Feeds:
Posts
Comments

Archive for the ‘Cardiovascular Pharmacogenomics’ Category

Inhibition of the Cardiomyocyte-Specific Kinase TNNI3K

Author and Curator: Larry H Bernstein, MD, FCAP

 

 

This report from Science Translational Medicine is about the finding that a cardiomyocyte-specific kinase limits reperfusion injury in acute coronary syndrome, a phenomenon driven by oxidative stress, protecting cardiac cells from further damage.

Inhibition of the Cardiomyocyte-Specific Kinase TNNI3K Limits Oxidative Stress, Injury, and Adverse Remodeling in the Ischemic Heart

Ronald J. Vagnozzi1,2,  Gregory J. Gatto Jr.3, Lara S. Kallander3, Nicholas E. Hoffman2, Karthik Mallilankaraman2, Victoria L. T. Ballard3, Brian G. Lawhorn3, …, and Thomas Force2,6,*
+ Author Affiliations
1Program in Cell and Developmental Biology, Thomas Jefferson University, Philadelphia, PA
2Center for Translational Medicine, and 6Cardiology Division, Temple University School of Medicine, Philadelphia, PA
3Heart Failure Discovery Performance Unit, Metabolic Pathways and Cardiovascular Therapeutic Area Unit, GlaxoSmithKline, King of Prussia, PA
4Platform Technology and Sciences, GlaxoSmithKline, King of Prussia, PA
5Cardiovascular Division, Department of Internal Medicine, Hyogo College of Medicine, Nishinomiya 663-8131, Japan.

Sci Transl Med 16 Oct 2013; 
5(207), p. 207ra141     http://dx.doi.org/10.1126/scitranslmed.3006479
Percutaneous coronary intervention is first-line therapy for acute coronary syndromes (ACS) but can promote cardiomyocyte death and cardiac dysfunction via reperfusion injury, a phenomenon driven in large part by oxidative stress. Therapies to limit this progression have proven elusive, with no major classes of new agents since the development of anti-platelets/anti-thrombotics. We report that cardiac troponin I–interacting kinase (TNNI3K), a cardiomyocyte-specific kinase,
  1. promotes ischemia/reperfusion injury,
  2. oxidative stress,
  3. and myocyte death.
TNNI3K-mediated injury occurs
  • through increased mitochondrial superoxide production and
  • impaired mitochondrial function and is largely
  • dependent on p38 mitogen-activated protein kinase (MAPK) activation.

We developed a series of small-molecule TNNI3K inhibitors that

  1. reduce mitochondrial-derived superoxide generation,
  2. p38 activation, and
  3. infarct size
when delivered at reperfusion to mimic clinical intervention.
TNNI3K inhibition also preserves cardiac function and limits chronic adverse remodeling.
Our findings demonstrate that TNNI3K modulates reperfusion injury in the ischemic heart and is a tractable therapeutic target for ACS.  Pharmacologic TNNI3K inhibition would be cardiac-selective,
  • preventing potential adverse effects of systemic kinase inhibition.
Citation: R. J. Vagnozzi, G. J. Gatto, L. S. Kallander, N. E. Hoffman, K. Mallilankaraman, V. L. T. Ballard, B. G. Lawhorn, P. Stoy, J. Philp, A. P. Graves, Y. Naito, J. J. Lepore, E. Gao, M. Madesh, T. Force, Inhibition of the Cardiomyocyte-Specific Kinase TNNI3K Limits Oxidative Stress, Injury, and Adverse Remodeling in the Ischemic Heart. Sci. Transl. Med. 5, 207ra141 (2013).

Read Full Post »

Heroes in Medical Research: Dr. Carmine Paul Bianchi Pharmacologist, Leader, and Mentor

Writer/Curator: Stephen J. Williams, Ph.D.

Article ID #83: Heroes in Medical Research: Dr. Carmine Paul Bianchi Pharmacologist, Leader, and Mentor. Published on 10/29/2013

WordCloud Image Produced by Adam Tubman

Past articles in this Heroes in Medical Research series had focused on those seemingly small discoveries, sometimes gained serendipitously and through careful observation and experimentation, which led to some of our most important breakthroughs of our time.  I have tried to make the posts more about the people and less about the discoveries

However, though seminal discoveries are so important to the future of science (and should be celebrated), equally if not MORE IMPORTANT is the MENTORING of future scientists and the PROMOTION of fields of study.  One person who exemplified these values was Dr. Carmine Paul Bianchi, who had recently just passed away this August, and will be sorely missed in the field of pharmacology and toxicology.

For those who were not familiar with Dr. Bianchi I have curated some pertinent information about his work as a scientist, professor and Chairman in pharmacology, and leader and spokesperson for the field of pharmacology.  He was one of the founders of the Mid-Atlantic Pharmacology Society and was an advocate and influential in the careers of many pharmacologists and toxicologists.

Comments from fellow colleagues are very welcome (in comment section at end of post)

The following is separated in 3 sections:

  • An obituary from the Philadelphia Inquirer
  •  A section of the history of the Pharmacology Department at Thomas Jefferson University where Dr. Bianchi was Chairman
  • A few important textbooks and scientific articles he had authored

 

Carmine Paul Bianchi, 86, pharmacology professor

Paul Bianchi

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Carmine Paul Bianchi

By Bonnie L. Cook, Inquirer Staff Writer

Posted: August 20, 2013

Carmine Paul Bianchi, 86, of Boothwyn, a professor of pharmacology in Philadelphia for many years, died Tuesday, Aug. 13, of a digestive ailment at Taylor Hospice House in Ridley Park.

Born in Newark, N.J., and raised in Maplewood, Dr. Bianchi served as an Army surgical technician in Tilton General Hospital at Fort Dix from 1945 to 1947.

He earned a bachelor’s degree in chemistry from Columbia University in 1950, a master’s in physiology and biochemistry from Rutgers University in 1953, and a doctorate in physiology and physical chemistry in 1956 from Rutgers.

In the 1950s, he did research at Rutgers and was a public health fellow and visiting scientist at the National Institutes of Health in Maryland.

From 1961 to 1976, he held a number of jobs in the department of pharmacology in the University of Pennsylvania School of Medicine. That culminated in his being named professor of pharmacology.

Dr. Bianchi left in 1976 for Jefferson Medical College of Thomas Jefferson University, where he became pharmacology professor and chairman of the pharmacology department from 1976 to 1987. In 1987, he stepped down from the chairmanship but remained professor of pharmacology. He retired in 1997 as professor emeritus.

Dr. Bianchi was a member of many professional groups, including the New York Academy of Sciences and the American Association for the Advancement of Science.

He was a leader and author in pharmacology, helping edit an industry journal and making himself available for consultation to medical examiners and experts in toxicology.

He wrote or contributed to three books and 200 scientific papers and lectured widely. He enjoyed mentoring medical and graduate students.

His family called Dr. Bianchi “a true renaissance man” who was as comfortable discussing English, history, and politics as he was the sciences.

 

 

 

The following was taken from a history of  Department of Pharmacology  at Thomas Jefferson University  and can be viewed at: http://jdc.jefferson.edu/cgi/viewcontent.cgi?article=1008&context=wagner2

 

 

Carmine Paul Bianchi, Ph.D;

Third Chairman (1976-1986)

The new Chairman of the Department, effective

July 1, 1976, was Carmine Paul Bianchi, Ph.D.

(Figure 8-3) from the University of Pennsylvania

School of Medicine, where he had been Professor

of Pharmacology since [969 and a member of the

faculty of that Department since 1961.

Dr. Bianchi was born on April 9, [927, in

Newark, New Jersey. After receiving his diploma

at Columbia High School in 1945, he spent two

years in the Army Medical Corps as Technical Sgt.

Fourth Grade. He then attended Columbia

University, where he majored in chemistry and

obtained the B.A. degree in 1950. Like Dr.

Gruber, the first Chairman of the Pharmacology

Department at Jefferson, Bianchi earned his Ph.D.

in physiology. He pursued his graduate studies at

Rutgers University, supplementing his physiology

major with a biochemistry minor for the M.S.

degree in [953 and with a physical chemistry minor

for the Ph.D. degree in 1956. Dr. Bianchi then

spent several years at the National Institutes of

Health-two years as a Public Health Fellow and

one as a Visiting Scientist. Following that he was

Assistant Member of the Institute for Muscle

Disease in New York for one year. In 1961 Dr.

Bianchi became classified professionally as a

pharmacologist by becoming an Associate in the

Department of Pharmacology at the University of

Pennsylvania School of Medicine. There he

advanced to Professorship in 1969 and remained

until he came to Jefferson. The evolution of Dr.

Bianchi’s career from physiology to pharmacology

was the logical result of his investigations of the

effect of various drugs on the metabolism and

distribution of some of the important elements of

the body, notably calcium. His major field of

interest became classified and remained in

electrolyte pharmacology.

Throughout his career Dr. Bianchi has been

very active in the affairs of outside professional

organizations. He is a member of the American

Society for Pharmacology and Experimental

Therapeutics, the American Physiological Society,

the American Chemical Society, and the

International Society of Toxicology, to name

only a few. He served as President of both the

Philadelphia Physiological Society and the John

Morgan Society in the same year (1973-1974), and

of the Philadelphia Chapter of the Society for

Neuroscience (1979-1980). He gave much time

and valuable services as Field Editor for the

Journal of Pharmacology and Experimental

Therapeutics ([970-1979) and as a member of the

Pharmacology Section of the National Board of

Medical Examiners (1981-1985).

After Dr. Bianchi became Chairman no

immediate changes in the general structure and

activities of the Department took place. He

enlarged the Department and filled vacancies

occasioned by the retirement of some faculty

members. The didactic schedules and subject

matter offered to the medical and graduate

students underwent only minor annual changes.

Research activities were augmented by the

addition of Dr. Bianchi’s specialty in electrolyte

pharmacology and the appointments of new staff

members for investigations in that and related

flelds. Through the following decade there was a

marked change in the faculty structure of the

Department. The [975 Jefferson catalogue, for

example, listed 15 faculty appointments in

Pharmacology, of which eight were on a primary

full-time basis with offices and laboratories in the

Department. In 1985 there were 36 faculty

appointments of which eight were on a primary

full-time basis. The large increase in the total

number of faculty resulted from adjunct

appointments from outside organizations and from

secondary appointments of faculty members of the

Clinical Departments at Jefferson. This expansion

reflected a broadening of interests and interactions

on both the scientific and clinical fronts in clinical

pharmacology and clinical toxicology.

A notable addition to the faculty of the

Department in 1978 was Dr. Hyman Menduke

as Professor of Pharmacology

(Biostatistics). After receiving his Ph.D. in

Economic Statistics at the University of

Pennsylvania, Menduke came to Jefferson in 1953

as Assistant Professor of Biostatistics with no

official Departmental affiliation until 1963, when

he was appointed Professor of Preventive

Medicine (Biostatistics). When Dr. Menduke first

came to Jefferson he gave a ten-hour course in

biostatistics to the second-year medical students in

time provided during their pharmacology course.

Through the years his offerings expanded to a

12-hour course for freshman medical students and

introductory and advanced courses for graduate

students. An early and valuable contribution was a

series of individual conferences with graduate

students on the statistical planning of their

research problems and the later analysis of their

data.

 

The interests and activities of the Department in

research in toxicology have been emphasized.

Toxicology continued as an important part of the

research program after Dr. Bianchi became

Chairman in 1976, although under his direction

the major emphasis in research became redirected

toward the general areas of cell pharmacology and

neuropharmacology.

In accord with its continuing research and

teaching activities in toxicology, the Department

starting in 1977 organized a series of annual

workshops on Industrial Toxicology sponsored by

the College of Graduate Studies. These were

four-day symposia on important toxicologic

problems in industry and the general environment,

presented by toxicologically involved Jefferson

faculty and by invited experts from other

universities, industry, and government.

In 1979 the Department was awarded a training

grant in Industrial and Environmental Toxicology

by the National Institute of Environmental Health

Sciences. The purpose of this award was to

provide postdoctoral training in toxicology for

individuals who had previously received their

Ph.D. degrees in other sciences. Ten M.S. degrees

were subsequently awarded in this program

through the years from 1981 to 1986.

On December 14, 1978, a full day’s workshop

with outside invited experts was held to discuss

the formation of a Toxicology Center and the

establishment of a Chair in Toxicology-Pathology

to broaden the base of research and training in

toxicology at Jefferson. It was envisioned that the

Center would be an administrative Division within

the Department of Pharmacology, with research

participation from other basic science departments

and the Department of Medicine. Although funds

accumulated in support of a Toxicology Center,

disagreements developed relating to the

administrative base of the Center.

 

A few articles from Dr. Bianchi showing the diversity of his research interests including calcium mobilization, neurotoxicology, and cellular metabolism and physiology.

Muscle fatigue and the role of transverse tubules.

Bianchi CP, Narayan S.

Science. 1982 Jan 15;215(4530):295-6. No abstract available.

 

Effect of adenosine on oxygen uptake and electrolyte content of frog sartorius muscle.

Prosdocimi M, Bianchi CP.

J Pharmacol Exp Ther. 1981 Jul;218(1):92-6.

 

The effect of diazepam on tension and electrolyte distribution in frog muscle.

Degroof RC, Bianchi CP, Narayan S.

Eur J Pharmacol. 1980 Aug 29;66(2-3):193-9.

 

Steady state maintenance of electrolytes in the spinal cord of the frog.

Bianchi CP, Erulkar SD.

J Neurochem. 1979 Jun;32(6):1671-7. No abstract available.

An in-vitro model of anesthetic hypertonic hyperpyrexia, halothane–caffeine-induced muscle contractures: prevention of contracture by procainamide.

Strobel GE, Bianchi CP.

Anesthesiology. 1971 Nov;35(5):465-73. No abstract available.

 

The effects of psychoactive agents on calcium uptake by preparations of rat brain mitochondria.

Tjioe S, Haugaard N, Bianchi CP.

J Neurochem. 1971 Nov;18(11):2171-8. No abstract available.

 

The effect of veratridine on sodium-sensitive radiocalcium uptake in frog sartorius muscle.

Johnson P, Bianchi CP.

Eur J Pharmacol. 1971 Sep;16(1):90-9. No abstract available.

 

The function of ATP in Ca2+ uptake by rat brain mitochondria.

Tjioe S, Bianchi CP, Haugaard N.

Biochim Biophys Acta. 1970 Sep 1;216(2):270-3. No abstract availabl

 

The effects of pH gradients on the uptake and distribution of C14-procaine and lidocaine in intact and desheathed sciatic nerve trunks.

Strobel GE, Bianchi CP.

J Pharmacol Exp Ther. 1970 Mar;172(1):18-32. No abstract available

 

 

More articles by CP Bianchi  can be found at: http://www.ncbi.nlm.nih.gov/pubmed/?term=Bianchi%20CP[auth]

The following is one of the seminal books Dr. Bianchi authored:

 

Role of Calcium Channels of the Sarcolemma and the Sarcoplasmic Reticulum in Skeletal Muscle Functions

http://link.springer.com/article/10.1007%2F978-1-4615-3362-7_17/lookinside/000.png

AND

Advances in General and Cellular Pharmacology (1976)

Toshio Narahashi; Carmine Paul Bianchi

The author of the Advances in General and Cellular Pharmacology is Toshio Narahashi; Carmine Paul Bianchi – very good writer. You can download this e-book absolutely for free. This ebook’s ISBN number is 9781461582007. if you were searching for for free download of kindle books, google books, free pdf books, pdf ebooks, e-books, pdf files or pdf ebooks just stay here for a while, download what you wanted for free and enjoy!

Advances in General and Cellular Pharmacology – Toshio Narahashi; Carmine Paul Bianchi – PDF Free Download Ebook also for Kindle

 

Other articles in this series published on this site include:

Heroes in Medical Research: Dr. Robert Ting, Ph.D. and Retrovirus in AIDS and Cancer

Heroes in Medical Research: Barnett Rosenberg and the Discovery of Cisplatin

Volume Two: Interviews with Scientific Leaders

 

 

Read Full Post »

Notable Contributions to Regenerative Cardiology by Richard T. Lee – Part I

 

Author and Curator: Larry H Bernstein, MD, FCAP

and

Article Commissioner: Aviva Lev-Ari, PhD, RD

 

Introduction

This presentation is a two part discussion of selected articles of a large body of research from Dr. Richard T. Lee, at Harvard Medical School’s Lee Laboratory and Brigham & Womens Hospital.  This work is innovative in the field of stem cell research and myocardial regeneration.  It devolves the complex cellular processes that are involved in the management of a cell transforming from a progenitor to a functional cardiomyocyte.  The cell engineering involves investigating interactions between a cell placed into the layer derived from the interstitial layer between viable cardiomyocytes.  This is only possible from a through actionable knowledge of the mechanism involved in the transformation process, which has occupied the Lee Laboratory for many years.  Part II will cover the cellular mechanisms underlying the conceptual approach to cardiac myocyte regeneration.

The Lee Laboratory uses emerging biotechnologies to discover and design new approaches to cardiovascular diseases. A central theme of the laboratory is that merging bioengineering and molecular biology approaches can yield novel approaches. Thus, the Lee Laboratory works at this interface using a broad variety of techniques in genomics, imaging, nanotechnology, physiology, cell biology, and molecular biology. The approach is to understand problems and design solutions in the laboratory and then demonstrate the effectiveness of these solutions in vivo. Ongoing projects in the laboratory include studies of cardiac regeneration, diabetic vascular disease, wound healing, heart failure, and cardiac hypertrophy.

Richard T. Lee is Professor of Medicine at Harvard Medical School and lecturer in Biological Engineering at the Massachusetts Institute of Technology. He is a 1979 graduate of Harvard College in Biochemical Sciences and received his M.D. from Cornell University Medical College in 1983.  He went on to complete his residency in 1986 and cardiology fellowship in 1989, both at Brigham and Women’s Hospital in Boston, and he obtained post-doctoral training at MIT in Bioengineering.

Dr. Lee is certified by the American Board of Internal Medicine in cardiovascular disease and is a Fellow of the American College of Cardiology. He is Leader of the Cardiovascular Program of the Harvard Stem Cell Institute.  He is a member of the Editorial Boards of the journals Circulation Research, Journal of Clinical Investigation, and Circulation, and has published over 180 peer-reviewed articles based on his research, which combines approaches in biotechnology and molecular biology to discover new avenues to manage and treat heart disease.

Regeneration of the heart

Matthew L. Steinhauser, Richard T. Lee
Division of Cardiovascular Medicine, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, and (2)             Harvard Stem Cell Institute, Cambridge, MA
EMBO Mol Med 2011; 3: 701–712   http://dx.doi.org/10.1002/emmm.201100175

The death of cardiac myocytes diminishes the heart’s pump function and is a major cause of heart failure. With the exception of heart transplantation and implantation of mechanical ventricular assist devices, current therapies do not address the central problem of decreased pumping capacity owing to a depleted pool of cardiac myocytes. The field is evolving in two important directions. First, although endogenous mammalian cardiac regeneration clearly seems to decline rapidly after birth, it may still persist in adulthood. The careful elucidation of the cellular and molecular mechanisms of endogenous heart regeneration may therefore provide an opportunity for developing therapeutic interventions that amplify this process. Second, recent breakthroughs have enabled reprogramming of cells that were apparently terminally differentiated, either by dedifferentiation into pluripotent stem cells or by trans-differentiation into cardiac myocytes.
The longstanding paradigm held that the mammalian heart is a terminally differentiated organ, incapable of replenishing any myocyte attrition. During the past decade, however, studies revealed not only that mammalian cardiac myocytes retain some capacity for division (Beltrami et al, 2001), but also identified endogenous cardiac progenitor cells in the heart (Beltrami et al, 2003) or bone marrow (Orlic et al, 2001). These cells retain some potential for differentiation into the cellular components of the heart, including endothelial cells, smooth muscle cells and cardiac myocytes.
If progenitor cells residing in the adult are capable of producing new heart cells, the therapeutic delivery of such progenitors might facilitate the generation of de novo functional myocardium. In this context, cell-based therapies for the heart have been rapidly translated into the clinic to treat heart disease, but randomized clinical trials with bone marrow progenitors have shown at best modest improvements in ventricular function (Martin-Rendon et al, 2008). In short, the promise of complete cardiac regeneration has not yet been realized.  Therefore, it is worth revisiting both the foundations of cardiac regeneration and highlight recent advances that may portend future directions in the field.
We will first define the problem, that is elucidating the scope of endogenous mammalian regeneration and, by extension, the scale of the regenerative deficit. We will then summarize current regenerative approaches, including both cell-based therapies and pharmacoregenerative strategies. In this context, we will summarize the many challenges that stand in the way of cardiac regeneration, both endogenous repair processes and exogenous regenerative therapies.
The regenerative deficit of the mammalian heart is obvious when compared with organisms such as zebrafish and newts, which demonstrate a remarkable survival capacity after removal of up to 20% of the heart by transection of the ventricular apex. Pre-existing cardiac myocytes adjacent to the site appear to undergo a process of dedifferentiation, characterized by dissolution of sarcomeric structures. This is followed by incorporation of deoxyribonucleic acid (DNA) synthesis markers (e.g. nucleotide analogues) consistent with proliferation. Ultimately, newly generated cardiac myocytes are functionally integrated with the preexisting myocardium. The heart is left with little residual evidence of the injury, thus providing a natural example of complete myocardial regeneration.

Evidence for heart regeneration in mammals

During embryonic development and the early post-natal period, mice also demonstrate a remarkable regenerative capacity. Embryos heterozygous for a cardiac myocyte-specific null mutation in the x-linked holocytochrome c synthase (Hccs) gene demonstrate cardiac myocyte replacement during foetal development (Drenckhahn et al, 2008): when one of two X-chromosomes is randomly inactivated in each female somatic cell, approximately 50% of the cardiac myocytes are rendered Hccs-null and hence dysfunctional. Proliferative functional Hccs-expressing cardiac myocytes compensate for dysfunctional Hccs-null myocytes, such that, at birth, 90% of the heart is derived from myocytes containing one functional Hccs allele. However, after the first week in post-natal mice, injured myocardium is largely replaced by fibrosis and scarring.  Distinguishing whether the adult mammalian heart is incapable of cardiac myocyte replacement or whether it retains a low-level capacity for repair is therefore fundamentally important. This is the basis for an evolving view of a more plastic mammalian heart.
Arguments against the age old view of the terminally differentiated quiescent cardiac myocyte:

  1. evidence supporting cardiac myocyte plasticity relied on mathematical modelling of the myocyte population based on cytometric indices. (the measured average volume increase of cardiac myocytes was calculated to fall short of the increase predicted by the observed volumetric changes in the whole heart
  • changes in heart volume could not be explained by hypertrophy alone, and that cardiac myocyte hyperplasia contributed to changes in heart mass, but the conclusions relied on a number of assumptions about myocyte size and DNA content.
  • detecting cell cycle markers such as Ki67 or the incorporation of nucleotide analogues (e.g. iododeoxyuridine or 3H-thymidine) into newly synthesized DNA further support the notion that the mammalian heart may generate new myocytes
  • human cardiac myocytes can reenter the cell cycle, but the described rates of this phenomenon differ by more than one order of magnitude
  • experiments, made possible by nuclear arms testing in the middle of the 20th century, provide the most convincing evidence for post-natal human cardiac myocyte turnover.
  • the period of nuclear testing serves as a historical DNA labelling pulse, and the period after the test ban treaty serves as a chase.
  • the genomic DNA of cells generated during either the pulse or the chase reflect the earth’s atmospheric 14C concentration at that point in time, which allows investigators to date the age of cardiac myocytes by measuring the concentration of 14C in their nuclei
  1. Listed are a number of problems in detecting the generation of cardiac myocytes:
  • small errors may magnify projections of absolute yearly or lifetime myocyte turnover
  • mis-identification of cellular components by light microscopy
  • autofluorescence of myocardium, which complicates any method that relies on the detection of a fluorescent signal
  • confounders could also affect the 14C dating method, because it requires the isolation of cardiac myocyte nuclei by digestion and flow cytometric sorting

The heart also presents a unique challenge compared to other organs owing to the propensity of cardiac myocytes to synthesize DNA during S-phase without completing either mitosis and/or cytokinesis (Fig 1).

Figure 1. The majority of post-natal human DNA synthesis in the heart does not lead to new myocyte formation.

Cardiac myocytes can complete S-phase, followed by mitosis and cytokinesis (centre) resulting in myocyte doubling. Cardiac myocytes can also complete mitosis without cytokinesis (left), resulting in a binucleated cell. Cardiac myocytes can also undergo chromosomal replication without completing either mitosis or cytokinesis (right), resulting in polyploidy nuclei. By the completion of post-natal development, the majority of human myocyte nuclei contain ~4n chromosomal copies.

During early post-natal development, for example, the majority of rodent cardiac myocytes and an estimated 25–57% of human cardiac myocytes become binucleated. By adulthood, most cardiac myocyte nuclei have also become polyploid with at least one or two additional rounds of chromosomal replication.

The ploidy state of cardiac myocytes may increase with myocardial hypertrophy or injury, which could be mistaken for myocyte division. Conversely, hearts that have been unloaded by implantation of a ventricular assist device may have a lower percentage of polyploid myocytes, because more 2n cardiac myocytes are being generated. These aspects of cardiac myocyte biology inevitably represent potential confounders that must be considered in any quantification of cardiac myocyte formation.

Defining the cellular source of new cardiac myocytes

The majority of reports suggest some endogenous capacity for cardiac myocyte renewal, which has generated a broad focus on finding the cellular source of newly generated cardiac myocytes.  Newly generated adult mammalian cardiac myocytes may arise from an endogenous pool of progenitor cells after injury. The Lee Laboratory developed a genetic lineage mapping approach to quantify progenitor-dependent cardiac myocyte turnover (Fig 2) (Hsieh et al, 2007). In the bitransgenic MerCreMer/ZEG inducible cardiac myocyte reporter mouse, mature cardiac myocytes undergo an irreversible genetic switch from constitutive 3-galactosidase expression to green fluorescent protein (GFP) expression upon tamoxifen pulse. During a chase period, we evaluated the effect of myocardial injury on the proportion of GFP+ or 3-gal+ cardiac myocytes. Pressure overload or myocardial infarction resulted in a significant reduction in the percentage of GFP+ cardiac myocytes and a corresponding increase in the percentage of B-gal+ cardiac myocytes, consistent with repletion of the myocyte pool by B-gal— expressing progenitors. This approach cannot directly identify the molecular identity or anatomic location of the progenitor pool.
One approach to characterizing the molecular phenotype of cardiac progenitors is to study cardiac embryologic develop-ment, guided by the assumption that developmental paradigms are recapitulated during post-natal repair. When examined through a developmental lens, an increasingly detailed picture emerges of the soluble and transcriptional signals that guide the cardiogenic programme from gastrulation (formation of distinct germ layers) through the ultimate maturation of cardiac myocytes. The induction of mesoderm posterior (MESP)-1 expression by brachyury-expressing primitive mesodermal cells is a proximal require¬ment for the ultimate production of differentiated heart cells. As the developing embryo grows beyond the germ layer phase, its developing heart receives cells from distinct anatomic progeni¬tor sources: the 1st and 2nd heart fields provide the majority of the myocardium, with some contribution from epicardial progenitors.
Also, Certain fields may be preferentially marked by specific transcription factors;

  • the first heart field by T-box transcription factor 5 (Tbx5)
  • the second heart field by
    • Lim-homeodomain protein Islet1 (Isl1)
    • and epicardial progenitors by Wilms tumour-1 (WT1) or
    • T-box transcription factor 18 (Tbx18)
    • identified by embryonic lineage tracing or analysis of gene silencing include
      • homeobox protein nkx2.5
      • myocyte enhancer factor 2C (Mef2c)
      • GATA4
      • there is no consensus yet about the molecular identity of post-natal mammalian cardiac progenitor cells or ‘adult cardiac stem cells’

Figure 2. Lineage-mapping in the adult heart.

Left: Theoretical progenitor lineage-mapping is depicted. Progenitors would be selectively marked by fluorescent protein expression. After injury, the appearance of fluorescently labelled cardiac myocytes would support the concept that these progenitors were contributing to new myocyte formation. Right: Differentiated cell (cardiac myocyte) lineage-mapping. Upon treatment of the MerCreMer-ZEG mouse with OH-tamoxifen, approximately 80% of the cardiac myocytes undergo a permanent switch from I3-galactosidase to GFP expression. The dilution of the GFPþ cardiac myocyte pool after injury is consistent with repletion by I3-galþ progenitors.

A number of laboratories have identified cell populations within the post-natal mouse, which fulfil some criteria of cardiac progenitors:

  • expression of a developmentally important gene (isl-1(Laugwitz et al, 2005))
  • specific cell surface receptor profile (c-kit (Beltrami et al, 2003)
  • or sca-1 (Oh et al, 2003))
  • capacity to actively exclude Hoechst dye (so-called side population cells (Martin et al, 2004)) or based on the outgrowth of typical spherical colonies in tissue culture 

In general, the label of ‘cardiac stem cell’ results from the observation of self-propagation and cardiac myocyte transdifferentiation when exposed to cardiogenic conditions in vitro or when delivered in vivo after injury. However, the field will benefit from careful in vivo lineage tracing studies—without ex vivo culture steps—to study if and how a given cell type contributes to cardiac myocyte replenishment during either normal homeostasis or after injury (Fig 2). The lack of such publications to date owes in part to the lack of specificity of many stem cell markers (Fig 3).

Figure 3. Possible recapitulation of developmental paradigms by endogenous post-natal cardiac stem cells.

Between mesodermal development and the emergence of cardiac myocytes, cardiovascular progenitors express a number of markers that have also been detected in the various post-natal cardiac stem cell (CSC) preparations. Expression as measured by messenger RNA (mRNA) or protein expression is denoted with (þ). Absent expression is denoted by (-). Blank1/4 untested.

Moving towards a regenerative therapy

The therapeutic challenge is considerable: a typical large myocardial infarction that leads to heart failure will kill around 1 billion cardiac myocytes,  roughly a quarter of the heart’s myocytes. A possible therapeutic approach would coax an endogenous stem cell population or an exogenously delivered cell-based therapy to replace lost cardiac myocytes in a coordinated fashion. Amongst the myriad of potential cell-based therapies, no clear winning strategy has so far emerged (Segers & Lee, 2008).

Bone marrow derived progenitors

Conflicting studies sparked excitement and also uncertainty about a possible adult cardiogenic progenitor originating outside of the heart. A post-mortem examination of male heart transplant patients who had received female donor hearts found that approximately 10% of -sarcomeric actin-positive cardiac myocytes had Y-chromosomes, and two cases in which a bone marrow cell population with a higher density of the cell surface receptor c-kit, showed repopulation of murine cardiac myocytes after experimental myocardial infarction. A number of studies that followed failed to demonstrate similar rates of chimerism in transplanted hearts or potency of bone marrow stem cell.  However, some therapeutic effect was observed even in studies with no detectable transdifferentiation.

Figure 4. The challenge of regenerating the heart.

Both exogenously delivered cell therapies and progenitors in the endogenous niche encounter a similar hostile environment after myocardial injury, often including inadequate blood supply (ischemia), inflammation and fibrosis/scarring. Regenerative pathways may be activated by as yet unknown paracrine pathways, responsible for recruiting progenitors from the niche, stimulating proliferation and coaxing differentiation.  Cell-based therapy using autologous bone marrow
progenitors was rapidly translated into the clinic to treat human ischemic heart disease. A number of randomized trials, using bone marrow mononuclear cells have been performed and most studies demonstrated modest cell therapy-mediated improvements in ventricular function.

Pluripotent stem cells

Embryonic stem (ES) cells represent the prototypical stem cells with the hallmarks of clonogenicity, self-renewal and pluripotency. The potency of these cells also represents a real safety concern, given their tendency to form teratomas. One approach to overcoming this prohibitive safety problem has been to generate pluripotent-derived progenitors that have already committed to a cardiogenic pathway. As a proof-of-principle example of such a strategy, cells with an expression profile of Oct4, stage-specific embryonic antigen 1 (SSEA-1) and MESP1 demonstrated some regenerative potency when delivered therapeutically in a primate infarct model, without detectable teratoma formation. One could envision a similar strategy using cardiogenic intermediates that express any of the previously mentioned transcription factors associated with cardiac progenitors or cell surface markers such as the receptor for vascular endothelial growth factor (Flk1/KDR). Yet, such a strategy should still demonstrate both substantial preclinical efficacy without tumorigenicity before human translation. If such criteria are met, ES-derived therapies have the potential of providing ‘off-the-shelf’ cardiac myocytes to treat acute myocardial infarctions or chronic heart failure.
A second approach, which may also obviate the risk of teratomas, is to generate a pure population of ES-derived cardiac myocytes for therapeutic delivery either as a cell suspension or after ex vivo tissue engineering. There has already been enormous progress during the past decade in defining the factors and transcription signals to differentiate cardiac myocytes from ES-cells. As discussed in greater detail, cardiac myocyte development is dictated by the time and dose-dependent exposure to a series of growth factors from the wingless-type MMTV integration site (Wnt), fibroblast growth factor (FGF), bone morphogenetic protein (BMP) and nodal families. Several laboratories have successfully generated ES-derived preparations with more than 50% of functional cardiac myocytes.  The most realistic future for such technical advances may be as an unlimited source of cardiac myocytes for engineering myocardial grafts.
The generation of induced pluripotent stem (iPS) cells may overcome two important limitations of ES cells: ethical concerns about harvesting ES cells from embryos and graft rejection

  • iPS cells can be custom-engineered from a patient’s stromal cells for autologous transplantation.
  • immunogenecity in syngeneically transplanted iPS cells, suggests that the immune system cannot yet be discounted in the development of iPS-based therapies

The initial protocols for iPS cell generation involved retro-viral-mediated expression of four stem-cell genes.
But virally reprogrammed cells may harbour an associated risk of neoplastic conversion. Alternative reprogramming strategies, such as the use of small molecules (Shi et al, 2008) or non-viral gene modifying approaches (Warren et al, 2010) will probably be a necessary component of any future therapeutic strategies. However, the most important lesson from these landmark studies may be the remarkable plasticity of even the most terminally differentiated cells when exposed to the right combination of signals.

Tissue engineering

Historically, the greatest challenge in tissue engineering has been an adequate supply of oxygen and nutrients for metabolically active tissues such as the heart. One approach has been to engineer thin cardiac sheets, which can then be stacked for in vivo delivery. Although these layered sheets demonstrate some degree of electromechanical coordination and neovascularization in vivo, it is not clear yet if such an approach can be optimized to yield full-thickness myocardium with an adequate blood supply. The addition of non-myocyte cellular components, such as fibroblasts and endothelial cells, leads to the formation of primitive vascular structures within engineered grafts, but the electro-mechanical properties are not sufficient for normal functionality.

Circumventing cell-based therapy with pharmacoregeneration?

A short-term goal may be to exploit paracrine signalling to amplify the existent endogenous regenerative response. Recent cell transplantation experiments conducted in our laboratory, using an inducible cre-based genetic lineage mapping approach, tested the hypothesis that cell-based therapies might exert proregenerative effects via a paracrine mechanism (Loffredo et al, 2011) (Fig 5).  Consistent with some prior studies, we found no evidence for transdifferentiation of exogenously delivered bone marrow cells into cardiac myocytes. However, we did find increased generation of cardiac myocytes from endogenous progenitors in mice, which were administered c-kit+ bone marrow cells but not mesenchymal stem cells. This finding suggests paracrine signalling between exogenously delivered cells and endogenous resident progenitors. It provides a rationale for therapeutic interventions aimed at activating progenitors or recruiting them from their niche to the injury site.

Figure 5. Proposed of action for cell-based therapies.

In theory, exogenously delivered cells may directly differentiate into endothelial cells, smooth muscle cells and cardiac myocytes. They may also release paracrine factors which may result in non-regenerative effects, such as immunomodulation, angiogenesis or cardioprotection. Recent work from our laboratory suggests that a dominant mechanism achieved with bone marrow progenitor therapy may be via the activation of endogenous progenitor recruitment (Loffredo et al, 2011).

Controlling the mitotic activity of mononucleated cardiac myocytes may provide an alternative approach to replenishing cardiac myocytes. A major concern with systemic growth factor therapy, however, is the potential for mitogenic effects that may impact other organs. Thus, the future of pharmacologic regeneration may lie in the local delivery of engineered proteins and small molecules that target 

Future directions

In this review, we have described the current status of research on cardiac regeneration, highlighting important recent discoveries and ongoing controversies. The initial hope that a cell progenitor would emerge with the capacity to regenerate the injured mammalian heart in the same manner that bone marrow may be reconstituted has not been realized.
Cardiac myocyte regeneration may lie in the local delivery of engineered proteins and small molecules that target specific survival, growth and differentiation pathways.

Pending issues

Dissect the mechanistic differences between adult mammals with limited regenerative capacity and organisms, such as neonatal mice, zebrafish and newts, that demonstrate unambiguous cardiac myocyte regeneration. Understanding these differences may reveal new pathways that can be therapeutically targeted to achieve more robust regeneration.

Complete molecular and functional characterization of endogenous cardiac myocyte progenitors. Multiple laboratories have isolated progenitors from the heart with different molecular characteristics. What are the in vivo functional roles of these progenitors? Do the observed molecular differences between these isolated cells represent functionally distinct cell types?

Identify paracrine signalling pathways responsible for activation and recruitment of endogenous cardiac myocyte progenitors. This may facilitate a pharmacoregenerative therapy, in which treatment with a protein or small molecule would hold the promise of amplifying endogenous regeneration.

Refine reprogramming strategies to more efficiently produce mature cardiac myocytes, both in vitro and in vivo. The ultimate bioengineering goal is to produce a pure population of mature, fully functional cardiac myocytes for ex vivo tissue engineering (or) to control the proliferation and differentiation of endogenous cell populations or exogenously delivered cell therapies such that scar tissue is replaced by myocardium. These different strategies are unified by an underlying requirement to understand the fundamental pathways involved in cardiac myocyte differentiation and maturation.

There is reason for optimism for a regenerative medicine approach to heart failure, given the intense research efforts and the capacity of higher organisms, including the neonatal mouse, to regenerate myocardium. Perhaps the most important issue in this field is identifying which findings are consistently supported by multiple experimental approaches. Ultimately, the findings that are easily reproduced by most or all laboratories will most likely benefit patients.

Selected references

Hsieh et al, 2007.  Hsieh PC, Segers VF, Davis ME, MacGillivray C, Gannon J, Molkentin JD, Robbins J, Lee RT (2007) Evidence from a genetic fate-mapping study that stem cells refresh adult mammalian cardiomyocytes after injury. Nat Med 13: 970¬974
Laugwitz et al, 2005.  Laugwitz KL, Moretti A, Lam J, Gruber P, Chen Y, Woodard S, Lin LZ, Cai CL, Lu MM, Reth M et al (2005) Postnatal isl1þ cardioblasts enter fully differentiated cardiomyocyte lineages. Nature 433: 647-653
Beltrami et al, 2003.  Beltrami AP, Barlucchi L, Torella D, Baker M, Limana F, Chimenti S, Kasahara H, Rota M, Musso E, Urbanek K et al (2003) Adult cardiac stem cells are multipotent and support myocardial regeneration. Cell 114: 763¬776
Oh et al, 2003. Oh H, Bradfute SB, Gallardo TD, Nakamura T, Gaussin V, Mishina Y, Pocius J, Michael LH, Behringer RR, Garry DJ et al (2003) Cardiac progenitor cells from adult myocardium: homing, differentiation, and fusion after infarction. Proc Natl Acad Sci USA 100: 12313-12318
Segers & Lee, 2008.  Segers VF, Lee RT (2008) Stem-cell therapy for cardiac disease. Nature 451:937-942
Loffredo et al, 2011.  Loffredo FS, Steinhauser ML, Gannon J, Lee RT (2011) Bone marrow-derived cell therapy stimulates endogenous cardiomyocyte progenitors and promotes cardiac repair. Cell Stem Cell 8: 389-398.
Shi et al, 2008.  Shi Y, Desponts C, Do JT, Hahm HS, Scholer HR, Ding S (2008) Induction of pluripotent stem cells from mouse embryonic fibroblasts by Oct4 and Klf4 with small-molecule compounds. Cell Stem Cell 3: 568-574.
Warren et al, 2010.  Warren L, Manos PD, Ahfeldt T, Loh YH, Li H, Lau F, Ebina W, Mandal PK, Smith ZD, Meissner A et al (2010) Highly efficient reprogramming to pluripotency and directed differentiation of human cells with synthetic modified mRNA. Cell Stem Cell 7: 618-630.

