, 1993.
  42.  Granadino, B., Juan, A. B. S. B, Santamaria, P., Sanchez, L., Distinct mechanisms of splicing regulation in vivo by the Drosoophila protein Sex-lethal, PNAS USA, 94, pp. 7343-7348, 1997.
  43.  Hager, J.H. and Cline, T.W., Induction of female Sex-lethal RNA splicing in male germ cells: implications for Drosophila germline sex-determination, Development 124, pp. 5033-5048, 1997.
  44.  Hilfiker, A., Amrein, H., H., Dobendorfer, A., Schneiter, R, and Nuthiger, R., The gene virilizer is required for female-specific splicing controlled by Sxl, master gene for development in Drosophila, Development 121, pp. 4017-4026, 1995.
  45.  Horabin, J.I., Bopp, D., Waterburry, J., and Schedl, P., Selection and maintenance of sexual identity in the Drosophila melanogaster, Genetics 141, pp. 1521-1565, 1995.
  46.  Horabin, J. I. And Schedl, P., Regulated spilicing of the Drosophila Sex-lethal male exon involves a blockage mechanism, Moll. Cell. Biol. 13, pp. 1408-1414, 1993.
  47.  Horabin, J.L., and Schedl, P., Sex-lethal autoregulation requires multiple cis-acting elements upstream and downstream of the male exon and appears to depend largely on controlling the use of the male exon 5’ splice site, Moll. Cell. Biol. 13: pp. 7734-7746, 1993.
  48.  Hoshijima, K., Kohyama, A., Watakabe, I., Inonue, K., Sakamato, H., and Shimura, Y., Transcriptiuonal regulation of the Sex-lethal gene by helix-loop-helix proteins, Nucleic Acids Res. 23, pp. 3441-3448, 1995.
  49.  Inonue, K., Hojhijima, K., Sakamato,, H., and Shimura, Y., Binding of the Drosophila Sex-lethal gene product to the alternative splice site of transformer primary transcript, Nature 344, pp. 461-463, 1990.
  50.  Keyes, L.N., Cline, T.W., and Schedl, P., The primary sex-determination signal of Drosophila acts at the level of transcription, Cell, Vol. 68, pp. 933-943, 1992.
  51.  Komitopoulou, K., Gans, M., Margaritis, L.H., Kafatos, F.C., and Masson, M., Isolation and characterization of sex-linked female-sterile mutants in Drosophila melanogaster with special attention to eggshell mutants, Genetics 105: 897-921, 1983.
  52.  Lee, S., DNA binding targets of the Drosophila melanogaster OVO protein, PhD Dissertation, Illinois Institute of Technology, Chicago, IL, USA, 1998.
  53.  Lee, S. and Garfinkel, M.D., DNA-binding targets of the Drosophila melanogaster OVO protein, Nucleic Acid. Res.
  54.  Linsley, D.L., and Zimm, G., The genome of the Drosophila melanogaster, Academic Press, San Diego, New York, 1980.
  55.  Lu, J., Andrews, J., Pauli, D., and Oliver, B., Drosophila OVO zinc finger protein regulates ovo and ovarian tumor target promoters, Dev. Genes. Evol., pp. 1-10, 1998.
  56.  Luccesi, J.C. and Manning, E., Gene dosage compaensation in Drosophila melanogaster, Adv. Genetics 24, pp. 371-429, 1987.
  57.  Madl, J.E., and Herman, R.K., Polyploids and sex determination in Caenornabtidis elegans, Genetics 93, pp. 393-402, 1979.
  58.  Mevel-Ninio, M., Mariol, M.C. and Gans, M., Mobilization of the gypsy and copia retrotransposans in Drosophila melanogaster induces reversion of the ovoD dominant female-sterile-mutations: molecular analysis of revertant alleles, EMBO J. 8, pp. 1549-1558, 1989.
  59.  Mevel-Ninio, M., Terracol, R., and Kafatos, F.C., The ovo gene of Drosophila encodes a zinc finger protein required for female germ line development, EMBO J. 10, pp.2259-2266, 1991.
  60.  Mevel-Ninio, M., Guenal, I., and Limburg-Bouchen, B., Production of dominant female sterility in Drosophila melanogaster by insertion of the ovoD1 allele autosomes: use of transformed starins to generate germline mosaic, Mechanism of development 45, pp. 155-162, 1994.
  61.  Mevel-Ninio, M., Terracol, R., Salles, C., Vincent, A., and Payre, F., ovo, a Drosophila gene required for ovarian development, is specially expressed in the germline and shares most of its coding sequences with shavenbaby, a gene involved in embryo patterning, Mecahnism of Development 49, pp. 83-95, 1995.
  62.  Mevel-Ninio, M., Fouilloux, E., Genal, I.  and Vincent, A., The three point dominant female-staerile mutations of Drosophila ovo gene are point mutations that create new translation-initiatorAUG codons, Development 122, pp. 4131-4138, 1996.
  63.  Mohler, J.D., Developmental genetics of the Drosophila egg. I.: Identification of 50 sex-linked cistrons with maternal effects on embryonic development, genetics 85, pp. 259-272, 1977.
  64.  Nagai, K., Oubridge, C., Jessen, T. H., Li, J., and Evans, P.R., Crystal structure of the RNA-binding domain of the U1 small nuclear ribonucleoprotein A, Nature 348, pp. 515-520, 1990.
  65.  Nagoshi, R.N., McKeown, M., Burtis, K.C., Belote, J.M., and Baker, B., The control of alternative spilicing at genes regulating differentiation in D. melanogaster, Cell, Vol. 53, pp.229-236, 1988.
  66.  Nagoshi, R.N., and Baker, B., Regulation of sex-specific RNA splicing at the Drosophila doublesex gene: cis-acting mutations in exon sequences alter sex specific RNA splicing patterns, Genes and Development 4, pp. 89-97, 1990.
  67.  Nagoshi, R.N., Patton, J.S., Bae, E., and Geyer, P., The somatic sex determines the requirement for ovarian tumor gene activity in the proliferation of the Drosophila germline, development 121, pp.579-587, 1995.
  68.  Nothiger, R., and Steinmann-Zwicky, M., Meier-Gerschwiller, P., and Weber, T., Sex determination in the germline of Drosophila depends on genetic signals and inductive somatic factors, development 107, pp.505-518, 1989.
  69.  Oliver, B., Singer, J., Laget, V., Pennetta, G. and Pauli, D., Function of Drosophila melanogaster ovo– in germ line sex determination depend on X-Chromosome number, Development 120, pp.1-11, 1994.
  70.  Oliver, B., Kim, Y. and Baker, B., Sex-lethal, master and slave: a hierarchy of germ line sex determination in Drosophila, Development 119, pp. 897-908, 1993.
  71.  Oliver, B., Pauli, D., and Mahowald, A.P., Genetic evidence that the ovo locus is involved in Drosophila germ line sex determination, Genetics 125, pp. 535-550, 1990.
  72.  Oliver, B., Perrimon, N, an Mahowald, A.P., The ovo locus is required for sex-specific germ line maintenance in Drosophila, Genes and Development 1, pp. 913-923, 1987.
  73.   Oubridge, C., Ito, N., Evans, P.R., Teo, C.H., and Nagai, K., Crystal structure at the 1.92A resolution of the RNA binding domain of the U1A splicesomal protein completed with an RNA hairpin, Nature 372, pp.432-438, 1994.
  74.  Pauli, D., Oliver, B., and Mahowald, A.P., Identifications of regions interacting with ovo D mutations: potential new genes involved in germline sex determination in Drosophila melanogaster, Genetics 139, pp.713-732, 1995.
  75.  Pauli, D., Oliver, B., and Mahowal, A.P., The role of the ovarian tumor locus in Drosophila melanogaster germ line sex determination, Development 119, pp.123-134, 1993.
  76.  Pauli, D. and Mahowald, A.P., Germline sex determination in Drosophila melanogaster, Trends in Genetics, Vol. 6, No. 8, pp.259-264, 1990.