Mammalian Heart Renewal by Preexisting Cardiomyocytes

SE Senyo, ML Steinhauser, CL Pizzimenti, VK. Yang, Lei Cai, Mei Wang, …,and Richard T. Lee
Cardiovascular and Genetics Divisions, Brigham and Women’s Hospital and Harvard Medical School,
INSERM, Orsay (Fr), Institut Curie, Laboratoire de Microscopie Ionique, Orsay (Fr), National Resource for Imaging Mass Spectrometry, Harvard Stem Cell Institute
Nature. 2013 January 17; 493(7432): 433–436.  http://dx.doi.org/10.1038/nature11682

Although recent studies have revealed that heart cells are generated in adult mammals, the frequency and source of new heart cells is unclear. Some studies suggest a high rate of stem cell activity with differentiation of progenitors to cardiomyocytes. Other studies suggest that new cardiomyocytes are born at a very low rate, and that they may be derived from division of pre-existing cardiomyocytes. Thus, the origin of cardiomyocytes in adult mammals remains unknown. Here we combined two different pulse-chase approaches — genetic fate-mapping with stable isotope labeling and Multi-isotope Imaging Mass Spectrometry (MIMS). We show that genesis of cardiomyocytes occurs at a low rate by division of pre-existing cardiomyocytes during normal aging, a process that increases by four-fold adjacent to areas of myocardial injury. Cell cycle activity during normal aging and after injury led to polyploidy and multinucleation, but also to new diploid, mononucleated cardiomyocytes. These data reveal pre-existing cardiomyocytes as the dominant source of cardiomyocyte replacement in normal mammalian myocardial homeostasis as well as after myocardial injury.

Despite intensive research, fundamental aspects of the mammalian heart’s capacity for self-renewal are actively debated. Estimates of cardiomyocyte turnover range from less than 1% per year to more than 40% per year. Turnover has been reported to either decrease or increase with age, while the source of new cardiomyocytes has been attributed to both division of existing myocytes and to progenitors residing within the heart or in exogenous niches such as bone marrow. Controversy persists regarding the plasticity of the adult heart in part due to methodological challenges associated with studying slowly replenished tissues. Toxicity attributed to radiolabeled thymidine and halogenated nucleotide analogues limits the duration of labeling and may produce direct biological effects. The challenge of measuring cardiomyocyte turnover is further compounded by the faster rate of turnover of cardiac stromal cells relative to cardiomyocytes.

We used Multi-isotope Imaging Mass Spectrometry (MIMS) to study cardiomyocyte turnover and to determine whether new cardiomyocytes are derived from preexisting myocytes or from a progenitor pool (Fig 1a). MIMS uses ion microscopy and mass spectrometry to generate high resolution quantitative mass images and localize stable isotope reporters in domains smaller than one micron cubed15,16,17. MIMS generates 14N quantitative mass images by measuring the atomic composition of the sample surface with a lateral resolution of under 50nm and a depth resolution of a few atomic layers. Cardiomyocyte cell borders and intracellular organelles were easily resolved (Fig 1b). Regions of interest can be analyzed at higher resolution, demonstrating cardiomyocyte-specific subcellular ultrastructure, including sarcomeres (Fig 1c, Supplemental Fig 1a). In all subsequent analyses, cardiomyocyte nuclei were identified by their location within sarcomere-containing cells, distinguishing them from adjacent stromal cells.
An immense advantage of MIMS is the detection of nonradioactive stable isotope tracers. As an integral part of animate and inanimate matter, they do not alter biochemical reactions and are not harmful to the organism18. MIMS localizes stable isotope tracers by simultaneously quantifying multiple masses from each analyzed domain; this enables the generation of a quantitative ratio image of two stable isotopes of the same element15. The incorporation of a tracer tagged with the rare stable isotope of nitrogen (15N) is detectable with high precision by an increase in 15N:14N above the natural ratio (0.37%). Nuclear incorporation of 15N-thymidine is evident in cells having divided during a one-week labeling period, as observed in the small intestinal epithelium, which turns over completely in 3–5 days16 (Fig 1d); in contrast, 15N-thymidine labeled cells are rarely observed in the heart (Fig 1e) after 1 week of labeling. In subsequent studies, small intestine was used as a positive control to confirm label delivery.
To evaluate for an age-related change in cell cycle activity, we administered 15N-thymidine for 8 weeks to three age groups of C57BL6 mice starting at day-4 (neonate), at 10-weeks (young adult) and at 22-months (old adult) (Supplemental Fig 2). We then performed MIMS analysis (Fig 2a, b, Supplemental Fig 3). In the neonatal group, 56% (±3% s.e.m., n=3 mice) of cardiomyocytes demonstrated 15N nuclear labeling, consistent with the well-accepted occurrence of cardiomyocyte DNA synthesis during post-natal development19. We observed a marked decline in the frequency of 15N-labeled cardiomyocyte nuclei (15N+CM) in the young adult (neonate= 1.00%15N+CM/day ±0.05 s.e.m. vs young adult=0.015% 15N+CM/ day ±0.003 s.e.m., n=3 mice/group, p<0.001) (Fig 2a, c; Supplemental Fig 3). We found a further reduction in cardiomyocyte DNA synthesis in old mice (young adult=0.015%15N+CM/day ±0.003 s.e.m. vs. old adult=0.007 %15N+CM/day ±0.002 s.e.m., n=3/group, p<0.05) (Fig 2c). The observed pattern of nuclear 15N-labeling in cardiomyocytes is consistent with the known chromatin distribution pattern in cardiomyocytes20 (Supplemental Fig 1b) and was measured at levels that could not be explained by DNA repair (Supplemental Fig 4). Extrapolating DNA synthesis measured in cardiomyocytes over 8 weeks yields a yearly rate of 5.5% in the young adult and 2.6% in the old mice. Given that cardiomyocytes are known to undergo DNA replication without completing the cell cycle19,21,22, these calculations represent the upper limit of cardiomyocyte generation under normal homeostatic conditions, indicating a low rate of cardiogenesis.
To test whether cell cycle activity occurred in preexisting cardiomyocytes or was dependent on a progenitor pool, we performed 15N-thymidine labeling of double-transgenic MerCreMer/ZEG mice, previously developed for genetic lineage mapping (Fig 3a)23,24. MerCreMer/ZEG cardiomyocytes irreversibly express green fluorescent protein (GFP) after treatment with 4OH-tamoxifen, allowing pulse labeling of existing cardiomyocytes with a reproducible efficiency of approximately 80%. Although some have reported rare GFP expression by non-cardiomyocytes with this approach25, we did not detect GFP expression in interstitial cells isolated from MerCreMer/ZEG hearts nor did we detect GFP expression by Sca1 or ckit-expressing progenitors in histological sections (Supplemental Fig 5). Thus, during a chase period, cardiomyocytes generated from progenitors should be GFP−, whereas cardiomyocytes arising from preexisting cardiomyocytes should express GFP at a frequency similar to the background rate induced by 4OH-tamoxifen. We administered 4OH-tamoxifen for two weeks to 8 wk-old mice (n=4); during a subsequent 10-week chase, mice received 15N-thymidine via osmotic minipump.

We next used MIMS and genetic fate mapping to study myocardial injury. Cardiomyocyte GFP labeling was induced in MerCreMer/ZEG mice with 4OH-tamoxifen. Mice then underwent experimental myocardial infarction or sham surgery followed by continuous labeling with 15N-thymidine for 8wks. The frequency of 15N-labeled cardiomyocytes in sham-operated mice was similar to prior experiments in unoperated mice (yearly projected rates: sham=6.8%; unoperated=4.4%), but increased significantly adjacent to infarcted myocardium (total 15N+ cardiomyocyte nuclei: MI=23.0% vs sham=1.1%, Fig 4a–b, Supplemental Fig 8). We examined GFP expression, nucleation and ploidy status of 15N-labeled cardiomyocytes and surrounding unlabeled cardiomyocytes. We found a significant dilution of the GFP+ cardiomyocyte pool at the border region as previously shown23,24 (67% vs. 79%, p<0.05, Table 2, Supplemental Fig 9); however, 15N+ myocytes demonstrated a similar frequency of GFP expression compared to unlabeled myocytes (71% vs. 67%, Fisher’s exact=n.s.), suggesting that DNA synthesis was primarily occurring in pre-existing cardiomyocytes. Of 15N-labeled cardiomyocytes, approximately 14% were mononucleated and diploid consistent with division of pre-existing cardiomyocytes (Supplemental Fig 6, 7). We observed higher DNA content (>2N) in the remaining cardiomyocytes as expected with compensatory hypertrophy after injury. Thus, in the 8wks after myocardial infarction, approximately 3.2% of the cardiomyocytes adjacent to the infarct had unambiguously undergone division (total 15N+ × mononucleated diploid fraction = 23% × 0.14 = 3.2%). The low rate of cardiomyocyte cell cycle completion is further supported by the absence of detectable Aurora B Kinase, a transiently expressed cytokinesis marker, which was detected in rapidly proliferating small intestinal cells but not in cardiomyocytes (Supplemental Fig 10). We also considered the possibility that a subset of 15N+ myocytes that were multinucleated and/or polyploid resulted from division followed by additional rounds of DNA synthesis without division. However, quantitative analysis of the 15N+ population did not identify a subpopulation that had accumulated additional 15N-label as would be expected in such a scenario (Supplemental Fig 11). Together, these data suggest that adult cardiomyocytes retain some capacity to reenter the cell cycle, but that the majority of DNA synthesis after injury occurs in preexisting cardiomyocytes without completion of cell division.
If dilution of the GFP+ cardiomyocyte pool cannot be attributed to division and differentiation of endogenous progenitors, do these data exclude a role for progenitors in the adult mammalian heart? These data could be explained by preferential loss of GFP+ cardiomyocytes after injury, a process that we have previously considered but for which we have not found supporting evidence23. Such an explanation excludes a role for endogenous progenitors in cardiac repair and would be consistent with data emerging from lower vertebrates8,26 and the neonatal mouse27 in which preexisting cardiomyocytes are the cellular source for cardiomyocyte repletion. A second possibility to explain the dilution of the GFP+ cardiomyocyte pool is that injury stimulates progenitor differentiation without division; inevitably, this would lead to exhaustion of the progenitor pool, which if true could explain the limited regenerative potential of the adult mammalian heart.

In summary, this study demonstrates birth of cardiomyocytes from preexisting cardiomyocytes at a projected rate of approximately 0.76%/year (15N+ annual rate × mononucleated diploid fraction = 4.4% × 0.17) in the young adult mouse under normal homeostatic conditions, a rate that declines with age but increases by approximately four-fold after myocardial injury in the border region. This study shows that cardiac progenitors do not play a significant role in myocardial homeostasis in mammals and suggests that their role after injury is also limited.

Engineering insulin-like growth factor-1 for local delivery

T Tokunou, R Miller, P Patwari, ME Davis, VFM Segers, AJ Grodzinsky, and RT Lee
Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA and Biological Engineering, MIT, Cambridge, MA
FASEB J. 2008 June ; 22(6): 1886–1893.   http://dx.doi.org/10.1096/fj.07-100925

Insulin-like growth factor-1 (IGF-1) is a small protein that promotes cell survival and growth, often acting over long distances. Although for decades IGF-1 has been considered to have therapeutic potential, systemic side effects of IGF-1 are significant, and local delivery of IGF-1 for tissue repair has been a long-standing challenge. In this study, we designed and purified a novel protein, heparin-binding IGF-1 (Xp-HB-IGF-1), which is a fusion protein of native IGF-1 with the heparin-binding domain of heparin-binding epidermal growth factor-like growth factor. Xp-HB-IGF-1 bound selectively to heparin as well as the cell surfaces of 3T3 fibroblasts, neonatal cardiac myocytes and differentiating ES cells. Xp-HB-IGF-1 activated the IGF-1 receptor and Akt with identical kinetics and dose response, indicating no compromise of biological activity due to the heparin-binding domain. Because cartilage is a proteoglycan-rich environment and IGF-1 is a known stimulus for chondrocyte biosynthesis, we then studied the effectiveness of Xp-HB-IGF-1 in cartilage. Xp-HB-IGF-1 was selectively retained by cartilage explants and led to sustained chondrocyte proteoglycan biosynthesis compared to IGF-1. These data show that the strategy of engineering a “long-distance” growth factor like IGF-1 for local delivery may be useful for tissue repair and minimizing systemic effects.

INSULIN-LIKE GROWTH FACTOR-1 (IGF-1) is a growth factor well known as an important mediator of cell growth and differentiation. IGF-1 stimulates several signaling pathways through the tyrosine kinase IGF-1 receptor, including phosphatidylinositol (PI) 3-kinase and mitogen-activated protein kinases (MAPKs). PI3-kinase has many downstream targets, including the kinase Akt, and activation of Akt promotes survival, proliferation, and growth.
IGF-1 has been extensively studied for its therapeutic potential in tissue repair and regeneration. IGF-1 is a small and highly diffusible protein that can act over long distances. However, systemic administration of IGF-1 has significant side effects as well as the potential to promote diabetic retinopathy and cancer. Therefore, local delivery of IGF-1 has been a longstanding challenge. Here, we describe the design of a new protein, formed by fusion of IGF-1 with the heparin-binding (HB) domain of heparin-binding epidermal growth factor-like growth factor (HB-EGF). HB-EGF binds selectively to glycosaminoglycans through its highly positively charged heparin-binding domain.

Thus, we hypothesized that engineering IGF-1 to bind to glycosaminoglycans could provide selective delivery of IGF-1 to cell surfaces or to specific tissues. We demonstrate that this heparin-binding IGF-1 (Xp-HB-IGF-1) can bind to cell surfaces as well as the proteoglycan-rich tissue of cartilage; furthermore, Xp-HB-IGF-1 prolongs the stimulation of chondrocyte biosynthesis, demonstrating its potential for tissue specific repair.

Purification of Xp-HB-IGF-1

Figure 1A—C shows the constructs for Xp-HB-IGF-1 and the control Xp-IGF-1 fusion proteins.

IGF-1 has 3 disulfide bonds and includes 70 amino acids. The IGF-1 fusion proteins both contain polyhistidine tags for protein purification and Xpress tags for protein detection. The expected molecular masses of Xp-HB-IGF-1 and Xp-IGF-1 are 14,018 and 11,548 Da, respectively. Xp-HB-IGF-1 has the HB domain on the N terminus of IGF-1. The HB domain has 21 amino acids and includes 12 positively charged amino acids. Final purification of the new fusion proteins after refolding was performed with RP-HPLC (Fig. 1D, E). Identification of the correctly folded protein was performed as described previously and confirmed with bioactivity assays. These 3 IGF-1s (Xp-HB-IGF-1, Xp-IGF-1, and unmodified IGF-1) yielded similar intensities.

Xp-HB-IGF-1 binds to heparin and cell surfaces

1. Xp-HB-IGF-1 binds selectively to heparin compared with Xp-IGF-1 (Fig. 2A).
2. Xp-HB-IGF-1 bound to 3T3 fibroblast cells when treated with 10 and 100 nM concentrations.
3. Xp-HB-IGF-1 binds with neonatal cardiac myocytes, with clear selective binding of Xp-HB-IGF-1 (Fig 2C)
4. These results are consistent with binding of this HB domain to heparan sulfate in the submicromolar range
5. Xp-HB-IGF-1 was readily detected on the surfaces of ES cells in embryoid bodies — which contain multiple cell types.
6. There is more Xpress epitope tag in Xp-HB-IGF-1 group than the Xp-IGF-1 group, suggesting that Xp-HB-IGF-1 binds with heparan sulfate on the cell surface.

Xp-HB-IGF-1 bioactivity

Bioassays for IGF-1 receptor phosphorylation and Akt activation were performed. Control IGF-1, Xp-HB-IGF-1, and Xp-IGF-1 all activated the IGF-1 receptor of neonatal cardiac myocytes dose-dependently and induced Akt phosphorylation identically (Fig. 3A), and they  activated Akt with a similar time course (Fig. 3B), indicating — addition of the heparin-binding domain does not interfere with the bioactivity of IGF-1.

  1. Xp-HB-IGF-1 transport in cartilage
  2. Cartilage is a proteoglycan-rich tissue, and chondrocytes respond to IGF-1 with increased extracellular matrix synthesis (19). Because prolonged local stimulation of IGF-1 signaling could thus be beneficial for cartilage repair, we studied the ability of Xp-HB-IGF-1 to bind to cartilage.
  3. Xp-HB-IGF-1 is selectively retained by cartilage, while Xp-IGF-1 is rapidly lost.
  4. Xp-HB-IGF-1 can bind to cartilage after chondroitin sulfate digestion

To explore the possibility of nonspecific binding of Xp-HB-IGF-1 to glycosaminoglycans other than heparan sulfate, we studied the binding of Xp-HB-IGF-1 after chondroitinase ABC digestion.
Xp-HB-IGF-1 retention is not mediated by the pool of chondroitin sulfated proteoglycans in the cartilage matrix.

  1. Xp-HB-IGF-1 increases chondrocyte biosynthesis
  2. Xp-HB-IGF-1, which is selectively retained in the cartilage, stimulates chondrocyte biosynthesis over a more sustained period.

DISCUSSION

In this study, we describe a novel IGF-1 protein, Xp-HB-IGF-1, which binds to proteoglycan-rich tissue and cell surfaces but has the same bioactivity as IGF-1. Our data indicate that Xp-HB-IGF-1 can activate the IGF-1 receptor and Akt and thus that the heparin-binding domain does not interfere with interactions of IGF-1 and its receptor. IGF-1 has four domains: B domain (aa 1–29), C domain (aa 30 – 41), A domain (aa 42–62) and D domain (aa 63–70), with the C domain playing the most important role in binding to the IGF-1 receptor. Replacement of the entire C domain causes a 30-fold decrease in affinity for the IGF-1 receptor. Thus, the addition of the heparin-binding domain to the N terminus of IGF-1 was not anticipated to interfere with interactions with the IGF-1 C domain.
Both extracellular matrix and cell surfaces are rich in proteoglycans and can serve as reservoirs for proteoglycan-binding growth factors. A classic example is the fibroblast growth factor-2 (FGF-2) system, where a low-affinity, high-capacity pool of proteoglycan receptors serves as a reservoir of FGF-2 for its high-affinity receptor. Our experiments suggest that Xp-HB-IGF-1 could function in some circumstances in a similar manner, since Xp-HB-IGF-1 is selectively retained on cell surfaces. Many growth factors are known to interact with heparan sulfate, including HB-EGF (10-12), FGF-2 (26), vascular endothelial growth factor-A (VEGF-A), transforming growth factor beta (TGF-β) (28), platelet-derived growth factors (PDGFs), and hepatocyte growth factor (HGF). However, other proteins such as nerve growth factor (NGF), which induces differentiation and reduces apoptosis of neurons, does not have the heparin-binding domain. Thus, the strategy of engineering growth factors for selective matrix or cell surface binding could be used for other growth factors.
IGF-1 can also bind with extracellular matrix via IGF binding proteins (IGFBPs); in the circulation, at least 99% of IGF-1 is bound to IGFBPs (IGFBP-1 to −6). Further experiments are necessary to determine whether addition of a heparin-binding domain to IGF-1 changes interactions with IGFBPs and whether this changes its biological activity.
IGF-1 can promote the synthesis of cartilage extracellular matrix and inhibit cartilage degradation (19); however, a practical mode of IGF-1 delivery to cartilage has yet to be developed (33). Heparan sulfate proteoglycans are prevalent in the pericellular matrix of cartilage, particularly as chains on perlecan and syndecan-2, and are known to bind other ligands such as FGF-2 (34). Our experiments suggest that Xp-HB-IGF-1 protein can bind with matrix and increase local, long-term bioavailability to chondrocytes and thus may improve cartilage repair.

Selected References

Hameed M, Orrell RW, Cobbold M, Goldspink G, Harridge SD. Expression of IGF-I splice variants in young and old human skeletal muscle after high resistance exercise. J. Physiol 2003;547:247–254. [PubMed: 12562960]
Shavlakadze T, Winn N, Rosenthal N, Grounds MD. Reconciling data from transgenic mice that overexpress IGF-I specifically in skeletal muscle. Growth Horm. IGF Res 2005;15:4–18. [PubMed: 15701567]
Milner SJ, Francis GL, Wallace JC, Magee BA, Ballard FJ. Mutations in the B-domain of insulin-like growth factor-I influence the oxidative folding to yield products with modified biological properties. Biochem. J 1995;308(Pt 3):865–871. [PubMed: 8948444]
Milner SJ, Carver JA, Ballard FJ, Francis GL. Probing the disulfide folding pathway of insulin-like growth factor-I. Biotechnol. Bioeng 1999;62:693–703. [PubMed: 9951525]
Bonassar LJ, Grodzinsky AJ, Srinivasan A, Davila SG, Trippel SB. Mechanical and physicochemical regulation of the action of insulin-like growth factor-I on articular cartilage. Arch. Biochem. Biophys 2000;379:57–63. [PubMed: 10864441]
Denley A, Cosgrove LJ, Booker GW, Wallace JC, Forbes BE. Molecular interactions of the IGF system. Cytokine Growth Factor Rev 2005;16:421–439. [PubMed: 15936977]
Musaro A, Dobrowolny G, Rosenthal N. The neuroprotective effects of a locally acting IGF-1 isoform. Exp. Gerontol 2007;42:76–80. [PubMed: 16782294]
Farndale RW, Buttle DJ, Barrett AJ. Improved quantitation and discrimination of sulphated glycosaminoglycans by use of dimethylmethylene blue. Biochim. Biophys. Acta 1986;883:173–177. [PubMed: 3091074]
Yayon A, Klagsbrun M, Esko JD, Leder P, Ornitz DM. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor. Cell 1991;64:841– 848. [PubMed: 1847668]
Martin P. Wound healing—aiming for perfect skin regeneration. Science 1997;276:75–81. [PubMed: 9082989]

Figure 1.  Construction and purification of a new Xp-HB-IGF-1 fusion protein.

Figure 1.  Construction and purification of a new Xp-HB-IGF-1 fusion protein.

A) The heparin binding domain of HB-EGF was inserted N-terminal to IGF-1 to generate the fusion protein. The construct included the hexahistidine and Xpress tags from the pTrcHis vector for purification and detection. B) The resulting amino acid sequence of HB-IGF-1. C) Schematic for the structure of HB-IGF-1. Red circles: positively charged amino acids; blue circles: negatively charged amino acids; yellow circles: cysteines. The arrow shows the HB domain. In this figure the epitope tags are not shown. D, E) Representative reverse-phase high-performance liquid chromatography (RP-HPLC) elution profiles with single peaks containing correctly folded protein. Readings of optical density at 214 nm are in blue; readings at 280 nm are in red; elution is by acetonitrile (ACN) gradient. F) After RP-HPLC, Coomassie blue staining and Western blot analysis demonstrate isolation of single bands containing Xpress-tagged protein. The right panel shows that the Western blot analysis of IGF-1, and the two engineered IGF-1 proteins yield similar results using an anti-IGF-1 antibody.

Protein Therapeutics for Cardiac Regeneration after Myocardial Infarction

Vincent F.M. Segers and Richard T. Lee
Provasculon Inc, 14 Cambridge Center, and Harvard Stem Cell Institute and the Cardiovascular Division, Department of Medicine, Brigham and Women’s Hospital, Harvard Medical School, Cambridge, MA
J Cardiovasc Transl Res. 2010 October ; 3(5): 469–477.   http://dx.doi./10.1007/s12265-010-9207-5.

Although most medicines have historically been small molecules, many newly approved drugs are derived from proteins. Protein therapies have been developed for treatment of diseases in almost every organ system, including the heart. Great excitement has now arisen in the field of regenerative medicine, particularly for cardiac regeneration after myocardial infarction. Every year, millions of people suffer from acute myocardial infarction, but the adult mammalian myocardium has limited regeneration potential. Regeneration of the heart after myocardium infarction is therefore an exciting target for protein therapeutics.  

In this review, we discuss different classes of proteins that have therapeutic potential to regenerate the heart after myocardial infarction. Protein candidates have been described that induce angiogenesis, including fibroblast growth factors and vascular endothelial growth factors, although thus far clinical development has been disappointing. Chemotactic factors that attract stem cells, e.g. hepatocyte growth factor and stromal cell derived factor-1, may also be useful. Finally, neuregulins and periostin are proteins that induce cell cycle reentry of cardiomyocytes, and growth factors like IGF-1 can induce growth and differentiation of stem cells. As our knowledge of the biology of regenerative processes and the role of specific proteins in these processes increases, the use of proteins as regenerative drugs could develop as a cardiac therapy.
Keywords: protein therapeutics; myocardial infarction; regeneration; heart failure

The current standard of care for MI is early reperfusion of the occluded vessel with angioplasty or thrombolysis to reverse ischemia and increase the number of surviving myocytes. Efforts to decrease delays between onset of symptoms and reperfusion have resulted in decreased morbidity and mortality, but the maximal benefit of early reperfusion has reached a point close to practical limits. Besides early reperfusion therapy, ACE inhibitors and beta-blockers are used to prevent remodeling after MI and progression to heart failure. Both ACE inhibitors and beta-blockers improve long term survival but no therapies besides cardiac transplantation are currently available that restore cardiac function.
In the last decade, a large number of pre-clinical and clinical studies have been published on the potential use of stem cells for cardiac regeneration after MI. Different stem cell types have been shown to improve cardiac function in animal studies and can induce a small but potentially significant increase in ejection fraction in clinical studies. Stem cell therapy is a promising treatment option for heart failure, but numerous technical challenges and gaps in our understanding of stem cell behavior may limit translation to the clinic.
With the advent of biotechnology, protein and peptide drugs are becoming increasingly important in modern medicine. Drugs based on naturally-occurring proteins have the advantage of efficacy based on a mechanism of action refined by millions of years of biological evolution. Though promising as therapeutics, proteins might behave differently when used at pharmacological instead of physiological concentrations with an increase in adverse effects on other organs. Proteins used as therapeutics have been modified in different ways to limit immunogenicity and rapid degradation in plasma and tissues.
We discuss four different classes of proteins that could potentially benefit patients with MI (Figure 1); all of these proteins have been shown to improve cardiac function in animal models of MI or heart failure. They include angiogenic growth factors, proteins that increase recruitment of progenitor cells to the heart, proteins that induce mitosis of existing myocytes, and proteins that increase differentiation and growth of stem cells and myocytes. As more is learned about cardiac regeneration and why mammals lack sufficient myocardial regeneration, more proteins are likely to be added to this list of candidates.

A decade of extensive research on cardiac stem cell biology revealed 1 protein (G-CSF) that can be used to mobilize hematopoietic stem cells and just 2 proteins with chemotactic properties on stem cells: SDF-1 on endothelial progenitor cells and HGF on cardiac stem cells. Another protein that has been identified as a stem cell attractant is monocyte chemotactic protein-3 which attracts mesenchymal stem cells [42]. It is unknown if local administration of MCP-3 improves cardiac function. Identification of new stem cell chemotactic proteins is important because it could lead to the development of new and feasible therapeutics for treatment of MI and heart failure. At the same time, the true regenerative potential of most stem cells remains highly controversial; indicating that even if a chemotactic factor attracting stem cells to the heart is identified, formation of functional myocardial is still a challenging task.

Proteins like periostin and neuregulin which stimulate mitosis of surviving myocytes can partially restore the damage inflicted by MI. However, some requirements have to be met before this will result in a viable therapy. An inherent selectivity for myocytes would also allow for systemic delivery as opposed to the use of more complicated local delivery methods. An important factor to consider is the duration of the signal necessary to induce mitosis in a significant number of myocytes. A protein that induces cell cycle reentry in a significant fraction of myocytes with a single pulse has more therapeutical potential than a protein that needs sustained or repeated delivery. Ideally, pro-mitotic proteins will be not only specific for myocytes in general but might also be specific for myocytes in the border zone of the MI. This has drawbacks, among which is that formation of new myocytes, either by stem cell differentiation or by myocyte mitosis, carries an increased risk of ventricular arrhythmias.

Figure 1. Regeneration of the heart by 4 different classes of proteins

Figure 1. Regeneration of the heart by 4 different classes of proteins

See text for details. A) FGF and VEGF increase angiogenesis. B) G-CSF mobilizes bone marrow hematopoietic stem cells and SDF-1 attracts endothelial progenitor cells. HGF attracts cardiac stem cells. C) Neuregulin and periostin can induce division of adult cardiomyocytes. D) IGF-1 induces maturation and differentiation of cardiac stem cells.

Read Full Post »

Cardiovascular Drugs: Transgenomic’s Molecular Diagnostic Test to be Commercialized by PDI

Reporter: Aviva Lev-Ari, PhD, RN

Transgenomic, PDI Team up to Commercialize Genetic Cardiovascular MDx

October 15, 2013

NEW YORK (GenomeWeb News) – PDI and Transgenomic today announced a collaboration to commercialize Transgenomic’s molecular diagnostic test that identifies specific genes that influence the safety and effectiveness of commonly used cardiovascular drugs.

Under the terms of the deal, PDI will market and promote the test called CardioPredict in the US. Transgenomic will process the test, which launches later this month, in its CLIA laboratory and be responsible for customer support. The firms will bear their respective costs and will divide profits based on an undisclosed formula. PDI will also provide funding to Transgenomic “principally to mitigate working capital requirements.”

Other financial terms were not disclosed.

“With an experienced sales team and a demonstrated record of success in sales and marketing in the life sciences, PDI is the right partner for the launch and long-term growth of CardioPredict,” Transgenomic President and CEO Paul Kinnon said in a statement. Kinnon replaced Craig Tuttle in those positions earlier this month.

“This collaboration with Transgenomic is another step in our pursuit of commercialization opportunities for clinically valuable products aimed at adding more predictable, higher growth, higher margin businesses that can leverage the substantial full commercialization capabilities of PDI,” PDI CEO Nancy Lurker added.

Based in Parsippany, NJ, PDI is a healthcare commercialization company.

“There is a large market, a well-defined patient population, and a clearly identified physician base treating these patients that should allow for a very efficient use of PDI’s broad base of commercialization capabilities,” Lurker said.

 

Read Full Post »

Platelets in Translational Research – Part 1

 

Reviewer and Curator: Larry H Bernstein, MD, FCAP 

 

Introduction

This article is one of a 2 part presentation posted as an example of a central role of platelet biology in translational medicine investigations leading to the prevention and control of hemolytic and coagulopathic conditions, and to an understanding of atherosclerotic cardiovascular disease. The study of coagulation traces back to the early work on Warfarin in bleeding, and even earlier than that to the geneological evidence of inherited hemophilia in the Royal family of 18th Century Victoria.  The amount of work has been voluminous, and the conceptual framework has been difficult to put into practice over generations of postgraduate physicians.  No wonder, considering the clotting proteins and the amazing platelet.

Part I of Platelets in Translaional Research is a comprehensive coberage of the signaling and control involved in platelet-endothelial reactions, platelet-platelet reactions, and platelet transciptomics, all of which have a significant bearing on atherosclerotic plaque buildup, plaque rupture, and acute coronary syndrome as well as chronic ischemic heart disease.

Part II will cover a range of studies pointing to anti-platelet therapeutic targets.

Related work in Pharmaceutical Intelligence

Advanced Topics in Sepsis and the Cardiovascular System at its End Stage

Larry H Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-sepsis-and-the-cardiovascular-system-at-its-end-stage/

‎ Special Considerations in Blood Lipoproteins, Viscosity, Assessment and Treatment

Larry H. Bernstein, MD, FCAP and Curator: Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2012/11/28/special-considerations-in-blood-lipoproteins_ viscosity_assessment-and-treatment/

What is the role of plasma viscosity in hemostasis and vascular disease risk?

Larry H Bernstein, MD  and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2012/11/28/What-is-the-role-of-plasma-viscosity-in-hemostasis-and-vascular-disease-risk?

Biochemistry of the Coagulation Cascade and Platelet Aggregation – Part I

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/11/26/Biochemistry-of-the-Coagulation-Cascade-and-Platelet-Aggregation-Part_I

Nitric Oxide Function in Coagulation

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/11/26/nitric-oxide-function-in-coagulation/

Coagulation: Transition from a familiar model tied to laboratory testing, and the new cellular-driven model

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/11/10/coagulation-transition-from-a familiar-model-tied-to-laboratory-testing-and-the-new-cellular-driven-model/

Nitric Oxide, Platelets, Endothelium and Hemostasis

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/11/08/nitric-oxide-platelets-endothelium-and-hemostasis/

Interaction of Nitric Oxide and Prostacyclin in Vascular Endothelium

Larry H. Bernstein, MD

http://pharmaceuticalintelligence.com/2012/09/14/interaction-of-nitric-oxide-and-prostacyclin-in-vascular-endothelium

The Effects of Aprotinin on Endothelial Cell Coagulant Biology

Demet Sag, PhD*†, Kamran Baig, MBBS, MRCS; James Jaggers, MD, Jeffrey H. Lawson, MD, PhD

http://pharmaceuticalintelligence.com/2013/07/20/the-effects-of-aprotinin-on-endothelial-cell-coagulant-biology/

Platelet Role in Atheroscleosis

Platelets and Cardiovascular Disease

David Gregg, MD; Pascal J. Goldschmidt-Clermont, MD
Duke University Medical Center, Durham, NC.

Platelets are specialized disk-shaped cells in the blood stream that are involved in the formation of blood clots that play an important role in heart attacks, strokes, and peripheral vascular disease. In most people, the more than 200 million platelets in a milliliter of blood act as tiny building blocks to form the basis of a clot to stop bleeding from cuts or injuries. Platelets can detect a disruption in the lining of a blood vessel and react to build a wall to stop bleeding.

F1.large  platelr forms plug

Figure 1. Platelets form a platelet plug to stop bleeding from an injured blood vessel.

In cardiovascular disease, abnormal clotting occurs that can result in heart attacks or stroke. Blood vessels injured by smoking, cholesterol, or high blood pressure develop cholesterol-rich build-ups (plaques) that line the blood vessel; these plaques can rupture and cause the platelets to form a clot. Even though no bleeding is occurring, platelets sense the plaque rupture and are confused, thinking that an injury has taken place that will cause bleeding. Instead of sealing the vessel to prevent bleeding as would occur with a cut, a clot forms in an intact blood vessel, causing a blockage of blood flow (Figure 2). Without blood, a portion of the heart muscle can die, leading to a heart attack.

F2.large   clot formation blocks flow

Figure 2. Plaque rupture results in clot formation to block blood flow, which may result in a heart attack or stroke

Platelet Disorders

Platelets may be abnormal either quantitatively (too many or too few) or qualitatively (the right number but they do not work correctly). The number of platelets is routinely tested as part of the complete blood count (CBC). Normal counts range from 150 000 to 450 000. A decrease in the number of platelets indicates a condition known as thrombocytopenia and may result in increased bleeding, the first signs of which may include gum bleeding, nose bleeds, and increased bruising. In cardiology, the most frequent cause of a low platelet count is an abnormal immune response caused by drug therapy, particularly with the intravenous blood thinner heparin (heparin-induced thrombocytopenia), and rarely with other drugs to control high blood pressure or symptoms of congestive heart failure (diuretics), to control diabetes (antidiabetic medications), or to regulate your blood clotting (antiplatelet drugs). Elevated platelet counts can also occur, usually in association with diseases in the elderly, and can result in either excess clotting or even abnormal bleeding.

Because platelets are so important in stopping bleeding from everyday injuries such as cuts or bruises, severe inherited disorders of platelets are quite rare. Researchers, however, have discovered more subtle genetic variations in platelets called polymorphisms that may alter platelets in subtle ways to raise the risk of cardiovascular disease when combined with other risk factors, but which on their own do not result in overt disease. These polymorphisms may also be important in understanding who may gain the greatest benefit from anti-platelet drugs.

The most commonly used antiplatelet agent is aspirin, although you may also be prescribed other oral agents, such as ticlopidine, clopidogrel, or dipyridamole, or intravenous antiplatelet drugs such as abciximab or eptifibatide while you are in the hospital or undergoing angioplasty procedures. Each agent affects platelets in slightly different ways and may have unique side effects, but all either cause the platelets to stick together or induce them to clot less well. Your doctor will choose the drug that best suits your situation. Table 1 shows some of the unique features of commonly used oral antiplatelet drugs

TABLE 1. Commonly Used Oral Antiplatelet Drugs: Uses and Side Effects

Aspirin Clopidogrel Ticlopidine Dipyridamole + Aspirin
Uses Heart disease and stroke; inexpensive Heart disease and stroke, particularly after stenting Mostly in stroke; requires blood count monitoring Stroke; may not be suitable for patients with heart disease
Side effects Gastrointestinal (GI) intolerance; GI bleeding Diarrhea (much less common than with ticlopidine); rash and itching Diarrhea and GI upset (usually resolves in 2 weeks); may decrease blood counts, particularly white blood cells Headache; GI bleeding; GI intolerance

Antiplatelet drugs are different than blood thinners or anticoagulants such as warfarin (Coumadin, Bristol-Myers Squibb) or heparin. Anticoagulants block a second step in clotting known as coagulation but do not directly affect the platelets.

Eur J Cardiovasc Nurs. 2002 Dec;1(4):273-88.

Platelets and cardiovascular disease

Willoughby S, Holmes A, Loscalzo J.
Queen Elizabeth Hospital, Adelaide University, South Australia, Adelaide, Au

Platelets play an important, but often under-recognized role in cardiovascular disease. For example, the normal response of the platelet can be altered, either by increased pro-aggregatory stimuli or by diminished anti-aggregatory substances to produce conditions of increased platelet activation/aggregation and occur in active cardiovascular disease states both on a chronic (e.g. stable angina pectoris) and acute basis (e.g. acute myocardial infarction). In addition, platelet hyperaggregability is also associated with the risk factors for coronary artery disease (e.g. smoking, hypertension, and hypercholesterolaemia). Finally, the utility of an increasing range of anti-platelet therapies in the management of the above disease states further emphasizes the pivotal role platelets play in the pathogenesis of cardiovascular disease. This paper provides a comprehensive overview of the normal physiologic role of platelets in maintain homeostasis, the pathophysiologic processes that contribute to platelet dysfunction in cardiovascular disease and the associated role and benefits of anti-platelet therapies.   PMID: 14622657

Triggering of Plaque Disruption and Arterial Thrombosis in an Atherosclerotic Rabbit Model

GS Abela, PD Picon, SE Friedl, OC Gebara, A Miyamoto, et al.
Deaconess Hospital, Harvard Medical School, Boston, Mass; Federal Univ and Univ Passo Fundo (P.D.P.), Rio Grande de Sul, Brazil;  Heart Institute, Univ São Paulo (O.C.G.), São Paulo, Brazil; National Defense Medical College (A.K.), Saitama, Jp.

It is now recognized that plaque disruption and thrombosis, a process often triggered by activities of the patient, is generally the cause of the onset of acute coronary syndromes. Plaque disruption and subsequent arterial thrombosis are now recognized as critical to the onset of acute coronary ischemic syndromes. It is hypothesized that occurrence of thrombotic coronary occlusion has three components. First, a plaque that is vulnerable to disruption must be present. Second, acute physiological events are required to induce plaque disruption and thrombosis. Third, a relatively hypercoagulable state and heightened vasomotor tone increase the likelihood that arterial thrombosis will produce complete lumen occlusion.

In human patients, the opportunity to study factors responsible for acute onset of myocardial infarction is limited because coronary angiography performed before the event cannot prospectively identify plaques vulnerable to disruption. After the event, angiography cannot distinguish the features of the plaque responsible for the disruption from those resulting from the disruption. Moreover, plaque disruptions producing total vascular occlusion and death may be more severe than those occurring in asymptomatic individuals or in patients with unstable angina or nonfatal myocardial infarction. These difficulties, inherent in the study of plaque disruption and thrombosis in human patients, create a great need for an animal model of the process.  An atherosclerotic rabbit model of triggering of arterial thrombosis that was introduced by Constantinides and Chakravarti more than 30 years ago but not subsequently used. Aortic plaques were induced by a high-cholesterol diet, by mechanical balloon injury of the artery, or by a combination of the two. Triggering was attempted by injection of Russell’s viper venom (RVV), which is a proteolytic procoagulant, and histamine. A recent review of the animal models of thrombosis currently in use noted that “thus far, it has not been possible to duplicate in a model the most common clinical cause of thrombosis—an ulcerated atherosclerotic plaque.” The advantage of the Constantinides model over other animal models used to study thrombosis is that it uses a biological intervention to trigger localized atherosclerotic plaque disruption and formation of platelet-rich arterial thrombi.  Disadvantages of the Constantinides model are (1) the low yield of triggering (only about one third of the rabbits developed thrombosis) and (2) the long (8-month) preparatory period. In addition, there is a need to replicate the findings of Constantinides and Chakravarti13 from 30 years ago because of the biological variability of rabbit strains and RVV. It cannot be assumed that the rabbits and RVV currently available will produce the results obtained in the 1960s.