  77.  Parkhurst, S.M., Bopp, D., and Ish-Horowicz,  X:A ratio, the primary sex determining signal in Drosophila, is transduced by helix-loop-helix proteins, Cell, Vol. 63, pp.1179-1191, 1990.
  78.  Perrimon, N., Mohler, D., Engsttrom, L., and Mahowald, A.P., X-linked female-sterile loci in Drosophila melanogaster, Genetics 113, pp.695-712, 1986.
  79.  Perrimon, N., Engstrom, L., and Mahowald, A.P., The effects of zygotic lethal mutations on female-germ-line functions in Drosophila, Developmental Biology 105, pp. 404-414, 1984.
  80.  Perrimon, N., Clonal analysis of dominant female-sterile, germline-dependent mutations in Drosophila melanogaster, Genetics 108, pp.927-939, 1984.
  81.  Perrimon, N. and Gans, M., Clonalo analysis of the tissue specificity of recessive female-sterile mutations of Drosophila melanogaster using a dominant female sterile mutation Fs(1)K1237, Developmental Biology 100, pp. 365-373, 1983.
  82.  Rodesch, C., Geyer, P.K., Patton, J.S., Bae, E., and Nagoshi, R.N., Developmental analysis of the ovarian tumor gene during Drosophila oogenesis, Genetics 141, pp.191-202, 1995.
  83.  Sag-Ozkol, D., Tekin, S., Garfinkel, M.D., Gene-dose sensitive trans-acting regulators of the Drosophila melanogaster germline promoter, 38th Annual Drosophila Research Conference, Chicago, IL, USA, 1997.
  84.  Sag-Ozkol, D., and Garfinkel, M.D., Negative autoregulation of Drosophila melanogaster female germline specific gene, ovo (in preparation).
  85.  Sag-Ozkol, D., and Garfinkel, M.D., X-chromosome screening of Drosophila melanogaster to find numerator elements of germline sex determination (in preparation).
  86.  Salz, H.K. and Flickinger, T.W., Both loss of function and gain-of-function mutations in snf define a role for snRNP proteins in regulating Sex-lethal pre-mRNA splicing in Drosophila development, Genetics 144, pp.95-108, 1996.
  87.  Salz, H.K., Maine, E.M., Keyes, L.N., Samuels, M.E., Cline, T.W., and Schedl, P., The Drosophila female-specific sex-determination gene, Sex-lethal has stage-, tissue-, and sex-specific RNAs suggesting multiple models of regulation, Genes and Development 3, pp.708-709, 1989.
  88.  Salz, H.K., Cline, T.W., and Schedl, P., Functional changes associated with structural alterations induced by mobilization of a p element inserted in the Sex-lethal gene of Drosophila, Genetics 117, pp.221-231, 1987.
  89.  Sanchez, L., Granadino, B., and Torres, M., Sex determination in Drosophila melanogaster, X-linked genes involved in the initial step of Sex-lethal activation, Developmental Genetics 15: 251-264, 1994.
  90.  Sass, G., Mohler, J.D., Walsh, R.C., Kalfayan, L.J. and Searles, L.L., Structure an the expression of hybrid dysgenesis-induced alleles of the ovarian-tumor (otu) gene in Drosophila melanogaster, Genetics 133, pp.253-263, 1993.
  91.  Sass, G., Comer, A.R. and Searles, L.L., The ovarian tumor protein isoforms of Drosophila melanogaster exhibit differences in function, expression, and localization, developmental Biology 167, pp.201-212, 1995.
  92.  Schedl, A, Ross, A., Lee, M., Engelkamp, D., Rashbass, van Heyningen, V., and Hastie, N., Influence of PAX6 gene dosage on development: over-expression causes sever eye abnormalities, Cell 86, pp.71-82, 1992.
  93.  Schupbach, T., and Wieschhaus, E., Female sterile mutations on the second chromosome of Drosophila melanogaster II mutations blocking oogenesis an altering egg morphology, Genetics 129, pp.1119-1136, 1991.
  94.  Shupbach, T., an Wieschaus, E., Female sterile mutations on the second chromosome of Drosophila melanogaster I. Maternal effect mutations, Genetics 121, pp.101-17, 1989.
  95.  Schupbach, T., Normal female germ cell differentiation requires the female X-chromosome to autosome ratio and expression of Sex-lethal in Drosophila melanogaster, Genetics 109, pp.529-548, 1985.
  96.  Simon, J.A. and Lis, J.T., A germline transformation analysis reveals flexibility in the organization of the heat-shock consensus elements, Nucleic Acids Research, Vol 15, No.7, 1987.
  97.  Staab, H., Heller, A., Steinmann-Zwicky, M., Somatic sex determining signals act on XX germ cells in Drosophila embryos, Development 122, pp.4065-4071, 1996.
  98.  Staab, H., and Steinmann-Zwicky, M., Female germ cells of Drosophila require zygotic ovo and out product for survival in larvae and pupae, Mech. Dev. 54, pp.205-210, 1995.
  99.  Stanewsky, R., Rendahl, K.G., Dill, M., and Saumweber, H., Genetic and molecular analysis of the X-chromosomal region 14B17-14C4 in Drosophila melanogaster: Loss of function in NONA, a nuclear protein common to many cell types, results in specific physiological and behavioral defects, Genetics 135, pp.419-442, 1993.
  100.   Steinman-Zwicky, M., Sex determination of the Drosophila germ line: tra and dsx control somatic inductive signals, Development 120, pp. 707-716, 1994.
  101.  Steinman-Zwicky, M., Sxl in the germline of Drosophila: A target for somatic late induction, Developmental Genetics 15, pp.265-274, 1994.
  102.  Steinman-Zwicky, M., Sex determination in Drosophila: sis-b, a major numerator element of the X:A ratio in the soma, does not contribute to the X:A ratio in germ line, Development 117, pp. 763-767, 1993.
  103.  Steinman-Zwicky, M., How do the germ cells choose their sex? Drosophila as a paradigm, Bioassays 14 (8), pp.513-518, 1992.
  104.  Steinman-Zwicky, M.,  Anrein, H. and Nothiger, R., Genetic control of sex determination in Drosophila, Advanced Genetics 27, pp.189-237, 1990.
  105.  Steinman-Zwicky, M.,  Schmid, H. and Nothiger, R., Cell-autonomous an inductive signals can determine the sex of the germ line of Drosophila by regulating the gene Sxl, Cell, Vol. 57, pp.157-166, 1989.
  106.  Steinman-Zwicky, M., Sex determination in Drosophila. The X-chromosomal gene liz is required for Sxl activity, The EMBO Journal 7, pp.3889-3898, 1988.
  107.  Steinman-Zwicky, M. and Nothiger, R., The small region on the X chromosome of Drosophila regulates a key gene that controls sex determination and dosage compensation, Cell, Vol. 42, pp.877-887, 1985.
  108.   Sosnowski, B. A., Belote, J. M. and McKeown, M., Sex specific alternative spilicing of RNA gene results from sequence-dependent splice site blockage, Cell, Vol. 3, pp.449-459, 1989.
  109.   Yarfitz, S., Provost, N. M., and Hurley, J. B., Cloning of Drosophila melanogaster guanine nucleotide regulatory protein subunit gene and characterization of its expression during development, PNAS USA 85, pp.7134-7138, 1988.
  110. Wieschaus, E., Audit, C., and Masson, M., A clonal analysis of the rules of somatic cells and germline during oogenesis in Drosophila, Developmental Biology 88, pp.92-103, 1981.
  111.  Wieschaus, E., Nusslein-Volhard, C., an Jurgen, G., Mutations affecting the pattern of the larval cuticle in Drosophila melanogaster. Part III. Zygotic loci on the X-chromosome and fourth chromosome, Roux. Arch. Dev. Biol., 193, pp.296-307, 1984.

FIGURES and TABLES:

Figure 1: Sex determination of D. melanogaster (1998)

Figure 2: Somatic-Germline Interactions. (1998)

Figure 3: Molecular Structure of the ovo locus

Figure 4: In vivo Biochemical_genetic Assay for Regulators

Figure 5: ovo-LacZ Reporter Construction. (1998)

Figure 6 : Establishing Stocks From Duplication Carrying Lines.

Figure 7: Control Assay for b-galactosidase Assay. (1998).

Table 1: List of Stocks for X-chromosome Screening (1998)

Table 2: Stocks Made in This Study for X-Chromosome Screening

Table 3: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo3U21

Table 4: LacZ Specific Activities Obtained by Screening X-Chromosome with ovo4B8 (Results)

Table 5: Deficiency Lines Affecting the ovo Gene Activity (X-chromosome screening result)

 

Previously Posted:  

ovo Female Germline Specific Drosophila melanogaster Gene has two auto-regulation mechanism: negative and positive

Blavatar

 

 

Read Full Post »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and Pathology2  Duke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »

Author: Tilda Barliya PhD

Annual treatment costs for musculoskeletal diseases in the US are roughly 7.7% (~ $849 billion) of total gross domestic product. Such disorders are the main cause of physical disability in US (I). The challenges of drug delivery for bone regeneration and reconstruction has been previously reported here by Dr. Aviral Vatsa (I-IV), herein, we will discussed the different needs for bone regeneration and the potential use if nanotechnology.

Bone regeneration is a complex, well-orchestrated physiological process of bone formation, which can be seen during normal fracture healing, and is involved in continuous remodelling throughout adult life. However, there are complex clinical conditions in which bone regeneration is required in large quantity, such as for skeletal reconstruction of large bone defects created by trauma, infection, tumour resection and skeletal abnormalities, or cases in which the regenerative process is compromised, including avascular necrosis, atrophic non-unions and osteoporosis (1,2).

Regenerative medicine offers a way to improve  ‘local’ strategies in terms of tissue engineering and gene therapy, or even ‘systemic’ enhancement of bone repair. To make regenerative medicine successful, three elements are required: stem cells, scaffolds, and growth factors (3).

Bones

Bone is a tough supporting tissue and functions in both movement and the maintenance of postural stability by working cooperatively with muscles as well as play a role in calcium metabolism. Despite its hard structure it exist in a dynamic turnover known as bone remodeling. There are two types of bone structures that naturally remodel during the a year:

  • cortical bone (~3%/year)
  • cancellous bone (~30%/year)
148261.fig.001

Jimi J et al. The schematic outlines of the bone remodeling cycle and the balance of bone resorption and bone formation

At the remodeling sites, osteoblasts produce new bone, while osteoclasts resorb existing bone. Each cell type seems to be regulated by a variety of hormones and by local factors. If the balance between bone formation and resorption is lost by uncontrolled production of these regulators, the bone structure will be damaged, and the subject would be susceptible to osteoporosis and osteopetrosis (2).

Current Clinical approaches:

Standard approaches widely used in clinical practice to stimulate or augment bone regeneration include distraction osteogenesis and bone transport.

As well as the use of a number of different bone-grafting methods, such as (1):

  • Autologous bone grafts – considered as the ‘gold standard‘ bone-grafting material, as it combines all properties required in a bone-graft material: osteoinduction (bone morphogenetic proteins (BMPs) and other growth factors), osteogenesis (osteoprogenitor cells) and osteoconduction (scaffold)
  • Allografts – obtained from human cadavers or living donors, which bypasses the problems associated with harvesting and quantity of graft material. Allogeneic bone is available in many preparations, including demineralised bone matrix (DBM), morcellised and cancellous chips, corticocancellous and cortical grafts, and osteochondral and whole-bone segments, depending on the recipient site requirements.
  • Bone-graft substitutes or growth factors – developed as alternatives to autologous or allogeneic bone grafts. They consist of scaffolds made of synthetic or natural biomaterials that promote the migration, proliferation and differentiation of bone cells for bone regeneration. Commonly performed surgical procedure to augment bone regeneration in a variety of orthopaedic and maxillofacial procedures.

The Masquelet technique is a two-step procedure for bone regeneration and reconstruction of long-bone defects. It is based on the concept of a “biological” membrane, which is induced after application of a cement spacer at the first stage and acts as a ‘chamber’ for the insertion of non-vascularised autograft at the second stage (2, 4).

There are  non-invasive methods of biophysical stimulation, such as low-intensity pulsed ultrasound (LIPUS) and pulsed electromagnetic fields (PEMF) (1).

Limitations of Current approaches: Most of the current strategies for bone regeneration exhibit relatively satisfactory results. However, there are associated drawbacks and limitations to their use and availability, and even controversial reports about their efficacy and cost-effectiveness.

New Approaches:

New methods for studying this process, such as quantitative three-dimensional microcomputed tomography analyses, finite element modelling, and nanotechnology have been developed to further evaluate the mechanical properties of bone regenerate at the microscopic level. Here are some examples of the latest developments as reviewed by Dimitriou R at el (1).