A total of 53 New Zealand White rabbits were exposed to one of four preparatory regimens: rabbits in group I (n=9) were fed a regular diet for 8 months; rabbits in group II (n=13) were fed a diet of 1% cholesterol for 2 months alternated with 2 months of a regular diet for a total of 8 months; rabbits in group III (n=5) underwent balloon-induced arterial wall injury, then were given a regular diet for 8 months; and rabbits in group IV (n=14) underwent balloon-induced arterial wall injury, then were given a diet of 1% cholesterol for 2 months followed by a regular diet for 2 months for a total of 4 months. After completion of the preparatory regimen, triggering of plaque disruption and thrombosis was attempted by injection of RVV (0.15 mg/kg IP) and histamine (0.02 mg/kg IV). In group I, normal control rabbits without atherosclerosis, only one small thrombus was noted in 1 of 9 rabbits. In group II, cholesterol-fed rabbits, thrombosis occurred in 3 of 13 rabbits. Thrombus occurred in all rabbits in group III (5 of 5) and in 10 of 14 rabbits in group IV. Although the frequency of thrombosis was not significantly different between groups I and II, possibly due to a small sample size, it was significantly different among all four groups (P<.001). Also, the frequency and amount of thrombus formation were significantly different among all four groups (P<.001; P<.0001) but not between groups I and II. Rabbits with atherosclerosis (those in groups II and IV) demonstrated plaque disruption and overlying platelet-rich thrombus formation similar to that observed in patients with acute coronary syndromes. The surface area covered by thrombus was 2 mm2 in group I, 15.3±19.2 mm2 in group II, 223±119 mm2 in group III, and 263±222 mm2 in group IV. Rabbits in groups III and IV had the greatest amount of thrombus, and this amount was significantly greater than in rabbits in groups I and II (P<.001 and P<.03, respectively).

The intima in group I rabbits appeared normal by gross inspection. In group II rabbits, white-yellow plaque was widely distributed over the arterial surface, with focal punctate ulceration occasionally noted under a dissecting microscope. In group III rabbits, the intima was smooth and widely covered with white plaque. Group IV rabbits had extensive sheets of elevated white-yellow plaque. By gross visualization, ulceration of the surface was present without superimposed thrombus in two rabbits in group IV.  In sections from groups II and IV, some areas of plaque directly adjacent to the thrombi had marked thinning of the connective tissue cap and areas of dehiscent foam cells. These observations were rare and were noted in <0.5% of the examined lesions. In most cases, the arterial thrombus was not located at a site of obvious plaque rupture. Foam cell infiltration was also noted adjacent to sites of thrombosis. Scanning electron microscopy demonstrated fissures of various lengths below areas from which overlying thrombi were removed. Endothelial cells could be seen lining the intimal surface of the aorta in the rabbits that had undergone balloon-induced arterial wall injury 8 months earlier. Surface blebs and focal endothelial breakdown with ulcer formation, without grossly visible thrombosis, were occasionally seen in samples from groups II and IV. The base of these ulcers was layered with platelets, fibrin, and red blood cells. Transmission electron microscopy of areas with thrombosis confirms that the thrombi were platelet rich.

In the two groups that received cholesterol feeding, the total cholesterol content in tissue samples pooled from the thoracic and abdominal aorta was significantly higher in group IV (16±7.2 mg/g) than in group II (2.8±1.6 mg/g) (P<.0001). Rabbits that were maintained on a regular diet (groups I and III) had equally low levels of tissue cholesterol (0.05±0.04 versus 0.06±0.02 mg/g, P=NS). The average fibrinogen level before triggering in the 27 rabbits in which fibrinogen was measured was 210±119 mg/dL; it rose to 403±168 mg/dL 48 hours after triggering (P<.001). Plasma fibrinolytic activity did not change after triggering (85.5±37.8 versus 94.8±33.5 arbitrary units). Platelet counts (measured in only 19 rabbits in groups II and IV) decreased from 350±84×103 to 215±116×103 per cubic millimeter after triggering (P<.001).

Conclusions

The results demonstrate that vulnerable plaques can be produced and that plaque disruption and platelet-rich arterial thrombus formation may be triggered pharmacologically in an animal model of arterial plaque. This finding documents that the New Zealand White rabbit strains and the RVV currently available can be used to obtain the same results observed by Constantinides and Chakravarti13 more than 30 years ago. This animal model is suitable for the study of plaque disruption and arterial thrombosis. Hypercholesterolemia and mechanical arterial wall injury seemed to produce plaques vulnerable to triggering of disruption and thrombosis, whereas normal arteries were relatively resistant to triggering. The model provides a method to evaluate agents that might decrease the occurrence of vulnerable plaques or the amount of thrombus formed after triggering. Most important, the model can be used to identify the features of vulnerable plaques and the pharmacological stressors that trigger plaque disruption and thrombus formation.

Certain features of the lesions seen in this model are similar to those of human lesions seen at autopsy of patients with fatal myocardial infarction, ie, a lesion with a fissured collagen cap overlying a lipid mass of amorphous and crystalline lipid. However, most of the lesions in the model did not have these features and were more consistent with a recent pathological study of fatal coronary thrombosis, which revealed that in approximately half the cases, the plaque was relatively intact but an inflammatory infiltrate was present. Perhaps the incidence of plaque rupture causing thrombus may be even lower in patients with nonfatal coronary thrombosis, as suggested from angioscopic studies of coronary arteries that have shown plaque ulceration of various severities.  Analyses of human plaques have demonstrated that disrupted plaques have significantly less collagen, glycosaminoglycans, and smooth muscle cells and more extracellular lipid and macrophages  than do nondisrupted plaques. This is consistent with findings in our study that rabbits in group II had more connective tissue and a lower rate of disruption and thrombosis than those in groups III and IV.

references

Herrick JB. Clinical features of sudden obstruction of the coronary arteries. JAMA. 1912;59:2015-2020.
Chapman I. Morphogenesis of occluding coronary artery thrombosis. Arch Pathol. 1965;80:256-261.
Friedman M, van den Bovenkamp GJ. The pathogenesis of a coronary thrombus. Am J Pathol. 1966;80:19-44.

This reader sees a validation in this study of the noted cardiologist, Alan Jaffe, at Mayo Clinic, in referring to Type I and Type II myocardial infarcts, which accounts for differences in troponin elevations in patients.

The Platelet in Cardiovascular Disease

1. microthrombi adhering to foam cells
2. Platelets secrete

–  Platelet-derived growth factor (PDGF) that promotes smooth muscle cell migration and collagen production

– Plasminogen activator inhibitor-1 (PAI-1) that suppresses fibrinolysis

Davies MJ, Woolf N, Rowles PM, et al. Morphology of the endothelium over atherosclerotic plaques in human coronary arteries. Br Heart J 1988;60:459-64.

– Microhemorrhages attract and activate neighboring platelets, support fibrin generation

Inoue M, Itoh H, Ueda M, et al. Vascular endothelial growth factor (VEGF) expression in human coronary atherosclerotic lesions: Possible pathophysiological significance in progression of atherosclerosis. Circulation 1998;98:2108-16.

Systems biology of platelet-vessel wall interactions

Scott L. Diamond*, Jeremy Purvis, Manash Chatterjee and Matthew H. Flamm
Institute for Medicine and Engineering, University of Pennsylvania, Philadelphia, PA
Front Phys 26 August 2013    http://dx.doi.org/10.3389/fphys.2013.00229

Blood systems biology seeks to quantify outside-in signaling as platelets respond to numerous external stimuli, typically under flow conditions. Platelets can activate via GPVI collagen receptor and numerous G-protein coupled receptors (GPCRs) responsive to ADP, thromboxane, thrombin, and prostacyclin. A bottom-up ODE approach allowed prediction of platelet calcium and phosphoinositides following P2Y1 activation with ADP, either for a population average or single cell stochastic behavior. The homeostasis assumption (i.e., a resting platelet stays resting until activated) was particularly useful in finding global steady states for these large metabolic networks. Alternatively, a top-down approach involving Pairwise Agonist Scanning (PAS) allowed large data sets of measured calcium mobilization to predict an individual’s platelet responses. The data was used to train neural network (NN) models of signaling to predict patient-specific responses to combinatorial stimulation. A kinetic description of platelet signaling then allows prediction of inside-out activation of platelets as they experience the complex biochemical milieu at the site of thrombosis. Multiscale lattice kinetic Monte Carlo (LKMC) utilizes these detailed descriptions of platelet signaling under flow conditions where released soluble species are solved by finite element method and the flow field around the growing thrombus is updated using computational fluid dynamics or lattice Boltzmann method. Since hemodynamic effects are included in a multiscale approach, thrombosis can then be predicted under arterial and venous thrombotic conditions for various anatomical geometries. Such systems biology approaches accommodate the effect of anti-platelet pharmacological intervention where COX1 pathways or ADP signaling are modulated in a patient-specific manner.

CLOTTING UNDER FLOW CONDITIONS

Collagen is sufficient to capture and activate platelets under venous wall shear rates (ãw  100–200s_1). In the arterial circulation (ãw 1000–2000 s_1), collagen adsorbed von Willebrand factor (vWF) facilitates platelet capture, allowing col­lagen induced GPVI signaling and subsequent á2â1 and á2bâ3 activation. Under flow conditions, red blood cells help enrich the platelet concentration by 3–8x in the plasma layer near the wall. At pathological high shear exposures (>5000 s_1) encountered in severe stenosis, mechanical heart valves, and continuous LVAD pumps, the plasma vWF may undergo structural changes, such as a transition from a globular to an extended state (Schneider et al., 2007), likely increasing the availability of A1 domains in the vWF polymer for multivalent contacting with platelet GPIb receptors.

GROWTH OF THE PLATELET AGGREGATE VIA AUTOCATALYTIC SIGNALING

Collagen triggers GPVI clustering, leading to rapid phosphorylation of the GPVI-associated Fc receptor by Src family tyrosine kinases. Such phosphotyrosine residues are recognized by Syk, and the binding and activation of Syk activates PLCã2. PLCã2 converts phosphatidylinositol (PI)-4,5-P2 (PIP2) to inositol 1,4,5-trisphosphate (1,4,5-IP3 or IP3) and diacyclglycerol (DAG). IP3 opens Ca2+ channels in the platelet dense tubular system (DTS). Depletion of DTS Ca2+ results in STIM1 activation and bind­ing to Orai1, leading to store operated calcium entry (SOCE). DAG/Ca2+ activates protein kinase C (PKC) in platelets, which in turn governs several serine/threonine phosphorylation events.

Beyond the first monolayer of platelets adherent to colla-gen/VWF, the addition of subsequent layers of platelets to the growing thrombus is strongly potentiated by locally released ADP and thromboxane (TXA2) as well as locally generated thrombin. ADP activates P2Y1 and P2Y12 while TXA2 activates the TP receptor and thrombin cleaves PAR1 and PAR4. Activation of a GPCR causes an exchange of GTP for GDP on the α subunit of the G protein and dissociation of the α and γ subunits. Both these units in turn interact with secondary effectors such as PLC and adenylate cyclase. Human platelets express at least 10 forms of Gα (including members of the Gq, Gi, G12, and Gs fami­lies) (Brass et al., 2006; Offermanns, 2006). Thrombin, ADP, and TXA2 activate PLC via Gq. PLC generates IP3 from membrane PIP2. Rising Ca2+ levels activate the Ras family member, Rap1B via Cal-DAG GEF. Rap1B activation is a precursor to αIIb 3 acti­vation and allows the platelets to form aggregates with other platelets through fibrinogen cross-bridging. Ca2+-dependent signaling drives myosin light chain kinase and activation of GTP binding proteins of the Rho family. Rho acti­vation in turn activates kinases like p160ROCK and 5 LIM-kinase that can phosphorylate myosin light chain kinase and cofilin to regulate actin-dependent cytoskeletal shape changes. Endothelial derived prostacyclin (PGI2) binds the IP recep­tor and causes Gs mediated increase in adenyl cyclase activity. Also, NO from the endothelium and platelets can activate guany-late cyclase resulting in elevated cGMP levels that subsequently inhibit the hydrolysis of cAMP by intracellular phosphodi-esterases. Taken together these mechanisms elevate intracellular cAMP levels, which strongly downregulate platelet signaling. Agonists coupled to Gi family members inhibit cAMP production in platelets, thus allowing activation to proceed unhindered. Additionally the âã subunits of these receptors can activate PLCâ and the ã isoform of PI3K. The effectors for PI3K include Rap1b and Akt.

Fig 1 reaction schemes for platelet signaling

FIGURE 1 | Detailed reaction schemes for platelet signaling modules. Four interconnected models were defined: (A) Ca2+ module: cytosolic and DTS compartments are separated by the DTS membrane, which contains the IP3R and SERCA. (B) Phosphoinositide (PI) module: Membrane-bound PIs are cleaved by PLC-â to form diffusible inositol phosphates and DAG, which are substrates for resynthesis of PIs. (C) PKC module: Ca2+i and DAG activate PKC, which migrates to the plasmamembrane where it phosphorylates PLC-â. (D) P2Y1 module: extracellular ADP binds to and activates P2Y1. Active P2Y1 accelerates guanine nucleotide exchange on bound Gq. The Gq·GTP binds and activates PLC-â, which increases the GTPase activity of Gq·GTP.

ADP is stored in platelet dense granules and is released upon activation. P2Y1 and P2Y12 are the primary receptors for this agonist. P2Y1 is Gq coupled and signaling through this receptor causes Ca2+ mobilization, shape change, and thromboxane generation. P2Y12 is the target of the commonly used anti-platelet drug Plavix, and is a Gi2 coupled receptor that inhibits cAMP production in platelets. Thrombin is a potent platelet agonist that causes fast mobi­lization of intracellular Ca2+, and activation of phospholipase A2 and subsequent thromboxane generation (Offermanns et al., 1997). Also, thrombin can trigger Rho dependent signaling pathways in platelets (Moers et al., 2003), that contribute to actin modeling and shape change. Thrombin signals through the protease-activated receptor (PAR) family of GPCRs. PAR1 and PAR4 are expressed on human platelets, while PAR3 and PAR4 are expressed on mouse platelets. Thrombin cleaves the N-terminus of these receptors, exposing a new N-terminus that serves as a tethered ligand for these receptors. Synthetic pep­tides are able to selectively activate these receptors and mimic the actions of thrombin (for example, SFLLRN for PAR1, and AYPGKF for PAR4). Kinetic studies have shown that the human platelet response to thrombin is biphasic and involves first signal­ing through PAR1 and subsequent signaling through PAR4 (Covic et al., 2000). In mouse platelets signaling occurs primarily via PAR4, and is facilitated by PAR3. In addition to the PAR recep­tors, GP1bá has high affinity for thrombin. Absence of GP1bá reduces responses to low doses of thrombin and diminishes PAR1 signaling, suggesting that this receptor facilitates signaling through the PARs (Dormann et al., 2000). Ca2+ mobilization also activates phospholipase A2 (PLA2), which in turn converts mem­brane phospholipids to arachidonic Acid. TXA2 is produced from membrane arachidonate by the aspirin sensitive cyclooxygenase (COX-1) enzyme. TXA2 causes Ca2+ mobilization, aggregation, secretion, phosphoinositide hydrolysis, and protein phosphoryla-tion. TXA2 can diffuse across the membrane and activate nearby platelets, but its activity is limited by the molecule’s short half life (∼30 s).

These modules use previously validated or data-consistent kinetic networks for SERCA, IP3-Receptor, PKC translocation, and GPCR signaling (Figures 1E–H). Assembling the four modules together results in a global ODE model that has 77 reactions, 132 fixed kinetic rate constants, and 70 species. Since the reaction network (Figure 1) and the kinetic parameters are fixed, the reaction topology of the model is also fixed. Such a model takes the general form: dc/dt = F(c) and c(t = 0) = co where c is a vector of all species concentrations and co is a specified initial condition vector at t = 0. To determine appropriate sets of co that are suitable for use in modeling platelets, a challenge exists that the copy number of each species in a resting platelet is not known. Imposing a homeostasis assumption results in powerful tool to define a set of acceptable co vectors. The homeostasis assumption states that a resting platelet remains resting until activated. This means that an acceptable ini­tial condition co also represents a steady state for the system and will satisfy the equation dc/dt = 0. Finding a global co involves assembling the steady state solutions of each module (Figure 2).

Fig 2 Assembly of full model from steady-state modules

FIGURE 2 | Homeostasis requirement: Assembly of full model from steady-state modules using principle component analysis (PCA). The full model is assembled by combining PCA-reduced, steady-state solution spaces from each module into a combined steady state solution space. This global space is searched for full-length, steady-state solution vectors that satisfy both the steady state requirements of each module and the desired time-dependent properties when the steady-state is perturbed. A simple linear constraint is imposed for every pair of modules that share a common molecule ci to ensure that steady state solutions are Keywords: platelet, thrombosis, hemodynamic, ADP, thromboxane consistent. To assemble the platelet signaling model, a set of 16 PC vectors representing all 72 unknown variables in the model were used as search directions in a global optimization routine. The global solution space was searched for models with accurate dynamic behavior using experimental time-series data for ADP-stimulated Ca2+ release. Species are grouped according to compartment. Color values correspond to molar concentrations (mol/L or mol/m2) or as indicated: ∗DTS species (mol L−1). †Extracellular species (mol L−1). ‡DTS volume (L). §PM leak conductance/area (S m−2).

The first phase of the method involves generating a com­pact representation of the steady-state solutions for each module. First, conservative bounds are chosen for c based on physiological and practical considerations. Also, because molecular concentra­tions can span several orders of magnitude, it is most efficient to delineate this range of values on a logarithmic scale rather than a linear scale. Once the sampling distribution for c has been defined, steady-state solutions (co = c55) for each module are cal­culated using fixed kinetic parameters for each reaction in the module. For non-oscillating systems, steady-state solutions may be obtained by simulating the system until equilibrium is reached (i.e., until dc/dt = 0). In the third step, a large collection of steady-state solutions for each module is subjected to principal component analysis (PCA) (Purvis et al., 2009). PCA is then used to transform these points to a new coordinate set that optimally covers the space of steady-state solutions using the fewest num­ber of dimensions. For example, if two molecule concentrations in the steady-state space are highly correlated due to participation in the same reaction, PCA will locate a single dimension to rep­resent each pair of points in the transformed space. Ultimately, these new dimensions will be combined across all modules to search for global solutions that lie in the steady-state space for the fully combined network. Since PCA is a linear method, a steady-state solution space that is highly nonlinear may require more principal component vectors to accurately estimate the solutions. The reduction procedure is shown for the human platelet model comprising 4 interlinked signaling modules (Figure 2). For this step, we generated more than 109 sets of initial guesses (co) for each module, computed the initial value problem for each co until a steady state was reached (dc/dt ≈ 0), and selected only those steady states (c55) that were consistent with known con­centrations (i.e., [Ca2+]o ∼100 nM).  Interestingly, only a small fraction of initial guesses produce steady-state solutions that are also consistent with known concentration values. For example, it was shown that only 50,000 of 109 initial guesses (0.005%) in the Ca2+ balance module (Figure 1A) met both requirements and were suitable for further analysis. This observation shows that the kinetic topology of these molecular networks places very strong constraints on the range of concentrations that can exist at steady state. In biological terms, this suggests that fixed kinetic proper­ties at the molecular level (e.g., IP3R and SERCA kinetics) can affect not only the dynamical features of a biochemical system but can also determine the abundance of chemical species and the compartmental structures that contain them. A fully assem­bled initial condition vector results (bottom, Figure 2) results in new hypotheses about allowable concentrations and ratios of con­centrations (i.e., IP3/SERCA ratio is very small). The allowed co = css is consistent with the known resting levels of Ca2+, IP3, P2Y1, DAG, PA, PI, PIP2, and PIP (bottom, Figure 2) as well as the stimulated response of platelets to increasing amounts of ADP (right, Figure 2). With a global simulation of P2Y1 signaling, it is possible to simulate the ADP dose-response of calcium mobiliza­tion and IP3 generation in platelets as well as the mobilization of intracellular calcium in a single platelet due to stochastic fluctuations (Figure 3).

Fig 3. P2Y1 signalink model

FIGURE 3 | Tests of P2Y1 signaling model. ADP dose response for the full platelet model from 100 nM to 10 ìM ADP for calcium mobilization (A) or IP3 generation (B). Stochastic simulation of a single platelet (C). A single, fura-2-loaded platelet was immobilized on a fibrinogen-coated coverslip and activated with 40 ìM ADP at t = 90 [Ca2+ trace from Heemskerk et al. (2001)]. After 90 s of simulated rest, the platelet model was activated by setting extracellular [ADP] to 40ìM. Simulated interval times were binned in 2s increments for direct comparison with experiment (inset).

Since many initial condition vectors can be found to allow a resting platelet to remain resting and then respond appropriately to stimulation, investigation of these multiple steady states and associated cell responses can allow an ad-hoc sensitivity analysis. Some species (flexible nodes) may vary widely in the allowed ini­tial condition vectors but have little effect on system response. In contrast, other species (rigid nodes) may be forced to take on val­ues in a very narrow range due to the kinetic constraints of the problem.

To examine the changes in steady-state properties caused by kinetic perturbations in the P2Y1 model, we altered the rates of important regulatory reactions and observed the system response to each perturbation. Each perturbation cause a brief adjustment phase lasting ∼200 s followed by a more gradual phase char­acterized by a new steady-state profile. After 1 h of simulated time, steady-state concentrations and reaction fluxes were quan­tified relative to their original steady-state levels (Figure 4). In a computational perturbation, the inhibition of phospholipase C-β (PLC-β) activity by PKC was reduced 10-fold. Since PKC has a negative-feedback role in suppressing the platelet-stimulating activity of PLC-β, this perturbation caused a 2-fold increase

in steady-state PIP2 hydrolysis, elevated IP3 concentration, and accelerated Ca2+ release. This was a compensatory effect caused by the negative feedback loop involving Ca2+-regulated activity of PKC, a resulting new hypothesis that can be probed experi­mentally. In another example, increasing the hydrolytic activity of PLC-â for the substrate PIP2 by 10-fold caused an expected stimulatory effect, raising intracellular calcium and steady-state levels of cytosolic inositol phosphates (IP3, IP2, and IP) between 2- and 3-fold. Interestingly, reaction fluxes for phosphoinositide hydrolysis were diminished, possibly due to substrate depletion. Taken together, these examples illustrate the system-wide effects of perturbations in the kinetic rate processes. The procedure could easily be extended to examine multiple simultaneous per­turbations in both reaction rates and steady-state concentrations. In future applications of this approach, genomic or proteomic information of multiple perturbations could be used to help predict platelet signaling phenotypes.

Fig 4 Shifts in steady-state profiles caused by kinetic perturbations

FIGURE 4 | Shifts in steady-state profiles caused by kinetic perturbations. The steady-state platelet model was perturbed by changing selected kinetic parameters (±10-fold) and simulating for 1 h. After approaching a new steady state, the model concentrations and fluxes were determined relative to their original steady-state values and colored according to fold-change. Green indicates no change (NC) relative to initial flux/concentration. Red indicates a relative increase and blue indicates a relative decrease. Note that the color scale in each panel is normalized separately to maximize distinctions in fold change. New steady states were achieved after (top) 10-fold decrease in PKC-mediated inhibition of PLC-β, and (bottom) 10-fold increase in PIP2 hydrolysis (10-fold increase in kcat of hydrolysis). ∗, active state.

Fig 5. predicting global calcium response

FIGURE 5 | Pairwise agonist scanning to predict global calcium response in human platelets. (A) Simplified schematic of signaling pathways examined in this study that converge on intracellular calcium release in human platelets. (B) Dynamic NN model used to train platelet response to combinatorial agonist activation. A sequence of input signals representing agonist concentrations is introduced to the network at each time point. Processing layers integrate input values with feedback signals to predict the next time point. (C) A total of 154 calcium traces were measured for single and pairwise activation using 6 different agonists (“Experiment”) and used for neural network training. The NN training accurately predicted (“NN Prediction”) the training data.

Fig 6. Multiscale modeling with 4 components

FIGURE 6 | Multiscale modeling. The multiscale model has four main components (A) fluid flow, transport of soluble species, motion and binding of platelets, and the activation state of each platelet. The fluid flow is perturbed by the growing clot and is determined using the lattice Boltzmann method. The released soluble agonists form a boundary layer in the flow, and this process is determined using the finite element method. Platelet motion and bonding are simulated with lattice kinetic Monte Carlo. Platelet activation state is estimated from the history of intracellular calcium concentration, which is determined by a neural network model. (B) Multiscale simulation of patient-specific platelet deposition under flow for a specific donor and PAS-trained neural network of calcium signaling. Platelet activation (black, unactivated; white, activated) and deposition at 500 s (inlet wall shear rate, 200 s−1) showing released ADP (top) and TXA2 (middle) and perturbation of the flow field (bottom). Flow: left to right (streamlines, black lines); surface collagen (250 ìm long): red bar.  

PLATELET INTERACTIONS WITH THE VESSEL WALL

The multiscale systems biology model accommodates platelet sig­naling, platelet adhesion to collagen and other activated platelets, release of soluble agonists, thrombus growth, and distortion of the prevailing flow field (Figure 6A). The lattice Boltzmann (LB) method is used to solve for the velocity field of the fluid. Platelets in the growing aggregate release ADP and TXA2 into the fluid, and a boundary layer is formed with the flow. The dynamics of this process are determined with a finite element method solution of the convection-diffusion-reaction equation for each of the soluble species, ADP and TXA2. Platelets move in the fluid by convection and RBC-augmented dispersion. They also bind to the collagen surface as well as previously bound platelets. The motion and binding of platelets is simulated using the convective lattice kinetic Monte Carlo (LKMC) algorithm validated for stochastic convective-diffusive particle transport (Flamm et al., 2009, 2011, 2012). The level of integrin activation and associated adhesiveness for each platelet is related to the cumulative intracellular calcium concentration. The intracellu­lar calcium concentration is determined using a NN trained on a specifc patient’s platelet PAS phenotyping experiment. Using this multiscale approach, Multiscale simulations predicted the density of platelets adherent to the surface, platelet activation states, as well as the spatiotemporal dynamics of ADP and TXA2 release, morphology of the growing aggregate, and the distribu­tion of shear along the solid-fluid boundary (Figure 6B). Platelets stick to the collagen surface and release ADP and TXA2 which forms a boundary layer extending up to 10 pm from the throm­bus. Boundary layer concentrations of up to 10 pM ADP and 0.1 pM TXA2 were found by simulation. TXA2 concentrations were found to be sub-physiological (<0.0067 pM or <0.1 xEC50) until a sufficient platelet mass accumulated at the surface after ∼250 s. Boundary layer ADP concentrations were within the effective dynamic range (0.1–10 pM) throughout the simulation. The strong temporal and spatial fluctuations in the concentration of ADP were predominately driven by the short release time (5 s), whereas the longer release time of TXA2 (100 s) smoothed fluc­tuations. The shear rate along the solid-fluid boundary became nonuniform during the simulation (5–10-fold increase above 200 s−1) due to surface roughness. At 500 s, the platelet deposit was characterized by platelet clusters 20–30 pm in length, fully consistent with microfluidic measurements of platelet cluster size on collagen at this shear rate.

Developing tools to define platelet variations between patients and the relationship of platelet phenotype to prothrombotic or bleeding traits will have significant impact in stratifying patients according to risk. This multiscale approach also makes feasible patient-specific prediction of platelet deposi­tion and drug response in more complex in vivo geometries such as stenosis, aneurysms, stented vessels, valves, bifurcations, or ves­sel rupture (for prediction of bleeding risks) or in geometries encountered in mechanical biomedical devices.

 Platelet–Leukocyte–Endothelial Cell Interactions After Middle Cerebral Artery Occlusion

Mami Ishikawa, *Dianne Cooper, *Thiruma V. Arumugam, †John H. Zhang, †Anil Nanda, and *D. Neil Granger
Departments of *Molecular and Cellular Physiology, and †Neurosurgery, Louisiana State University Health Sciences Center, Shreveport, LA
Journal of Cerebral Blood Flow & Metabolism 24:907–915 © 2004 

Summary: The adhesion of both leukocytes and platelets to microvascular endothelial cells has been implicated in the pathogenesis of ischemia/reperfusion (I/R) injury in several vascular beds. The objectives of this study were to (1) assess the platelet–leukocyte–endothelial cell interactions induced in the cerebral microvasculature by middle cerebral artery occlu­sion (MCAO)/reperfusion, and (2) define the molecular deter­minants of the prothrombogenic and inflammatory responses in this model of focal I/R. MCAO was induced for 1 hour in wild-type (WT) mice, WT mice treated with a monoclonal antibody (mAb) to either P-selectin or GPIIb/IIIa, and in P-selectin−/−(P-sel−/−) chimeras. Isolated platelets labeled with carboxyfluorescein diacetate succinimidyl ester (CFDASE) were administered intravenously and observed with intravital fluorescence microscopy. Leukocytes were observed after in­travenous injection of rhodamine 6G. One hour of MCAO fol­lowed by 1 hour of reperfusion resulted in the rolling and adhesion of leukocytes in venules, and after 4 hours of reperfusion, the adhesion of both leukocytes and platelets was de­tected. Although both the P-selectin and GPIIb/IIIa mAbs sig­nificantly reduced the adhesion of leukocytes and platelets at 4 hours of reperfusion, the antiadhesive effects of the P-selectin mAb were much greater. The leukocyte and platelet adhesion responses were significantly attenuated in both P-sel−/−-WT and WT-P-sel−/− bone marrow chimeras, compared with WT-WT chimeras. Neutropenia, induced by antineutrophil serum treatment, also reduced the recruitment of leukocytes and platelets after cerebral I/R. These findings implicate a ma­jor role for both platelet-associated and endothelial cell– associated P-selectin, as well as neutrophils in the inflamma­tory and prothrombogenic responses in the microcirculation after focal cerebral I/R.
Key Words: Platelet—Leukocyte—P-selectin—GPIIb/IIIa—Cerebral ischemia—Reperfusion.

Adhesion of leukocytes and platelets after treatment with mAb against P-selectin or GPIIIb/IIIa

The I/R-induced recruitment of rolling and adherent leuko­cytes was significantly attenuated in P-selectin mAb-treated mice, compared with the responses noted in untreated mice exposed to 1-hour MCAO and 4-hour reperfusion (Figs. 3A and 3B). However, the number of adherent leukocytes after P-selectin mAb treatment remained elevated above the level de­tected in sham experiments. Both the rolling and firm adhesion of platelets was reduced to sham levels in the P-selectin mAb-treated mice. Although treatment with a GPIIb/IIIa mAb sig­nificantly reduced the adhesion of both platelets and leukocytes after I/R, the reductions noted were relatively small compared with the responses seen with the P-selectin mAb.

Leukocyte and platelet adhesion in P-selectin–deficient bone marrow chimeras

Our findings related to the role of platelet-associated and endothelial cell–associated P-selectin in mediating the I/R-induced rolling and adhesion of leukocytes and platelets are summarized in Fig. 4.  In P-sel / -WT chimeras, the number of rolling and adherent leukocytes were significantly but not completely reduced compared with WT—WT chimeras. However, compared with WT—WT chimeras, the rolling and firm adhesion of platelets was virtually abolished after I/R. In WT—P-sel−/− chimeras, the number of rolling and adherent leu­kocytes and platelets also decreased significantly com­pare with WT—WT chimeras; however, some adhesion of leukocytes and platelets was still detected after I/R, similar to the responses noted in the group treated with the P-selectin blocking mAb.

Platelet–leukocyte interaction

Platelets were noted to adhere directly onto adherent leukocytes and platelet-bearing leukocytes were occa­sionally observed rolling in postischemic venules. Some free-flowing platelets were seen to suddenly bind (with-out rolling) on adherent leukocytes. Some of these plate­lets detached from the adherent leukocyte whereas others adhered firmly on the leukocyte. Other platelets were seen to roll and adhere directly on venular endothelium. To quantify the contribution of leukocytes to I/R-induced platelet recruitment, some mice were rendered neutropenic with antineutrophil serum. Although leuko­cyte rolling and adherence were still observed in cerebral venules of serum-treated mice after I/R, the responses were dramatically reduced. The cerebral venules of neutropenic mice also exhibited large and significant reduc­tions in rolling and adherent platelets after I/R (Fig. 5).

Fig  platelet and endothelial cell–associated P-selectin in mediating rolling and adhesion of leukocytes

FIG. 4. Role of platelet-associated and endothelial cell–associated P-selectin in mediating I/R-induced rolling and adhesion of leuko­cytes (A) and platelets (B). Four or five animals were studied in each group. Mice in all groups were exposed to 1 hour of MCAO followed by 4 hours of reperfusion. WT—*WT and WT—*P-sel−/− chi­meras received CFDASE-labeled platelets from WT mice. P-sel−/−—*WT chimeras received CFDASE-labeled platelets from P-sel−/− mice. *P < 0.05 relative to the WT*WT (control) chimeras.

Signal-Dependent Protein Synthesis by Activated Platelets: New Pathways to Altered Phenotype and Function

Guy A. Zimmerman and Andrew S. Weyrich
Arterioscler Thromb Vasc Biol. 2008;28:s17-s24       http://dx.do.org/10.1161/ATVBAHA.107.160218      http://atvb.ahajournals.org/content/28/3/s17         Online ISSN: 1524-4636

New biologic activities of platelets continue to be discovered, indicating that concepts of platelet function in hemostasis, thrombosis, and inflammation require reconsideration as new paradigms evolve. Studies done over 3 decades ago demonstrated that mature circulating platelets have protein synthetic capacity, but it was thought to be low level and inconsequential. In contrast, recent discoveries demonstrate that platelets synthesize protein products with important biologic activities in a rapid and sustained fashion in response to cellular activation. This process, termed signal-dependent translation, uses a constitutive transcriptome and specialized pathways, and can alter platelet phenotype and functions in a fashion that can have clinical relevance. Signal-dependent translation and consequent protein synthesis are examples of a diverse group of posttranscriptural mechanisms in activated platelets that are now being revealed. (Arterioscler Thromb Vasc Biol. 2008;28:s17-s24)
Key Words: platelets . translation . protein synthesis . transcriptome . proteome . thrombosis

This article is part of a multi-part CME-certified activity titled Translational Therapeutics at the Platelet Vascular Interface. 

New Paradigms at the Vascular Interface

The acute hemostatic functions of platelets are well known, have dominated the attention of the field for decades, and have been the founda­tion for discoveries that generated new molecular therapies. Rapid, immediate activation responses mediate platelet-dependent thrombosis in a variety of pathologic conditions, and pharmacological antiplatelet strategies are largely aimed at these events. Nevertheless, the focus on adhesion, aggre­gation, and secretion, and the view that platelets have a repertoire of activities primarily restricted to these acute processes, have also generated a central dogma that may inappropriately limit our view of their actions at the vascular interface and in other settings in health and disease. Clearly, our understanding of the molecular mechanisms by which platelets influence hemostasis, thrombosis, regulated and dysregulated inflammation, and neoplasia remains incom­plete and continues to evolve. New paradigms are emerging as previously unrecognized pathways in platelets are identi­fied, and unanticipated activities are characterized. In this regard, the current state of the field of platelet biology may be akin to that of endothelial cells several decades ago, when endothelium was thought by most investigators and physi­cians to have a limited range of responses; on the contrary, however, when this dogma was reexamined using new approaches that included primary culture of human endothe-lium, active participation of these cells in interactions with leukocytes and a variety of other previously unrecognized functions were discovered. If the comparison is accurate, new paradigms relevant to activities of platelets at the vascular interface are likely to be reported with some frequency.

Alternative and traditional views of selected features of platelet biology are listed in the Table. There is already considerable evidence for some of the alternative themes, such as inflammatory and immune activities of platelets,10–16 whereas others are less well explored and more speculative. The remainder of this review summarizes evidence for one such functional capability not generally recognized in plate­lets until recent discoveries revealed it: synthesis of new protein products in response to cellular activation (reviewed in references5,17).

Table. New Biology of Platelets: Traditional Paradigms May Be Insufficient to Understand Platelet Activities at the Vascular Interface

Traditional View                                                                                                                                              Alternate View

Platelets are biologically simple because they are anucleate                   Platelets have specializations and biologic activities that are novel and complex. Some

and have a limited repertoire of responses.                                                                                     activities are yet to be discovered.

Platelets do not express new gene products.                                             Platelets have diverse posttranscriptional mechanisms and use a transcriptome and

specialized pathways to modify their proteome, phenotype, and functions.

Platelets are short-acting cells in clots and damaged tissue.                      Platelets can be relatively long-lived and can mediate cell-cell interactions for many

hours after initial adhesion, aggregation, and secretion.

Platelets operate exclusively in the intravascular                                               Platelets can influence critical events in the extravascular milieu in direct

compartment.                                                                                                                                            and indirect fashions.

Observations from a number of laboratories now demonstrate that physiologically relevant activation signals induce translation of proteins with impor­tant functions from constitutive or posttranscriptionally pro­cessed messenger RNAs (mRNAs) in human and murine platelets, a process that we have termed signal-dependent translation. These and other studies indicate that the platelet has intricate posttranscriptional mechanisms that allow it to alter its proteome, phenotype, and functions by accomplish­ing new protein synthesis in response to cellular activation. This capacity may allow platelets to modify the complex milieu of the vascular interface in ways that were previously unrecognized.

Essentially, all of the platelets isolated from normal subjects incorporated radiolabeled amino acids into new protein, demonstrating that this function is not a property of a subset of immature cells. Platelets from splenectomized subjects with idiopathic throm-bocytopenic purpura had increased levels of amino acid incorporation into protein, indicating that the physiological state of the subject or the age and maturity of the platelets influence protein synthesis. Extracellular factors were re­ported to alter protein synthesis by human platelets under some conditions. This provided evidence suggesting that the synthetic mechanisms involved are regulated.

The Platelet Transcriptome

Circulating human platelets have a substantial and diverse transcriptome, in addition to protein synthetic machinery. RNA-selective fluorescent dyes stain the entire population of platelets isolated from normal subjects, indicating the presence of RNA species transcribed by parent megakaryocytes. Messenger RNAs with 5′-methylguanosyl (m7G) caps and 3′ untranslated region polyadenylated tails are present, as are 18S and 28S ribosomal proteins, which are integral to the structure of ribo-somes. Early experiments with intact platelets from nor­mal subjects indicated that some of the mRNA transcripts are competent to serve as templates for proteins and have relatively long functional half lives that correlate with the lifespan of platelets in the circulation. This observation then lay fallow, for the most part, until the advent of reverse transcriptase polymer-ase chain reaction (RT-PCR) analysis and cDNA cloning meth-odologies. This infusion of new technology resulted in construction of cDNA libraries from platelet transcripts. Most recently, transcript profiling by microarray analysis and serial analysis of gene expression (SAGE) have been applied to platelets, identifying 1500 to 3000 unique transcripts in platelets from normal subjects, depending on the approach. Both cytoplasmic and mitochondrial transcripts are represented.35 There is substantial consistency between data generated by microarray analysis and SAGE, and in platelets isolated from different normal donors.

Multiple Proteins Are Synthesized by Activated Human Platelets

Although early studies indicated that platelets have protein synthetic capacity, the general concept in the field has been that it is low level, vestigial, and likely inconsequential. Several texts of hemostasis and platelet biology do not mention this function, and some commentaries conclude that platelets are simply incapable of any new protein synthesis. Consistent with the notion that platelets have low basal protein synthesis, little incorporation of the radiolabeled amino acid is detectable when freshly isolated human plate­lets are incubated with [35S] methionine under resting condi­tions in the absence of activation. However, when an activat­ing signal is delivered to platelets incubated in parallel, multiple labeled proteins are synthesized when lysates and soluble fractions are analyzed by 1-dimensional or 2-dimensional gel electrophoresis (Lindemann S, Weyrich AS, Zimmerman GA, 2001). Some of these newly synthe­sized proteins have been identified and mechanisms of their signal-dependent translation determined.

Recent findings provided clear evidence for signal-dependent (that is, induced by activating signals) translation of Bcl-3 from mRNA that is transcribed in parent megakaryocytes but is repressed, or “silenced,” in circulating platelets under resting, basal conditions. Immunocytochemical de­tection of Bcl-3 in platelets in inflamed and thrombosed human vessels in surgical specimens (Figure 1D) provided in situ evidence that the experimental observations have physi­ological and clinical relevance. We subsequently found that collagen, platelet-activating factor, ADP, and epinephrine are also agonists for signal-dependent translation in plate-lets. Collagen was recently reported to induce Bcl-3 synthesis by platelets in experiments by other investigators. The time course of Bcl-3 synthesis in response to thrombin yielded additional important insights: newly synthesized Bcl-3 could be detected in activated platelets within 15 to 30 minutes in some experiments, consistent with translation of constitutively present mRNA without a requirement for new transcription. This feature is also consistent with the biology of platelets as rapid response cells. Nevertheless, synthesis of Bcl-3 is also prolonged over many hours, indicating that platelets may have important functions in thrombi and injured vessels well beyond the first few minutes of acute activation.