BMPs and growth factors – They induce the mitogenesis of mesenchymal stem cells (MSCs) and other osteoprogenitors, and their differentiation towards osteoblasts. BMP-2 and BMP-7 have been licensed for clinical use since 2002 and 2001 respectively (5). These two molecules have been used in a variety of clinical conditions including non-union, open fractures, joint fusions, aseptic bone necrosis and critical bone defects. Platelet-derived growth factor (PDFG), transforming growth factor-β (TGF-b), insulin-like growth factor-1 (IGF-1), vascular endothelial growth factor (VEGF) and fibroblast growth factor (FGF) have been also implicated in bone regeneration, with different functions in terms of cell proliferation, chemotaxis and angiogenesis. One current approach to enhance bone regeneration and soft-tissue healing by is local application of growth factors is the use of platelet-rich plasma alongside the autograph. BMPs are also being used in bone-tissue engineering.

MSCs – The current approach of delivering osteogenic cells directly to the regeneration site includes use of bone-marrow aspirate from the iliac crest, which also contains growth factors. It is a minimally invasive procedure to enhance bone repair, and produces satisfactory results (1). Overall, however, there are significant ongoing issues with quality control with respect to delivering the requisite number of MSCs/osteoprogenitors to effect adequate repair responses. Issues of quantity and alternative sources of MSCs are being extensively investigated. Novel approaches in terms of cell harvesting, in vitro expansion and subsequent implantation are promising.

Scaffolds and Bone substitutes – synthetic bone substitutes and biomaterials are already widely used in clinical practice for osteoconduction. DBM (Demineralized bone matrix)  and collagen are biomaterials, used mainly as bone-graft extenders, as they provide minimal structural support. A large number of synthetic bone substitutes are currently available, such as HA, β-TCP and calcium-phosphate cements, and glass ceramics. These are being used as adjuncts or alternatives to autologous bone grafts. Especially for regeneration of large bone defects, where the requirements for grafting material are substantial, these synthetics can be used in combination with autologous bone graft, growth factors or cells (6). Improved biodegradable and bioactive three-dimensional porous scaffolds are being investigated, as well as novel approaches using nanotechnology, such as magnetic biohybrid porous scaffolds acting as a crosslinking agent for collagen for bone regeneration guided by an external magnetic field or injectable scaffolds for easier application.

Tissue Engineering – The tissue-engineering approach is a promising strategy added in the field of bone regenerative medicine, which aims to generate new, cell-driven, functional tissues, rather than just to implant non-living scaffolds. In essence, bone-tissue engineering combines progenitor cells, such as MSCs (native or expanded) or mature cells (for osteogenesis) seeded in biocompatible scaffolds and ideally in three-dimensional tissue-like structures (for osteoconduction and vascular ingrowth), with appropriate growth factors (for osteoinduction), in order to generate and maintain bone (7). Bone-tissue engineering is in its early stages, and there are many issues of efficacy, safety and cost to be addressed before general clinical application can be achieved.

Gene Therapy – This involves the transfer of genetic material into the genome of the target cell, allowing expression of bioactive factors from the cells themselves for a prolonged time. Gene transfer can be performed using a viral (transfection) or a non-viral (transduction) vector, and by either an in vivo or ex vivo gene-transfer strategy. There are issues of cost, efficacy and biological safety that need to be answered.

Nanotechnology and Bone Regeneration

Nanotechnology has been greatly utilized for bone tissue engineering strategies. It has been employed to overcome some of the current limitations associated with bone regeneration methods including insufficient mechanical strength of scaffold materials, ineffective cell growth and osteogenic differentiation at the defect site, as well as unstable and insufficient production of growth factors to stimulate bone cell growth (8,9).

To mimic the natural bone nanocomposite architecture, novel biomaterials and nanofabrication techniques are currently being employed and many different nanostructures have already been designed and tested. Electrospinning has been extensively applied to create bone nanofiber scaffolds and biomaterials typically used for this purpose, including synthetic organic polymers such as PCL, PLGA, PLLA, Chitosan, and silk fibroin.

Among the materials used for bone-reconstruction, PLLA is a biocompatible polymer with the advantage of being highly. biodegradable. For this reason, PLLA have received the approval of the Food and Drug Administration (FDA) to be use in bone reconstructive surgery (10).

PLLA nanofibers are often functionalized to improve their biological performance with peptides such as RGD (Arg-Gly-Asp); with osteogenic molecules such as hydroxyapatite; or with proteins such as collagen and the growth factor bone morphogenic protein 2 (BMP-2). It was found that direct incorporation of BMP-2 into PLLA nanofibers enhances the osteoinductivity of the scaffolds.

Current orthopedic implants fail in an appropriate osteo-integration limiting implant lifespan. Titanium, as a biocompatible material, has been used to enhance implant incorporation in bone for dental, craniofacial, and orthopedic applications. Studies have demonstrated that nanoporous titanium dioxide (TiO2) surface modification alters nanoscale topography improving soft tissue attachment on titanium implants surface (11). For example, the uses of nanoporous TiO2 surface-modified implants, in a human dental clinical study, showed that TiO2 thin film increased adherence in early healing of the human oral mucosa and reduced marginal bone resorption (11).

Another example are rosette nanotubes. Bioactive helical rosette nanotubes are self-assembled nanomaterials, formed in water from synthetic DNA base analogs that mimic the helical nanostructure of collagen in bone. This technology has been used to create a biomimetic nanocomposite combined with nanocrystalline hydroxyapatite, and biocompatible hydrogels which increased osteoblast adhesion.

Carbon nanotubes (CNTs) are other suitable scaffold materials that have proved to support osteoblast proliferation. CNTs possess exceptional mechanical, thermal, and electrical properties, facilitating their use as reinforcements or, in combination with other biomaterials, to improve and to support bone growth.

Nanotechnology and clinical trials

Clinical therapies implying the use of nanotechnology in bone regeneration are still in the beginning stages.

BDSint –  Recently, the bone healing ability of a nanocomposite (DBSint®), approved for clinical use, constituted by biomimetic nanostructured Mg-hydroxyapatite and human demineralized bone matrix has been investigated.  The clinical-radiographic and histomorphometry study in subjects undergoing high tibial osteotomy, demonstrated that these nanocomposites are safe and effective. Yet the long term outcome is still to be defined (8, 12).

BioOsss and BioGides –  Schwarz et al. undertook a four-year study of patients treated of moderate intrabony peri-implantitis defects using either a nanocrystalline hydroxyapatite or a natural bone mineral (BioOsss spongiosa granules) in combination with a collagen membrane (BioGides) and found bone reconstruction (8, 13).

Here are some of the ongoing clinical trials for use of nanotechnology in bone regeneration (Perán M et al (8)):

NCT00729716 – Comparison of BioCart™II With Microfracture for Treatment of Cartilage Defects of the Femoral Condyle BioCart™II scaffold Cartilage ————Phase 2.