We examined the effect of rapamycin and found that it completely and selectively inhibited Bcl-3 synthesis in thrombin-stimulated platelets, and also inhibited phosphorylation of 4E-BP1 assayed as a marker of mTOR activation in parallel. Pharmacological inhibition of phosphatidylinositol-3-kinase, which lies upstream from

mTOR in signaling cascades linking surface receptors to mTOR activation,49 also blocked both 4E-BP1 phosphoryla-tion and Bcl-3 synthesis.52 Together, these studies demon­strated that synthesis of Bcl-3 is controlled by mTOR and provided evidence for a new and previously unrecognized activity of mTOR as a regulator of expression of specific protein products and phenotypic changes in terminally differ­entiated cells in response to signals delivered via G protein– coupled receptors and integrins.52 This observation in platelets contributed to a parallel set of discoveries demonstrating that mTOR has similar roles in myeloid leukocytes.69–71 The find­ings also suggest that inhibition of mTOR by rapamycin may have novel therapeutic effects on gene expression by platelets and leukocytes independent of inhibition of proliferation of other cell types when this agent is applied in antiangiogenic strategies and in “drug-eluting” vascular stents in the clinic.72

Although Bcl-3 provided an index example of specialized, signal-dependent translation of a protein product in activated platelets the functional relevance of this event was not immediately obvious and was initially perplexing because the activity assigned to Bcl-3 at that time was as a transcriptional regulator. A clue lay in the domain structure of Bcl-3, which includes ankyrin repeats and proline-rich N and C termini, suggesting the possibility of multiple protein-protein interactions. Based on this information, we designed experi­ments to determine whether newly synthesized Bcl-3 interacts with other intracellular proteins. We found that Bcl-3 specifi­cally binds to the tyrosine kinase Fyn via the Fyn SH2 domain in activated platelets and transfected COS cells. Bcl-3 also associates with the actin cytoskeleton in platelets.53

Because Fyn and related intracellular tyrosine kinases influence contractile responses of activated platelets, we examined the contributions of Bcl-3 and mTOR to fibrin clot retraction. Clot retraction is proposed to stabilize thrombi and to modify thrombus remodeling and resolution. It can be modeled in vitro, where activated platelets retract and condense fibrin strands in a fashion that can be examined macroscopically and microscopically (Figure 1E). In paral­lel loss-of-function and gain-of-function strategies, inhibition of mTOR activity in human platelets using rapamycin under conditions that block Bcl-3 synthesis inhibited clot retraction,

Common and Specialized Elements in Platelet Translational Pathways and Transcripts

Biologic Advantages of Signal-Dependent Translation, and Potential Roles in Disease

Novel Pathways to Signal-Dependent Translation in Activated Human Platelets

Activated Platelets Synthesize Additional Proteins Under Signal-Dependent Control

Translation in Activated Human Platelets

Discovery of synthesis of Bcl-3 by activated platelets sparked a search for the identities of other protein products, yielding IL-1J3 and TF. It also led to the unexpected discovery that their synthesis is preceded by signal-dependent cytoplasmic splicing of IL-1J3 and TF pre-mRNAs, yielding mature transcripts that are translated into precursor (IL-1J3) and active (TF) proteins.24,43,44 This identified a novel mechanism not previously recognized in activated mammalian cells. The splicing capacities of activated platelets are intricate and will be reviewed separately. Signal-dependent splicing, to­gether with the mTOR-dependent translational control mech­anism and other regulatory pathways discussed here, indicate that platelets have unexpected diversity in posttranscriptional control. Previous and ongoing studies add to this conclusion and suggest that platelets may also use ribosomal “stalling” or polypeptide termination, participation of micro RNAs (Denis MM, Trask B, Schwertz H, Weyrich AS, Zimmerman GA, 2004) and, potentially, other modes of control.

References

  1. Lindemann S, McIntyre TM, Prescott SM, Zimmerman GA, Weyrich AS. Platelet signal-dependent protein synthesis. In: Quinn M, Fitzgerald D, eds. Platelet Function: Assessment, Diagnosis, and Treatment. Totowa, NJ: Humana Press Inc.;2005:149-74.
  2. Weyrich AS, Lindemann S, Tolley ND, Kraiss LW, Dixon DA, Mahoney TM, Prescott SP, McIntyre TM, Zimmerman GA. Change in protein phenotype without a nucleus: translational control in platelets. Semin Thromb Hemost. 2004;30:491–498.

Related articles in Pharmaceutical Intelligence

(no name assigned is Larry H Bernstein, MD)

Platelets in Translational Research – 1 http://pharmaceuticalintelligence.com/10-6-2013/larryhbern/Platelets_in_Translational_Research-1

Platelets in Translational Research – 2 http://phramaceuticalintelligence.com/2013-10-7/larryhbern/Platelets-in-Translational-Research-2/

αllbβ3 Antagonists As An Example of Translational Medicine Therapeutics   http://phrmaceuticalintelligence.com/2013-10-12/larryhbern_BS-Coller/αllbβ3_Antagonists_As_An_Example_of_Translational_Medicine_Therapeutics

Do Novel Anticoagulants Affect the PT/INR? The Cases of XARELTO (rivaroxaban) and PRADAXA (dabigatran)    Vivek Lal, MBBS, MD, FCIR, Justin D Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2013/09/23/do-novel-anticoagulants-affect-the-ptinr-the-cases-of-xarelto-rivaroxaban-and-pradaxa-dabigatran/

Intravenous drug for the treatment of Acute Heart Failure (AHF) by Trevena, Inc. (Trevena) – Leader in the Discovery of G-protein coupled receptor (GPCR) biased ligands   Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2013/10/10/intravenous-drug-for-the-treatment-of-acute-heart-failure-ahf-by-trevena-inc-trevena-leader-in-the-discovery-of-g-protein-coupled-receptor-gpcr-biased-ligands/

Nitric Oxide, Platelets, Endothelium and Hemostasis http://pharmaceuticalintelligence.com/2012/11/08/nitric-oxide-platelets-endothelium-and-hemostasis/

Nitric Oxide Function in Coagulation http://pharmaceuticalintelligence.com/2012/11/26/nitric-oxide-function-in-coagulation/

Advanced Topics in Sepsis and the Cardiovascular System at its End Stage http://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-Sepsis-and-the-Cardiovascular-System-at-its-End-Stage/

The Effects of Aprotinin on Endothelial Cell Coagulant Biology Demet Sag, PhD http://pharmaceuticalintelligence.com/2013/07/20/the-effects-of-aprotinin-on-coagulant-biology/

Biomaterials Technology: Models of Tissue Engineering for Reperfusion and Implantable Devices for Revascularization http://pharmaceuticalintelligence.com/5_04_2013/bernstein_lev-ari/Bioengineering_of_Vascular_and_Tissue_Models

Vascular Repair: Stents and Biologically Active Implants http://pharmaceuticalintelligence.com/05-03-2013/Bernstein.Lev-Ari/Stents,_biologically_active_implants_and_vascular_repair/

Prostacyclin and Nitric Oxide: Adventures in Vascular Biology – A Tale of Two Mediators Aviva Lev-Ari, PhD, RN  http://pharmaceuticalintelligence.com/2013/04/30/prostacyclin-and-nitric-oxide-adventures-in-vascular-biology-a-tale-of-two-mediators/

Drug Eluting Stents: On MIT’s Edelman Lab’s Contributions to Vascular Biology and its Pioneering Research on DES Larry Bernstein, MD and Aviva Lev-Ari, PhD, RN http://PharmaceuticalIntelligence.com/2013/04/25/Contributions-to-vascular-biology/

Accurate Identification and Treatment of Emergent Cardiac Events http://pharmaceuticalintelligence.com/2013/03/15/accurate-identification -and-tratment-of-emergent-cardiac-events/

The Heart: Vasculature Protection – A Concept-based Pharmacological Therapy including THYMOSIN Aviva Lev-Ari, PhD, RN http://pharmaceuticalintelligence.com/2013/02/28/the-heart-vascculature-a-concept-based-pharmaceutical-therapy-including-thymosin/

Arteriogenesis and Cardiac Repair: Two Biomaterials – Injectable Thymosin beta4 and Myocardial Matrix Hydrogel Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2013/02/27/arteriogenesis-and-cardiac-repair-two-biomaterials-injectable-thymosin-beta5-and-myocardial-matrix-hydrogel/

PCI Outcomes, Increased Ischemic Risk associated with Elevated Plasma Fibrinogen not Platelet Reactivity Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2013/01/10/pci-outcomes-increased-ischemic-risk-associated-with-elevated-plasma-fibrinogen-not-platelet-reactivity/

PLATO Trial on ACS: BRILINTA (ticagrelor) better than Plavix® (clopidogrel bisulfate): Lowering chances of having another heart attack Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2012/12/28/PLATO-trial-on-ACS:-Brilinta-(tigrelor)-better-than–Plavix-(clopidogrel-bisulfate)-lowering-chances-of-having-another-heart-attack/

Biochemistry of the Coagulation Cascade and Platelet Aggregation – Part I http://pharmaceuticalintelligence.com/2012/11/26/biochemistry-of-the-coagulation-cascade-and-platelet-aggregation/

Peroxisome proliferator-activated receptor (PPAR-gamma) Receptors Activation: PPARγ transrepression  for Angiogenesis in Cardiovascular Disease and PPARγ transactivation for Treatment of Diabetes Aviva Lev-Ari, PhD, RN  http://pharmaceuticalintelligence.com/2012/11/13/peroxisome-proliferator-activated-receptor-ppar-gamma-receptors-activation-pparγ-transrepression-for-angiogenesis-in-cardiovascular-disease-and-pparγ-transactivation-for-treatment-of-diabetes/

Coagulation: Transition from a familiar model tied to laboratory testing, and the new cellular-driven model http://pharmaceuticalintelligence.com/2012/11/10/coagulation-transition-from-a-familiar-model-tied-to-laboratory-testing-and-the-new-cellular-driven-model/

Nitric Oxide and Sepsis, Hemodynamic Collapse, and the Search for Therapeutic Options http://pharmaceuticalintelligence.com/2012/10/20/nitric-oxide-and-sepsis-hemodynamic-collapse-and-the-search-for-therapeutic-options/

Sepsis, Multi-organ Dysfunction Syndrome, and Septic Shock: A Conundrum of Signaling Pathways Cascading Out of Control
http://pharmaceuticalintelligence.com/2012/10/13/sepsis-multi-organ-dysfunction-syndrome-and-septic-shock-a-conundrum-of-signaling-pathways-cascading-out-of-control/

Endothelin Receptors in Cardiovascular Diseases: The Role of eNOS Stimulation Aviva Lev-Ari, PhD, RN http://pharmaceuticalintelligence.com/2012/10/04/endothelin-receptors-in-cardiovascular-diseases-the-role-of-enos-stimulation/

Nitric Oxide Covalent Modifications: A Putative Therapeutic Target? SJ Williams, PhD http://pharmaceuticalintelligence.com/2012/09/24/nitric-oxide-covalent-modifications-a-putative-therapeutic-target/

Interaction of Nitric Oxide and Prostacyclin in Vascular Endothelium http://pharmaceuticalintelligence.com/2012/09/14/interaction-of-nitric-oxide-and-prostacyclin-in-vascular-endothelium/

Cardiovascular Disease (CVD) and the Role of Agent Alternatives in endothelial Nitric Oxide Synthase (eNOS) Activation and Nitric Oxide Production Aviva Lev-Ari, PhD, RN
http://pharmaceuticalintelligence.com/2012/07/19/cardiovascular-disease-cvd-and-the-role-of-agent-alternatives-in-endothelial-nitric-oxide-synthase-enos-activation-and-nitric-oxide-production/

 

nihms-292073-f0002  platelet and vessel

Protein_Slide_2  proteome

nihms-292073-f0001  platelets support integrity and barrier function

Read Full Post »

Calcium-Channel Blocker, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Author, and Content Consultant to e-SERIES A: Cardiovascular Diseases: Justin Pearlman, MD, PhD, FACC

Author and Curator: Larry H Bernstein, MD, FCAP

and Article Curator: Aviva Lev-Ari, PhD, RN
Article IX Calcium-Channel Blocker, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor
Image created by Adina Hazan 06/30/2021

Introduction

Author: Larry H Bernstein, MD, FACC  

This Chapter is one of a series of articles on calcium activation, in this case, in the signaling of smooth muscle cells by the interacting neural innervation.    The process occurs by calcium triggering neurotransmitter release by initiating synaptic vesicle fusion.   The mechanism by which this occurs is addressed in detail, and involves the interaction of soluble N-acetylmaleimide-sensitive factor (SNARE) and SM proteins, and in addition, the discovery of a calcium-dependsent Syt1 (C) domain of protein- kinase C isoenzyme, which binds to phospholipids.
The 2013 Lasker Prize was awarded to Richard Schell (Genentech) and Thomas Sudolf (Stanford University) for their discoveries concerning the molecular machinery and regulatory mechanism that underlie the rapid release of neurotransmitters, a process that underlies all of the brain’s activities. They identified and isolated many of this reaction’s key elements, unraveled central aspects of its fundamental mechanism, and deciphered how cells govern it with extreme precision. These advances have provided a molecular framework for understanding some of the most devastating disorders that afflict humans as well as normal functions such as learning and memory, explaining unresolved hypotheses derived from the earlier work in the 1950sof the late Bernard Katz.  We also see that the work clarifies the debates initiated by the Nobelist Santiago Ramon y Cajal (1891) concerning the development of neural networks.  A biological relay system achieves these feats. Neurotransmission kicks off with an electrical pulse that runs down a nerve cell, or neuron. When that signal reaches the tip, calcium enters the cell. In response, the neuron liberates chemical messengers—neurotransmitters.
In the 1950s, the late Bernard Katz figured out that cells eject neurotransmitters in fixed amounts.  Balloon-like containers—vesicles—each hold set quantities of the chemicals. Calcium incites these lipid-bound sacs to fuse with the membrane that encases the cell, and their contents spill out. The picture that emerges from the later work is that synaptic vesicle exocytosis operates by a general mechanism of membrane fusion that revealed itself to be a model for all membrane fusion, but that is uniquely regulated by a calcium-sensor protein called synaptotagmin. The general membrane-fusion mechanism thus identified is mediated by SNARE- (for soluble NSF-receptors) and SM-proteins (for Sec1/Munc18-like proteins), largely discovered at the synapse, with synaptotagmin acting together with a molecular assistant called complexin as a clamp and activator of the membrane fusion mediated by the SNARE- and SM-proteins. Strikingly, the biochemical properties of synaptotagmin were found to precisely correspond to the extraordinary calcium-triggering properties of release, and to account for a regulatory pathway that also applies to other types of calcium-triggered fusion, for example fusion observed in hormone secretion and fertilization. At the synapse, finally, these interdependent machines — the fusion apparatus and its synaptotagmin-dependent control mechanism — are embedded in a proteinaceous active zone that links them to calcium channels, and regulates the docking and priming of synaptic vesicles for subsequent calcium-triggered fusion. Thus, work on neurotransmitter release revealed a hierarchy of molecular machines that mediate the fusion of synaptic vesicles, the calcium-control of this fusion, and the embedding of calcium-controlled fusion in the context of the presynaptic terminal at the synapse.
This portion of the discussion deals with the interaction of the neuronal endings interwoven into smooth muscle.   The calcium triggering of smooth muscle contractions is similar with respect to airways and arteries, urinary bladder, uterine contraction, and gastrointestinl tract.
The basic mechanism that underlie this MOTIF taken as variations of that described above are well described  by Michael J. Berridge in ‘Smooth muscle cell calcium activation mechanisms’. (J Physiol. 2008 Nov 1;586(Pt 21):5047-61.
http://dx.doi.org/10.1113/jphysiol.2008.160440.  Epub 2008 Sep 11.)
This is illustrated in his graphical examples.
Figure 1. The three main mechanisms responsible for generating the Ca2+ transients that trigger smooth muscle cell (SMC) contraction. From: Smooth muscle cell calcium activation mechanisms.
 Fig 1 Ca2+
A, receptor-operated channels (ROCs) or a membrane oscillator induces the membrane depolarization (ΔV) that triggers Ca2+ entry and contraction.
B, a cytosolic Ca2+ oscillator induces the Ca2+ signal that drives contraction.
C, a cytosolic Ca2+ oscillator in interstitial cells of Cajal (ICCs) or atypical SMCs induces the membrane depolarization that spreads through the gap junctions to activate neighbouring SMCs. Reproduced from Berridge (2008), with permission.
Michael J Berridge. J Physiol. 2008 November 1;586(Pt 21):5047-5061.  http://www.ncbi.nlm.nih.gov/pmc/articles/instance/2652144/bin/tjp0586-5047-f1.jpg

Figure 5. Vascular or airway SMCs are driven by a cytosolic oscillator that generates a periodic release of Ca2+ from the endoplasmic reticulum that usually appears as a propagating Ca2+ wave. From: Smooth muscle cell calcium activation mechanisms.

tjp0586-5047-f5   Vascular or airway SMCs are driven by a cytosolic oscillator that generates a periodic release of Ca2+ from the endoplasmic reticulum

The oscillator is induced/modulated by neurotransmitters such as acetylcholine (ACh), 5-hydroxytryptamine (5-HT), noradrenaline (NA) and endothelin-1 (ET-1), which act through inositol 1,4,5-trisphosphate (InsP3) that initiates the oscillatory mechanism. The sequence of steps 1–9 is described in the text. Reproduced from Berridge (2008), with permission.
Michael J Berridge. J Physiol. 2008 November 1;586(Pt 21):5047-5061.    http://www.ncbi.nlm.nih.gov/pmc/articles/instance/2652144/bin/tjp0586-5047-f5.jpg

Figure 7. The cytosolic Ca2+ oscillator responsible for pacemaker activity in interstitial cells of Cajal releases periodic pulses of Ca2+ that form a Ca2+ wave. From: Smooth muscle cell calcium activation mechanisms.

tjp0586-5047-f7 The cytosolic Ca2+ oscillator responsible for pacemaker activity in interstitial cells of Cajal releases periodic pulses of Ca2+ that form a Ca2+ wave.

The increase in Ca2+ activates Cl− channels (CLCA) to give the spontaneous transient inward currents (STICs) that sum to form the spontaneous transient depolarizations (STD) resulting in the slow waves of membrane depolarization (see inset). Current flow through gap junctions allows these waves to spread into neighbouring smooth muscle cells to activate contraction. See text for a description of the oscillator that drives this activation process. Reproduced from Berridge (2008), with permission.
Michael J Berridge. J Physiol. 2008 November 1;586(Pt 21):5047-5061.  http://www.ncbi.nlm.nih.gov/pmc/articles/instance/2652144/bin/tjp0586-5047-f7.gif

This article is the Part IX in a series of articles on Activation and Dysfunction of the Calcium Release Mechanisms in Cardiomyocytes and Vascular Smooth Muscle Cells.

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmiasand Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IX: Calcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

This article has FIVE Sections:

Section One

Innovations in Combination Drug Therapy: Calcium-Channel Blocker –  Amlodipine (Norvasc) in single-pill combinations (SPCs) of drugs

Section Two

Calcium-Channel Blockers: Drug Class and Indications

Section Three

Brand and Generic Calcium Channel Blocking Agents

Section Four

Dysfunction of the Calcium Release Mechanism

Section Five

The Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

 Section One

Innovations in Combination Drug Therapy:

Calcium-Channel Blocker, Amlodipine (Norvasc) in Single-Pill Combinations (SPCs) of Drugs

Latest development on Cardiovascular Pharmacotherapy relates to the development of a Duo Combination Therapy to include a leading  Calcium-Channel Blocker, Amlodipine (Norvasc), as one of the two drug classes in one pill:The research investigated the therapeutic efficacy achieved via a comparison of a two single-pill combinations (SPCs) of drugs:

  • telmisartan/amlodipine (T/A) [ARB/CCB]

and

  • telmisartan/hydrochlorothiazide (T/H) [ARB/Diuterics]
Drug classes:
ARB – telmisartan
CCB – amlodipine
Diuretics – hydrochlorothiazide

A review of the benefits of early treatment initiation with single-pill combinations of telmisartan with amlodipine or hydrochlorothiazide

Authors: Segura J, Ruilope LM

Published Date September 2013 Volume 2013:9 Pages 521 – 528

http://www.dovepress.com/articles.php?article_id=14373

Published: 16 September 2013, Dovepress Journal: Vascular Health and Risk Management

Julian Segura, Luis Miguel Ruilope

Department of Nephrology, Hospital 12 de Octubre, Madrid, Spain

Abstract:

This review discusses the rationale for earlier use of single-pill combinations (SPCs) of antihypertensive drugs, with a focus on telmisartan/amlodipine (T/A) and telmisartan/hydrochlorothiazide (T/H) SPCs.
  • Compared with the respective monotherapies, the once-daily T/A and T/H SPCs have been shown to result in significantly higher blood pressure (BP) reductions, BP goal rates, and response rates in patients at all stages of hypertension.
  • As expected, BP reductions are highest with the highest dose (T80/A10 and T80/H25) SPCs. Subgroup analyses of the telmisartan trials have reported the efficacy of both SPCs to be consistent, regardless of the patients’ age, race, and coexisting diabetes, obesity, or renal impairment.
  • In patients with mild-to-moderate hypertension, the T/A combination provides superior 24-hour BP-lowering efficacy compared with either treatment administered as monotherapy.
  • Similarly, the T/H SPC treatment provides superior 24-hour BP-lowering efficacy, especially in the last 6 hours relative to other renin–angiotensin system inhibitor-based SPCs.
  • The T/A SPC is associated with a lower incidence of edema than amlodipine monotherapy, and
  • The T/H SPC with a lower incidence of hypokalemia than hydrochlorothiazide monotherapy
  • Existing evidence supports the use of the T/A SPC for the treatment of hypertensive patients with prediabetes, diabetes, or metabolic syndrome, due to the metabolic neutrality of both component drugs, and the use of the T/H SPC for those patients with edema or in need of volume reduction.
Keywords: angiotensin receptor blockers, or ARBs, calcium-channel blocker, or CCBs, essential hypertension, diuretic, , renin-angiotensin system inhibitor, or ACEI
http://www.dovepress.com/articles.php?article_id=14373
We reported on 5/29/2012

Triple Combination Therapy: ARB and Calcium Channel Blocker and Diuretics

In July 2010, a triple combination drug for hypertension was approved by the US Food and Drug Administration. Tribenzor contains olmesartan medoxomil, amlodipine and hydrochlorothiazide, according to Monthly Prescribing Reference.

TRIBENZOR is a Daiichi Sankyo’s product- ARB and Calcium Channel Blocker and Diuretic

How TRIBENZOR work

Tribenzor contains olmesartan medoxomil, amlodipine and hydrochlorothiazide. High blood pressure makes the heart work harder to pump blood through the body and causes damage to blood vessels. TRIBENZOR can help your blood vessels relax and reduce the amount of fluid in your blood. This can make your blood pressure lower. Medicines that lower blood pressure may lower your chance of having a stroke or a heart attack.

Some people may need more than 1—or even more than 2—medicines to help control their blood pressure. TRIBENZOR combines 3 effective medicines in 1 convenient pill. Read the following chart to learn how each medicine works in its own way to help lower blood pressure.

TRIBENZOR: 3 effective medicines in 1 pill

The medicine in TRIBENZOR How it works What it does
Angiotensin II receptor blocker Blocks a natural chemical in your body that causes blood vessels to narrow.

Lowers

Yours

blood

pressure

Calcium channel blocker Blocks the narrowing effect of calcium on your blood vessels. This helps your blood vessels relax.
Diuretic (water pill) Helps your kidneys flush extra fluid and salt from your body. This lowers the amount of fluid in your blood.

http://www.tribenzor.com/how_works.html

            Effectively lower blood pressure. People taking the 3 medicines in TRIBENZOR had greater reductions in blood pressure than did people taking any 2 of the medicines combined

            Start to work quickly. People taking TRIBENZOR saw results in as little as 2 weeks

AZOR is a Daiichi Sankyo’s product- ARB and Calcium Channel Blocker

How AZOR work

AZOR relaxes and widens blood vessels to help lower blood pressure.

You may have already tried another blood pressure medicine that works a certain way to lower blood pressure. But 1 blood pressure medicine may not be enough for you. You may find the help you need with the 2 effective medicines in AZOR.

AZOR combines 2 effective medicines in 1 convenient pill.

Learn how each medicine in AZOR works in its own way to help lower blood pressure.

The medicine in AZOR How it works What it does
Angiotensin II receptor blocker (ARB) Blocks a natural chemical in your body that causes blood vessels to narrow. This helps your blood vessels relax and widen.

Lowers

Your

Blood

pressure

Calcium channel blocker Blocks the narrowing effect of calcium on your blood vessels. This helps your blood vessels relax.

http://www.AZOR.com/how_works.html

Section Two

Calcium-Channel Blockers: Drug Class and Indications

In Sudhof’s Lasker Award presentation he refers to the biochemical properties of synaptotagmin were found to precisely correspond to the extraordinary calcium-triggering properties of release, and to account for a regulatory pathway that also applies to other types of calcium-triggered fusion, for example fusion observed in hormone secretion.  A CCB would have to block the calcium-triggering properties of release, and consequently, would block the release of neurohormones.  This is because the fusion apparatus and its synaptotagmin-dependent control mechanism linked to the calcium channels, docking and priming synaptic vesicles, being blocked, disables the calcium-control of the vesicle fusion that is necessary for neurotransmitter release. Consequently, the end result would be increased vascular flow from the inhibition.

What are calcium channel blockers and how do they work?

In order to pump blood, the heart needs oxygen. The harder the heart works, the more oxygen it requires. Angina (heart pain) occurs when the supply of oxygen to the heart is inadequate for the amount of work the heart must do. By dilating the arteries, CCBs reduce the pressure in the arteries. This makes it easier for the heart to pump blood, and, as a result, the heart needs less oxygen. By reducing the heart’s need for oxygen, CCBs relieve or prevent angina. CCBs also are used for treating high blood pressure because of their blood pressure-lowering effects. CCBs also slow the rate at which the heart beats and are therefore used for treating certain types of abnormally rapid heart rhythms.

For what conditions are calcium channel blockers used?

CCBs are used for treating high blood pressure, angina, and abnormal heart rhythms (for example, atrial fibrillation, paroxysmal supraventricular tachycardia).

They also may be used after a heart attack, particularly among patients who cannot tolerate beta-blocking drugs, have atrial fibrillation, or require treatment for their angina.

Unlike beta blockers, CCBs have not been shown to reduce mortality or additional heart attacks after a heart attack.

CCBs are as effective as ACE inhibitors in reducing blood pressure, but they may not be as effective as ACE inhibitors in preventing the kidney failure caused by high blood pressure or diabetes.

They also are used for treating:

CCBs are also used in the prevention of migraine headaches.

Are there any differences among calcium channel blockers?

CCBs differ in their duration of action, the process by which they are eliminated from the body, and, most importantly, in their ability to affect heart rate and contraction. Some CCBs [for example, amlodipine (Norvasc)] have very little effect on heart rate and contraction so they are safer to use in individuals who have heart failure or bradycardia (a slow heart rate). Verapamil (Calan, Isoptin) and diltiazem (Cardizem) have the greatest effects on the heart and reduce the strength and rate of contraction. Therefore, they are used in reducing heart rate when the heart is beating too fast.

What are the side effects of calcium channel blockers?

  • The most common side effects of CCBs are constipation, nausea,headache, rash, edema (swelling of the legs with fluid), low blood pressure, drowsiness, and dizziness.
  • Liver dysfunction and over growth of gums may also occur. When diltiazem (Cardizem) or verapamil (Calan, Isoptin) are given to individuals with heart failure, symptoms of heart failure may worsen because these drugs reduce the ability of the heart to pump blood.
  • Like other blood pressure medications, CCBs are associated with sexual dysfunction.

http://www.medicinenet.com/calcium_channel_blockers/article.htm

Section Three

Brand and Generic Calcium Channel Blocking Agents

A drug may be classified by the chemical type of the active ingredient or by the way it is used to treat a particular condition. Each drug can be classified into one or more drug classes.

Calcium channel blockers block voltage gated calcium channels and inhibits the influx of calcium ions into cardiac and smooth muscle cells. The decrease in intracellular calcium reduces the strength of heart muscle contraction, reduces conduction of impulses in the heart, and causes vasodilatation.

Decrease in intracellular calcium in the heart decreases cardiac contractility. Decreased calcium in the vascular smooth muscle reduces its contraction and therefore causes vasodilatation.

Decrease in cardiac contractility decreases cardiac output and vasodilatation decreases total peripheral resistance, both of which cause a drop in blood pressure.

Calcium channel blocking agents are used to treat hypertension.

Filter by: — all conditions –AnginaAngina Pectoris ProphylaxisArrhythmiaAtrial FibrillationAtrial FlutterBipolar DisorderCluster HeadachesCoronary Artery DiseaseHeart FailureHigh Blood PressureHypertensive EmergencyHypertrophic CardiomyopathyIdiopathic Hypertrophic Subaortic StenosisIschemic StrokeMigraine PreventionNocturnal Leg CrampsPremature LaborRaynaud’s SyndromeSubarachnoid HemorrhageSupraventricular Tachycardia

Drug Name ( View by: Brand | Generic )
Afeditab CR (Pro, More…)generic name: nifedipine
Diltia XT (Pro, More…)generic name: diltiazem
Diltiazem Hydrochloride SR (More…)generic name: diltiazem
Nimotop (Pro, More…)generic name: nimodipine
Verelan PM (Pro, More…)generic name: verapamil
Cartia XT (Pro, More…)generic name: diltiazem
Adalat (More…)generic name: nifedipine
Calan SR (Pro, More…)generic name: verapamil
Cardizem (Pro, More…)generic name: diltiazem
Diltiazem Hydrochloride CD (More…)generic name: diltiazem
Isoptin SR (Pro, More…)generic name: verapamil
Nifediac CC (Pro, More…)generic name: nifedipine
Tiazac (Pro, More…)generic name: diltiazem
Procardia (Pro, More…)generic name: nifedipine
Adalat CC (Pro, More…)generic name: nifedipine
Cardizem LA (Pro, More…)generic name: diltiazem
Calan (Pro, More…)generic name: verapamil
Procardia XL (Pro, More…)generic name: nifedipine
Isoptin (More…)generic name: verapamil
Nifedical XL (Pro, More…)generic name: nifedipine
Plendil (Pro, More…)generic name: felodipine
Taztia XT (Pro, More…)generic name: diltiazem
Cardizem CD (Pro, More…)generic name: diltiazem
Norvasc (Pro, More…)generic name: amlodipine
Verelan (Pro, More…)generic name: verapamil
Cardene SR (Pro, More…)generic name: nicardipine
DynaCirc CR (Pro, More…)generic name: isradipine
Sular (Pro, More…)generic name: nisoldipine
Cardene (Pro, More…)generic name: nicardipine
Cardene IV (Pro, More…)generic name: nicardipine
Cleviprex (Pro, More…)generic name: clevidipine
Covera-HS (Pro, More…)generic name: verapamil
Dilacor XR (Pro, More…)generic name: diltiazem
Dilt-XR (Pro, More…)generic name: diltiazem
Diltiazem Hydrochloride XR (More…)generic name: diltiazem
Diltiazem Hydrochloride XT (More…)generic name: diltiazem
Diltzac (Pro, More…)generic name: diltiazem
Dynacirc (Pro, More…)generic name: isradipine
Matzim LA (Pro, More…)generic name: diltiazem
Nymalize (Pro, More…)generic name: nimodipine
Vascor (More…)generic name: bepridil

Section Four

Dysfunction of the Calcium Release Mechanism

For Disruption of Calcium Homeostasis in Vascular Smooth Muscle Cells, see

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

For Disruption of Calcium Homeostasis in Cardiomyocyte Cells, see

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Section Five

The Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

This topic is covered in

Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

Summary

Work on neurotransmitter release revealed a hierarchy of molecular machines that mediate the fusion of synaptic vesicles, the calcium-control of this fusion, and the embedding of calcium-controlled fusion in the context of the presynaptic terminal at the synapse. The neural transmission is described as a biological relay system. Neurotransmission kicks off with an electrical pulse that runs down a nerve cell, or neuron. When that signal reaches the tip, calcium enters the cell. In response, the neuron liberates chemical messengers—neurotransmitters.  When the calcium-controlled fusion at the presynaptic junction is blocked, as with a CCB, neurotransmitters are not released.  The activity of the neurotransmitters would be to cause smaooth muscle contraction of the vessel.  The CCB would cause relaxation and flow.

http://www.nature.com/focus/Lasker/2013/pdf/ES-Lasker13-Sudhof.pdf

Part IX of this series of articles discussed the mechanism of the signaling of smooth muscle cells by the interacting parasympathetic neural innervation that occurs by calcium triggering neurotransmitter release by initiating synaptic vesicle fusion. It involves the interaction of soluble N-acetylmaleimide-sensitive factor (SNARE) and SM proteins, and in addition, the discovery of a calcium-dependent Syt1 (C) domain of protein- kinase C isoenzyme, which binds to phospholipids. It is reasonable to consider that it differs from motor neuron activation of skeletal muscles, mainly because the innervation is in the involuntary domain. The cranial nerve rooted innervation has evolved comes from the spinal ganglia at the corresponding level of the spinal cord. It is in this specific neural function that we find a mechanistic interaction with adrenergic hormonal function, a concept intimated by the late Richard Bing. Only recently has there been a plausible concept that brings this into serious consideration. Moreover, the review of therapeutic drugs that are used in blocking adrenergic receptors are closely related to the calcium-channels. Interesting too is the participation of a phospholipid bound protein-kinase isoenzyme C calcium-dependent domain Syt1. The neurohormonal connection lies in the observation by Katz in the 1950’s that the vesicles of the neurons hold and eject fixed amounts of neurotransmitters.  The mechanism of this action will be futher discussed in Part X.

Read Full Post »

Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Author and Curator: Larry H Bernstein, MD, FCAP

Author and Cardiovascular Three-volume Series, Editor: Justin Pearlman, MD, PhD, FACC, and

Curator: Aviva Lev-Ari, PhD, RN

Article V Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Image created by Adina Hazan 06/30/2021

Abbreviations

AP, action potential; ARVD2, arrhythmogenic right ventricular cardiomyopathy type 2; CaMKII, Ca2+/calmodulim-dependent protein kinase II; CICR, Ca2+ induced Ca2+ release;CM, calmodulin; CPVT, catecholaminergic polymorphic ventricular tachycardia;  ECC, excitation–contraction coupling; FKBP12/12.6, FK506 binding protein; HF, heart failure; LCC, L-type Ca2+ channel;  P-1 or P-2, phosphatase inhibitor type-1 or type-2; PKA, protein kinase A; PLB, phosphoplamban; PP1, protein phosphatase 1; PP2A, protein phosphatase 2A; RyR1/2, ryanodine receptor type-1/type-2; SCD, sudden cardiac death; SERCA, sarcoplasmic reticulum Ca2+ ATPase; SL, sarcolemma; SR, sarcoplasmic reticulum.

This is Part V of a series on the cytoskeleton and structural shared thematics in cellular movement and cellular dynamics.

The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

 

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

In the first part, we discussed common MOTIFs across cell-types that are essential for cell division, embryogenesis, cancer metastasis, osteogenesis, musculoskeletal function, vascular compliance, and cardiac contractility.   This second article concentrates on specific functionalities for cardiac contractility based on Ca++ signaling in excitation-contraction coupling.  The modifications discussed apply specifically to cardiac muscle and not to skeletal muscle.  Considering the observations described might raise additional questions specifically address to the unique requirements of smooth muscle, abundant in the GI tract and responsible for motility in organ function, and in blood vessel compliance or rigidity. Due to the distinctly different aspects of the cardiac contractility and contraction force, and the interactions with potential pharmaceutical targets, there are two separate articles on calcium signaling and cardiac arrhythmias or heart failure (Part 2 and Part 3).  Part 2 focuses on the RYANODINE role in cardiac Ca(2+) signaling and its effect in heart failure.  Part 3 takes up other aspects of heart failure and calcium signaling with respect to phosporylation/dephosphorylation. I add a single review and classification of genetic cardiac disorders of the same cardiac Ca(2+) signaling and the initiation and force of contraction. Keep in mind that the heart is a syncytium, and this makes a huge difference compared with skeletal muscle dynamics. In Part 1 there was some discussion of the importance of Ca2+ signaling on innate immune system, and the immunology will be further expanded in a fourth of the series.

SUMMARY:

This second article on the cardiomyocyte and the Ca(2+) cycling between the sarcomere and the cytoplasm, takes a little distance from the discussion of the ryanodine that precedes it.  In this discussion we found that there is a critical phosphorylation/dephosphorylation balance that exists between Ca(+) ion displacement and it occurs at a specific amino acid residue on the CaMKIId, specific for myocardium, and there is a 4-fold increase in contraction and calcium release associated with this CAM kinase (ser 2809) dependent exchange.  These events are discussed in depth, and the research holds promise for therapeutic application. We also learn that Ca(2+) ion channels are critically involved in the generation of arrhythmia as well as dilated and hypertrophic cardiomyopathy.  In the case of arrhythmiagenesis, there are two possible manners by which this occurs.  One trigger is Ca(2+) efflux instability.  The other is based on the finding that when the cellular instability is voltage driven, the steady-state wave­length (separation of nodes in space) depends on electrotonic coupling between cells and the steepness of APD and CV restitution. The last article is an in depth review of the genetic mutations that occur in cardiac diseases.  It is an attempt at classifying them into reasonable groupings. What are the therapeutic implications of this? We see that the molecular mechanism of cardiac function has been substantially elucidated, although there are contradictions in experimental findings that are unexplained.  However, for the first time, it appears that personalized medicine is on a course that will improve health in the population, and the findings will allow specific targets designed for the individual with a treatable impairment in cardiac function that is identifiable early in the course of illness. This article is a continuation to the following articles on tightly related topics: Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton     Larry H Bernstein, MD, FCAP http://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/ Part II:  Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility    Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN  http://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/ Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease    Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and  Aviva Lev-Ari, PhD, RN http://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/ Part  IV:  The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN  http:/pharmaceuticalintelligence.com/2013.09.089/lhbern/The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Part V:  Heart Smooth Muscle and Cardiomyocyte Cells: Excitation-Contraction Coupling & Ryanodine Receptor (RyR) type-1/type-2 in Cytoskeleton Cellular Dynamics and Ca2+ Signaling

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN http://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/ Part VI:  Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD Curator: Aviva Lev-Ari, PhD, RN http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/ and Advanced Topics in Sepsis and the Cardiovascular System at its End Stage Larry H Bernstein, MD, FCAP  http://pharmaceuticalintelligence.com/2013/08/18/advanced-topics-in-sepsis-and-the-cardiovascular-system-at-its-end-stage/

The Role of Protein Kinases and Protein Phosphatases in the Regulation of Cardiac Sarcoplasmic Reticulum Function

EG Kranias, RC Gupta, G Jakab, HW Kim, NAE Steenaart, ST Rapundalo Molecular and Cellular Biochemistry 06/1988; 82(1):37-44. · 2.06 Impact Factor http://www.researchgate.net/publication/6420466_Protein_phosphatases_decrease_sarcoplasmic_reticulum_calcium_content_by_stimulating_calcium_release_in_cardiac_myocytes Canine cardiac sarcoplasmic reticulum is phosphorylated by

  • adenosine 3,5-monophosphate (cAMP)-dependent and
  • calcium calmodulin-dependent protein kinases on
  • a proteolipid, called phospholamban.

Both types of phosphorylation are associated with

  •  an increase in the initial rates of Ca(2+) transport by SR vesicles
  • which reflects an increased turnover of elementary steps of the calcium ATPase reaction sequence.

The stimulatory effects of the protein kinases on the calcium pump may be reversed by an endogenous protein phosphatase, which

  • can dephosphorylate both the CAMP-dependent and the calcium calmodulin-dependent sites on phospholamban.

Thus, the calcium pump in cardiac sarcoplasmic reticulum appears to be under reversible regulation mediated by protein kinases and protein phosphatases. calcium release calmodulin + ER Ca(2+) and contraction

Regulation of the Cardiac Ryanodine Receptor Channel by Luminal Ca2+ involves Luminal Ca2+ Sensing Sites

I Györke, S Györke.   Biophysical Journal 01/1999; 75(6):2801-10. · 3.65 Impact factor  http:// www.researchgate.net/publication/13459335/Regulation_of_the_cardiac_ryanodine_receptor_channel_by_luminal_Ca2_involves_luminal_Ca2_sensing_sites The mechanism of activation of the cardiac calcium release channel/ryanodine receptor (RyR) by luminal Ca(2+) was investigated in native canine cardiac RyRs incorporated into lipid bilayers in the presence of 0.01 microM to 2 mM Ca(2+) (free) and 3 mM ATP (total) on the cytosolic (cis) side and 20 microM to 20 mM Ca(2+) on the luminal (trans) side of the channel and with Cs+ as the charge carrier. Under conditions of low [trans Ca(2+)] (20 microM), increasing [cis Ca(2+)] from 0.1 to 10 microM caused a gradual increase in channel open probability (Po). Elevating [cis Ca(2+)] [cytosolic] above 100 microM resulted in a gradual decrease in Po. Elevating trans [Ca(2+)] [luminal] enhanced channel activity (EC50 approximately 2.5 mM at 1 microM cis Ca2+) primarily by increasing the frequency of channel openings. The dependency of Po on trans [Ca2+] [luminal] was similar at negative and positive holding potentials and was not influenced by high cytosolic concentrations of the fast Ca(2+) chelator, 1,2-bis(2-aminophenoxy)ethane-N,N,N, N-tetraacetic acid. Elevated luminal Ca(2+)

  1. enhanced the sensitivity of the channel to activating cytosolic Ca(2+), and it
  2. essentially reversed the inhibition of the channel by high cytosolic Ca(2+).

Potentiation of Po by increased luminal Ca(2+) occurred irrespective of whether the electrochemical gradient for Ca(2+) supported a cytosolic-to-luminal or a luminal-to-cytosolic flow of Ca(2+) through the channel. These results rule out the possibility that under our experimental conditions, luminal Ca(2+) acts by interacting with the cytosolic activation site of the channel and suggest that the effects of luminal Ca2+ are mediated by distinct Ca(2+)-sensitive site(s) at the luminal face of the channel or associated protein. F1.large  calcium movement and RyR2 receptor

Protein phosphatases Decrease Sarcoplasmic Reticulum Calcium Content by Stimulating Calcium Release in Cardiac Myocytes

D Terentyev, S Viatchenko-Karpinski, I Gyorke, R Terentyeva and S Gyorke Texas Tech University Health Sciences Center, Lubbock, TX J Physiol 2003; 552(1), pp. 109–118.  http://dx.doi.org/10.1113/jphysiol.2003.046367 Phosphorylation/dephosphorylation of Ca2+ transport proteins by cellular kinases and phosphatases plays an important role in regulation of cardiac excitation–contraction coupling; furthermore,

  • abnormal protein kinase and phosphatase activities have been implicated in heart failure.

However, the precise mechanisms of action of these enzymes on intracellular Ca2+ handling in normal and diseased hearts remains poorly understood. We have investigated

  •   the effects of protein phosphatases PP1 and PP2A on spontaneous Ca(2+) sparks and SR Ca(2+) load in myocytes permeabilized with saponin.

Exposure of myocytes to PP1 or PP2A caused a dramatic increase in frequency of Ca(2+) sparks followed by a nearly complete disappearance of events, which were accompanied by depletion of the SR Ca(2+) stores, as determined by application of caffeine. These changes in

  •  Ca(2+) release and
  • SR Ca(2+) load

could be prevented by the inhibitors of PP1 and PP2A phosphatase activities okadaic acid and calyculin A. At the single channel level, PP1 increased the open probability of RyRs incorporated into lipid bilayers. PP1-medited RyR dephosphorylation in our permeabilized myocytes preparations was confirmed biochemically by quantitative immunoblotting using a phosphospecific anti-RyR antibody. Our results suggest that

  •  increased intracellular phosphatase activity stimulates
  • RyR mediated SR Ca(2+) release
    • leading to depleted SR Ca(2+) stores in cardiac myocytes.

In heart muscle cells, the process of excitation–contraction (EC) coupling is mediated by

  •  Ca(2+) influx through sarcolemmal L-type Ca(2+) channels
  • activating Ca(2+) release channels (ryanodine receptors, RyRs) in the sarcoplasmic reticulum (SR).

Once activated, the RyR channels allow Ca(2+) to be released from the SR into the cytosol to induce contraction. This mechanism is known as Ca(2+)-induced calcium release (CICR) (Fabiato, 1985; Bers, 2002).  During relaxation, most of the Ca(2+) is resequestered into the SR by the Ca(2+)-ATPase. The amount of Ca(2+) released and the force of contraction depend on

  •  the magnitude of the Ca(2+) trigger signal,
  • the functional state of the RyRs and
  • the amount of Ca(2+) stored in the SR.

F1.large  calcium movement and RyR2 receptor Ca(2+) and contraction calcium release calmodulin + ER Reversible phosphorylation of proteins composing the EC coupling machinery plays an important role in regulation of cardiac contractility (Bers, 2002). Thus, during stimulation of the b-adrenergic pathway, phosphorylation of several target proteins, including

  • the L-type Ca(2+) channels,
  • RyRs and
  • phospholamban,

by protein kinase A (PKA) leads to an overall increase in SR Ca2+ release and contractile force in heart cells (Callewaert et al. 1988, Spurgeon et al. 1990; Hussain & Orchard, 1997; Zhou et al. 1999; Song et al. 2001; Viatchenko-Karpinski & Gyorke, 2001). PKA-dependent phosphorylation of the L-type Ca(2+) channels increases the Ca2+ current (ICa), increasing both

  • the Ca2+ trigger for SR Ca2+ release and
  • the SR Ca(2+) content

(Callewaert et al. 1988; Hussain & Orchard, 1997; Del Principe et al. 2001). Phosphorylation of phospholamban (PLB) relieves the tonic inhibition dephosphorylated PLB exerts on the SR Ca(2+)-ATPase (SERCA) resulting in enhanced SR Ca(2+) accumulation and enlarged Ca(2+) release (Kranias et al. 1985; Simmermann & Jones, 1998). With regard to the RyR, despite clear demonstration of phosphorylation of the channel in biochemical studies (Takasago et al. 1989; Yoshida et al. 1992), the consequences of this reaction to channel function have not been clearly defined. RyR phosphorylation by PKA and Ca(2+)–calmodulin dependent protein kinase (CaMKII) has been reported to increase RyR activity in lipid bilayers (Hain et al. 1995; Marx et al. 2000; Uehara et al. 2002). Moreover, it has been reported that in heart failure (HF), hyperphosphorylation of RyR causes

  •  the release of FK-506 binding protein (FKBP12.6) from the RyR,
    • rendering the channel excessively leaky for Ca(2+) (Marx et al. 2000).

However, other studies have reported no functional effects (Li et al. 2002) or even found phosphorylation to reduce RyR channel steady-state open probability (Valdivia et al. 1995; Lokuta et al. 1995).  The action of protein kinases is opposed by dephosphorylating phosphatases. Three types of protein phosphatases (PPs), referred to as PP1, PP2A and PP2B (calcineurin), have been shown to influence cardiac performance (Neumann et al. 1993; Rusnak & Mertz, 2000). Overall, according to most studies phosphatases appear to downregulate SR Ca(2+) release and contractile performance (Neumann et al. 1993; duBell et al. 1996, 2002; Carr et al. 2002; Santana et al. 2002). Furthermore, PP1 and PP2A activities appear to be increased in heart failure (Neumann, 2002; Carr et al. 2002). However, again the precise mode of action of these enzymes on intracellular Ca(2+) handling in normal and diseased hearts remains poorly understood.  In the present study, we have investigated the effects of protein phosphatases PP1 and PP2A on local Ca(2+) release events, Ca(2+) sparks, in cardiac cells. Our results show that

  •  phosphatases activate RyR mediated SR Ca(2+) release
    • leading to depletion of SR Ca(2+) stores.

These results provide novel insights into the mechanisms and potential role of protein phosphorylation/dephosphorylation in regulation of Ca(2+) signaling in normal and diseased hearts. F2.large   RyR and calcium

RESULTS

Effects of PP1 and PP2A on Ca2+ sparks and SR Ca(2+) content.

[1]  PP1 caused an early transient potentiation of Ca2+ spark frequency followed by a delayed inhibition of event occurrence. [2]  PP1 produced similar biphasic effects on the magnitude and spatio-temporal characteristics of Ca(2+) sparks Specifically, during the potentiatory phase (1 min after addition of the enzyme), PP1 significantly increased

  • the amplitude,
  • rise-time,
  • duration and
  • width of Ca(2+) sparks;

during the inhibitory phase (5 min after addition of the enzyme),

  •  all these parameters were significantly suppressed by PP1.

The SR Ca(2+) content decreased by 35 % or 69 % following the exposure of myocytes to either 0.5 or 2Uml_1 PP1, respectively (Fig. 1C). Qualitatively similar results were obtained with phosphatase PP2A. Similar to the effects of PP1, PP2A (5Uml_1) produced a transient increase in Ca(2+) spark frequency (~4-fold) followed by a depression of event occurrence and decreased SR Ca(2+) content (by 82 % and 65 %, respectively). Also similar to the action of PP1, PP2A increased

  •  the amplitude and
  • spatio-temporal spread (i.e. rise-time, duration and width) of Ca(2+) sparks at 1 min
  • and suppressed the same parameters at 5 min of exposure to the enzyme (Table 1).

Together, these results suggest that phosphatases enhance spark-mediated SR Ca2+ release, leading to decreased SR Ca(2+) content. Preventive effects of calyculin A and okadaic acid Preventive effects of ryanodine

PP1-mediated RyR dephosphorylation

F3.large  cardiomyocyte SR F3.large  cardiomyocyte SR F2.large   RyR and calcium coupled receptors coupled receptors The cardiac RyR is phosphorylated at Ser-2809 (in the rabbit sequence) by both PKA and CAMKII (Witcher et al. 1991; Marx et al. 2000). Although additional phosphorylation sites may exist on the RyR (Rodriguez et al. 2003), but Ser-2809 is believed to be the only site that is phosphorylated by PKA, and RyR hyperphosphorylation at this site has been reported in heart failure (Marx et al. 2000).  To test whether indeed phosphatases dephosphorylated the RyR in our permeabilized myocyte experiments we performed quantitative immunoblotting using an antibody that specifically recognizes the phosphorylated form of the RyR at Ser-2809 (Rodriguez et al. 2003). Myocytes exhibited a significant level of phosphorylation under baseline conditions. Maximal phosphorylation was 201 % of control. When exposed to 2Uml_1 PP1, RyR phosphorylation was 58 % of the control basal condition. Exposing to a higher PP1 concentration (10Uml_1) further reduced RyR phosphorylation to 22% of control. Thus, consistent with the results of our functional measurements,

  •  PP1 decreased RyR phosphorylation in cardiac myocytes.

Figure 1. Effects of PP1 on properties of Ca(2+) sparks and SR Ca(2+) content in rat permeabilized myocytes    see .  http://dx.doi.org/10.1113/jphysiol.2003.046367 A, spontaneous Ca(2+) spark images recorded under reference conditions, and 1 or 5 min after exposure of the cell to 2Uml_1 PP1. Traces below the images are Ca(2+) transients induced by application of 10 mM caffeine immediately following the acquisition of sparks before (3 min) and after (5 min) application of PP1 in the same cell. The Ca(2+) transients were elicited by a whole bath application of 10 mM caffeine. B, averaged spark frequency at early (1 min) and late (5 min) times following the addition of either 0.5 or 2Uml_1 of PP1 to the bathing solution. C, averaged SR Ca(2+) content for 0.5 or 2Uml_1 of PP1 measured before and 5 min after exposure to the enzyme. Data are presented as means ± S.E.M. of 6 experiments in different cells. Figure 2. Effects of PP2A on properties of Ca2+ sparks and SR Ca2+ content in rat permeabilized myocytes   see .  http://dx.doi.org/10.1113/jphysiol.2003.046367 A, spontaneous Ca(2+) spark images recorded under reference conditions, and 1 or 5 min after exposure of the cell to 5Uml_1 PP2A. Traces below the images are Ca(2+) transients induced by application of 10 mM caffeine immediately following the acquisition of sparks before (3 min) and after (5 min) application of PP2A in the same cell. B and C, averaged spark frequency (B) and SR Ca(2+) content (C) for the same conditions as in A. Data are presented as means ± S.E.M. of 6 experiments in different cells.

 DISCUSSION

In the present study, we have investigated the impact of physiologically relevant exogenous protein phosphatases PP1 and PP2A on RyR-mediated SR Ca(2+) release (measured as Ca(2+) sparks) in permeabilized heart cells. Our principal finding is that

  • phosphatases stimulated RyR channels lead to depleted SR Ca(2+) stores.

These results have important ramifications for understanding the mechanisms and role of protein phosphorylation/dephosphorylation in

  •  modulation of Ca(2+) handling in normal and diseased heart.

Modulation of SR Ca2+ release by protein phosphorylation/dephophorylation

Since protein dephosphorylation clearly resulted in increased functional activity of the Ca(+)release channel, our results imply that a reverse, phosphorylation reaction should reduce RyR activity. If indeed such effects take place, why do they not manifest in inhibition of Ca(+)sparks? One possibility is that enhanced Ca(+) uptake by SERCA

  •  masks or overcomes the effects phosphorylation may have on RyRs.

In addition, the potential inhibitory influence of protein phosphorylation on RyR activity in myocytes could be countered by feedback mechanisms  involving changes in luminal Ca(2+)(Trafford et al. 2002; Gyorke et al. 2002). In particular, reduced open probability of RyRs would be expected to lead to

  •  increased Ca2+ accumulation in the SR;
  • and increased intra-SR [Ca(2+)], in turn would
  • increase activity of RyRs at their luminal Ca(2+) regulatory sites

as demonstrated for the RyR channel inhibitor tetracaine (Gyorke et al. 1997; Overend et al. 1997). Thus

  • potentiation of SERCA
  • combined with the intrinsic capacity of the release mechanism to self-regulate

could explain at least in part why PKA-mediated protein phoshorylation results in maintained potentiation of Ca(2+) sparks despite a potential initial decrease in RyR activity.

Role of altered RyR Phosphorylation in Heart Failure

Marx et al. (2000) have proposed that  enhanced levels of circulating catecholamines lead to increased phosphorylation of RyR in heart failure.  Based on biochemical observations as well as on studying properties of single RyRs incorporated into artificial lipid bilayers, these investigators have hypothesized that

  •  hyperphosphorylation of RyRs contributes to pathogenesis of heart failure
    • by making the channel excessively leaky due to dissociation of FKBP12.6 from the channel.

We show that the mode of modulation of RyRs by phosphatases does not support this hypothesis as

  • dephosphorylation caused activation instead of

Interestingly, our results provide the basis for a different possibility in which

  •  dephophosphorylation of RyR rather than its phosphorylation causes depletion of SR Ca(2+) stores by stimulating RyRs in failing hearts.

It has been reported that PP1 and PP2 activities are increased in heart failure (Huang et al. 1999; Neumann et al. 1997; Neuman, 2002). Furthermore,  overexpression of PP1 or ablation of the endogenous PP1 inhibitor, l-1, results in

  • depressed contractile performance and heart failure (Carr et al. 2002).

Our finding that PP1 causes depletion of SR Ca(2+) stores by activating RyRs could account for, or contribute to, these results.

References

1 DelPrincipe F, Egger M, Pignier C & Niggli E (2001). Enhanced E-C coupling efficiency after beta-stimulation of cardiac myocytes. Biophys J 80, 64a. 2 Gyorke I & Gyorke S (1998). Regulation of the cardiac ryanodine receptor channel by luminal Ca2+ involves luminal Ca2+ sensing sites. Biophys J 75, 2801–2810. 3 Gyorke S, Gyorke I, Lukyanenko V, Terentyev D, Viatchenko-Karpinski S & Wiesner TF (2002). Regulation of sarcoplasmic reticulum calcium release by luminal calcium in cardiac muscle. Front Biosci 7, d1454–d1463. 4 Gyorke I, Lukyanenko V & Gyorke S (1997). Dual effects of tetracaine on spontaneous calcium release in rat ventricular myocytes. J Physiol 500, 297–309. 5 MacDougall LK, Jones LR & Cohen P (1991). Identification of the major protein phosphatases in mammalian cardiac muscle which dephosphorylate phospholamban. Eur J Biochem 196, 725–734. 6 Marx SO, Reiken S, Hisamatsu Y, Jayaraman T, Burkhoff D, Rosemblit N & Marks AR (2000). PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): defective regulation in failing hearts. Cell 101, 365–376. 7 Rodriguez P, Bhogal MS & Colyer J (2003). Stoichiometric phosphorylation of cardiac ryanodine receptor on serine-2809 by calmodulin-dependent kinase II and protein kinase A. J Biol Chem (in press).

The δC Isoform of CaMKII Is Activated in Cardiac Hypertrophy and Induces Dilated Cardiomyopathy and Heart Failure

T Zhang, LS Maier, ND Dalton, S Miyamoto, J Ross, DM Bers, JH Brown.  University of California, San Diego, La Jolla, Calif; and Loyola University, Chicago, Ill. Circ Res. 2003;92:912-919.    http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5 Recent studies have demonstrated that transgenic (TG) expression of either Ca(2+)/calmodulin-dependent protein kinase IV (CaMKIV) or CaMKIIδB, both of which localize to the nucleus, induces cardiac hypertrophy. However,

  •  CaMKIV is not present in heart, and
  • cardiomyocytes express not only the nuclear CaMKIIδB
    • but also a cytoplasmic isoform, CaMKII δC.

In the present study, we demonstrate that

  1.  expression of the δC isoform of CaMKII is selectively increased and
  2. its phosphorylation elevated as early as 2 days and continuously for up to 7 days after pressure overload.

To determine whether enhanced activity of this cytoplasmic δC isoform of CaMKII can lead to phosphorylation of Ca(2+) regulatory proteins and induce hypertrophy, we generated TG mice that expressed the δC isoform of CaMKII.  Immunocytochemical staining demonstrated that the expressed transgene is confined to the cytoplasm of cardiomyocytes isolated from these mice. These mice develop a dilated cardiomyopathy with up to a 65% decrease in fractional shortening and die prematurely. Isolated myocytes are enlarged and exhibit reduced contractility and altered Ca2(2+) handling. Phosphorylation of the ryanodine receptor (RyR) at a CaMKII site is increased even before development of heart failure, and

  • CaMKII is found associated with the RyR  from the CaMKII TG mice.
  • Phosphorylation of phospholamban is increased specifically at the CaMKII but not at the PKA phosphorylation site.

These findings are the first to demonstrate that CaMKIIδC can mediate phosphorylation of Ca(2+) regulatory proteins in vivo and provide evidence for the involvement of CaMKIIδC activation in the pathogenesis of dilated cardiomyopathy and heart failure.  Multifunctional Ca(2+)/calmodulin-dependent protein kinases (CaM kinases or CaMKs) are transducers of Ca2+ signals that phosphorylate a wide range of substrates and thereby affect Ca(2+)-mediated cellular responses.1 The family includes CaMKI and CaMKIV, monomeric enzymes activated by CaM kinase kinase,2,3 and CaMKII, a multimer of 6 to 12 subunits activated by autophosphorylation.1 The CaMKII subunits α, β, γ, and δ show different tissue distributions,1 with

  • the δ isoform predominating in the heart.4–7
  • Splice variants of the δ isoform, characterized by the presence of a second variable domain,4,7 include δB, which contains a nuclear localization signal (NLS), and
  • δC, which does not. CaMKII composed of δB subunits localizes to the nucleus, whereas CaMKIIδC localizes to the cytoplasm.4,8,9

CaMKII has been implicated in several key aspects of acute cellular Ca(2+) regulation related to cardiac excitation-contraction (E-C) coupling. CaMKII

  • phosphorylates sarcoplasmic reticulum (SR) proteins including the ryanodine receptors (RyR2) and
  • phospholamban (PLB).10–14

Phosphorylation of RyR has been suggested to alter the channel open probability,14,15 whereas phosphorylation of PLB has been suggested to regulate SR Ca(2+) uptake.14 It is also likely that CaMKII phosphorylates the L-type Ca(2+) channel complex or an associated regulatory protein and thus

  1. mediates Ca(2+) current (ICa) facilitation.16-18 and
  2. the development of early after-depolarizations and arrhythmias.19

Thus, CaMKII has significant effects on E-C coupling and cellular Ca(2 +) regulation. Nothing is known about the CaMKII isoforms regulating these responses.  Contractile dysfunction develops with hypertrophy, characterizes heart failure, and is associated with changes in cardiomyocyte (Ca2+) homeostasis.20  CaMKII expression and activity are altered in the myocardium of rat models of hypertensive cardiac hypertrophy21,22 and heart failure,23 and

  • in cardiac tissue from patients with dilated cardiomyopathy.24,25

Several transgenic mouse models have confirmed a role for CaMK in the development of cardiac hypertrophy, as originally suggested by studies in isolated neonatal rat ventricular myocytes.9,26–28 Hypertrophy develops in transgenic mice that overexpress CaMKIV,27 but this isoform is not detectable in the heart,4,29 and CaMKIV knockout mice still develop hypertrophy after transverse aortic constriction (TAC).29  Transgenic mice overexpressing calmodulin developed severe cardiac hypertrophy,30 later shown to be associated with an increase in activated CaMKII31; the isoform of CaMKII involved in hypertrophy could not be determined from these studies. We recently reported that transgenic mice that overexpress CaMKIIδB, which is highly concentrated in cardiomyocyte nuclei, develop hypertrophy and dilated cardiomyopathy.32 To determine whether

  • in vivo expression of the cytoplasmic CaMKIIδC can phosphorylate cytoplasmic Ca(2+) regulatory proteins and
  • induce hypertrophy or heart failure,

we generated transgenic (TG) mice that expressed the δC isoform of CaMKII under the control of the cardiac specific α-myosin heavy chain (MHC) promoter. Our findings implicate CaMKIIδC in the pathogenesis of dilated cardiomyopathy and heart failure and suggest that

  • this occurs at least in part via alterations in Ca(2+) handling proteins.33

Ca(2+) and contraction RyR yuan_image3  Ca++ exchange yuan_image3  Ca++ exchange

Results

 Expression and Activation of CaMKIIδC Isoform After TAC

To determine whether CaMKII was regulated in pressure overload–induced hypertrophy, CaMKIIδ expression and phosphorylation were examined by Western blot analysis using left ventricular samples obtained at various times after TAC.  A selective increase (1.6-fold) in the lower band of CaMKIIδwas observed as early as 1 day and continuously for 4 days (2.3-fold) and 7 days (2-fold) after TAC (Figure 1A).  To confirm that CaMKIIδC was increased and determine whether this occurred at the transcriptional level, we performed semiquantitative RT-PCR using primers specific for the CaMKIIδC isoform. These experiments revealed that

  • mRNA levels for CaMKIIδC were increased 1 to 7 days after TAC (Figure 1B).

In addition to examining CaMKII expression, the activation state of CaMKII was monitored by its autophosphorylation, which confers Ca2-independent activity.

Figure 1. Expression and activation of CaMKII δC isoform after TAC.

see http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5 A, Western blot analysis of total CaMKII in left ventricular (LV) homogenates obtained at indicated times after TAC. Cardiomyocytes transfected with CaMKIIδB and δC (right) served as positive controls and molecular markers. Top band (58 kDa) represents CaMKIIδB plus δ9, and the bottom band (56 kDa) corresponds to CaMKIIδC. *P0.05 vs control. B, Semiquantitative RT-PCR using primers specific for CaMKIIδC isoform (24 cycles) and GAPDH (19 cycles) using total RNA isolated from the same LV samples. C, Western blot analysis of phospho-CaMKII in LV homogenates obtained at various times after TAC. Three bands seen for each sample represent CaMKIIγ subunit (uppermost), CaMKIIδB plus δ9 (58 kDa), and CaMKIIδC (56 kDa). Quantitation is based on the sum of all of the bands. *P0.05 vs control.

 Figure 2. Expression and activation of CaMKII in CaMKIIδC transgenic mice.

see  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5 A, Transgene copy number based on Southern blots using genomic DNA isolated from mouse tails (digested with EcoRI). Probe (a 32P-labeled 1.7-kb EcoRI-SalI -MHC fragment) was hybridized to a 2.3-kb endogenous fragment (En) and a 3.9-kb transgenic fragment (TG). Transgene copy number was determined from the ratio of the 3.9-kb/2.3-kb multiplied by 2. B, Immunocytochemical staining of ventricular myocytes isolated from WT and CaMKIIδTG mice. Myocytes were cultured on laminin-coated slides overnight. Transgene was detected by indirect immunofluorescence staining using rabbit anti-HA antibody (1:100 dilution) followed by FITC-conjugated goat antirabbit IgG antibody (1:100 dilution). CaMKIIδB localization to the nucleus in CaMKIIδB TG mice (see Reference 32) is shown here for comparative purpose. C, Quantitation of the fold increase in CaMKIIδprotein expression in TGL and TGM lines. Different amounts of ventricular protein (numbers) from WT control, TG () and their littermates () were immunoblotted with an anti-CaMKIIδ antibody. Standard curve from the WT control was used to calculate fold increases in protein expression in TGL and TGM lines. D, Phosphorylated CaMKII in ventricular homogenates was measured by Western blot analysis (n5 for each group). **P0.01 vs WT.

 Generation and Identification of CaMKIIδC Transgenic Mice

TG mice expressing HA-tagged rat wild-type CaMKIIδC under the control of the cardiac-specific α-MHC promoter were generated as described in Materials and Methods. By Southern blot analysis, 3 independent TG founder lines carrying 3, 5, and 15 copies of the transgene were identified. They were designated as TGL (low copy number), TGM (medium copy number), and TGH (high copy number), The founder mice from the TGH line died at 5 weeks of age with marked cardiac enlargement.  The other two lines showed germline transmission of the transgene. The transgene was expressed only in the heart. Although CaMKII protein levels in TGL and TGM hearts were increased 12- and 17-fold over wild-type (WT) controls (Figure 2C), the amount of activated CaMKII was only increased 1.7- and 3-fold in TGL and TGM hearts (Figure 2D). The relatively small increase in CaMKII activity in the TG lines probably reflects the fact that the enzyme is not constitutively activated and that the availability of Ca2/CaM, necessary for activation of the overexpressed CaMKII, is limited. Importantly,

  • the extent of increase in active CaMKII in the TG lines was similar to that elicited by TAC.

 Cardiac Overexpression of CaMKIIδC Induces Cardiac Hypertrophy and Dilated Cardiomyopathy

There was significant enlargement of hearts from CaMKIIδC TGM mice by 8 to 10 weeks [see  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5%5D  (Figure 3A) and from TGL mice by 12 to 16 weeks. Histological analysis showed ventricular dilation (Figure 3B), cardiomyocyte enlargement (Figure 3C), and mild fibrosis (Figure 3D) in CaMKIIδC TG mice. Quantitative analysis of cardiomyocyte cell volume from 12-week-old TGM mice gave values of 54.7 + 0.1 pL for TGM (n = 96) versus 28.6 + 0.1 pL for WT littermates (n=94; P0.001). Ventricular dilation and cardiac dysfunction developed over time in proportion to the extent of transgene expression. Left ventricular end diastolic diameter (LVEDD) was increased by 35% to 45%, left ventricular posterior wall thickness (LVPW) decreased by 26% to 29% and fractional shortening decreased by 50% to 60% at 8 weeks for TGM and at 16 weeks for TGL. None of these parameters were significantly altered at 4 weeks in TGM or up to 11 weeks in TGL mice, indicating that heart failure had not yet developed.  Contractile function was significantly decreased. Figure 6. Dilated cardiomyopathy and dysfunction in CaMKIIδC TG mice at both whole heart and single cell levels.  [see Fig 6:  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5] C, Decreased contractile function in ventricular myocytes isolated from 12-week old TGM and WT controls presented as percent change of resting cell length (RCL) stimulated at 0.5 Hz. Representative trace and mean values are shown. *P0.05 vs WT. Figure 7. Phosphorylation of PLB in CaMKIIδC TG mice.  [see Fig 7: http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5] Thr17 and Ser16 phosphorylated PLB was measured by Western blots using specific anti-phospho antibodies. Ventricular homogenates were from 12- to 14-week-old WT and TGM mice (A) or 4 to 5-week-old WT and TGM mice (B). Data were normalized to total PLB examined by Western blots (data not shown here). n = 6 to 8 mice per group; *P0.05 vs WT.

 Cardiac Overexpression of CaMKIIδC Results in Changes in the Phosphorylation of Ca2 Handling Proteins

To assess the possible involvement of phosphorylation of Ca2cycling proteins in the phenotypic changes observed in the CaMKIIC TG mice, we first compared PLB phosphorylation state in homogenates from 12- to 14-week-old TGM and WT littermates. Western blots using antibodies specific for phosphorylated PLB showed a 2.3-fold increase in phosphorylation of Thr17 (the CaMKII site) in hearts from TGM versus WT (Figure 7A). Phosphorylation of PLB at the CaMKII site was also increased 2-fold in 4- to 5-week-old TGM mice (Figure 7B). Significantly, phosphorylation of the PKA site (Ser16) was unchanged in either the older or the younger TGM mice (Figures 7A and 7B). (see  http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5)  To demonstrate that the RyR2 phosphorylation changes observed in the CaMKII transgenic mice are not secondary to development of heart failure, we performed biochemical studies examining RyR2 phosphorylation in 4- to 5-week-old TGM mice. At this age, most mice showed no signs of hypertrophy or heart failure (see Figure 6B) and there was no significant increase in myocyte size (21.3 + 1.3 versus 27.7 + 4.6 pL; P0.14). Also, twitch Ca2 transient amplitude was not yet significantly depressed, and mean δ [Ca2+]i (1 Hz) was only 20% lower (192 + 36 versus 156 + 13 nmol/L; P0.47) versus 50% lower in TGM at 13 weeks.33  The in vivo phosphorylation of RyR2, determined by back phosphorylation, was significantly (2.10.3-fold; P0.05) increased in these 4- to 5-week-old TGM animals (Figure 8C), an increase equivalent to that seen in 12- to 14-week-old mice. We also performed the RyR2 back-phosphorylation assay using purified CaMKII rather than PKA. RyR2 phosphorylation at the CaMKII site was also significantly increased (2.2 + 0.3-fold; P0.05) in 4- to 5-week-old TGM mice (Figure 8C).  (http://dx.doi.org/10.1161/01.RES.0000069686.31472.C5) The association of CaMKII with the RyR2 is consistent with a physical interaction between this protein kinase and its substrate. The catalytic subunit of PKA and the phosphatases PP1 and PP2A were also present in the RyR2 immunoprecipitates, but not different in WT versus TG mouse hearts (Figure 8D). These data provide further evidence that

  • the increase in RyR2 phosphorylation, which precedes development of failure in the 4- to 5-week-old CaMKIIδC TG hearts, can be attributed to the increased activity of CaMKII.

 Discussion

  1. CaMKII is involved in the dynamic modulation of cellular
  2. Ca2 regulation and has been implicated in the development of cardiac hypertrophy and heart failure.14
  3. Published data from CaMK-expressing TG mice demonstrate that forced expression of CaMK can induce cardiac hypertrophy and lead to heart failure.27,32

However, the CaMK genes expressed in these mice are neither the endogenous isoforms of the enzyme nor the isoforms likely to regulate cytoplasmic Ca(2+) handling, because they localize to the nucleus.

  1.  the cytoplasmic cardiac isoform of CaMKII is upregulated at the expression level and is in the active state (based on autophosphorylation) after pressure overload induced by TAC.
  2.  two cytoplasmic CaMKII substrates (PLB and RyR) are phosphorylated in vivo when CaMKII is overexpressed and its activity increased to an extent seen under pathophysiological conditions.
  3. CaMKIIδ is found to associate physically with the RyR in the heart.
  4.  heart failure can result from activation of the cytoplasmic form of CaMKII and this may be due to altered Ca(2+) handling.

 Differential Regulation of CaMKIIδ Isoforms in Cardiac Hypertrophy

  1.  The isoform of CaMKII that predominates in the heart is the δ isoform.4–7 Neither the α nor the β isoforms are expressed and there is only a low level of expression of the γ isoforms.39
  2. Both δB and δC splice variants of CaMKIIδ are present in the adult mammalian myocardium36,40 and expressed in distinct cellular compartments.4,8,9

We suggest that the CaMKIIδ isoforms are differentially regulated in pressure-overload–induced hypertrophy, because the expression of CaMKIIδC is selectively increased as early as 1 day after TAC. Studies using RT-PCR confirm that

  • CaMKIIδC is regulated at the transcriptional level in response to TAC. In addition,
  • activation of both CaMKIIδB and CaMKIIδC, as indexed by autophosphorylation, increases as early as 2 days after TAC.
  • Activation of CaMKIIδB by TAC is relevant to our previous work indicating its role in hypertrophy.9,32
  • The increased expression, as well as activation of the CaMKIIδC isoform, suggests that it could also play a critical role in both the acute and longer responses to pressure overload.

In conclusion, we demonstrate here that CaMKIIδC can phosphorylate RyR2 and PLB when expressed in vivo at levels leading to 2- to 3-fold increases in its activity. Similar increases in CaMKII activity occur with TAC or in heart failure. Data presented in this study and in the accompanying article33 suggest that altered phosphorylation of Ca(2+) cycling proteins is a major component of the observed decrease in contractile function in CaMKIIδC TG mice. The occurrence of increased CaMKII activity after TAC, and of RyR and PLB phosphorylation in the CaMKIIδC TG mice suggest that

  • CaMKIIδC plays an important role in the pathogenesis of dilated cardiomyopathy and heart failure.

These results have major implications for considering CaMKII and its isoforms in exploring new treatment strategies for heart failure.

Cardiac Electrophysiological Dynamics From the Cellular Level to the Organ Level

Daisuke Sato and Colleen E. Clancy Department of Pharmacology, University of California – Davis, Davis, CA. Biomedical Engineering and Computational Biology 2013:5: 69–75 http://www.la-press.com.   http://dx.doi.org/10.4137/BECB.S10960 Abstract: Cardiac alternans describes contraction of the ventricles in a strong-weak-strong-weak sequence at a constant pacing fre­quency. Clinically, alternans manifests as alternation of the T-wave on the ECG and predisposes individuals to arrhythmia and sudden cardiac death. In this review, we focus on the fundamental dynamical mechanisms of alternans and show how alternans at the cellular level underlies alternans in the tissue and on the ECG. A clear picture of dynamical mechanisms underlying alternans is important to allow development of effective anti-arrhythmic strategies. The cardiac action potential is the single cellular level electrical signal that triggers contraction of the heart.1 Under normal conditions, the originating activation signal comes from a small bundle of tissue in the right atrium called the sinoatrial node (SAN). The action potentials generated by the SAN initiate an excitatory wave that, in healthy tissue, propagates smoothly through a well-defined path and causes excitation and contraction in the ventricles. In disease states, the normal excitation pathway is disrupted and a variety of abnormal rhythms can occur, including cardiac alternans, a well-known precursor to sudden cardiac death. Cardiac alternans was initially documented in 1872 by a German physician, Ludwig Traube.2 He observed contraction of the ventricles in a strong-weak-strong-weak sequence even though the pacing frequency was constant. Clinically, alternans mani­fests as alternation of the T-wave on the ECG, typi­cally in the microvolt range. It is well established that individuals with microvolt T-wave alternans are at much higher risk for arrhythmia and sudden cardiac death. A clear picture of physio­logical mechanisms underlying alternans is important to allow development of effective anti-arrhythmic drugs. It is also important to understand dynamical mechanisms because while the cardiac action poten­tial is composed of multiple currents, each of which confers specific properties, revelation of dynamical mechanisms provides a unified fundamental view of the emergent phenomena that holds independently of specific current interactions. The ventricular myocyte is an excitable cell pro­viding the cellular level electrical activity that under­lies cardiac contraction. Under resting conditions, the membrane potential is about -80 mV. When the cell is stimulated, sodium (Na) channels open and the membrane potential goes above 0 mV. Then, a few ms later, the inward current L-type calcium (Ca) current activates and maintains depolarization of the mem­brane potential. During this action potential plateau, several types of outward current potassium (K) chan­nels also activate. Depending on the balance between inward and outward currents, the action potential duration (APD) is determined.The diastolic interval (DI) that follows cellular repolarization describes the duration the cell resides in the resting state until the next excitation. During the DI, channels recover with kinetics determined by intrinsic time constants. APD restitution defines the relationship between the APD and the previous DI (Fig. 1 top panel). In most cases1, the APD becomes longer as the previous DI becomes longer due to recovery of the L-type Ca channel (Fig. 1, bottom panel), and thus the APD restitution curve has a positive slope. Figure 1. (Top): APD and DI. (Bottom): The physiological mechanism of APD alternans involves recovery from inactivation of ICaL.  [see  http://dx.doi.org/10.4137/BECB.S10960]

 Action Potential Duration Restitution

In 1968 Nolasco and Dahlen showed graphically that APD alternans occurs when the slope of the APD res­titution curve exceeds unity. Why is the steepness of the slope important? As shown graphically in Figure 2, APD alternans amplitude is multiplied by the slope of the APD restitution curve in each cycle. When the slope is larger than one, then the alternans amplitude will be amplified until the average slope reaches 1 or the cell shows a 2:1 stimulus to response ratio.  The one-dimensional mapping between APD and DI fails to explain quasi-periodic oscillation of the APD. Figure 2. APD restitution and dynamical mechanism of APD alternans.   [see  http://dx.doi.org/10.4137/BECB.S10960]

Calcium Driven Alternans

A strong-weak-strong-weak oscillation in contrac­tion implies that the Ca transient (CaT) is alternating. Until 1999 it was assumed that if the APD is alternat­ing then the CaT alternates because the CaT follows APD changes. However, Chudin et al showed that CaT can alternate even when APD is kept constant during pacing with a periodic AP clamp waveform.14 This implies that the intracellular Ca cycling has intrinsic nonlinear dynamics. A critical component in this process is the sarcoplasmic reticulum (SR), a subcellular organelle that stores Ca inside the cell. When Ca enters a cell through the L-type Ca channel (or reverse mode Na-Ca exchanger (NCX) ryanodine receptors open and large Ca releases occur from the SR (Ca induced Ca release). The amount of Ca release steeply depends on SR Ca load. This steep relation between Ca release and SR Ca load is the key to induce CaT alternans.  A one-dimensional map between Ca release and SR calcium load can be constructed to describe the relationship21 similar to the map used in APD restitution.

 Subcellular Alternans

A number of experimental and computational stud­ies have been undertaken to identify molecular mechanisms of CaT alternans by identifying the specific components in the calcium cycling process critical to formation of CaT alternans. These compo­nents include SR Ca leak and load, Ca spark frequency and amplitude, and rate of SR refilling. For example, experiments have shown that alternation in diastolic SR Ca is not required for CaT alternans.24 In addition, stochastic openings of ryanodine receptors (RyR) lead to Ca sparks that occur randomly, not in an alternating sequence that would be expected to underlie Ca altern-ans. So, how do local random sparks and constant dia­stolic SR calcium load lead to global CaT alternans? Mathematical models with detailed representations of subcellular Ca cycling have been developed in order to elucidate the underlying mechanisms. Model­ing studies have shown that even when SR Ca load is not changing, RyRs, which are analogous to ICaL in APD alternans, recover gradually from refractoriness. As RyR availability increases (for example during a long diastolic interval) a single Ca spark from a RyR will be larger in amplitude and recruit neighboring Ca release units to generate more sparks. The large resultant CaT causes depletion of the SR and when complete recovery of RyRs does not occur prior to the arrival of the next stimulus, the subsequent CaT will be small. This process results in an alternans of CaT amplitude from beat-to-beat.

 Coupling Between the Membrane Potential and Subcellular Calcium Dynamics

Importantly, the membrane voltage and intracellu­lar Ca cycling are coupled via Ca sensitive channels such as the L-type Ca channel and the sodium-calcium exchanger (NCX). The membrane voltage dynamics and the intracellular Ca dynamics are bi-directionally coupled. One direction is from voltage to Ca. As the DI becomes longer, the CaT usually becomes larger since the recovery time for the L-type Ca channel in increased and the SR Ca release becomes larger. The other direction is from Ca to voltage. Here we consider two major currents, NCX and ICaL. As the CaT becomes larger, forward mode NCX becomes larger and pro­longs APD. On the other hand, as the CaT becomes larger, ICaL becomes smaller due to Ca-induced inacti­vation, and thus, larger CaT shortens the APD. There­fore, depending on which current dominates, larger CaT can prolong or shorten APD. If a larger CaT pro­longs (shortens) the APD, then the coupling is positive (negative). The coupled dynamics of the membrane voltage and the intracellular Ca cycling can be cate­gorized by the instability of membrane voltage (steep APD restitution), instability of the intracellular Ca cycling (steep relation between Ca release versus SR Ca load), and the coupling (positive or negative). If the coupling is positive, alternans is electromechani­cally concordant (long-short-long-short APD cor­responds to large-small-large-small CaT sequence) regardless of the underlying instability mechanism. On the other hand, if the coupling is negative, alternans is electromechanically concordant in a voltage-driven regime. However, if alternans is Ca driven, alternans becomes electromechanically discordant (long-short-long-short APD corresponds to small-large-small-large CaT sequence). It is also possible to induce quasi- periodic oscillation of APD and CaT when volt­age and Ca instabilities contribute equally.