NCT01183637  – Evaluation of “Kensey Nash Corp” an Acellular Osteochondral Graft for Cartilage Lesions Pilot Trial (EAGLE Pilot) bioresorbable scaffold Bone/ Cartilage————-Phase 2

NCT01218945 –  Development of Bone Grafts Using Adipose-Derived Stem Cells and Different Scaffolds Bone scaffold Bone——– recruiting participants

NCT01435434 – Mononucleotide Autologous Stem Cells and Demineralized Bone Matrix in the Treatment of Non-Union/Delayed Fractures Ignite®ICS injectable scaffold Bone——————Not yet recruiting

Summary:

The advantages of nanomaterials as therapeutic and diagnostic tools are vast, due to design flexibility, small sizes, large surface-to-volume ratio, and ease of surface modification.  The potential of these bio-devices has shown promising results in vitro, and some of them have also been successfully tested in vivo with animal models. Nevertheless, the gap between laboratory and medical application of these nanotechnological advances is still wide (8).

Although some successful devises have already being tested in clinical trials and the data produced by these studies is highly encouraging, the safety of nanomedicine is not yet fully defined and more clinical studies still need to be conducted to translate nanotechnological devices to the clinic.

Reference:

1. Dimitriou R, Jones E, McGonagle D and Giannoudis P.V. Bone regeneration: current concepts and future directions. BMC Medicine 2011, 9:66. http://www.biomedcentral.com/1741-7015/9/66

2. Jimi E.,  Hirata S., Osawa K.,  Terashita M., Kitamura C.,  and Fukushima H. The Current and Future Therapies of Bone Regeneration to Repair Bone Defects. International Journal of Dentistry Volume 2012 (2012), Article ID 148261. doi:10.1155/2012/148261. http://www.hindawi.com/journals/ijd/2012/148261/

3. G. C. Gurtner, M. J. Callaghan, and M. T. Longaker, “Progress and potential for regenerative medicine,” Annual Review of Medicine, vol. 58, pp. 299–312, 2007. http://www.ncbi.nlm.nih.gov/pubmed/17076602

4. Masquelet AC, Begue T: The concept of induced membrane for reconstruction of long bone defects. Orthop Clin North Am 2010, 41(1):27-37. http://www.ncbi.nlm.nih.gov/pubmed/19931050

5. Food and Drug Administration: Medical devices. [http:/ / www.fda.gov/ MedicalDevices/ ProductsandMedicalProcedures/ DeviceApprovalsandClearances/ Recently-ApprovedDevices/ default.htm

6. Giannoudis PV, Dinopoulos H, Tsiridis E: Bone substitutes: an update. Injury 2005, 36(Suppl 3):S20-27. http://www.ncbi.nlm.nih.gov/pubmed/16188545

7. Jones E, English A, Churchman SM, Kouroupis D, Boxall SA, Kinsey S, Giannoudis PG, Emery P, McGonagle D: Large-scale extraction and characterization of CD271+ multipotential stromal cells from trabecular bone in health and osteoarthritis: implications for bone regeneration strategies based on uncultured or minimally cultured multipotential stromal cells. Arthritis Rheum 2010, 62(7):1944-1954.  http://onlinelibrary.wiley.com/doi/10.1002/art.27451/abstract;jsessionid=4573A69E4561194C83A97EC302CD20CB.d04t02

8. Perán M., García MA., Lopez-Ruiz E., Jiménez G and Marchal JA. How Can Nanotechnology Help to Repair the Body?Advances in Cardiac, Skin, Bone, Cartilage and Nerve Tissue Regeneration. Materials 2013, 6, 1333-1359; doi:10.3390/ma6041333 http://www.mdpi.com/1996-1944/6/4/1333

9. Kim K and Fisher JP. Nanoparticle technology in bone tissue engineering. J Drug Target. 2007 May;15(4):241-52.  http://www.ncbi.nlm.nih.gov/pubmed/17487693

10.  Schofer, M.D.; Roessler, P.P.; Schaefer, J.; Theisen, C.; Schlimme, S.; Heverhagen, J.T.; Voelker, M.; Dersch, R.; Agarwal, S.; Fuchs-Winkelmann, S.; Paletta, J.R. Electrospun PLLA nanofiber scaffolds and their use in combination with BMP-2 for reconstruction of bone defects. PLoS One 2011, 6, e25462. http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3182232/

11.  Wennerberg, A.; Frojd, V.; Olsson, M.; Nannmark, U.; Emanuelsson, L.; Johansson, P.; Josefsson, Y.; Kangasniemi, I.; Peltola, T.; Tirri, T.; et al. Nanoporous TiO(2) thin film on titanium oral implants for enhanced human soft tissue adhesion: a light and electron microscopy study. Clin. Implant. Dent. Relat. Res. 2011, 13, 184–196. http://www.ncbi.nlm.nih.gov/pubmed/19681943

12. Dallari, D.; Savarino, L.; Albisinni, U.; Fornasari, P.; Ferruzzi, A.; Baldini, N.; Giannini, S. A prospective, randomised, controlled trial using a Mg-hydroxyapatite-demineralized bone matrix nanocomposite in tibial osteotomy. Biomaterials 2012, 33, 72–79. http://www.ncbi.nlm.nih.gov/pubmed/21955688

13. Schwarz, F.; Sahm, N.; Bieling, K.; Becker, J. Surgical regenerative treatment of peri-implantitis lesions using a nanocrystalline hydroxyapatite or a natural bone mineral in combination with a collagen membrane: a four-year clinical follow-up report. J. Clin. Periodontol. 2009, 36, 807–814.  http://www.ncbi.nlm.nih.gov/pubmed/19637997

Other articles from our Open Access Journal

I. By: Aviral Vatsa PhD MBBS. Targeted delivery of therapeutics to bone and connective tissues: current status and challenges- Part I. http://pharmaceuticalintelligence.com/2012/09/23/targeted-delivery-of-therapeutics-to-bone-and-connective-tissues-current-status-and-challenges-part-i/

II. By: Aviral Vatsa PhD MBBS. Targeted delivery of therapeutics to bone and connective tissues: current status and challenges- Part II. http://pharmaceuticalintelligence.com/2012/09/30/targeted-delivery-of-therapeutics-to-bone-and-connective-tissues-current-status-and-challenges-part-ii/

III. By: Aviral Vatsa PhD MBBS. Osteocytes: A Special Issue in Bone.  http://pharmaceuticalintelligence.com/2013/02/06/osteocytes-a-special-issue-in-bone/

IV. By: Aviral Vatsa PhD MBBS. Bone remodelling in a nutshell. http://pharmaceuticalintelligence.com/2012/06/22/bone-remodelling-in-a-nutshell/

V. By: Ritu Saxena PhD. Dual protection of bone by Sema3a. http://pharmaceuticalintelligence.com/2012/05/10/dual-protection-of-bone-by-sema3a-2/

Read Full Post »

Cancer Metastasis

Author: Tilda Barliya PhD

Metastasis, a complex process that involves the spread of tumor cells, accounts for more than 90%of cancer-related mortality (1,2). A metastatic tumor cell has a treacherous journey to go through:

  • local invasion and intravasation
  • survival in the circulation
  • homing and extravasation into the parenchyma of distant organs
  • adaptation to the new environment
  • outgrowth of secondary lesions

Although tumor cells that are shed from the primary tumor disseminate throughout the body, they tend to colonize select organs, with characteristically different periods of latency and efficiency depending on tumor type or subtype (2).

Steven Paget’s century-old ‘seed and soil’ hypothesis (2, 9) likened tumor cells to ‘seeds’ that are systemically distributed, but that only inhabit particular environments, or ‘soils’, which are supportive to their sustained growth. Understanding the molecular complexity of this process is difficult and we’ll try to unravel some of the pathogenesis and cellular basis that support the metastatic process.

Progression models:

There are two major tumor progression models (2) :

  • Linear –  primary tumour cells undergo successive rounds of mutation and selection35, giving rise to a biologically heterogeneous cellular population in which a subset of malignant clones have accumulated genetic alterations, necessary for metastasis.
  • Parallel –  tumor cells may disseminate very early in malignant progression, colonize multiple secondary sites at different times and ultimately accumulate genetic changes independently from those incurred by the primary tumor.

While both theories are possible, the linear model is validated by both clinical evidence and animal models, the parallel model is mainly based on animal models and still under investigation for clinical clues.

Meera Saxena. Molecular Oncology
Volume 7, Issue 2 , Pages 283-296, April 2013

“Drivers of metastasis”

During the past few years several methods and studies have been used to find and correlate between a specific gene and it’s homing target.

These genes, which were found using next-generation sequencing and their equivalents, were also validated their actual functional consequences.

Figure 1 (Meera Saxena et al) represent some of the genes that were associated with organ-specific translocation (additional genes were recently identified and included in table 1 – Sethi N et all). Herein, we generally show the gene to organ-specific homing, yet we will not discuss each and every one of them.  An example of specific gene to organ will be further discussed in detail in follow up article.

Signalling pathways in cancer metastasis have been extensively studied at the level of individual proteins or as a linear cascade of proteins but they have been less frequently evaluated through a network approach (2). Understanding the different variables in the gene-metastasis network may be crucial for drug development.

For example;  the drug–gene–phenotype Connectivity Map approach was successfully used to identify the mTOR inhibitor rapamycin as an effective agent for overcoming dexamethasone resistance in acute lymphoblastic leukaemia (2, 4).

Microenvironment

“Non-neoplastic stromal cells have a function in the development of tumor metastasis. Stromal cells as important regulators of metastasis through their ability to influence cancer cell functions such as chemotaxis and invasion, as well as microenvironment properties. It should not come as a surprise that tumor angiogenesis was among the initial findings that supported a role for stromal cells in cancer metastasis; the poor vascular integrity of newly synthesized blood vessels within the tumour allows for the escape of malignant cells with the potential of distant spread” (2). Such cells include:

  • Tumour-associated macrophages,
  • Leukocytes and other immune cells,
  • Mesenchymal cells that reside in breast tissue
  • Mesenchymal cells and neuroendocrine cells

Although some of the molecular pathway was discovered, the molecular components that facilitate communication between tumour cells and individual stromal cells of the primary tumor have yet to be fully understood.

Circulating Tumor cells (CTC)

“Essential to cancer metastasis is the ability of primary tumor cells to enter the vasculature and to use these fluid ‘highways’ as a means to reach distant organs”. Tight vascular wall barriers, unfavorable conditions for survival in distant organs, and a rate-limiting acquisition of organ colonization functions are just some of the impediments to the formation of distant metastasis (2,5,6 ).

Despite their clear prognostic importance, the diagnostic value of CTCs is largely unknown and fairly unexplored. Research challenges both in detection and interpretation render their ability to  be clinically accepted. Additional research is needed to fully explore CTCs’ potential in to predict clinical response to therapy would also help to guide disease management.

Colonization

The colonization and outgrowth of tumor cells in a secondary organ is often considered the rate-limiting, as well as the most poorly delineated, step in the metastatic cascade. Understanding the functional involvement of the tumor stromal cells of the secondary site may be crucial to understanding their ability to colonize.

The pre-metastatic niche model shows that, preceding the arrival of  disseminated tumour cells (DTCs), bone marrow-derived haematopoietic stem cells are mobilized by tumour-derived factors and are recruited to the secondary site where they negotiate a more hospitable microenvironment to foster the survival and expansion of metastatic lesions. Inflammatory cytokines have emerged as crucial mediators of the pre-metastatic niche and self-seeding and include IL-6, SRC and NF-kB.

After surviving the adjustment to the secondary site, tumor cells must sustain their growth to develop overt metastases. Developmental pathways have emerged as important players in tumor progression and metastasis. These include: transforming growth factor-β (TGFβ), bone morphogenetic protein (BMP), WNT and Hedgehog.  These genes will trigger additional genes that will affect downstream steps of the colonization process.

Clinical Aspect

“As most metastatic cancers are inoperable, systemic treatments using chemotherapeutic or targeted therapy is often the only option to slow tumor growth or to relieve metastasis-associated morbidity”.  Genes and pathways that have crucial roles in primary tumour growth and metastasis are ideal targets for therapeutic inventions. One example is the oncogenic BRAF:  potent inhibitors of mutant BRAF, had initial clinical results which suggest dramatic efficacy in the treatment of metastatic malignant melanoma.  It is important to keep in mind that many cancers develop resistance to BRAF inhibitor and require used of next-generation drugs. More so,  the mechanism of resistance will be discussed elsewhere.

A sound framework of normal homeostatic mechanisms can improve our ability to understand and target tumor–stromal interactions in metastasis.

Summary:

“Despite recognizing the devastating consequences of metastasis, we are not yet able to effectively treat cancer that has spread to vital organs” .  Despite our increasing knowledge about metastatic colonization, we still hold little understanding of how metastatic tumour cells behave as solitary disseminated entities. Understanding the genomics of metastatic cancer cells and the complexity of the metastasis process will enable us to develop a better target-therapeutic drugs.

 

References:

1. Naure Review: Cancer: focus on metastasis. http://www.nature.com/nrc/focus/metastasis/index.html

2. Nilay Sethi and Yibin Kang. Unravelling the complexity of metastasis — molecular understanding and targeted therapies. Nature Reviews Cancer 2011; 11:732- 748. http://www.nature.com/nrc/journal/v11/n10/abs/nrc3125.html

3. Meera Saxena and Gerhard Christophor. Rebuilding cancer metastasis in the mouse. Molecular Oncology 2013, 7(2):283-296. http://www.moloncol.org/article/S1574-7891(13)00033-1/abstract

4. Lamb, J. et al. The Connectivity Map: using geneexpression signatures to connect small molecules, genes, and disease. Science 2006 313, 1929–1935. http://www.sciencemag.org/content/313/5795/1929.short

5. Chiang AC and Massagué J. Molecular basis of metastasis. N Engl J Med. 2008 Dec 25;359(26):2814 23 ;http://www.ncbi.nlm.nih.gov/pubmed/19109576

6. By: Ritu Saxena PhD. In focus: Circulating Tumor Cells. http://pharmaceuticalintelligence.com/2013/06/24/in-focus-circulating-tumor-cells/