 Alternans in Higher Dimensions

Tissue level alternans in APD and CaT also occur and here we describe how the dynamical mechanism of alternans at the single cell level determines the phenomena in tissue. Spatially discordant alternans (SDA) where APDs in different regions of tissue alternate out-of-phase, is more arrhythmogenic since it causes large gradients of refractoriness and wave-break, which can initiate ventricular tachycardia and ventricular fibrillation. How is SDA induced? As the APD is a function of the previous DI, con­duction velocity (CV) is also function of the previ­ous DI (CV restitution) since the action potential propagation speed depends on the availability of the sodium channel. As the DI becomes shorter, sodium channels have less time to recover. Therefore, in general, as the DI becomes shorter, the CV becomes slower. When tissue is paced rapidly, action poten­tials propagate slowly near the stimulus, and thenac-celerate downstream as the DI becomes longer. This causes heterogeneity in APD (APD is shorter near the stimulus). During the following tissue excitation, APD becomes longer and the CV becomes faster at the pacing site then gradually APD becomes shorter and the CV becomes slower. The interaction between steep APD restitution and steep CV restitution creates SDA. This mechanism applies only when the cel­lular instability is voltage driven. When the cellular instability is Ca driven, the mechanism of SDA formation is different. If the volt­age-Ca coupling is negative, SDA can form without steep APD and CV restitution. The mechanism can be understood as follows. First, when cells are uncou­pled, alternans of APD and Ca are electromechanically discordant. If two cells are alternating in opposite phases, once these cells are coupled by voltage, due to electrotonic coupling, the membrane voltage of both cells is synchronized and thus APD becomes the same. This synchronization of APD amplifies the difference of CaT between two cells (Fig. 5 in). In other words it desynchronizes CaT. This instability mechanism is also found in subcellular SDA. In the case where the instability is Ca driven and the coupling is positive, there are several interest­ing distinctive phenomena that can occur. First, the profile of SDA of Ca contains a much steeper gra­dient at the node (point in space where no alternans occurs–cells downstream of the node are alternating out of phase with those upstream of the node) com­pared to the case of voltage driven SDA. Thus, the cellular mechanism of instability can be identified by evaluating the steepness of the alternans amplitude gradient in space around the node. When the cellular instability is voltage driven, the steady-state wave­length (separation of nodes in space) depends on electrotonic coupling between cells and the steepness of APD and CV restitution, regardless of the initial conditions. However, if the cellular instability is Ca driven, the location of nodes depends on the pacing history, which includes pacing cycle length and other parameters affected by pacing frequency. In this case, once the node is formed, the location of the node may be fixed, especially when Ca instability is strong. Such an explanation may apply to recent experimen­tal results. Summary In this review, we described how the origin of alternans at the cellular level (voltage driven, Ca drive, coupling between voltage and Ca) affects the formation of spatially discordant alternans at the tissue level. Cardiac alternans is a multi-scale emergent phenomenon. Channel properties determine the instability mechanism at the cellular level. Alternans mechanisms at cellular level determine SDA patterns at the tissue level. In order to understand alternans and develop anti-arrhythmic drug and therapy, multi-scale modeling of the heart is useful, which is increasingly enabled by emerging technologies such as general-purpose computing on graphics processing units (GPGPU) and cloud computing.

English: Diagram of contraction of smooth musc...

English: Diagram of contraction of smooth muscle fiber (Photo credit: Wikipedia)

Schematic representation of Calcium Cycling in Contractile and Proliferating VSMCs receptors voltage gated Ca(2) channel Marks-Wehrens Model and multiphosphorylation  site model ncpcardio0419-f4   calcium leak

Read Full Post »

Cardiac Contractility & Myocardial Performance: Therapeutic Implications of Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Author, and Content Consultant to e-SERIES A: Cardiovascular Diseases: Justin Pearlman, MD, PhD, FACC

Author and Curator: Larry H Bernstein, MD, FCAP

and Article Curator: Aviva Lev-Ari, PhD, RN
Article VII Cardiac Contractility &amp; Myocardium Performance Ventricular Arrhythmias and Non-ischemic Heart Failure
Image created by Adina Hazan 06/30/2021
Voice of Justin Pearlman, MD, PhD, FACC

Catechols refer to the stress hormones that control our response to fright, flight and fight, e.g., epinephrine, also known as adrenaline. Sudden elevation of catechols increases heart rate and also the strength of heart contraction (contractility). In the short term, that provides a boost that supports special demands to run faster, work harder. Like the healthcare system, it is not sustainable in high gear. Excess catechol push causes heart failure (catechol toxicity). Race horses routinely develop pulmonary edema by the end of a race – those pretreated for that with the diuretic LASIX have an L next to their entry in the race ticket.  The same issues occur as a whole-body system and at the subcellular level. Catechols increase amount and speed of the release of calcium which in turn triggers heart muscle contraction. However, the failing heart has elevated levels of calcium that impair oxygen utilization. The following discussions address the linkages between catechols and calcium traffic, including both the catechol and calcium stimulation of speed and strength, and their detrimental effects over time.

This article is Part VII in a continuation to the following article series on tightly related topics of the Calcium Release Mechanism.

 The Series consists of the following articles:

Part I: Identification of Biomarkers that are Related to the Actin Cytoskeleton

Larry H Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

Larry H. Bernstein, MD, FCAP, Stephen Williams, PhD and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

Larry H. Bernstein, MD, FCAP, Stephen J. Williams, PhD
 and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

Larry H Bernstein, MD, FCAP, Justin Pearlman, MD, PhD, FACC and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differences/

Part V: Ca2+-Stimulated Exocytosis:  The Role of Calmodulin and Protein Kinase C in Ca2+ Regulation of Hormone and Neurotransmitter

Larry H Bernstein, MD, FCAP
and
Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/12/23/calmodulin-and-protein-kinase-c-drive-the-ca2-regulation-of-hormone-and-neurotransmitter-release-that-triggers-ca2-stimulated-exocytosis/

Part VI: Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Part IX: Calcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

Justin Pearlman, MD, PhD, FACC, Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Part XI: Sensors and Signaling in Oxidative Stress

Larry H. Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2013/11/01/sensors-and-signaling-in-oxidative-stress/

Part XII: Atherosclerosis Independence: Genetic Polymorphisms of Ion Channels Role in the Pathogenesis of Coronary Microvascular Dysfunction and Myocardial Ischemia (Coronary Artery Disease (CAD))

Larry H Bernstein, MD, FCAP and Aviva Lev-Ari, PhD, RN

http://pharmaceuticalintelligence.com/2013/12/21/genetic-polymorphisms-of-ion-channels-have-a-role-in-the-pathogenesis-of-coronary-microvascular-dysfunction-and-ischemic-heart-disease/

and
Advanced Topics in Sepsis and the Cardiovascular System at its End Stage
Larry H Bernstein, MD, FCAP
Pharmacol Ther. 2009 August; 123(2): 151–177.
PMCID: PMC2704947

Ryanodine receptor-mediated arrhythmias and sudden cardiac death

This article has the following sections:

Introduction to Calcium Release Mechanism in Vascular Smooth Muscle and in Cardiomyocytes

Author: Justin D Pearlman, MD, PhD, FACC PENDING

I. Cellular Contractility Capacity — Actin, Cellular Dynamics and Calcium Efflux: Emergence of the Calcium Release-related Contractile Dysfunction

Author: Justin D Pearlman, MD, PhD, FACC

II. Integration and Interpretation of Research Results in Two Labs: Mark E Anderson’s and Roger Hajjar’s Lab

Author: Justin D Pearlman, MD, PhD, FACC PENDING

Mark Anderson’s Laboratory at the University of Iowa Carver College of Medicine recently summarized the critical roles of calcium in heart failure and arrhythmia in an article in Circulation Research. That laboratory elucidated critical facts, such as the controlling role of phosphorylation of ryanodine receptors among other details of the control and impact of Ca²⁺ homeostatic and structural proteins, ion channels, and enzymes. Their review focuses on the molecular mechanisms of defective Ca²⁺ cycling in heart failure and knowledge of those pathways may translate into new innovative therapies. The highly conserved Ca2+/calmodulin-dependent protein kinase II (CaMKII)plays an essential role in cardiac myocytes. Electrichemical activation of the cariac contraction cycle triggers a transient increase in the intracellular Ca2+ concentration ([Ca2+]i) which activates CaMKII activated through the binding of Ca2+-bound calmodulin (CaM). The activated CaMKII molecules phosphorylate many intracellular target proteins, including the sarcolemmal L-type Ca2+ channel, the ryanodine receptor, and the Ca2+ pump on the sarcoplasmic reticulum. Intersubunit autophosphorylation (positive feedback) promotes accumulation of the active CaMKII. Phosphorylated CaMKII maintains its catalytic activity until it is inactivated by constitutive phosphatase activity.

Roger J. Hajjar MD is the Director of the Cardiovascular Research Center, a cutting-edge translational research laboratory at Mt Sinai Medical Center. He is the Arthur & Janet C. Ross Professor of Medicine, Professor of Gene & Cell Medicine, Director of the Cardiology Fellowship Program, and Co-Director of the Transatlantic Cardiovascular Research Center, which combines Mount Sinai Cardiology Laboratories with those of the Universite de Paris – Madame Curie. He earned a bachelors of science degree in Biomedical Engineering at Johns Hopkins University and a medical degree from Harvard Medical School and the Harvard-MIT Division of Health Sciences and Technology. He completed his fellowship in cardiology at Massachusetts General Hospital in Boston, then became a staff cardiologist in the Heart Failure & Cardiac Transplantation Center, followed by Director of the Cardiovascular Laboratory of Integrative Physiology and Imaging, before moving to Mt. Sinai.

Roger J. Hajjar, MD and his team of investigators translate scientific findings into therapies for cardiovascular diseases. Dr. Hajjar’s team pioneered a potential gene therapy for heart failure, AAV1.SERCA2a, which can revive malfunctioning myocardium. His laboratory has completed Phase 1 and Phase 2 First-in-Man clinical trials of SERCA2a gene transfer in patients with advanced heart failure, and Phase 3 validation began in 2011. His laboratory also studies how to block signaling pathways in cardiac hypertrophy, aging, apoptosis, and diastolic failure.

Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Aviva Lev-Ari, PhD, RN

Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

Anderson Publications (2006-2013)

2013
•He BJ, Anderson ME. Aldosterone and Cardiovascular Disease: the heart of the matter. Trends in Endocrinology & Metabolism 24(1):21-30, 2013. [PMID: 23040074]
•Luo M, Anderson ME, Mechanisms of altered Ca2+ handling in heart failure. Circ Res 113(6):690-708. 2013 [PMID: 23989713]
•Anderson ME. Why has it taken so long to learn what we still don’t know? Circ Res 113(7):840-2. 2013 [PMID: 24030016]
•Thomas C, Anderson ME. In memoriam: John B. Stokes, MD. Semin Nephrol. 33(3):207-8, 2013. [PMID: 23953797]
•Gyorke S, Ho HT, Anderson ME, et al. Ryanodine receptor phosphorylation by oxidized CaMKII contributes to the cardiotoxic effects of cardiac glycosides. Cardiovas Res [PMID: Accepted for publication]
•Kline J, Anderson ME, et al, βIV-spectrin and CaMKII facilitate Kir6.2 regulation in pancreatic beta cells. Proc Natl Acad Sci. [PMID: Accepted for publication]
•Maier LS, Sag C, Anderson ME, Ionizing Radiation Regulates Cardiac Ca handling via increased ROS and activated CaMKII. Bas Res in Card [PMID: Accepted for publication]
•Chen B, Guo A, Zhang C, Chen R, Zhu Y, Hong J, Kutschke W, Zimmerman K, Weiss RM, Zingman L, Anderson ME, Wehrens XH, Song LS. Critical roles of Junctophilin-2 T-tubule and excitation-contraction coupling maturation during postnatal development. Cardiovas Res 2013 Oct 1; 100(1):54-62. [PMID: 23860812] [PMC3778961]
•Purohit A, Rokita AG, Xiaoqun G, Biyi C, Koval OM, Voigt N, Neef S, Sowa T, Gao Z, Luczak E, Stefansdottir H, Behunin AC, Li N, El-Accaoui RN, Yang B, Swaminathan PD, Weiss RM, Wehrens XH, Song LS, Dobrev D, Maier LS, Anderson ME. Oxidized CaMKII Triggers Atrial Fibrillation. Circulation 2013 Sep 12 [Epub ahead of print] [PMID: 24030498]
•Yoshida-Moriguchi T, Willer T, Anderson ME, Venzke D, Whyte T, Muntoni F, Lee H, Nelson SF, Yu L, Campbell, KP. SGK196 is a glycosylation-specific O-mannose kinase required for dystroglycan function. Science 2013 Aug 23; 341(6148): 896-9. [PMID:23929950]
•Scott JA, Klutho PJ, El Accaoui R, Nguyen E, Venema AN, Xie L, Jiang S, Dibbern M, Scroggins S, Prasad AM, Luczak ED, Davis MK, Li W, Guan X, Backs J, Schlueter AJ, Weiss RM, Miller FJ, Anderson ME, Grumbach IM. The Multifunctional Ca2+/Calmodulin-Dependent Kinase IIδ (CaMKIIδ) Regulates Arteriogenesis in a Mouse Model of Flow-Mediated Remodeling. PLoS One 2013 Aug 8; 8(8):e71550. [PMID: 23951185] [PMC3738514]
•Scholten A, Preisinger C, Corradini E, Bourgonje VJ, Hennrick ML, van Veen TA, Swaminathan PD, Joiner ML, Vos MA, Anderson ME, Heck AJ. A Phosphoproteomics Study Based on In Vivo Inhibition Reveals Sites of Calmodulin Dependent Protein Kinase II Regulation in the Heart. J Am Heart Assoc 2013 Aug 7; 2(4):e000318. [PMID: 23926118]
•Prasad AM, Nuno DW, Koval OM, Ketsawatsomkron P, Li W, Li H, Shen Y, Joiner ML, Kutschke W, Weiss RM, Sigmund CD, Anderson ME, Lamping KG, Grumbach IM. Differential Control of Calcium Homeostatis and Vascular Reactivity by Ca2+/Calmodulin-Dependent Kinase II. Hypertension 2013 Aug; 62(2):434-41.[PMID:23753415]
•Sanders PN, Koval OM, Jaffer OA, Prasad AM, Businga TR, Scott JA, Hayden PJ, Luczak ED, Dickey DD, Allamargot C, Olivier AK, Meyerholz DK, Robison AJ, Winder DG, Blackwell TS, Dworski R, Sammut D, Wagner BA, Buettner GR, Pope MR, Miller FJ, Dibbern ME, Haitchi HM, Mohler PJ, Howarth PH, Zabner J, Kline JN, Grumbach IM, Anderson ME. CaMKII is Essential for the Proasthmatic Effects of Oxidation. Sci Trans Med 2013 Jul 24; 5(195):195 ra97. [PMID: 23884469] Chosen as a “From the Cover” article in STM and with a commentary in JAMA. 310(9):894. doi: 10.1001/jama.2013.277035
•Wolf RM, Glynn P, Hashemi S, Zarei K, Mitchell CC, Anderson ME, Mohler PJ, Hund TJ. Atrial fibrillation and sinus node dysfunction in human ankyrin-B syndrome: A computational analysis. Am J Physiol Heart and Circ Physiol 2013 May; 304(9):H1253-66. [PMID: 23436330] [PMC3652094]
•Ather S, Wang W, Wang Q, Li N, Anderson ME, Wehrens XH. Inhibition of CaMKII Phosphorylation of RyR2 Prevents Inducible Ventricular Arrhythmias in Mice with Duchenne Muscular Dystrophy. Heart Rhythm 2013 Apr; (10)4:592-9 [PMID: 23246599] [PMC3605194]
•Yang J, Maity B, Huang J, Gao Z, Stewart A, Weiss RM, Anderson ME, Fisher RA. G- protein inactivator RGS6 mediates myocardial cell apoptosis and cardiomyopathy caused by doxorubicin. Cancer Res 2013 Mar 15; 73(6): 1662-7. [PMID: 23338613] [PMC3602152]
•Luo M, Guan X, Luczak ED, Di L, Kutschke W, Gao Z, Yang J, Glynn P , Sossalla S, Swaminathan PD, Weiss RM, Yang B, Rokita AG,5, Maier LS, Efimov I, Hund TJ, Anderson ME. Diabetes increases mortality after myocardial infarction by oxidizing CaMKII. J Clin Invest 2013 Mar 1; 123(3):1262-74. [PMID: 23426181] [ PMC3673230]
•Sierra A, Zhu Z, Sapay N, Sharotri V, Kline CF, Luczak ED, Subbotina E, Sivaprasadarao A, Snyder PM, Mohler PJ, Anderson ME, Vivaudou M, Zingman LV, Hodgson-Zingman DM. Regulation of cardiac ATP-sensitive potassium channel surface expression by calcium/calmodulin-dependent protein kinase II. J Biol Chem 2013 Jan 18; 288(3):1568-81. [PMID: 23223335] [PMC3548467]
•Gao Z, Rasmussen TP, Li Y , Kutschke W , Koval OM, Wu Y, Wu Y, Hall DD, Joiner ML, Wu XQ, Swaminathan PD, Purohit A, Zimmerman KA, Weiss RM, Philipson K , Song LS, Hund TJ, Anderson ME. Genetic inhibition of Na+-Ca2+ exchanger current disables fight or flight sinoatrial node activity without affecting resting heart rate. Circ Res 2013 Jan 18;112(2):309-17. [PMID: 23192947][Epub: e157-e179] [PMC3562595]
•Degrande ST, Little S, Nixon DJ, Wright P, Snyder J, Dun W, Murphy N, Kilic A, Higgins R, Binkley PF, Boyden PA, Carnes CA, Anderson ME, Hund TJ, Mohler PJ. Molecular mechanisms underlying cardiac protein phosphatase 2A regulation in heart. J Biol Chem 2013 Jan 11; 288(2):1032-46. [PMID: 23204520] [PMC3542989]
•He BJ, Anderson ME. Aldosterone and Cardiovascular Disease: the heart of the matter. Trends in Endocrinology & Metabolism 24(1):21-30, 2013. [PMID: 23040074]
• Luo M, Anderson ME, Mechanisms of altered Ca2+ handling in heart failure. Circ Res 113(6):690-708. 2013 [PMID: 23989713]
•Anderson ME. Why has it taken so long to learn what we still don’t know? Circ Res 113(7):840-2. 2013 [PMID: 24030016]
• Thomas C, Anderson ME. In memoriam: John B. Stokes, MD. Semin Nephrol. 33(3):207-8, 2013. [PMID: 23953797]

2012
•Wang Y and Anderson ME. Chapter 22: Intracellular Signaling Pathways in Cardiac Remodeling. Muscle: Fundamental Biology and Mechanisms of Disease. J. Hill and E. Olson (Eds), Elsevier, pp 299-308, 2012.
• Ather S, Wang W, Wang Q, Li N, Anderson ME, Wehrens XH. Inhibition of CaMKII Phosphorylation of RyR2 Prevents Inducible Ventricular Arrhythmiasin Mice with Duchenne Muscular Dystrophy. Heart Rhythm. 2012 Dec 11. doi:pii: S1547-5271(12)01450-6. 10.1016/j.hrthm.2012.12.016. PubMed PMID: 23246599.
• Sierra A, Zhu Z, Sapay N, Sharotri V, Kline CF, Luczak ED, Subbotina E, Sivaprasadarao A, Snyder PM, Mohler PJ, Anderson ME, Vivaudou M, Zingman LV, Hodgson-Zingman DM. Regulation of cardiac ATP-sensitive potassium channel surface expression by calcium/calmodulin-dependent protein kinase II. J Biol Chem. 2012 Dec 6. [Epub ahead of print] PubMed PMID: 23223335.
• Degrande S, Nixon D, Koval O, Curran JW, Wright P, Wang Q, Kashef F, Chiang D, Li N, Wehrens XH, Anderson ME, Hund TJ, Mohler PJ. CaMKII inhibition rescues proarrhythmic phenotypes in the model of human ankyrin-B syndrome. Heart Rhythm. 2012 Dec;9(12):2034-41. doi: 10.1016/j.hrthm.2012.08.026. Epub 2012 Aug 28. PubMed PMID: 23059182.
• Degrande ST, Little S, Nixon DJ, Wright P, Snyder J, Dun W, Murphy N, Kilic A, Higgins R, Binkley PF, Boyden PA, Carnes CA, Anderson ME, Hund TJ, Mohler PJ. Molecular mechanisms underlying cardiac protein phosphatase 2A regulation in heart. J Biol Chem. 2012 Nov 30. [Epub ahead of print] PubMed PMID: 23204520.
• Gao Z, Rasmussen TP, Li Y, Kutschke W, Koval OM, Wu Y, Wu Y, Hall DD, Joiner ML, Wu X, Dominic Swaminathan P, Purohit A, Zimmerman KA, Weiss RM, Philipson K, Song LS, Hund TJ, Anderson ME. Genetic Inhibition of Na+-Ca2+ Exchanger Current Disables Fight or Flight Sinoatrial Node Activity Without Affecting Resting Heart Rate. Circ Res. 2012 Nov 27. PubMed PMID: 23192947
• Joiner ML, Koval OM, Li J, He BJ, Allamargot C, Gao Z, Luczak ED, Hall DD, Fink BD, Chen B, Yang J, Moore SA, Scholz TD, Strack S, Mohler PJ, Sivitz WI, Song LS, Anderson ME. CaMKII determines mitochondrial stress responses in heart. Nature. 2012 Nov 8;491(7423):269-73. doi: 10.1038/nature11444. Epub 2012 Oct 10. PubMed PMID: 23051746; PubMed Central PMCID: PMC3471377.
• Rokita AG, Anderson ME. New therapeutic targets in cardiology: arrhythmias and Ca2+/calmodulin-dependent kinase II (CaMKII). Circulation. 2012 Oct 23;126(17):2125-39. doi: 10.1161/CIRCULATIONAHA.112.124990. Review. PubMed PMID: 23091085; PubMed Central PMCID: PMC3532717.
• Koval OM, Snyder JS, Wolf RM, Pavlovicz RE, Glynn P, Curran J, Leymaster ND, Dun W, Wright PJ, Cardona N, Qian L, Mitchell CC, Boyden PA, Binkley PF, Li C, Anderson ME, Mohler PJ, Hund TJ. Ca2+/calmodulin-dependent protein kinase II-based regulation of voltage-gated Na+ channel in cardiac disease. Circulation. 2012 Oct 23;126(17):2084-94. doi: 10.1161/CIRCULATIONAHA.112.105320. Epub 2012Sep 24. PubMed PMID: 23008441.
• Wagner S, Rokita AG, Anderson ME, Maier LS. Redox Regulation of Sodium and Calcium Handling. Antioxid Redox Signal. 2012 Oct 3. [Epub ahead of print] PubMed PMID: 22900788.
• Wu Y, Luczak ED, Lee EJ, Hidalgo C, Yang J, Gao Z, Li J, Wehrens XH, Granzier H, Anderson ME. CaMKII effects on inotropic but not lusitropic force frequency responses require phospholamban. J Mol Cell Cardiol. 2012 Sep;53(3):429-36. doi: 10.1016/j.yjmcc.2012.06.019. Epub 2012 Jul 11. PubMed PMID: 22796260.
• Majumdar S, Anderson ME, Xu CR, Yakovleva TV, Gu LC, Malefyt TR, Siahaan TJ. Methotrexate (MTX)-cIBR conjugate for targeting MTX to leukocytes: conjugate stability and in vivo efficacy in suppressing rheumatoid arthritis. J Pharm Sci. 2012 Sep;101(9):3275-91. doi: 10.1002/jps.23164. Epub 2012 Apr 26. PubMed PMID: 22539217.
• Kashef F, Li J, Wright P, Snyder J, Suliman F, Kilic A, Higgins RS, Anderson ME, Binkley PF, Hund TJ, Mohler PJ. Ankyrin-B protein in heart failure: identification of a new component of metazoan cardioprotection. J Biol Chem. 2012 Aug 31;287(36):30268-81. doi: 10.1074/jbc.M112.368415. Epub 2012 Jul 9. PubMed PMID: 22778271; PubMed Central PMCID: PMC3436279.
• Chen B, Guo A, Gao Z, Wei S, Xie YP, Chen SR, Anderson ME, Song LS. In situ confocal imaging in intact heart reveals stress-induced Ca(2+) release variability in a murine catecholaminergic polymorphic ventricular tachycardia model of type 2 ryanodine receptor(R4496C+/-) mutation. Circ Arrhythm Electrophysiol. 2012 Aug 1;5(4):841-9. doi: 10.1161/CIRCEP.111.969733. Epub 2012 Jun 21. PubMed PMID: 22722659; PubMed Central PMCID: PMC3421047.
• Swaminathan PD, Purohit A, Hund TJ, Anderson ME. Calmodulin-dependent protein kinase II: linking heart failure and arrhythmias. Circ Res. 2012 Jun 8;110(12):1661-77. doi: 10.1161/CIRCRESAHA.111.243956. Review. PubMed PMID: 22679140.
• Chen B, Li Y, Jiang S, Xie YP, Guo A, Kutschke W, Zimmerman K, Weiss RM, Miller FJ, Anderson ME, Song LS. β-Adrenergic receptor antagonists ameliorate myocyte T-tubule remodeling following myocardial infarction. FASEB J. 2012 Jun;26(6):2531-7. doi: 10.1096/fj.11-199505. Epub 2012 Feb 28. PubMed PMID: 22375019; PubMed Central PMCID: PMC3360148.
• Scott JA, Xie L, Li H, Li W, He JB, Sanders PN, Carter AB, Backs J, Anderson ME, Grumbach IM. The multifunctional Ca2+/calmodulin-dependent kinase II regulates vascular smooth muscle migration through matrix metalloproteinase 9. Am J Physiol Heart Circ Physiol. 2012 May 15;302(10):H1953-64. doi: 10.1152/ajpheart.00978.2011. Epub 2012 Mar 16. PubMed PMID: 22427508; PubMed Central PMCID: PMC3362103.
• Gudmundsson H, Curran J, Kashef F, Snyder JS, Smith SA, Vargas-Pinto P, Bonilla IM, Weiss RM, Anderson ME, Binkley P, Felder RB, Carnes CA, Band H, Hund TJ, Mohler PJ. Differential regulation of EHD3 in human and mammalian heart failure. J Mol Cell Cardiol. 2012 May;52(5):1183-90. doi: 10.1016/j.yjmcc.2012.02.008. Epub 2012 Mar 3. PubMed PMID: 22406195; PubMed Central PMCID: PMC3360944.
• Singh MV, Swaminathan PD, Luczak ED, Kutschke W, Weiss RM, Anderson ME. MyD88 mediated inflammatory signaling leads to CaMKII oxidation, cardiac hypertrophy and death after myocardial infarction. J Mol Cell Cardiol. 2012 May;52(5):1135-44. doi: 10.1016/j.yjmcc.2012.01.021. Epub 2012 Feb 3. PubMed PMID: 22326848; PubMed Central PMCID: PMC3327770.
• Qian H, Matt L, Zhang M, Nguyen M, Patriarchi T, Koval OM, Anderson ME, He K, Lee HK, Hell JW. β2-Adrenergic receptor supports prolonged theta tetanus-induced LTP. J Neurophysiol. 2012 May;107(10):2703-12. doi: 10.1152/jn.00374.2011. Epub 2012 Feb 15. PubMed PMID: 22338020; PubMed Central PMCID: PMC3362273.

2011
• Xie YP, Chen B, Sanders P, Guo A, Li Y, Zimmerman K, Wang LC, Weiss RM, Grumbach IM, Anderson ME, Song LS. Sildenafil Prevents and Reverses Transverse-Tubule Remodeling and Ca2+ Handling Dysfunction in Right Ventricle Failure Induced by Pulmonary Artery Hypertension. Hypertension. 2011 Dec 27.[Epub ahead of print] PubMed PMID: 22203744.
•He BJ, Joiner ML, Singh MV, Luczak ED, Swaminathan PD, Koval OM, Kutschke W, Allamargot C, Yang J, Guan X, Zimmerman K, Grumbach IM, Weiss RM, Spitz DR, Sigmund CD, Blankesteijn WM, Heymans S, Mohler PJ, Anderson ME. Oxidation of CaMKII determines the cardiotoxic effects of aldosterone. Nat Med. 2011 Nov 13;17(12):1610-8. doi: 10.1038/nm.2506. PubMed PMID: 22081025.
• Zhu Z, Burnett CM, Maksymov G, Stepniak E, Sierra A, Subbotina E, Anderson ME, Coetzee WA, Hodgson-Zingman DM, Zingman LV. Reduction in number of sarcolemmal KATP channels slows cardiac action potential duration shortening under hypoxia. Biochem Biophys Res Commun. 2011 Dec 2;415(4):637-41. Epub 2011 Nov 3. PubMed PMID: 22079630; PubMed Central PMCID: PMC3230708.
•Albert CM, Chen PS, Anderson ME, Cain ME, Fishman GI, Narayan SM, Olgin JE, Spooner PM, Stevenson WG, Van Wagoner DR, Packer DL; Heart Rhythm Society Research Task Force. Full report from the first annual Heart Rhythm Society Research Forum: a vision for our research future, “dream, discover, develop, deliver”. Heart Rhythm. 2011 Dec;8(12):e1-12. Epub 2011 Nov 7. PubMed PMID: 22079558.
•Cunha SR, Hund TJ, Hashemi S, Voigt N, Li N, Wright P, Koval O, Li J, Gudmundsson H, Gumina RJ, Karck M, Schott JJ, Probst V, Le Marec H, Anderson ME, Dobrev D, Wehrens XH, Mohler PJ. Defects in ankyrin-based membrane protein targeting pathways underlie atrial fibrillation. Circulation. 2011 Sep 13;124(11):1212-22. Epub 2011 Aug 22. PubMed PMID: 21859974; PubMed Central PMCID: PMC3211046.
•Sag CM, Köhler AC, Anderson ME, Backs J, Maier LS. CaMKII-dependent SR Ca leak contributes to doxorubicin-induced impaired Ca handling in isolated cardiac myocytes. J Mol Cell Cardiol. 2011 Nov;51(5):749-59. Epub 2011 Jul 26. PubMed PMID: 21819992; PubMed Central PMCID: PMC3226826.
•Swaminathan PD, Purohit A, Soni S, Voigt N, Singh MV, Glukhov AV, Gao Z, He BJ, Luczak ED, Joiner ML, Kutschke W, Yang J, Donahue JK, Weiss RM, Grumbach IM, Ogawa M, Chen PS, Efimov I, Dobrev D, Mohler PJ, Hund TJ, Anderson ME. Oxidized CaMKII causes cardiac sinus node dysfunction in mice. J Clin Invest. 2011 Aug 1;121(8):3277-88. doi: 10.1172/JCI57833. Epub 2011 Jul 25. PubMed PMID: 21785215; PubMed Central PMCID: PMC3223923.
•Erickson JR, He BJ, Grumbach IM, Anderson ME. CaMKII in the cardiovascular system: sensing redox states. Physiol Rev. 2011 Jul;91(3):889-915. Review. PubMed PMID: 21742790.
•Anderson ME. Pathways for CaMKII activation in disease. Heart Rhythm. 2011 Sep;8(9):1501-3. Epub 2011 May 3. PubMed PMID: 21699838; PubMed Central PMCID: PMC3163819.
•Swaminathan PD, Anderson ME. CaMKII inhibition: breaking the cycle of electrical storm? Circulation. 2011 May 24;123(20):2183-6. Epub 2011 May 9. PubMed PMID: 21555705.
•Schulman H, Anderson ME. Ca/Calmodulin-dependent Protein Kinase II in Heart Failure. Drug Discov Today Dis Mech. 2010 Summer;7(2):e117-e122. PubMed PMID: 21503275; PubMed Central PMCID: PMC3077766.
•Zingman LV, Zhu Z, Sierra A, Stepniak E, Burnett CM, Maksymov G, Anderson ME, Coetzee WA, Hodgson-Zingman DM. Exercise-induced expression of cardiacATP-sensitive potassium channels promotes action potential shortening and energy conservation. J Mol Cell Cardiol. 2011 Jul;51(1):72-81. Epub 2011 Mar 23. PubMed PMID: 21439969; PubMed Central PMCID: PMC3103621.
•Gao Z, Singh MV, Hall DD, Koval OM, Luczak ED, Joiner ML, Chen B, Wu Y, Chaudhary AK, Martins JB, Hund TJ, Mohler PJ, Song LS, Anderson ME. Catecholamine-independent heart rate increases require Ca2+/calmodulin-dependent protein kinase II. Circ Arrhythm Electrophysiol. 2011 Jun 1;4(3):379-87. Epub 2011 Mar 15. PubMed PMID: 21406683; PubMed Central PMCID: PMC3116039.
•Singh MV, Anderson ME. Is CaMKII a link between inflammation and hypertrophy in heart? J Mol Med (Berl). 2011 Jun;89(6):537-43. Epub 2011 Jan 29. Review. PubMed PMID: 21279501.
•Anderson ME, Brown JH, Bers DM. CaMKII in myocardial hypertrophy and heart failure. J Mol Cell Cardiol. 2011 Oct;51(4):468-73. Epub 2011 Jan 27. Review. PubMed PMID: 21276796; PubMed Central PMCID: PMC3158288.
•Wagner S, Ruff HM, Weber SL, Bellmann S, Sowa T, Schulte T, Anderson ME, Grandi E, Bers DM, Backs J, Belardinelli L, Maier LS. Reactive oxygen species-activated Ca/calmodulin kinase IIδ is required for late I(Na) augmentation leading to cellular Na and Ca overload. Circ Res. 2011 Mar 4;108(5):555-65. Epub 2011 Jan 20. PubMed PMID: 21252154; PubMed Central PMCID:PMC3065330.

2010
•Hund TJ, Koval OM, Li J, Wright PJ, Qian L, Snyder JS, Gudmundsson H, Kline CF, Davidson NP, Cardona N, Rasband MN, Anderson ME, Mohler PJ. A β(IV)-spectrin/CaMKII signaling complex is essential for membrane excitability in mice. J Clin Invest. 2010 Oct 1;120(10):3508-19
•Yang J, Huang J, Maity B, Gao Z, Lõrca R, Gudmundsson H, Li J, Stewart A, Swaminathan PD, Ibeawuchi SR, Shepherd A, Chen CK, Kutschke W, Mohler PJ, Mohapatra DP, Anderson ME, Fisher RA. RGS6, a Modulator of Parasympathetic Activation in Heart. Circ Res. 2010 Sep 23. [Epub ahead of print]
•Li J, Kline CF, Hund TJ, Anderson ME, Mohler PJ. Ankyrin-B regulates Kir6.2 membrane expression and function in heart J Biol Chem. 2010 Sep 10;285(37):28723-30.
•Wei S, Guo A, Chen B, Kutschke W, Xie YP, Zimmerman K, Weiss RM, Anderson ME, Cheng H, Song LS. T-tubule remodeling during transition from hypertrophy to heart failure. Circ Res. 2010 Aug 20;107(4):520-31.
•Glukhov AV, Fedorov VV, Anderson ME, Mohler PJ, Efimov IR. Functional anatomy of the murine sinus node: high-resolution optical mapping of ankyrin-B heterozygous mice.Am J Physiol Heart Circ Physiol. 2010 Aug;299(2):H482-91.
•Gudmundsson H, Hund TJ, Wright PJ, Kline CF, Snyder JS, Qian L, Koval OM, Cunha SR, George M, Rainey MA, Kashef FE, Dun W, Boyden PA, Anderson ME, Band H, Mohler PJ. EH domain proteins regulate cardiac membrane protein targeting. Circ Res. 2010 Jul 9;107(1):84-95.
•Gao Z, Chen B, Joiner ML, Wu Y, Guan X, Koval OM, Chaudhary AK, Cunha SR, Mohler PJ, Martins JB, Song LS, Anderson ME .I(f) and SR Ca(2+) release both contribute to pacemaker activity in canine sinoatrial node cells. J Mol Cell Cardiol. 2010 Jul;49(1):33-40.
•Witczak CA, Jessen N, Warro DM, Toyoda T, Fujii N, Anderson ME, Hirshman MF, Goodyear LJ. CaMKII regulates contraction- but not insulin-induced glucose uptake in mouse skeletal muscle. Am J Physiol Endocrinol Metab. 2010 Jun;298(6):E1150-60.
•Koval OM, Guan X, Wu Y, Joiner ML, Gao Z, Chen B, Grumbach IM, Luczak ED, Colbran RJ, Song LS, Hund TJ, Mohler PJ, Anderson ME. CaV1.2 beta-subunit coordinates CaMKII-triggered cardiomyocyte death and afterdepolarizations. Proc Natl Acad Sci U S A. 2010 Mar 16;107(11):4996-5000.
•Li H, Li W, Gupta AK, Mohler PJ, Anderson ME, Grumbach IM. Calmodulin kinase II is required for angiotensin II-mediated vascular smooth muscle hypertrophy. Am J Physiol Heart Circ Physiol. 2010 Feb;298(2):H688-98.

2009
• Singh, M.V., Kapoun, A., Higgins, L., Kutschke, W., Thurman, J.M., Singh, M., Yang, J., Guan, X., Lowe, J., Weiss, R.M., Zimmerman, K., Zhang, R., Yull, F.E., Blackwell, T.S., Mohler, P.J., Anderson, M.E. Ca2+/calmodulin-dependent kinase II triggers cell membrane injury by inducing complement factor B gene expression in the mouse heart. J. Clin. Invest. 119(4):986-996, 2009. (Commentary in Nat Med 15:375, 2009)
• Wu Y, Gao Z, Chen B, Koval O, Singh M, Guan X, Hund T, Kutschke WJ, Sarma S, Grumbach I, Wehrens X, Mohler P, Song L, Anderson M.E. Calmodulin kinase II is required for fight or flight sinoatrial node physiology. Proc. Natl. Acad. Sci. 106:5972-5977, 2009. (Commentary in Sci Signaling, 2:ec130, 2009)
• Chelu M, Sarma S, Sood S, Wang S, Oort V, Jeroen R, Skapura D, Li N, Santonastasi M, Mueller F, Schotten U, Anderson ME, Valderrabano M, Dobrev D, Wehrens XHT. Calmodulin kinase II mediated sarcoplasmic reticulum calcium leak promotes atrial fibrillation. J. Clin. Invest. 119(7): 1940-1951, 2009.
• Timmins J, Ozcan L, Seimon TA, Li G, Malagelada C, Backs J, Backs T, Bassel-Duby R, Olson EN, Anderson ME, and Tabas I. Calcium/calmodulin-dependent protein kinase II links endoplasmic reticulum stress with Fas and mitochondrial apoptosis pathways.J. Clin. Invest. 119(10):2925-2941, 2009.
• Chen B, Wu Y, Mohler PJ, Anderson ME, Song L-S. Local control of Ca2+-induced Ca2+ release in mouse sinoatrial node cells. J. Mol. Cell. Cardiol. 47(5):706-715, 2009.
• Kline CF, Kurata HT, Hund TJ, Cunha SR, Koval OM, Wright PJ, Christensen M, Anderson ME, Nichols CG, Mohler PJ. Dual Role of K ATP channel C-terminal motif in membrane targeting and metabolic regulation. Proc. Natl. Acad. Sci. 106 (39):16669-74, 2009.
• Christensen MD, Dun W, Boyden PA, Anderson ME, Mohler PJ, and Hund TJ. Oxidized calmodulin kinase II regulates conduction following myocardial infarction: A computational analysis. PLoS Comput Biol. 2009. (Accepted).

2008
•Erickson JR, Anderson ME. CaMKII and its role in cardiac arrhythmia. JCardiovasc Electrophysiol. 2008 Dec;19(12):1332-6. Epub 2008 Sep 17. PubMed PMID:18803570.
•Thiel WH, Chen B, Hund TJ, Koval OM, Purohit A, Song LS, Mohler PJ, Anderson ME. Proarrhythmic defects in Timothy syndrome require calmodulin kinase II. Circulation. 2008 Nov 25;118(22):2225-34. Epub 2008 Nov 10. PubMed PMID:19001023.
•Le Scouarnec S, Bhasin N, Vieyres C, Hund TJ, Cunha SR, Koval O, Marionneau C, Chen B, Wu Y, Demolombe S, Song LS, Le Marec H, Probst V, Schott JJ, Anderson ME, Mohler PJ. Dysfunction in ankyrin-B-dependent ion channel and transporter targeting causes human sinus node disease. Proc Natl Acad Sci U S A. 2008 Oct7;105(40):15617-22. Epub 2008 Oct 1. PubMed PMID: 18832177; PubMed Central PMCID: PMC2563133.
•Couchonnal LF, Anderson ME. The role of calmodulin kinase II in myocardial physiology and disease. Physiology (Bethesda). 2008 Jun;23:151-9. Review. PubMed PMID: 18556468.
•Erickson JR, Joiner ML, Guan X, Kutschke W, Yang J, Oddis CV, Bartlett RK, Lowe JS, O’Donnell SE, Aykin-Burns N, Zimmerman MC, Zimmerman K, Ham AJ, Weiss RM, Spitz DR, Shea MA, Colbran RJ, Mohler PJ, Anderson ME. A dynamic pathway for calcium-independent activation of CaMKII by methionine oxidation. Cell. 2008 May 2;133(3):462-74. PubMed PMID: 18455987; PubMed Central PMCID: PMC2435269.
•Werdich AA, Lima EA, Dzhura I, Singh MV, Li J, Anderson ME, Baudenbacher FJ. Differential effects of phospholamban and Ca2+/calmodulin-dependent kinase II on [Ca2+]i transients in cardiac myocytes at physiological stimulation frequencies. Am J Physiol Heart Circ Physiol. 2008 May;294(5):H2352-62. Epub 2008 Mar 21. PubMed PMID: 18359893.
•Mohler PJ, Anderson ME. New insights into genetic causes of sinus node disease and atrial fibrillation. J Cardiovasc Electrophysiol. 2008 May;19(5):516-8. Epub 2008 Feb 21. PubMed PMID: 18298510.
•Grueter CE, Abiria SA, Wu Y, Anderson ME, Colbran RJ. Differential regulated interactions of calcium/calmodulin-dependent protein kinase II with isoforms of voltage-gated calcium channel beta subunits. Biochemistry. 2008 Feb12;47(6):1760-7. Epub 2008 Jan 19.
PubMed PMID: 18205403; PubMed Central PMCID: PMC2814322.
•Khoo MS, Grueter CE, Eren M, Yang J, Zhang R, Bass MA, Lwin ST, Mendes LA, Vaughan DE, Colbran RJ, Anderson ME. Calmodulin kinase II inhibition disrupts cardiomyopathic effects of enhanced green fluorescent protein. J Mol Cell Cardiol. 2008 Feb;44(2):405-10.
Epub 2007 Nov 28. PubMed PMID: 18048055; PubMed Central PMCID: PMC2695824.
•Lowe JS, Palygin O, Bhasin N, Hund TJ, Boyden PA, Shibata E, Anderson ME, Mohler PJ. Voltage-gated Nav channel targeting in the heart requires an ankyrin-G dependent cellular pathway. J Cell Biol. 2008 Jan 14;180(1):173-86. Epub 2008 Jan7. PubMed PMID: 18180363; PubMed Central PMCID: PMC2213608.

2007
•Khoo MS, Grueter CE, Eren M, Yang J, Zhang R, Bass MA, Lwin ST, Mendes LA, Vaughan DE, Colbran RJ, Anderson ME. Calmodulin kinase II inhibition disrupts cardiomyopathic effects of enhanced green fluorescent protein. J Mol Cell Cardiol. 2008 Feb;44(2):405-10.
Epub 2007 Nov 28. PubMed PMID: 18048055; PubMed Central PMCID: PMC2695824.
•Li J, Marionneau C, Koval O, Zingman L, Mohler PJ, Nerbonne JM, Anderson ME. Calmodulin kinase II inhibition enhances ischemic preconditioning by augmenting ATP-sensitive K+ current. Channels (Austin). 2007 Sep-Oct;1(5):387-94. Epub 2007 Dec 17. PubMed PMID: 18690039.
•Werdich AA, Baudenbacher F, Dzhura I, Jeyakumar LH, Kannankeril PJ, Fleischer S, LeGrone A, Milatovic D, Aschner M, Strauss AW, Anderson ME, Exil VJ. Polymorphic ventricular tachycardia and abnormal Ca2+ handling in very-long-chain acyl-CoA dehydrogenase null mice. Am J Physiol Heart Circ Physiol. 2007
May;292(5):H2202-11. Epub 2007 Jan 5. PubMed PMID: 17209005. Anderson ME, Mohler PJ. MicroRNA may have macro effect on sudden death. Nat Med. 2007 Apr;13(4):410-1. PubMed PMID: 17415373.
•Anderson ME. Multiple downstream proarrhythmic targets for calmodulin kinase II: moving beyond an ion channel-centric focus. Cardiovasc Res. 2007 Mar 1;73(4):657-66. Epub 2006 Dec 12. Review. PubMed PMID: 17254559.
•Grimm M, El-Armouche A, Zhang R, Anderson ME, Eschenhagen T. Reduced contractile response to alpha1-adrenergic stimulation in atria from mice with chronic cardiac calmodulin kinase II inhibition. J Mol Cell Cardiol. 2007 Mar;42(3):643-52. Epub 2006 Dec 28. PubMed PMID: 17292391.
•Grueter CE, Colbran RJ, Anderson ME. CaMKII, an emerging molecular driver for calcium homeostasis, arrhythmias, and cardiac dysfunction. J Mol Med. 2007 Jan;85(1):5-14. Epub 2006 Nov 21. Review. PubMed PMID: 17119905.

2006
• Wu Y, Shintani A, Greuter C, Zhang R, Yang J, Kranias EG, Colbran RJ, Anderson ME. Calmodulin kinase II determines dynamic Ca2+ responses in heart. J Mol Cell Cardiol 2006; 40:213-23.
• Yang Y, Zhu WZ, Joiner M-L, Zhang R, Oddis CV, Hou Y, Yang J, Price EE jr, Gleaves L, Erin M, Ni G, Vaughn DE, Xiao R-P, Anderson ME. Calmodulin kinase inhibition protects against myocardial apoptosis in vivo. Am J Physiol 2006; 291:H3065-H3075.
•Kannankeril PJ, Mitchell BM, Goonasekera SA, Chelu MG, Zhang W, Sood S, Kearney DL, Danila CI, De Biasi M, Pautler RG, Roden DM, Taffet GE, Dirksen RT, Anderson ME, Hamilton SL. Mice with the R176Q cardiac ryanodine receptor mutation exhibit catecholamine-induced ventricular tachycardia and mild cardiomyopathy. Proc Natl Acad Sci 2006; 103:12179-12184.
• Khoo MSC, Zhang R, Ni G, Greuter C, Yang Y, Zhang W, Mendes L, Olson EN, Colbran RJ, Anderson ME. Death, cardiac dysfunction and arrhythmias due to up-regulation of calmodulin kinase II in calcineurin-induced cardiomyopathy. Circulation 2006; 114:1352-1359. Published with an accompanying editorial.
• Grueter CE, Abiria SA, Dzhura I, Wu Y, Hamm A-J, Mohler PJ, Anderson ME, Colbran RJ. Molecular basis for facilitation of native Ca2+ channels by CaMKII. Mol Cell 2006; 23:641-650. Selected as a recommended citation by the Faculty of 1000 Biology.
• Li J, Shah V, Hell J, Nerbonne JM, Anderson ME. Calmodulin kinase II inhibition shortens action potential duration by up-regulation of K+ currents. Circ Res 2006; 99:1092-1099. PMID: 17038644. Published with an accompanying editorial.
•Anderson ME, Higgins, LS, Schulman H. Disease mechanisms and emerging therapies: Protein kinases and their inhibitors in myocardial disease. Nature Clin Prac 2006; 3:437-445.

III. Therapeutic Implications of Pharmacological Agents for Cardiac  Contractility Dysfunction: “The Fire From Within The Biggest Ca2+ Channel Erupts and Dribbles” by Anderson, ME

Author: Justin D Pearlman, MD, PhD, FACC PENDING – 

Therapeutic Implications of these physiological research discoveries

JDP: RECOMMEND SPLIT TO TWO: a. contractility b. arrhythmia

IV. Selective Research Contributions on Calcium Release-related Contractile Dysfunction

Curator: Aviva Lev-Ari, PhD, RN

Summary

Author: Justin D Pearlman, MD, PhD, FACC

PENDING

Author: Larry H Bernstein, MD, FCAP

 PENDING

V. Bibliography on Calcium Release Mechanisms in Vascular Smooth Muscle, in Cardiomyocytes and the Role in Heart Failure

Curator: Aviva Lev-Ari, PhD, RN

  • Anderson ME, General Hospital Iowa City and University of Iowa
  • Wilson S. Colucci, MD, Heart Failure Lab at BMC
  • William Gregory Stevenson, M.D. Heart Failure Lab at BWH

Introduction to Calcium Release Mechanism in Vascular Smooth Muscle and in Cardiomyocytes

Author: Justin D Pearlman, MD, PhD, FACC
PENDING

I. Cellular Contractility Capacity — Actin, Cellular Dynamics and Calcium Efflux: Emergence of  the Calcium Release-related Contractile Dysfunction

Author: Justin D Pearlman, MD, PhD, FACC

The pumping action of the heart is mediated by repeated cycles of the release and re-uptake of calcium stored within cardiac myocytes. Similar to skeletal muscle function, the protein complex of actinomycin creates mechanical motion when calcium interacts with the threads of the protein strand tropomyosin which are wound around an actin protein filament  with the third protein troponin strung out like beads along the string. Calcium (Ca++) released from the storage space (sarcoplasmic reticulum) combines with troponin to actuate a shift in the tropomyosin threads, exposing myosin binding sites to adenosinetriphosphate (ATP, the energy source), which, in turn, consume the high-energy bond of ATP and concommitantly break and make cross-bridges resulting in shifted position (filament sliding, contraction). The spiral layers of these filaments within the heart result in a reduction of chamber size. Normally the two atrial chambers contract first, to boost the load of blood in the ventricles, then the ventricles contract, relying on one-way valves to impose a forward direction to the blood ejected from the heart.
Calcium and Myosin in Muscle Contraction
There is barely enough ATP around to complete a single heart beat, so ATP is replenished from a higher energy storage form, phosphocreatine (PCr, aka creatinephosphate), which in turn in reconstituted during the relaxation phase of the heart (low pressure) when oxygenated blood, glucose, and fatty acids are delivered to local mitochondria to restock energy stores. Thus the contraction cycle, unlike a continual pump, provides low pressure respite after each high pressure contraction, which facilitates delivery of oxygenated nutrient blood to the heart muscle to replenish its energy for the action. When switching to a mechanical total heart replacement, it is not necessary to preserve the pulsatile pattern, which primarily serves to facilitate energizing the biologic pump.
The volume of blood ejected by the left ventricle from a single heart beat is called the stroke volume (SV). The amount of blood in the left ventricle just before the heart beat is called the end-diastolic volume (EDV), and just after, the end-systolic volume (ESV), so SV=EDV-ESV. The portion of the filled left ventricle that gets pumped forward through the aortic valve by a single heart beat is called the ejection fraction (EF). Thus EF = SV/EDV, expressed as a percentage. The cardiac output (CO) in liters/minute is simply the product of stroke volume and heart rate (HR): CO = SV x HR.
Heart failure has three clinical forms: high output failure, systolic failure and diastolic heart failure. With high output failure (elevated SV x HR), the demands of the body are elevated beyond the normal capacity of the heart to supply cardiac output. With systolic failure (low EF) the pumping action of the heart is insufficient to meet the needs of fresh blood delivery to the various organs of the body (including in particular the heart, brain, liver, and kidneys). Note that the heart does not draw any significant nutrients or oxygen from the blood in its chambers – rather, it is first in line after the oxygenated blood is pumped out through the aortic valve to tax 10% of the cardiac output via the coronary arteries. In diastolic failure, the LV resists filling (stiff LV) so the back pressure to the lungs is elevated, resulting in pulmonary congestion. Many textbooks incorrectly describe diastolic heart failure as heart failure with a normal EF; however, that would imply that diastolic heart failure (stiff LV) can be “cured” by a myocardial infarction (heart attack) so that the EF drops. Contrary to that mistaken description, the addition of reduced EF to a patient with diastolic heart failure results in combined systolic and diastolic heart failure. Inadequate delivery of blood from low EF has been called “forward failure” and pulmonary congestion from a stiff LV “backward failure” but those terms are not synonymous with systolic and diastolic failure, as low EF also contributes to congestive heart failure, and stiff LV can impede adequate filling, so each has components for forward and backward failure.
One can plot a curve relating stroke volume to the end diastolic volume, called the “Frank-Starling curve” whereby an increase in EDV is generally accommodated by an increase in SV.  That adaptive feature is achieved by a stimulation of calcium-mediated increase in contractility (speed and strength of contraction) .  In heart failure, the usual amounts of calcium stores are not adequate to meet the demands. Consequently, remodeling occurs, which includes reversion towards a fetal phenotype in which the sarcoplasmic reticulum stores and releases a greater amount of calcium. While this does result in some augmentation of contractility, it occurs at a cost. The higher levels of calcium can interfere with mitochondrial function and reduce the energy efficiency of oxygen replenishment of phosphocreatine and ATP. In research by the author of this section (JDP), the timing of oxygen uptake and utilization is adversely affected by this remodeling, as demonstrated by oxygen uptake sensitive dynamic cardiac MRI.
Thus strategies to genetically re-engineer cardiac function by modifying calcium uptake and release to elevate contractility at a given workload have potentially harmful consequences in terms of lowering the energy efficiency of the heart. If the blood supply of the heart is good (non-ischemic heart failure), one can expect opportunities for benefit. However, if the blood supply to the heart is limited (ischemic heart failure), such changes may be detrimental. Furthermore, the impediments to mitochondrial function may contribute to other adverse effects of remodeling, including in particular activation of fibrosis (adverse remodeling promoting worsened diastolic failure).

II. Integration and Interpretation of Research Results in Two Labs: Mark E Anderson’s and Roger Hajjar’s Lab

Author: Justin D Pearlman, MD, PhD, FACC

PENDING

 

III. Therapeutic Implications of Pharmacological Agents for Cardiac Contractility Dysfunction: “The Fire From Within The Biggest Ca2+ Channel Erupts and Dribbles” by Anderson, ME

Treatment Selection

Author: Justin D Pearlman, MD, PhD, FACC

PENDING

Positive inotropic agents

Positive inotropic agents increase myocardial contractility, and are used to support cardiac function in conditions such as decompensated congestive heart failure, cardiogenic shock, septic shock, myocardial infarction,cardiomyopathy, etc. Examples of positive inotropic agents include:

Negative inotropic agents

Negative inotropic agents decrease myocardial contractility, and are used to decrease cardiac workload in conditions such as angina. While negative inotropism may precipitate or exacerbate heart failure, certain beta blockers (e.g. carvedilol, bisoprolol and metoprolol) have been believed to reduce morbidity and mortality in congestive heart failure. Quite recently, however, the effectiveness of beta blockers has come under renewed critical scientific scrutiny.

Class IA antiarrhythmics such as

Class IC antiarrhythmics such as

and

Therapeutic Implications

1. Arrhythmias

2. Heart Failure

Author: Justin D Pearlman, MD, PhD, FACC

 PENDING

Therapeutic Implications

Author: Larry H Bernstein, MD, FCAP

The above list of inotropic agents consists of agents developed to increase the contractile force of the heart and have had a long history of use.  Even though they have been proved valid, they are not part of the specific advances that we are seeing that justifies a cardiology specialty in cardiac electrophysiology, the disorders, and the treatments.  The developments we now witness were unknown and perhaps unexpected a quarter of a century ago.  The methods required to understand the myocardiocyte were not yet developed.  Our understanding is now based on a refined knowledge of the Ca(2+) release mechanism between the sarcomere and the myocyte cytoplasm, the Ca(2+) transport, the ion pores, the role of RyR2 and the phosphorylation of the Ca(2+) release mechanism.  This and more will lead to far better therapeutic advances in the next few years based on earlier detection of changes preceding heart failure, and the possibility of treatments for potential life-threatening arrhythmias will be averted.  

 

IV. Selective Research Contributions on Calcium Release-related Contractile Dysfunction

Curator: Aviva Lev-Ari, PhD, RN

Heart Fail Monit. 2001;1(4):122-5.

Ischemic versus non-ischemic heart failure: should the etiology be determined?

Source

Department of Medicine, University Hospital Zurich, Switzerland.

Abstract

In epidemiological surveys and in large-scale therapeutic trials, the prognosis of patients with ischemic heart failure is worse than in patients with a non-ischemic etiology. Even heart transplant candidates may respond better to intensified therapy if they have non-ischemic heart failure. The term ‘non-ischemic heart failure’ includes various subgroups such as hypertensive heart disease, myocarditis, alcoholic cardiomyopathy and cardiac dysfunction due to rapid atrial fibrillation. Some of these causes are reversible. The therapeutic effect of essential drugs such as angiotensin-converting enzyme inhibitors, beta-blockers and diuretics does not, in general, significantly differ between ischemic and non-ischemic heart failure. However, in some trials, response to certain drugs (digoxin, tumor necrosis factor-alpha, inhibition with pentoxifylline, growth hormone and amiodarone) was found to be better in non-ischemic patients. Patients with ischemic heart failure and non-contracting ischemic viable myocardium may, on the other hand, considerably improve following revascularization. In view of prognostic and possible therapeutic differences, the etiology of heart failure should be determined routinely in all patients. http://www.ncbi.nlm.nih.gov/pubmed/12634896

Upregulation of β3-Adrenoceptors and Altered Contractile Response to Inotropic Amines in Human Failing Myocardium

  1. Stéphane Moniotte, MD;
  2. Lester Kobzik, MD;
  3. Olivier Feron, PhD;
  4. Jean-Noël Trochu, MD;
  5. Chantal Gauthier, PhD;
  6. Jean-Luc Balligand, MD, PhD

+Author Affiliations


  1. From the Department of Medicine, Unit of Pharmacology and Therapeutics, University of Louvain Medical School (S.M., O.F., J.-L.B.), Brussels, Belgium; INSERM U533, Physiopathologie et Pharmacologie Cellulaires et Moléculaires (J.-N.T., C.G.) and Faculté des Sciences et Techniques (C.G.), Nantes, France; and Department of Pathology, Brigham and Women’s Hospital, and Physiology Program, Harvard School of Public Health (L.K.), Boston, Mass.
  1. Correspondence to Jean-Luc Balligand, Department of Medicine, Unit of Pharmacology and Therapeutics, FATH 5349, University of Louvain Medical School, 53 avenue Mounier, B1200 Brussels, Belgium, e-mail Balligand@mint.ucl.ac.be; or Chantal Gauthier, INSERM U533, Physiopathologie et Pharmacologie Cellulaires et Moléculaires, 44093 Nantes, France,

Abstract

Background—Contrary to β1– and β2-adrenoceptors, β3-adrenoceptors mediate a negative inotropic effect in human ventricular muscle. To assess their functional role in heart failure, our purpose was to compare the expression and contractile effect of β3-adrenoceptors in nonfailing and failing human hearts.

Methods and Results—We analyzed left ventricular samples from 29 failing (16 ischemic and 13 dilated cardiomyopathic) hearts (ejection fraction 18.6±2%) and 25 nonfailing (including 12 innervated) explanted hearts (ejection fraction 64.2±3%). β3-Adrenoceptor proteins were identified by immunohistochemistry in ventricular cardiomyocytes from nonfailing and failing hearts. Contrary to β1-adrenoceptor mRNA, Western blot analysis of β3-adrenoceptor proteins showed a 2- to 3-fold increase in failing compared with nonfailing hearts. A similar increase was observed for Gαi-2 proteins that couple β3-adrenoceptors to their negative inotropic effect. Contractile tension was measured in electrically stimulated myocardial samples ex vivo. In failing hearts, the positive inotropic effect of the nonspecific amine isoprenaline was reduced by 75% compared with that observed in nonfailing hearts. By contrast, the negative inotropic effect of β3-preferential agonists was only mildly reduced.

Conclusions—Opposite changes occur in β1– and β3-adrenoceptor abundance in the failing left ventricle, with an imbalance between their inotropic influences that may underlie the functional degradation of the human failing heart.

Key Words:

http://circ.ahajournals.org/content/103/12/1649.short

Increased beta-receptor density and improved hemodynamic response to catecholamine stimulation during long-term metoprolol therapy in heart failure from dilated cardiomyopathy.

  1. S M Heilbrunn;
  2. P Shah;
  3. M R Bristow;
  4. H A Valantine;
  5. R Ginsburg;
  6. M B Fowler

+Author Affiliations


  1. Cardiology Division, Stanford University School of Medicine, CA.
Abstract

Severe heart failure is associated with a reduction in myocardial beta-adrenergic receptor density and an impaired contractile response to catecholamine stimulation. Metoprolol was administered during a 6-month period to 14 patients with dilated cardiomyopathy to examine its effects on these abnormalities. The mean daily dose of metoprolol for the group was 105 mg (range, 75-150 mg). Myocardial beta-receptor density, resting hemodynamic output, and peak left ventricular dP/dt response to dobutamine infusions were compared in 9, 14, and 7 patients, respectively, before and after 6 months of metoprolol therapy while the patients were on therapy. The second hemodynamic study was performed 1-2 hours after the morning dose of metoprolol had been given. Myocardial beta-receptor density increased from 39 +/- 7 to 80 +/- 12 fmol/mg (p less than 0.05). Resting hemodynamic output showed a rise in stroke work index from 27 +/- 4 to 43 +/- 3 g/m/m2, p less than 0.05, and ejection fraction rose from 0.26 +/- 0.03 to 0.39 +/- 0.03 after 6 months of metoprolol therapy, p less than 0.05. Before metoprolol therapy, dobutamine caused a 21 +/- 4% increase in peak positive left ventricular dP/dt; during metoprolol therapy, the same dobutamine infusion rate increased peak positive dP/dt by 74 +/- 18% (p less than 0.05). Thus, long-term metoprolol therapy is associated with an increase in myocardial beta-receptor density, significant improvement in resting hemodynamic output, and improved contractile response to catecholamine stimulation. These changes indicate a restoration of beta-adrenergic sensitivity associated with metoprolol therapy, possibly related to the observed up-regulation of beta-adrenergic receptors.

http://circ.ahajournals.org/content/79/3/483.short

Ryanopathy: causes and manifestations of RyR2 dysfunction in heart failure

Belevych AE, Radwański PB, Carnes CA, Györke S. College of Medicine, The Ohio State University, Columbus, OH. Cardiovasc Res. 2013; 98(2):240-7. doi: 10.1093/cvr/cvt024. Epub 2013 Feb 12. PMID: 23408344 PMCID: PMC3633158 [Available on 2014/5/1] The cardiac ryanodine receptor (RyR2), a Ca(2+) release channel on the membrane of the sarcoplasmic reticulum (SR), plays a key role in determining the strength of the heartbeat by supplying Ca(2+) required for contractile activation. Abnormal RyR2 function is recognized as an important part of the pathophysiology of heart failure (HF). While in the normal heart, the balance between the cytosolic and intra-SR Ca(2+) regulation of RyR2 function maintains the contraction-relaxation cycle, in HF, this behaviour is compromised by excessive post-translational modifications of the RyR2. Such modification of the Ca(2+) release channel impairs the ability of the RyR2 to properly deactivate leading to a spectrum of Ca(2+)-dependent pathologies that include cardiac systolic and diastolic dysfunction, arrhythmias, and structural remodeling. In this article, we present an overview of recent advances in our understanding of the underlying causes and pathological consequences of abnormal RyR2 function in the failing heart. We also discuss the implications of these findings for HF therapy.

Circ Res. 2005 Dec 9;97(12):1314-22. Epub 2005 Nov 3.

Ca2+/calmodulin-dependent protein kinase modulates cardiac ryanodine receptor phosphorylation and sarcoplasmic reticulum Ca2+ leak in heart failure.

Source

Department of Medicine, University of Illinois at Chicago, IL 60612, USA.

Abstract

Abnormal release of Ca from sarcoplasmic reticulum (SR) via the cardiac ryanodine receptor (RyR2) may contribute to contractile dysfunction and arrhythmogenesis in heart failure (HF). We previously demonstrated decreased Ca transient amplitude and SR Ca load associated with increased Na/Ca exchanger expression and enhanced diastolic SR Ca leak in an arrhythmogenic rabbit model of nonischemic HF. Here we assessed expression and phosphorylation status of key Ca handling proteins and measured SR Ca leak in control and HF rabbit myocytes. With HF, expression of RyR2 and FK-506 binding protein 12.6 (FKBP12.6) were reduced, whereas inositol trisphosphate receptor (type 2) and Ca/calmodulin-dependent protein kinase II (CaMKII) expression were increased 50% to 100%. The RyR2 complex included more CaMKII (which was more activated) but less calmodulin, FKBP12.6, and phosphatases 1 and 2A. The RyR2 was more highly phosphorylated by both protein kinase A (PKA) and CaMKII. Total phospholamban phosphorylation was unaltered, although it was reduced at the PKA site and increased at the CaMKII site. SR Ca leak in intact HF myocytes (which is higher than in control) was reduced by inhibition of CaMKII but was unaltered by PKA inhibition. CaMKII inhibition also increased SR Ca content in HF myocytes. Our results suggest that CaMKII-dependent phosphorylation of RyR2 is involved in enhanced SR diastolic Ca leak and reduced SR Ca load in HF, and may thus contribute to arrhythmias and contractile dysfunction in HF.

Editorial Comment on the above article abstract made by Anderson, ME

http://www.ncbi.nlm.nih.gov/pubmed/16269653

The Fire From Within – The Biggest Ca2+ Channel Erupts and Dribbles

  1. Mark E. Anderson

+Author Affiliations


  1. From the University of Iowa, Carver College of Medicine, Iowa City.
  1. Correspondence to Mark E. Anderson, MD, PhD, University of Iowa, Carver College ofMedicine, 200 Hawkins Drive, Room E 315 GH, Iowa City, IA 53342-1081. E-mail mark-e-anderson@uiowa.edu

Key Words:

See related article, pages 1314–1322

CaMKII Is a Pluripotent Signaling Molecule in Heart

The multifunctional Ca2+ and calmodulin (CaM)-dependent protein kinase II (CaMKII) is a serine threonine kinase that is abundant in heart where it phosphorylates Ca2+ihomeostatic proteins. It seems likely that CaMKII plays an important role in cardiac physiology because these target proteins significantly overlap with the more extensively studied serine threonine kinase, protein kinase A (PKA), which is a key arbiter of catecholamine responses in heart. However, the physiological functions of CaMKII remain poorly understood, whereas the potential role of CaMKII in signaling myocardial dysfunction and arrhythmias has become an area of intense focus. CaMKII activity and expression are upregulated in failing human hearts and in many animal models of structural heart disease.1 CaMKII inhibitory drugs can prevent cardiac arrhythmias2,3 and suppress afterdepolarizations4 that are a probable proximate focal cause of arrhythmias in heart failure. CaMKII inhibition in mice reduces left ventricular dilation and prevents disordered intracellular Ca2+ (Ca2+i) homeostasis after myocardial infarction.5 CaMKII overexpression in mouse heart causes severe cardiac hypertrophy, dysfunction, and sudden death that is heralded by increased SR Ca2+ leak6; these findings go a long way to making a case for CaMKII as a causative signal in heart disease and arrhythmias but do not identify critical molecular targets or test the potential role of CaMKII in a large non-rodent animal model. The work by Ai et al in this issue of Circulation Research makes an important contribution by demonstrating CaMKII upregulation causes increased Ca2+ leak from ryanodine receptor (RyR) Ca2+ release channels in a clinically-relevant model of structural heart disease.7

Ryanodine Receptors Are Central

Ca2+i release controls cardiac contraction, and most of the Ca2+i for contraction is released from the intracellular sarcoplasmic reticulum (SR) through ryanodine receptors (RyR). RyRs are huge proteins (565 kDa) that assemble with a fourfold symmetry to form a functional Ca2+ release channel. Approximately 90% of the RyR is not directly required to form the pore but instead protrudes into the cytoplasm where it binds numerous proteins, including PKA, CaMKII, CaM, and FK12.6 (calstabin). Cardiac contraction is initiated when Ca2+ current (ICa), through sarcolemmal L-type Ca2+ channels (LTCC), triggers RyR opening by a Ca2+-induced Ca2+ release (CICR) mechanism. LTCCs “face off” with RyRs across a highly ordered cytoplasmic cleft that delineates a kind of Ca2+furnace during each CICR-initiated heart beat (Figure). CICR has an obvious need to function reliably, so it is astounding to consider how this feed forward process is intrinsically unstable. The increased instability of CICR in heart failure is directly relevant to arrhythmias initiated by afterdepolarizations. RyRs partly rely on a collaboration of Ca2+-sensing proteins in the SR lumen to grade their opening probability and the amount of SR Ca2+ release to a given ICa stimulus. Thus the SR Ca2+ content is an important parameter for setting the inotropic state, and heart failure is generally a condition of reduced SR Ca2+ content and diminished myocardial contraction.

Ca2+-induced Ca2+ release (CICR) in health and disease. Each heart beat is initiated by cell membrane depolarization that opens Ca2+channels. The Ca2+ current (ICa) induces ryanodine receptor (RyR) opening that allows release of myofilament activating Ca2+ for contraction. In healthy CICR, RyRs close during diastole while Ca2+ is removed from the cytoplasm by uptake into the sarcoplasmic reticulum (SR). In heart failure the SR has reduced Ca2+ content so that the amount of Ca2+ released to the myofilaments is smaller than in health. RyR hyperphosphorylation by CaMKII promotes repetitive RyR openings leading to a Ca2+ leak in diastole. This leak contributes to the reduction in SR Ca2+ content and can engage the electrogenic Na+-Ca2+ exchanger to trigger afterdepolarizations and arrhythmias.

Kinases Facilitate Communication Between LTCCs and RyRs

LTCCs and RyRs form the protein machinery for initiating contraction in cardiac and skeletal muscle, but in cardiac muscle communication between these proteins occurs without a requirement for physical contact. PKA is preassociated with LTCCs and RyRs, and PKA-dependent phosphorylation increases LTCC8 and RyR9opening. The resultant increase in Ca2+i is an important reason for the positive inotropic response to cathecholamines. The multifunctional Ca2+/calmodulin-dependent protein kinase II (CaMKII) is activated by increased Ca2+I, and so catecholamine stimulation activates CaMKII in addition to PKA.5 In contrast to PKA, which is tightly linked to inotropy, CaMKII inhibition does not cause a reduction in fractional shortening during acute catecholamine stimulation in mice.5 Prolonged catecholamine exposure does reduce contractile function by uncertain mechanisms that require CaMKII.10 CaMKII colocalizes with LTCCs11 and RyRs,12 and CaMKII can also increase LTCC13 and RyR12 opening probability in cardiac myocytes. The ultrastructural environment of LTCCs and RyRs is well-suited for a Ca2+i-responsive kinase to serve as a coordinating signal between LTCCs and RyRs during CICR. The recently identified role of CaMKII in heart failure suggests the possibility that excessive CaMKII activity could cause or contribute to CICR defects present in heart failure

Heart Failure Is a Disease of Disordered Ca2+i Homeostasis

The key clinical phenotypes of contractile dysfunction and electrical instability in heart failure involve problems with Ca2+i homeostasis. Broad changes in Ca2+I-handling proteins can occur in various heart failure models, but in general heart failure is marked by a reduction in the capacity for SR Ca2+ uptake, enhanced activity of the sarcolemmal Na+-Ca2+ exchanger, and reduction in CICR-coordinated SR Ca2+ release. On the other hand, the opening probability of individual LTCCs is increased in human heart failure,14suggesting that posttranslational modifications may also be mechanistically important for understanding these Ca2+i disturbances at Ca2+ homeostatic proteins.

Is Heart Failure a Disease of Enzymatic Over-Activity?

Heart failure is marked by hyper-adrenergic tone, and beta adrenergic receptor antagonist drugs (beta blockers) are a mainstay of therapy for reducing mortality in heart failure patients. The Marks group pioneered the concept that RyRs are hyperphosphorylated by PKA in patients with heart failure and showed that successful therapies, ranging from beta blockers to left ventricular assist devices, reduce RyR phosphorylation in step with improved mechanical function. They have developed a large body of evidence in patients and in animal models that PKA phosphorylation of Ser2809 on cardiac RyRs destabilizes binding of FK12.6 to RyRs and promotes increased RyR opening that causes an insidious Ca2+ leak. This leak is potentially problematic because it can reduce SR Ca2+ content (to depress inotropy), engage pathological Ca2+-dependent transcriptional programs (to promote myocyte hypertrophy), and activate arrhythmia-initiating afterdepolarizations (to cause sudden death). Indeed, RyR hyperphosphorylation can produce arrhythmias as well as mechanical dysfunction, whereas a drug that prevents FK12.6 dissociation from RyR also reduces or prevents arrhythmias.15 Taken together these findings make a strong case that RyR hyperphosphorylation (a result of net excess kinase activity) is a central event in heart failure and sudden death.

Not all findings point to hyperphosphorylation of RyR by PKA and subsequent FK12.6 dissociation as critical determinants of heart failure16 and arrhythmias.17 For example, studies in isolated and permeabilized ventricular myocytes failed to show an increase in RyR openings, called sparks, which are monitored by photoemission of a Ca2+-sensitive fluorescent dye.18 FKBP12.6 dissociation is not universally reported to follow RyR phosphorylation by PKA.19 Furthermore, FKBP12.6 binding to RyR is not affected during catecholamine stimulation that results in arrhythmias in a mouse model of catecholamine-induced ventricular tachycardia,20,21 a genetic disorder of hypersensitive RyR Ca2+release. These findings challenge the PKA hypothesis and make room, conceptually, to consider the role of additional signals for modulating RyR activity in heart disease.

Both PKA and CaMKII may phosphorylate Ser2809, but recently CaMKII was found to exclusively phosphorylate Ser2815 and this phosphorylation caused increased RyR opening.12 However, the PKA and CaMKII responses may be mechanistically distinct because CaMKII evoked increased RyR opening in the absence of FK12.6 dissociation. These findings together with the fact that CaMKII activity is recruited under conditions of increased PKA activity suggest that CaMKII might also be important in regulating RyRs in heart failure.

The article by Ai et al shows that expression of a CaMKII splice variant that is resident in cytoplasm (CaMKIIδc) was increased, and there was enhanced phosphorylation of the recently identified CaMKII site (Ser2815) on RyR. Both Ser2815 and the PKA site (Ser2809) were hyperphosphorylated in failing hearts, but phosphorylation of the CaMKII site was greater than the PKA site. Because both Ser2809 and Ser2815 can increase RyR openings, it seemed likely that PKA and CaMKII would work together to increase Ca2+leak. Surprisingly, CaMKII inhibition but not PKA inhibition suppressed the leak. These experiments were performed with meticulous attention to matching SR Ca2+ load, a technically difficult accomplishment that is not performed by most groups evaluating SR Ca2+ release. Thus, differences in the SR intraluminal Ca2+ could not account for these findings. Although these experiments were carefully controlled, one potential limitation is that the experiments relied exclusively on CaMKII and PKA inhibitor drugs that are notorious for nonspecific actions at ion channel proteins. They also showed that the ratio of inositol tris phosphate receptors (IP3R) to RyRs was increased in failing left ventricular myocytes. IP3R are important for regulating Ca2+i in many cells types, including atrial myocytes, but their role in ventricle remains uncertain. The finding that the IP3R are increased at the expense of RyR suggests that Ca2+i release sites are fundamentally reordered in heart failure but leaves the impact of this change untested. IP3R are also a target for CaMKII, so interesting questions remain about the potential role for this channel and CaMKII in heart failure, at least in this model.

What We Learned and What We Need to Know

CaMKII activity seems to be part and parcel of the adrenergic signaling seen in structural heart disease. This work shows us that CaMKII can contribute directly to increased SR Ca2+ leak in a clinically relevant model of heart failure that is marked by arrhythmias and sudden death.22 Acute experiments with CaMKII inhibitory drugs strongly suggest that SR Ca2+ leak is principally linked to CaMKII rather than PKA activity. Excessive SR Ca2+ release can activate inward (forward mode) Na+-Ca2+ exchanger current to cause delayed afterdepolarizations and arrhythmias and CaMKII inhibition can prevent these inward Na+-Ca2+ exchanger currents.23 An important next step toward translating these findings will be to evaluate the effects of chronic CaMKII inhibition in this model to see whether it reverses cardiac dysfunction, arrhythmias, and whether chronic CaMKII inhibitor therapy can stop the RyR leak to refill the SR. It will be necessary to have improved pharmacological agents with fewer nonspecific effects to convincingly perform these experiments. These future experiments will tell us whether CaMKII inhibition is a potentially viable therapy for structural heart disease and arrhythmias in a non-genetic non-mouse model. We need to know whether CaMKII inhibition is really a highly-specific form of beta blockade that can preserve inotropic responses to catecholamines while preventing the adverse consequences of catecholamines in heart failure.5

Acknowledgments

This work was supported in part by grants from the National Institutes of Health (HL070250, HL62494, and HL046681). Dr Anderson is an Established Investigator of the American Heart Association.

Footnotes

  • The opinions expressed in this editorial are not necessarily those of the editors or of the American Heart Association

References

  1. ↵
    Zhang T, Brown JH. Role of Ca2+/calmodulin-dependent protein kinase II in cardiac hypertrophy and heart failure. Cardiovasc Res. 2004; 63: 476–486.
  2. ↵
    Mazur A, Roden DM, Anderson ME. Systemic administration of calmodulin antagonist W-7 or protein kinase A inhibitor H-8 prevents torsade de pointes in rabbits. Circulation. 1999; 100: 2437–2442.
  3. ↵
    Wu Y, Temple J, Zhang R, Dzhura I, Zhang W, Trimble RW, Roden DM, Passier R, Olson EN, Colbran RJ, Anderson ME. Calmodulin kinase II and arrhythmias in a mouse model of cardiac hypertrophy. Circulation. 2002; 106: 1288–1293.
  4. ↵
    Anderson ME, Braun AP, Wu Y, Lu T, Schulman H, Sung RJ. KN-93, an inhibitor of multifunctional Ca++/calmodulin-dependent protein kinase, decreases early afterdepolarizations in rabbit heart. J Pharm Exp Ther. 1998; 287: 996–1006.
  5. ↵
    Zhang R, Khoo MS, Wu Y, Yang Y, Grueter CE, Ni G, Price EE, Thiel W, Guatimosim S, Song LS, Madu EC, Shah AN, Vishnivetskaya TA, Atkinson JB, Gurevich VV, Salama G, Lederer WJ, Colbran RJ, Anderson ME. Calmodulin kinase II inhibition protects against structural heart disease. Nature Med. 2005; 11:409–417.
  6. ↵
    Maier LS, Zhang T, Chen L, DeSantiago J, Brown JH, Bers DM. Transgenic CaMKIIdeltaC overexpression uniquely alters cardiac myocyte Ca2+ handling: reduced SR Ca2+ load and activated SR Ca2+ release. Circ Res. 2003; 92: 904–911.
  7. ↵
    Ai X, Curran JW, Shannon TR, Bers DM, Pogwizd SM Ca2+/-calmodulin-dependent protein kinase modulates cardiac RyR2 phosphorylation and SR Ca2+leak in heart failure. Circ Res. 2005; 97: 1314–1322.
  8. ↵
    Yue DT, Herzig S, Marban E. Beta-adrenergic stimulation of calcium channels occurs by potentiation of high-activity gating modes. Proc Nat Acad Sci U S A.1990; 87: 753–757.
  9. ↵
    Marx SO, Reiken S, Hisamatsu Y, Jayaraman T, Burkhoff D, Rosemblit N, Marks AR. PKA phosphorylation dissociates FKBP12.6 from the calcium release channel (ryanodine receptor): Defective regulation in failing hearts. Cell. 2000; 101:365–376.
  10. ↵
    Wang W, Zhu W, Wang S, Yang D, Crow MT, Xiao RP, Cheng H. Sustained beta1-adrenergic stimulation modulates cardiac contractility by Ca2+/calmodulin kinase signaling pathway. Circ Res. 2004; 95: 798–806.
  11. ↵
    Dzhura I, Wu Y, Colbran RJ, Corbin JD, Balser JR, Anderson ME. Cytoskeletal disrupting agents prevent calmodulin kinase, IQ domain and voltage-dependent facilitation of L-type Ca2+ channels. J Physiol. 2002; 545: 399–406.
  12. ↵
    Wehrens XH, Lehnart SE, Reiken SR, Marks AR. Ca2+/calmodulin-dependent protein kinase II phosphorylation regulates the cardiac ryanodine receptor. Circ Res.2004; 94: e61–e70.
  13. ↵
    Dzhura I, Wu Y, Colbran RJ, Balser JR, Anderson ME. Calmodulin kinase determines calcium-dependent facilitation of L-type calcium channels. Nature Cell Biol. 2000; 2: 173–177.
  14. ↵
    Schroder F, Handrock R, Beuckelmann DJ, Hirt S, Hullin R, Priebe L, Schwinger RH, Weil J, Herzig S. Increased availability and open probability of single L-type calcium channels from failing compared with nonfailing human ventricle. Circulation.1998; 98: 969–976.
  15. ↵
    Wehrens XH, Lehnart SE, Reiken SR, Deng SX, Vest JA, Cervantes D, Coromilas J, Landry DW, Marks AR. Protection from cardiac arrhythmia through ryanodine receptor-stabilizing protein calstabin2. Science. 2004; 304: 292–296.
  16. ↵
    Bers DM, Eisner DA, Valdivia HH. Sarcoplasmic reticulum Ca2+ and heart failure: Roles of diastolic leak and Ca2+ transport. Circ Res. 2003; 93: 487–490.
  17. ↵
    Houser SR. Can novel therapies for arrhythmias caused by spontaneous sarcoplasmic reticulum Ca2+ release be developed using mouse models? Circ Res.2005; 96: 1031–1032.
  18. ↵
    Li Y, Kranias EG, Mignery GA, Bers DM. Protein kinase A phosphorylation of the ryanodine receptor does not affect calcium sparks in mouse ventricular myocytes.Circ Res. 2002; 90: 309–316.
  19. ↵
    Xiao B, Sutherland C, Walsh MP, Chen SR. Protein kinase A phosphorylation at serine-2808 of the cardiac Ca2+-release channel (ryanodine receptor) does not dissociate 12.6-kDa FK506-binding protein (FKBP12.6). Circ Res. 2004; 94: 487–495.
  20. ↵
    Cerrone M, Colombi B, Santoro M, di Barletta MR, Scelsi M, Villani L, Napolitano C, Priori SG. Bidirectional ventricular tachycardia and fibrillation elicited in a knock-in mouse model carrier of a mutation in the cardiac ryanodine receptor. Circ Res. 2005;96: e77–e82.
  21. ↵
    George CH, Higgs GV, Lai FA. Ryanodine receptor mutations associated with stress-induced ventricular tachycardia mediate increased calcium release in stimulated cardiomyocytes. Circ Res. 2003; 93: 531–540.
  22. ↵
    Pogwizd SM, Schlotthauer K, Li L, Yuan W, Bers DM. Arrhythmogenesis and contractile dysfunction in heart failure: Roles of sodium-calcium exchange, inward rectifier potassium current, and residual beta-adrenergic responsiveness. Circ Res.2001; 88: 1159–1167.
  23. ↵
    Wu Y, Roden DM, Anderson ME. Calmodulin kinase inhibition prevents development of the arrhythmogenic transient inward current. Circ Res. 1999; 84:906–912.