7.   Davies, H. et al. Mutations of the BRAF gene in human cancer. Nature 2002, 417, 949–954. http://www.nature.com/nature/journal/v417/n6892/full/nature00766.html

8. Arozarena, I. et al. Oncogenic BRAF induces melanoma cell invasion by downregulating the cGMP specific phosphodiesterase PDE5A. Cancer Cell 19, 45–57 (2011). http://www.ncbi.nlm.nih.gov/pubmed/21215707

9. Isaiah J. Fidler. The pathogenesis of cancer metastasis: the ‘seed and soil’ hypothesis revisited. Nature Review Cancer. 2003 June. 3(6):453-8. http://www.ncbi.nlm.nih.gov/pubmed/12778135

10. Christoph A. Klein. Parallel progression of primary tumours and metastases.   Nat Rev Cancer. 2009 Apr;9(4):302-12  http://www.ncbi.nlm.nih.gov/pubmed/19308069 http://prometheus.fmrp.usp.br/biocelmolcancer/Klein.pdf

 

Other related articles published on this Open Access Scientific Journal, include the following:

I. By: Ritu Saxena PhD. In focus: Circulating Tumor Cells. http://pharmaceuticalintelligence.com/2013/06/24/in-focus-circulating-tumor-cells/

II. By: Ritu Saxena PhD. Scientists use natural agents for prostate cancer bone metastasis treatment. http://pharmaceuticalintelligence.com/2012/09/17/natural-agents-for-prostate-cancer-bone-metastasis-treatment/

III. By: Prabodh Kandala, PhD. All Cancer Cells Are Not Created Equal: Some Cell Types Control Continued Tumor Growth, Others Prepare the Way for Metastasis. http://pharmaceuticalintelligence.com/2012/05/17/all-cancer-cells-are-not-created-equal-some-cell-types-control-continued-tumor-growth-others-prepare-the-way-for-metastasis/

IV. By: Aviva Lev-Ari PhD RN. MIT Scientists Identified Gene that Controls Aggressiveness in Breast Cancer Cells. http://pharmaceuticalintelligence.com/2013/07/03/mit-scientists-identified-gene-that-controls-aggressiveness-in-breast-cancer-cells/

V. By: Demet Sag PhD CRA, GCP.  The Magic of the Pandora’s Box : Epigenetics and Stemness with Long non-coding RNAs (lincRNA). http://pharmaceuticalintelligence.com/2013/06/30/the-magic-of-the-pandoras-box-epigenetics-and-stemmness-with-long-non-coding-rnas-lincrna/

 

Read Full Post »

Role of Progesterone in Breast Cancer Progression

Author: Tilda Barliya PhD

Breast Cancer has been long discussed herein focusing on different aspects of the diseases: from diagnosis and all the way up to treatment modalities (I). The literature has put a lot of emphasis on the role of Estrogen receptor in the development of breast cancer, yet not much focus was placed on the counterpart partner–Progesterone Receptor.

Progesterone:

Progesterone is secreted by the empty egg follicle after ovulation has occurred. It is highest during the last phases of the menstrual cycle, after ovulation. Progesterone causes the endometrium to secrete special proteins to prepare it for the implantation of a fertilized egg (2). If conception has occurred, progesterone becomes the major hormone supporting pregnancy, with many important functions:

  • Responsible for the growth and maintenance of the endometrium
  • Suppresses further maturation of eggs by preventing release of LH and FSH (Follicle Stimulating Hormone).
  • By relaxing the major muscle of the uterus, progesterone prevents early contractions and birth.
  • It thicken the muscle, helping the body prepare for the hard work of labor.
  • Suppresses prolactin (the primary hormone of milk production), preventing lactation until birth

A recent review by Prof. Cathrin Brisken from ISREC- Swiss Institute for Experimental Cancer Research, summarizes and highlights the important role of progesterone in breast cancer progression (1). So where do we stand?

“The ovarian steroid hormones, 17β‑oestradiol and progesterone, are pivotal in the control of breast development and physiology, and both experimental and  epidemiological studies indicate that the two hormones are intimately linked to mammary carcinogenesis”.

“Ever since the 1960s,  pharmacological antagonists of both estrogen and progesterone were developed. PR antagonists failed in the clinic because of severe side effects, such as liver toxicity. By contrast, drugs that interfere with estrogen signalling, such as tamoxifen and aromatase inhibitors have become mainstays of breast cancer therapy; they substantially prolong survival and have saved many lives”.

Agonists for both receptors have been developed and are used for both contraception and hormone replacement therapy (HRT), but there are growing concerns that they may increase breast cancer risk. Women receiving HRT have little or no increase in breast cancer risk when taking estrogens only, in fact there may even be a protective effect (1,3).

“By contrast, a substantial increase in breast cancer risk was noticed in women taking combinations of an estrogen and various synthetic progesterone agonists (progestins). This could be related to the increase in cell proliferation in the breast epithelium that has been reported with combination therapy”. These results however differ between women who took natural progesterone and those who received the synthetic form- progestin, which may be due to the fact that progestin may bound other nuclear receptors (i.e androgen and glucocorticoid receptors). Other factors aside from progesterone may advances this higher risk for HRT-related breast cancer and include for example breast density (fatty pad density).

Cellular Mechanism:

“Across species, ERα and PR are absent from the myoepithelial cells and basal cells and are expressed by 30–50% of the luminal cells. Most cells co-express ERα and PR, which is consistent with PR being an ERα target. A small subset of cells expresses either only ERα or only PR”.  It was found that cells that are either or both hormone receptor(s) positive may affect neighboring cells in a paracrine fashion by secreting signalling and proliferating factors . Some of the attractive target genes of this hormones include but excluded to WNT, fibroblast growth factors (FGF), epidermal growth factor (EGF) as well as direct intercellular signalling mediated by Notch, ephrins or gap junctions.

“Hormone Receptor (HR)+ cells seem to act as ‘sensor’ cells that translate the signals encoded by systemic hormones into local paracrine signals. To relay these signals they secrete paracrine factors that bind to receptors on HR–, luminal and basal cells, which act as the ‘secondary responder cells”.

This organizing principle ensures that the signal is amplified and prolonged in time and provides a means of coordinating different biological functions of distinct cell types.

Several experiments in MCF-7 cells showed that if a cell had recently been stimulated by estrogens it would be hormone receptor (HR)–. More so, later experiments showed that the HR expression, rather positive or negative, is a hallmark of a distinct cell type in the mammary epithelium.

There are many alternations in global gene expressions and protein factors during each menstrual cycle and more over in the life time of a woman. The entire sum of changes in the different cell population determine the proliferation and development of breast cancer.

There are two types of proliferation, cell-intrinsic and paracrine proliferation. For example, it was found in mice model, that the cell-intrinsic action of progesterone on HR+ cell proliferation requires cyclin D1. Whereas the proliferation of HR– cells does not (1).

Proliferation of HR– cells on progesterone stimulation requires RANKL, which is a tumour necrosis factor‑α (TNFα) family member. It was further noted that that RANKL is a crucial mediator of PR signalling function.

It is believed that recurrent activation of PR during repeated menstrual cycles and its downstream effectors, cyclin D1, WNT4 and RANKL promotes breast carcinogenesis (Fig.1). It was found for instance, that use of PR agonists or ectopic expression of RANKL induce mammary tumors in mice models.

Therefore, of clinical relevance  for example, soluble RANKL administered intravenously can elicit proliferation in the mammary epithelium, and systemic administration of its decoy receptor osteoprotegerin (OPG) can inhibit proliferation (1). There are obviously other genes associated with these phenotypes and the RANKL was given as an example.

Cathrin Brisken 2011

Novel preventive strategies are envisioned to PR itself and its downstream mediators. The new generation of selective progesterone receptor modulators (SPRMs)  used for gynaecological disorders, have fewer side effects than earlier ones, and are thought to be introduced as potential breast cancer therapy.

Reproductive hormones impinge on breast carcinogenesis at all stages and can determine whether the disease will progress (Fig 1). In particular, PR signalling has a pivotal role in controlling tumour promotion from the in situ stage onwards.

Clinical Aspect

Breast Cancers are generally divided into molecular subtypes which include:

  • Basal-like: ER-, PR- and HER2-; also called triple negative breast cancer (TNBC). Most BRCA1 breast cancers are basal-like TNBC.
  • Luminal A: ER+ and low grade
  • Luminal B: ER+ but often high grade
  • Luminal ER-/AR+: (overlapping with apocrine and so called molecular apocrine) – recently identified androgen responsive subtype which may respond to antihormonal treatment with bicalutamide.  
  • ERBB2/HER2+: has amplified HER2/neu.
  • Normal breast-like
  • Claudin-low: a more recently described class; often triple-negative, but distinct in that there is low expression of cell-cell junction protein including E-cadherin and frequently there is infiltration with lymphocytes.

NCCN 2007

Onitilo et al suggested this subgroups in their 7-year retrospective study(6):

  • ER/PR+, Her2+ = ER+/PR+, Her2+; ER−/PR+, Her2+; ER+/PR−, Her2+

  • ER/PR+, Her2− = ER+/PR+, Her2−; ER−/PR+, Her2−; ER+/PR−, Her2−

  • ER/PR−, Her2+ = ER−/PR−, Her2+

  • ER/PR−, Her2− = ER−/PR−, Her2−

The independent prognostic and predictive role of PR expression irrespective of ER has been a subject of great controversy.

In their study, Onitilo & colleagues have evaluated numerous patients for different factors such as five-year overall and disease-free survival, recurrent site and age, depending on their subgroups (6).

Their study supports other studies which have shown both the triple negative and Her2+/ER− subtypes to have poorer clinical, pathologic and molecular prognoses. The triple negative group has the worst overall and disease-free survival. More so the prognosis according to ER/PR status was found to be:

ER-positive/PR-positive tumors >> ER-positive/PR-negative tumors >>> ER-negative/PR-negative tumors.

But what happens with the ER-negative/PR positive group? How many patients fall into this category and how important that is? Could it be an artifact?

Maleki et al believes that in their study tumor that were initially reported as ER-negative/PR-positive are actually grade I (low grade) ER positive tumors such as infiltrating lobular carcinoma and colloidal carcinoma (7).

Summary:

Reproductive hormones impinge on breast carcinogenesis at all stages and can determine whether the disease will progress. In particular, PR signalling has a pivotal role in controlling tumour promotion from the in situ stage onwards. It will therefore be a good opportunity to design new treatment strategies that include selective progesterone receptor inhibitors. Interfering with the breast-specific effects of increased serum progesterone levels may be an effective way to reduce their risk of dying of breast cancer without blocking all reproductive function.More so, the majority of the physicians and researchers would agree that more studies are necessary to refine IHC classification for better classification and clinical use.

Reference:

1. Cathrin Brisken. Progesterone signalling in breast  cancer: a neglected hormone coming  into the limelight. Nature Reviews Cancer June 2013, (13): 385-396. http://www.nature.com/nrc/journal/v13/n6/full/nrc3518.html

2. Nicole Galan RN. What is Progesterone? http://pcos.about.com/od/normalmenstrualcycle/f/Progesterone.htm

3. Anderson, G. L. et al. Conjugated equine oestrogen and breast cancer incidence and mortality in postmenopausal women with hysterectomy: extended follow-up of the Women’s Health Initiative randomised placebo-controlled trial. Lancet Oncol 2012. 13, 476–486.

4. MJ, Möller MF, DG, Niggemann B, Zänker KS and Entschladen F. Luminal and basal-like breast cancer cells show increased migration induced by hypoxia, mediated by an autocrine mechanism. BMC Cancer 2011, 11:158. http://www.biomedcentral.com/1471-2407/11/158

5. MCU Cheang, J Parker, K DeSchryver, J Snider, T Walsh, S Davies, A Prat, T Vickery, J Reed, B Zehnbauer, S Leung, D Voduc, T Nielsen, E Mardis, P Bernard, C Perou, and M Ellis. Luminal A vs. Basal-like Breast Cancer: time dependent changes in the risk of relapse in the absence of treatment. Cancer Research: December 15, 2012; Volume 72, Issue 24, Supplement 3. http://cancerres.aacrjournals.org/cgi/content/meeting_abstract/72/24_MeetingAbstracts/P6-07-10

6. Onitilo AA., Engel JM., Greenlee RT and Mukesh BN. Breast Cancer Subtypes Based on ER/PR and Her2 Expression: Comparison of Clinicopathologic Features and Survival. Clinical Medicine & Research  2009 June 1 7 (1-2); 4-13. http://www.clinmedres.org/content/7/1-2/4.long

7. Maleki Z., Shariat S., Mokri M and Atri M.  ER-negative /PR-positive Breast Carcinomas or Technical Artifacts in Immunohistochemistry? Arch Iran  Med. 2012; 15(6): 366 – 369. http://www.ams.ac.ir/AIM/NEWPUB/12/15/6/0010.pdf

Other articles from our Open Access Jounal:

I By: Larry Bernstein MD. “recurrence risk for breast cancer”. http://pharmaceuticalintelligence.com/2013/03/02/recurrence-risk-for-breast-cancer/

II. By: Ritu Saxena PhD. “In focus: Triple Negative Breast Cancer”. http://pharmaceuticalintelligence.com/2013/01/29/in-focus-triple-negative-breast-cancer/

III. By: Tilda Barliya PhD. The Molecular pathology of Breast Cancer Progression. http://pharmaceuticalintelligence.com/2013/01/10/the-molecular-pathology-of-breast-cancer-progression/

IV. By: Sudipta Saha PhD. The FEMALE reproductive system and the hypothalamic-pituitary-thyroid axis. http://pharmaceuticalintelligence.com/2012/12/11/the-female-reproductive-system-and-the-hypothalamic-pituitary-thyroid-axis/

V. By: Tilda Barliya PhD. Nanotech Therapy for Breast Cancer. http://pharmaceuticalintelligence.com/2012/12/09/naotech-therapy-for-breast-cancer/

 

Read Full Post »

« Newer Posts - Older Posts »