 SOURCE

Other tightly related articles by Prof. Anderson, ME

http://www.atgcchecker.com/pubmed/16339492

Summary

Author: Justin D Pearlman, MD, PhD, FACC

PENDING

Author: Larry H Bernstein, MD, FCAP

 PENDING

V. Bibliography on Calcium Release Mechanisms in Vascular Smooth Muscle, in Cardiomyocytes and the Role in Heart Failure 

Curator: Aviva Lev-Ari, PhD, RN

  • Anderson ME, General Hospital Iowa City and University of Iowa
  • Wilson S. Colucci, MD, Heart Failure Lab at BMC
  • William Gregory Stevenson, M.D. Heart Failure Lab at BWH

Anderson ME, General Hospital Iowa City and University of Iowa

Latest 20 Publications by Prof. Anderson ME on Heart Failure, Calcium and Calmodulin-dependent protein kinase II: linking heart failure and arrhythmias.

Mark E. Anderson, MD, PhD

Clinical Profile Head, Department of Internal Medicine Director, Cardiovascular Research Center Professor of Internal Medicine  – Cardiovascular Medicine Professor of Molecular Physiology and Biophysics

Contact Information

Primary Office: SE308 GH General Hospital Iowa City, IA 52242 Lab: 2270C CBRB Iowa City, IA 52242 Email: mark-e-anderson@uiowa.edu Web: Dr. Anderson’s Laboratory Web: Transatlantic CaMKII Alliance website (Fondation Leducq)

Dr. Anderson is clinically trained as a cardiac electrophysiologist. His research is focused on cellular signaling and ionic mechanisms that cause heart failure and sudden cardiac death. The multifunctional Ca2+/calmodulin dependent protein kinase II (CaMKII) is upregulated in heart disease and arrhythmias. Work in the Anderson laboratory implicates CaMKII as a signal that drives myocardial hypertrophy, apoptosis, mechanical dysfunction and electrical instability. The laboratory work ranges from molecular structure activity analysis of CaMKII to systems physiology using genetically modified mice to dissect cellular mechanisms of CaMKII signaling in heart. http://www.medicine.uiowa.edu/dept_primary_apr.aspx?appointment=Internal%20Medicine&id=andersonmar

Results: 1 to 20 of 419

Li J, Marionneau C, Zhang R, Shah V, Hell JW, Nerbonne JM, Anderson ME. Circ Res. 2006 Nov 10;99(10):1092-9. Epub 2006 Oct 12.
PMID:

17038644 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 186900392.
Calmodulin kinase II inhibition enhances ischemic preconditioning by augmenting ATP-sensitive K+ current.

Li J, Marionneau C, Koval O, Zingman L, Mohler PJ, Nerbonne JM, Anderson ME. Channels (Austin). 2007 Sep-Oct;1(5):387-94. Epub 2007 Dec 17.
PMID:

18690039 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 122088073.
Calmodulin kinase II and arrhythmias in a mouse model of cardiac hypertrophy.

Wu Y, Temple J, Zhang R, Dzhura I, Zhang W, Trimble R, Roden DM, Passier R, Olson EN, Colbran RJ, Anderson ME. Circulation. 2002 Sep 3;106(10):1288-93.
PMID:

12208807 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 164135754.
Suppression of dynamic Ca(2+) transient responses to pacing in ventricular myocytes from mice with genetic calmodulin kinase II inhibition.

Wu Y, Shintani A, Grueter C, Zhang R, Hou Y, Yang J, Kranias EG, Colbran RJ, Anderson ME. J Mol Cell Cardiol. 2006 Feb;40(2):213-23. Epub 2006 Jan 18.
PMID:

16413575 [PubMed – indexed for MEDLINE]

Related citations

Select item 159222735.
Calmodulin kinase II activity is required for normal atrioventricular nodal conduction.

Khoo MS, Kannankeril PJ, Li J, Zhang R, Kupershmidt S, Zhang W, Atkinson JB, Colbran RJ, Roden DM, Anderson ME. Heart Rhythm. 2005 Jun;2(6):634-40.
PMID:

15922273 [PubMed – indexed for MEDLINE]

Related citations

Select item 169829376.
Death, cardiac dysfunction, and arrhythmias are increased by calmodulin kinase II in calcineurin cardiomyopathy.

Khoo MS, Li J, Singh MV, Yang Y, Kannankeril P, Wu Y, Grueter CE, Guan X, Oddis CV, Zhang R, Mendes L, Ni G, Madu EC, Yang J, Bass M, Gomez RJ, Wadzinski BE, Olson EN, Colbran RJ, Anderson ME. Circulation. 2006 Sep 26;114(13):1352-9. Epub 2006 Sep 18.
PMID:

16982937 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 208646737.
RGS6, a modulator of parasympathetic activation in heart.

Yang J, Huang J, Maity B, Gao Z, Lorca RA, Gudmundsson H, Li J, Stewart A, Swaminathan PD, Ibeawuchi SR, Shepherd A, Chen CK, Kutschke W, Mohler PJ, Mohapatra DP, Anderson ME, Fisher RA. Circ Res. 2010 Nov 26;107(11):1345-9. doi: 10.1161/CIRCRESAHA.110.224220. Epub 2010 Sep 23.
PMID:

20864673 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 180480558.
Calmodulin kinase II inhibition disrupts cardiomyopathic effects of enhanced green fluorescent protein.

Khoo MS, Grueter CE, Eren M, Yang J, Zhang R, Bass MA, Lwin ST, Mendes LA, Vaughan DE, Colbran RJ, Anderson ME. J Mol Cell Cardiol. 2008 Feb;44(2):405-10. Epub 2007 Nov 28.
PMID:

18048055 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 192739099.
Ca2+/calmodulin-dependent kinase II triggers cell membrane injury by inducing complement factor B gene expression in the mouse heart.

Singh MV, Kapoun A, Higgins L, Kutschke W, Thurman JM, Zhang R, Singh M, Yang J, Guan X, Lowe JS, Weiss RM, Zimmermann K, Yull FE, Blackwell TS, Mohler PJ, Anderson ME. J Clin Invest. 2009 Apr;119(4):986-96. doi: 10.1172/JCI35814. Epub 2009 Mar 9.
PMID:

19273909 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 2279626010.
CaMKII effects on inotropic but not lusitropic force frequency responses require phospholamban.

Wu Y, Luczak ED, Lee EJ, Hidalgo C, Yang J, Gao Z, Li J, Wehrens XH, Granzier H, Anderson ME. J Mol Cell Cardiol. 2012 Sep;53(3):429-36. doi: 10.1016/j.yjmcc.2012.06.019. Epub 2012 Jul 11.
PMID:

22796260 [PubMed – indexed for MEDLINE]

Related citations

Select item 1280798611.
C terminus L-type Ca2+ channel calmodulin-binding domains are ‘auto-agonist’ ligands in rabbit ventricular myocytes.

Dzhura I, Wu Y, Zhang R, Colbran RJ, Hamilton SL, Anderson ME. J Physiol. 2003 Aug 1;550(Pt 3):731-8. Epub 2003 Jun 13.
PMID:

12807986 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 2061038012.
Ankyrin-B regulates Kir6.2 membrane expression and function in heart.

Li J, Kline CF, Hund TJ, Anderson ME, Mohler PJ. J Biol Chem. 2010 Sep 10;285(37):28723-30. doi: 10.1074/jbc.M110.147868. Epub 2010 Jul 7.
PMID:

20610380 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 2087700913.
A β(IV)-spectrin/CaMKII signaling complex is essential for membrane excitability in mice.

Hund TJ, Koval OM, Li J, Wright PJ, Qian L, Snyder JS, Gudmundsson H, Kline CF, Davidson NP, Cardona N, Rasband MN, Anderson ME, Mohler PJ. J Clin Invest. 2010 Oct;120(10):3508-19. doi: 10.1172/JCI43621. Epub 2010 Sep 27.
PMID:

20877009 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 1686169714.
Calmodulin kinase II inhibition protects against myocardial cell apoptosis in vivo.

Yang Y, Zhu WZ, Joiner ML, Zhang R, Oddis CV, Hou Y, Yang J, Price EE, Gleaves L, Eren M, Ni G, Vaughan DE, Xiao RP, Anderson ME. Am J Physiol Heart Circ Physiol. 2006 Dec;291(6):H3065-75. Epub 2006 Jul 21.
PMID:

16861697 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 2305174615.
CaMKII determines mitochondrial stress responses in heart.

Joiner ML, Koval OM, Li J, He BJ, Allamargot C, Gao Z, Luczak ED, Hall DD, Fink BD, Chen B, Yang J, Moore SA, Scholz TD, Strack S, Mohler PJ, Sivitz WI, Song LS, Anderson ME. Nature. 2012 Nov 8;491(7423):269-73. doi: 10.1038/nature11444. Epub 2012 Oct 10.
PMID:

23051746 [PubMed – indexed for MEDLINE] Free PMC Article

Related citations

Select item 2267914016.
Calmodulin-dependent protein kinase II: linking heart failure and arrhythmias.

Swaminathan PD, Purohit A, Hund TJ, Anderson ME. Circ Res. 2012 Jun 8;110(12):1661-77. doi: 10.1161/CIRCRESAHA.111.243956. Review.
PMID:

22679140 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 1729239117.
Reduced contractile response to alpha1-adrenergic stimulation in atria from mice with chronic cardiac calmodulin kinase II inhibition.

Grimm M, El-Armouche A, Zhang R, Anderson ME, Eschenhagen T. J Mol Cell Cardiol. 2007 Mar;42(3):643-52. Epub 2006 Dec 28.
PMID:

17292391 [PubMed – indexed for MEDLINE]

Related citations

Select item 1579358218.
Calmodulin kinase II inhibition protects against structural heart disease.

Zhang R, Khoo MS, Wu Y, Yang Y, Grueter CE, Ni G, Price EE Jr, Thiel W, Guatimosim S, Song LS, Madu EC, Shah AN, Vishnivetskaya TA, Atkinson JB, Gurevich VV, Salama G, Lederer WJ, Colbran RJ, Anderson ME. Nat Med. 2005 Apr;11(4):409-17. Epub 2005 Mar 27.
PMID:

15793582 [PubMed – indexed for MEDLINE]

Related citations

Select item 1835989319.
Differential effects of phospholamban and Ca2+/calmodulin-dependent kinase II on [Ca2+]i transients in cardiac myocytes at physiological stimulation frequencies.

Werdich AA, Lima EA, Dzhura I, Singh MV, Li J, Anderson ME, Baudenbacher FJ. Am J Physiol Heart Circ Physiol. 2008 May;294(5):H2352-62. doi: 10.1152/ajpheart.01398.2006. Epub 2008 Mar 21.
PMID:

18359893 [PubMed – indexed for MEDLINE] Free Article

Related citations

Select item 2233802020.
β2-Adrenergic receptor supports prolonged theta tetanus-induced LTP.

Qian H, Matt L, Zhang M, Nguyen M, Patriarchi T, Koval OM, Anderson ME, He K, Lee HK, Hell JW. J Neurophysiol. 2012 May;107(10):2703-12. doi: 10.1152/jn.00374.2011. Epub 2012 Feb 15.

Publications by Prof. Wilson S. Colucci, MD on Heart Failure

Wilson S. Colucci, MD
Title Professor
Institution Boston University School of Medicine
Department Medicine
Division Cardiovascular Medicine
Address 75 E. Newton St Boston, MA 02118
Telephone (617) 638-8706
Title Chief – Section of Medicine, Cardiovascular Medicine
Institution Boston University School of Medicine
Department Medicine
Division Cardiovascular Medicine
1. Qin F, Siwik DA, Lancel S, Zhang J, Kuster GM, Luptak I, Wang L, Tong X, Kang YJ, Cohen RA, Colucci WS. Hydrogen Peroxide-Mediated SERCA Cysteine 674 Oxidation Contributes to Impaired Cardiac Myocyte Relaxation in Senescent Mouse Heart. J Am Heart Assoc. 2013; 2(4):e000184.
View in: PubMed
2. Gopal DM, Kommineni M, Ayalon N, Koelbl C, Ayalon R, Biolo A, Dember LM, Downing J, Siwik DA, Liang CS, Colucci WS. Relationship of plasma galectin-3 to renal function in patients with heart failure: effects of clinical status, pathophysiology of heart failure, and presence or absence of heart failure. J Am Heart Assoc. 2012 Oct; 1(5):e000760.
View in: PubMed
3. Calamaras TD, Lee C, Lan F, Ido Y, Siwik DA, Colucci WS. Post-translational Modification of Serine/Threonine Kinase LKB1 via Adduction of the Reactive Lipid Species 4-Hydroxy-trans-2-nonenal (HNE) at Lysine Residue 97 Directly Inhibits Kinase Activity. J Biol Chem. 2012 Dec 7; 287(50):42400-6.
View in: PubMed
4. Kivikko M, Nieminen MS, Pollesello P, Pohjanjousi P, Colucci WS, Teerlink JR, Mebazaa A. The clinical effects of levosimendan are not attenuated by sulfonylureas. Scand Cardiovasc J. 2012 Dec; 46(6):330-8.
View in: PubMed
5. Kumar V, Calamaras TD, Haeussler DJ, Colucci W, Cohen RA, McComb ME, Pimental DR, Bachschmid MM. Cardiovascular Redox and Ox Stress Proteomics. Antioxid Redox Signal. 2012 May 18.
View in: PubMed
6. Qin F, Siwik DA, Luptak I, Hou X, Wang L, Higuchi A, Weisbrod RM, Ouchi N, Tu VH, Calamaras TD, Miller EJ, Verbeuren TJ, Walsh K, Cohen RA, Colucci WS. The polyphenols resveratrol and s17834 prevent the structural and functional sequelae of diet-induced metabolic heart disease in mice. Circulation. 2012 Apr 10; 125(14):1757-64.
View in: PubMed
7. Mazzini M, Tadros T, Siwik D, Joseph L, Bristow M, Qin F, Cohen R, Monahan K, Klein M, Colucci W. Primary carnitine deficiency and sudden death: in vivo evidence of myocardial lipid peroxidation and sulfonylation of sarcoendoplasmic reticulum calcium ATPase 2. Cardiology. 2011; 120(1):52-8.
View in: PubMed
8. Schulze PC, Biolo A, Gopal D, Shahzad K, Balog J, Fish M, Siwik D, Colucci WS. Dynamics in insulin resistance and plasma levels of adipokines in patients with acute decompensated and chronic stable heart failure. J Card Fail. 2011 Dec; 17(12):1004-11.
View in: PubMed
9. Liesa M, Luptak I, Qin F, Hyde BB, Sahin E, Siwik DA, Zhu Z, Pimentel DR, Xu XJ, Ruderman NB, Huffman KD, Doctrow SR, Richey L, Colucci WS, Shirihai OS. Mitochondrial transporter ATP binding cassette mitochondrial erythroid is a novel gene required for cardiac recovery after ischemia/reperfusion. Circulation. 2011 Aug 16; 124(7):806-13.
View in: PubMed
10. Jessup M, Greenberg B, Mancini D, Cappola T, Pauly DF, Jaski B, Yaroshinsky A, Zsebo KM, Dittrich H, Hajjar RJ. Calcium Upregulation by Percutaneous Administration of Gene Therapy in Cardiac Disease (CUPID): a phase 2 trial of intracoronary gene therapy of sarcoplasmic reticulum Ca2+-ATPase in patients with advanced heart failure. Circulation. 2011 Jul 19; 124(3):304-13.
View in: PubMed
11. Papanicolaou KN, Khairallah RJ, Ngoh GA, Chikando A, Luptak I, O’Shea KM, Riley DD, Lugus JJ, Colucci WS, Lederer WJ, Stanley WC, Walsh K. Mitofusin-2 maintains mitochondrial structure and contributes to stress-induced permeability transition in cardiac myocytes. Mol Cell Biol. 2011 Mar; 31(6):1309-28.
View in: PubMed
12. Kivikko M, Sundberg S, Karlsson MO, Pohjanjousi P, Colucci WS. Acetylation status does not affect levosimendan’s hemodynamic effects in heart failure patients. Scand Cardiovasc J. 2011 Apr; 45(2):86-90.
View in: PubMed
13. Zannad F, McMurray JJ, Krum H, van Veldhuisen DJ, Swedberg K, Shi H, Vincent J, Pocock SJ, Pitt B. Eplerenone in patients with systolic heart failure and mild symptoms. N Engl J Med. 2011 Jan 6; 364(1):11-21.
View in: PubMed
14. Velagaleti RS, Gona P, Sundström J, Larson MG, Siwik D, Colucci WS, Benjamin EJ, Vasan RS. Relations of biomarkers of extracellular matrix remodeling to incident cardiovascular events and mortality. Arterioscler Thromb Vasc Biol. 2010 Nov; 30(11):2283-8.
View in: PubMed
15. Lancel S, Qin F, Lennon SL, Zhang J, Tong X, Mazzini MJ, Kang YJ, Siwik DA, Cohen RA, Colucci WS. Oxidative posttranslational modifications mediate decreased SERCA activity and myocyte dysfunction in Galphaq-overexpressing mice. Circ Res. 2010 Jul 23; 107(2):228-32.
View in: PubMed
16. Jeong MY, Walker JS, Brown RD, Moore RL, Vinson CS, Colucci WS, Long CS. AFos inhibits phenylephrine-mediated contractile dysfunction by altering phospholamban phosphorylation. Am J Physiol Heart Circ Physiol. 2010 Jun; 298(6):H1719-26.
View in: PubMed
17. Kuster GM, Lancel S, Zhang J, Communal C, Trucillo MP, Lim CC, Pfister O, Weinberg EO, Cohen RA, Liao R, Siwik DA, Colucci WS. Redox-mediated reciprocal regulation of SERCA and Na+-Ca2+ exchanger contributes to sarcoplasmic reticulum Ca2+ depletion in cardiac myocytes. Free Radic Biol Med. 2010 May 1; 48(9):1182-7.
View in: PubMed
18. Qin F, Lennon-Edwards S, Lancel S, Biolo A, Siwik DA, Pimentel DR, Dorn GW, Kang YJ, Colucci WS. Cardiac-specific overexpression of catalase identifies hydrogen peroxide-dependent and -independent phases of myocardial remodeling and prevents the progression to overt heart failure in G(alpha)q-overexpressing transgenic mice. Circ Heart Fail. 2010 Mar; 3(2):306-13.
View in: PubMed
19. Biolo A, Fisch M, Balog J, Chao T, Schulze PC, Ooi H, Siwik D, Colucci WS. Episodes of acute heart failure syndrome are associated with increased levels of troponin and extracellular matrix markers. Circ Heart Fail. 2010 Jan; 3(1):44-50.
View in: PubMed
20. Lazar HL, Bao Y, Siwik D, Frame J, Mateo CS, Colucci WS. Nesiritide enhances myocardial protection during the revascularization of acutely ischemic myocardium. J Card Surg. 2009 Sep-Oct; 24(5):600-5.
View in: PubMed
21. Lancel S, Zhang J, Evangelista A, Trucillo MP, Tong X, Siwik DA, Cohen RA, Colucci WS. Nitroxyl activates SERCA in cardiac myocytes via glutathiolation of cysteine 674. Circ Res. 2009 Mar 27; 104(6):720-3.
View in: PubMed
22. Dhingra R, Pencina MJ, Schrader P, Wang TJ, Levy D, Pencina K, Siwik DA, Colucci WS, Benjamin EJ, Vasan RS. Relations of matrix remodeling biomarkers to blood pressure progression and incidence of hypertension in the community. Circulation. 2009 Mar 3; 119(8):1101-7.
View in: PubMed
23. Biolo A, Greferath R, Siwik DA, Qin F, Valsky E, Fylaktakidou KC, Pothukanuri S, Duarte CD, Schwarz RP, Lehn JM, Nicolau C, Colucci WS. Enhanced exercise capacity in mice with severe heart failure treated with an allosteric effector of hemoglobin, myo-inositol trispyrophosphate. Proc Natl Acad Sci U S A. 2009 Feb 10; 106(6):1926-9.
View in: PubMed
24. Brooks WW, Conrad CH, Robinson KG, Colucci WS, Bing OH. L-arginine fails to prevent ventricular remodeling and heart failure in the spontaneously hypertensive rat. Am J Hypertens. 2009 Feb; 22(2):228-34.
View in: PubMed
25. Holubarsch CJ, Colucci WS, Meinertz T, Gaus W, Tendera M. The efficacy and safety of Crataegus extract WS 1442 in patients with heart failure: the SPICE trial. Eur J Heart Fail. 2008 Dec; 10(12):1255-63.
View in: PubMed
26. Olshansky B, Sabbah HN, Hauptman PJ, Colucci WS. Parasympathetic nervous system and heart failure: pathophysiology and potential implications for therapy. Circulation. 2008 Aug 19; 118(8):863-71.
View in: PubMed
27. Hare JM, Mangal B, Brown J, Fisher C, Freudenberger R, Colucci WS, Mann DL, Liu P, Givertz MM, Schwarz RP. Impact of oxypurinol in patients with symptomatic heart failure. Results of the OPT-CHF study. J Am Coll Cardiol. 2008 Jun 17; 51(24):2301-9.
View in: PubMed
28. Torre-Amione G, Anker SD, Bourge RC, Colucci WS, Greenberg BH, Hildebrandt P, Keren A, Motro M, Moyé LA, Otterstad JE, Pratt CM, Ponikowski P, Rouleau JL, Sestier F, Winkelmann BR, Young JB. Results of a non-specific immunomodulation therapy in chronic heart failure (ACCLAIM trial): a placebo-controlled randomised trial. Lancet. 2008 Jan 19; 371(9608):228-36.
View in: PubMed
29. Fonarow GC, Lukas MA, Robertson M, Colucci WS, Dargie HJ. Effects of carvedilol early after myocardial infarction: analysis of the first 30 days in Carvedilol Post-Infarct Survival Control in Left Ventricular Dysfunction (CAPRICORN). Am Heart J. 2007 Oct; 154(4):637-44.
View in: PubMed
30. Wang TJ, Larson MG, Benjamin EJ, Siwik DA, Safa R, Guo CY, Corey D, Sundstrom J, Sawyer DB, Colucci WS, Vasan RS. Clinical and echocardiographic correlates of plasma procollagen type III amino-terminal peptide levels in the community. Am Heart J. 2007 Aug; 154(2):291-7.
View in: PubMed
31. Colucci WS, Kolias TJ, Adams KF, Armstrong WF, Ghali JK, Gottlieb SS, Greenberg B, Klibaner MI, Kukin ML, Sugg JE. Metoprolol reverses left ventricular remodeling in patients with asymptomatic systolic dysfunction: the REversal of VEntricular Remodeling with Toprol-XL (REVERT) trial. Circulation. 2007 Jul 3; 116(1):49-56.
View in: PubMed
32. Torre-Amione G, Bourge RC, Colucci WS, Greenberg B, Pratt C, Rouleau JL, Sestier F, Moyé LA, Geddes JA, Nemet AJ, Young JB. A study to assess the effects of a broad-spectrum immune modulatory therapy on mortality and morbidity in patients with chronic heart failure: the ACCLAIM trial rationale and design. Can J Cardiol. 2007 Apr; 23(5):369-76.
View in: PubMed
33. Shibata R, Izumiya Y, Sato K, Papanicolaou K, Kihara S, Colucci WS, Sam F, Ouchi N, Walsh K. Adiponectin protects against the development of systolic dysfunction following myocardial infarction. J Mol Cell Cardiol. 2007 Jun; 42(6):1065-74.
View in: PubMed
34. Givertz MM, Andreou C, Conrad CH, Colucci WS. Direct myocardial effects of levosimendan in humans with left ventricular dysfunction: alteration of force-frequency and relaxation-frequency relationships. Circulation. 2007 Mar 13; 115(10):1218-24.
View in: PubMed
35. Louhelainen M, Vahtola E, Kaheinen P, Leskinen H, Merasto S, Kytö V, Finckenberg P, Colucci WS, Levijoki J, Pollesello P, Haikala H, Mervaala EM. Effects of levosimendan on cardiac remodeling and cardiomyocyte apoptosis in hypertensive Dahl/Rapp rats. Br J Pharmacol. 2007 Apr; 150(7):851-61.
View in: PubMed
36. Kuster GM, Siwik DA, Pimentel DR, Colucci WS. Role of reversible, thioredoxin-sensitive oxidative protein modifications in cardiac myocytes. Antioxid Redox Signal. 2006 Nov-Dec; 8(11-12):2153-9.
View in: PubMed
37. Arnlöv J, Evans JC, Benjamin EJ, Larson MG, Levy D, Sutherland P, Siwik DA, Wang TJ, Colucci WS, Vasan RS. Clinical and echocardiographic correlates of plasma osteopontin in the community: the Framingham Heart Study. Heart. 2006 Oct; 92(10):1514-5.
View in: PubMed
38. Pimentel DR, Adachi T, Ido Y, Heibeck T, Jiang B, Lee Y, Melendez JA, Cohen RA, Colucci WS. Strain-stimulated hypertrophy in cardiac myocytes is mediated by reactive oxygen species-dependent Ras S-glutathiolation. J Mol Cell Cardiol. 2006 Oct; 41(4):613-22.
View in: PubMed
39. Gheorghiade M, van Veldhuisen DJ, Colucci WS. Contemporary use of digoxin in the management of cardiovascular disorders. Circulation. 2006 May 30; 113(21):2556-64.
View in: PubMed
40. De Luca L, Colucci WS, Nieminen MS, Massie BM, Gheorghiade M. Evidence-based use of levosimendan in different clinical settings. Eur Heart J. 2006 Aug; 27(16):1908-20.
View in: PubMed
41. Cohn JN, Colucci W. Cardiovascular effects of aldosterone and post-acute myocardial infarction pathophysiology. Am J Cardiol. 2006 May 22; 97(10A):4F-12F.
View in: PubMed
42. Izumiya Y, Shiojima I, Sato K, Sawyer DB, Colucci WS, Walsh K. Vascular endothelial growth factor blockade promotes the transition from compensatory cardiac hypertrophy to failure in response to pressure overload. Hypertension. 2006 May; 47(5):887-93.
View in: PubMed
43. Kotlyar E, Vita JA, Winter MR, Awtry EH, Siwik DA, Keaney JF, Sawyer DB, Cupples LA, Colucci WS, Sam F. The relationship between aldosterone, oxidative stress, and inflammation in chronic, stable human heart failure. J Card Fail. 2006 Mar; 12(2):122-7.
View in: PubMed
44. Ahmed A, Rich MW, Love TE, Lloyd-Jones DM, Aban IB, Colucci WS, Adams KF, Gheorghiade M. Digoxin and reduction in mortality and hospitalization in heart failure: a comprehensive post hoc analysis of the DIG trial. Eur Heart J. 2006 Jan; 27(2):178-86.
View in: PubMed
45. Bianchi P, Kunduzova O, Masini E, Cambon C, Bani D, Raimondi L, Seguelas MH, Nistri S, Colucci W, Leducq N, Parini A. Oxidative stress by monoamine oxidase mediates receptor-independent cardiomyocyte apoptosis by serotonin and postischemic myocardial injury. Circulation. 2005 Nov 22; 112(21):3297-305.
View in: PubMed
46. Maytin M, Colucci WS. Cardioprotection: a new paradigm in the management of acute heart failure syndromes. Am J Cardiol. 2005 Sep 19; 96(6A):26G-31G.
View in: PubMed
47. Shiojima I, Sato K, Izumiya Y, Schiekofer S, Ito M, Liao R, Colucci WS, Walsh K. Disruption of coordinated cardiac hypertrophy and angiogenesis contributes to the transition to heart failure. J Clin Invest. 2005 Aug; 115(8):2108-18.
View in: PubMed
48. Sam F, Kerstetter DL, Pimental DR, Mulukutla S, Tabaee A, Bristow MR, Colucci WS, Sawyer DB. Increased reactive oxygen species production and functional alterations in antioxidant enzymes in human failing myocardium. J Card Fail. 2005 Aug; 11(6):473-80.
View in: PubMed
49. Rude MK, Duhaney TA, Kuster GM, Judge S, Heo J, Colucci WS, Siwik DA, Sam F. Aldosterone stimulates matrix metalloproteinases and reactive oxygen species in adult rat ventricular cardiomyocytes. Hypertension. 2005 Sep; 46(3):555-61.
View in: PubMed
50. Pfister O, Mouquet F, Jain M, Summer R, Helmes M, Fine A, Colucci WS, Liao R. CD31- but Not CD31+ cardiac side population cells exhibit functional cardiomyogenic differentiation. Circ Res. 2005 Jul 8; 97(1):52-61.
View in: PubMed
51. Communal C, Colucci WS. The control of cardiomyocyte apoptosis via the beta-adrenergic signaling pathways. Arch Mal Coeur Vaiss. 2005 Mar; 98(3):236-41.
View in: PubMed
52. Kuster GM, Pimentel DR, Adachi T, Ido Y, Brenner DA, Cohen RA, Liao R, Siwik DA, Colucci WS. Alpha-adrenergic receptor-stimulated hypertrophy in adult rat ventricular myocytes is mediated via thioredoxin-1-sensitive oxidative modification of thiols on Ras. Circulation. 2005 Mar 8; 111(9):1192-8.
View in: PubMed
53. McMurray J, Køber L, Robertson M, Dargie H, Colucci W, Lopez-Sendon J, Remme W, Sharpe DN, Ford I. Antiarrhythmic effect of carvedilol after acute myocardial infarction: results of the Carvedilol Post-Infarct Survival Control in Left Ventricular Dysfunction (CAPRICORN) trial. J Am Coll Cardiol. 2005 Feb 15; 45(4):525-30.
View in: PubMed
54. Bianchi P, Pimentel DR, Murphy MP, Colucci WS, Parini A. A new hypertrophic mechanism of serotonin in cardiac myocytes: receptor-independent ROS generation. FASEB J. 2005 Apr; 19(6):641-3.
View in: PubMed
55. Kuster GM, Kotlyar E, Rude MK, Siwik DA, Liao R, Colucci WS, Sam F. Mineralocorticoid receptor inhibition ameliorates the transition to myocardial failure and decreases oxidative stress and inflammation in mice with chronic pressure overload. Circulation. 2005 Feb 1; 111(4):420-7.
View in: PubMed
56. Taniyama Y, Ito M, Sato K, Kuester C, Veit K, Tremp G, Liao R, Colucci WS, Ivashchenko Y, Walsh K, Shiojima I. Akt3 overexpression in the heart results in progression from adaptive to maladaptive hypertrophy. J Mol Cell Cardiol. 2005 Feb; 38(2):375-85.
View in: PubMed
57. Colucci WS (Editor): Atlas of Heart Failure – Cardiac Function and Dysfunction, Fourth Edition, Braunwald E (Series Editor). Current Medicine. 2005.
58. Shibata R, Ouchi N, Ito M, Kihara S, Shiojima I, Pimentel DR, Kumada M, Sato K, Schiekofer S, Ohashi K, Funahashi T, Colucci WS, Walsh K. Adiponectin-mediated modulation of hypertrophic signals in the heart. Nat Med. 2004 Dec; 10(12):1384-9.
View in: PubMed
59. Freudenberger RS, Schwarz RP, Brown J, Moore A, Mann D, Givertz MM, Colucci WS, Hare JM. Rationale, design and organisation of an efficacy and safety study of oxypurinol added to standard therapy in patients with NYHA class III – IV congestive heart failure. Expert Opin Investig Drugs. 2004 Nov; 13(11):1509-16.
View in: PubMed
60. Trueblood NA, Inscore PR, Brenner D, Lugassy D, Apstein CS, Sawyer DB, Colucci WS. Biphasic temporal pattern in exercise capacity after myocardial infarction in the rat: relationship to left ventricular remodeling. Am J Physiol Heart Circ Physiol. 2005 Jan; 288(1):H244-9.
View in: PubMed
61. Sundström J, Evans JC, Benjamin EJ, Levy D, Larson MG, Sawyer DB, Siwik DA, Colucci WS, Wilson PW, Vasan RS. Relations of plasma total TIMP-1 levels to cardiovascular risk factors and echocardiographic measures: the Framingham heart study. Eur Heart J. 2004 Sep; 25(17):1509-16.
View in: PubMed
62. Ito M, Adachi T, Pimentel DR, Ido Y, Colucci WS. Statins inhibit beta-adrenergic receptor-stimulated apoptosis in adult rat ventricular myocytes via a Rac1-dependent mechanism. Circulation. 2004 Jul 27; 110(4):412-8.
View in: PubMed
63. Gheorghiade M, Adams KF, Colucci WS. Digoxin in the management of cardiovascular disorders. Circulation. 2004 Jun 22; 109(24):2959-64.
View in: PubMed
64. Sundström J, Evans JC, Benjamin EJ, Levy D, Larson MG, Sawyer DB, Siwik DA, Colucci WS, Sutherland P, Wilson PW, Vasan RS. Relations of plasma matrix metalloproteinase-9 to clinical cardiovascular risk factors and echocardiographic left ventricular measures: the Framingham Heart Study. Circulation. 2004 Jun 15; 109(23):2850-6.
View in: PubMed
65. Colucci WS. Landmark study: the Carvedilol Post-Infarct Survival Control in Left Ventricular Dysfunction Study (CAPRICORN). Am J Cardiol. 2004 May 6; 93(9A):13B-6B.
View in: PubMed
66. Mann DL, McMurray JJ, Packer M, Swedberg K, Borer JS, Colucci WS, Djian J, Drexler H, Feldman A, Kober L, Krum H, Liu P, Nieminen M, Tavazzi L, van Veldhuisen DJ, Waldenstrom A, Warren M, Westheim A, Zannad F, Fleming T. Targeted anticytokine therapy in patients with chronic heart failure: results of the Randomized Etanercept Worldwide Evaluation (RENEWAL). Circulation. 2004 Apr 6; 109(13):1594-602.
View in: PubMed
67. Vasan RS, Evans JC, Benjamin EJ, Levy D, Larson MG, Sundstrom J, Murabito JM, Sam F, Colucci WS, Wilson PW. Relations of serum aldosterone to cardiac structure: gender-related differences in the Framingham Heart Study. Hypertension. 2004 May; 43(5):957-62.
View in: PubMed
68. Maytin M, Siwik DA, Ito M, Xiao L, Sawyer DB, Liao R, Colucci WS. Pressure overload-induced myocardial hypertrophy in mice does not require gp91phox. Circulation. 2004 Mar 9; 109(9):1168-71.
View in: PubMed
69. Sam F, Xie Z, Ooi H, Kerstetter DL, Colucci WS, Singh M, Singh K. Mice lacking osteopontin exhibit increased left ventricular dilation and reduced fibrosis after aldosterone infusion. Am J Hypertens. 2004 Feb; 17(2):188-93.
View in: PubMed
70. Giles TD, Chatterjee K, Cohn JN, Colucci WS, Feldman AM, Ferrans VJ, Roberts R. Definition, classification, and staging of the adult cardiomyopathies: a proposal for revision. J Card Fail. 2004 Feb; 10(1):6-8.
View in: PubMed
71. Siwik DA, Colucci WS. Regulation of matrix metalloproteinases by cytokines and reactive oxygen/nitrogen species in the myocardium. Heart Fail Rev. 2004 Jan; 9(1):43-51.
View in: PubMed
72. Sawyer DB, Colucci WS. Oxidative stress in heart failure; (Chapter 12). In: Mann DL (ed) Heart Failure: A Companion to Braunwald’s Heart Disease. Saunders. 2004; 181-92.
73. Maytin M, Sawyer DB and Colucci WS. Role of reactive oxygen species in the regulation of cardiac myocyte phenotype. In: Pathophysiology of Cardiovascular Disease. Dhalla NS, Rupp H, Angel A and Pierce GN (eds). 51-7:Kluwer Academic Publishers . 2004.
74. Kuramochi Y, Lim CC, Guo X, Colucci WS, Liao R, Sawyer DB. Myocyte contractile activity modulates norepinephrine cytotoxicity and survival effects of neuregulin-1beta. Am J Physiol Cell Physiol. 2004 Feb; 286(2):C222-9.
View in: PubMed
75. Torre-Amione G, Young JB, Colucci WS, Lewis BS, Pratt C, Cotter G, Stangl K, Elkayam U, Teerlink JR, Frey A, Rainisio M, Kobrin I. Hemodynamic and clinical effects of tezosentan, an intravenous dual endothelin receptor antagonist, in patients hospitalized for acute decompensated heart failure. J Am Coll Cardiol. 2003 Jul 2; 42(1):140-7.
View in: PubMed
76. Kwon SH, Pimentel DR, Remondino A, Sawyer DB, Colucci WS. H(2)O(2) regulates cardiac myocyte phenotype via concentration-dependent activation of distinct kinase pathways. J Mol Cell Cardiol. 2003 Jun; 35(6):615-21.
View in: PubMed
77. Communal C, Singh M, Menon B, Xie Z, Colucci WS, Singh K. beta1 integrins expression in adult rat ventricular myocytes and its role in the regulation of beta-adrenergic receptor-stimulated apoptosis. J Cell Biochem. 2003 May 15; 89(2):381-8.
View in: PubMed
78. Gheorghiade M, Colucci WS, Swedberg K. Beta-blockers in chronic heart failure. Circulation. 2003 Apr 1; 107(12):1570-5.
View in: PubMed
79. Remondino A, Kwon SH, Communal C, Pimentel DR, Sawyer DB, Singh K, Colucci WS. Beta-adrenergic receptor-stimulated apoptosis in cardiac myocytes is mediated by reactive oxygen species/c-Jun NH2-terminal kinase-dependent activation of the mitochondrial pathway. Circ Res. 2003 Feb 7; 92(2):136-8.
View in: PubMed
80. Kivikko M, Lehtonen L, Colucci WS. Sustained hemodynamic effects of intravenous levosimendan. Circulation. 2003 Jan 7; 107(1):81-6.
View in: PubMed
81. Sam F, Sawyer DB and Colucci WS. Myocardial nitric oxide in cardiac remodeling. In: Inflammation and Cardiac Diseases. Feuerstein GZ, Libby P and Mann DL (eds). Birkhäuser. 2003; 155-170.
82. Siwik DA, Pimentel DR, Xiao L, Singh K, Sawyer DB, and Colucci WS. Adrenergic and mechanical regulation of oxidative stress in the myocardium. In: Kukin ML, Fuster V (eds). Oxidative Stress and Cardiac Failure. Armonk, NY:Futura Publishing Co., Inc.. 2003; 153-171.
83. Ooi H, Colucci WS, Givertz MM. Endothelin mediates increased pulmonary vascular tone in patients with heart failure: demonstration by direct intrapulmonary infusion of sitaxsentan. Circulation. 2002 Sep 24; 106(13):1618-21.
View in: PubMed
84. Hare JM, Nguyen GC, Massaro AF, Drazen JM, Stevenson LW, Colucci WS, Fang JC, Johnson W, Givertz MM, Lucas C. Exhaled nitric oxide: a marker of pulmonary hemodynamics in heart failure. J Am Coll Cardiol. 2002 Sep 18; 40(6):1114-9.
View in: PubMed
85. Maytin M, Colucci WS. Molecular and cellular mechanisms of myocardial remodeling. J Nucl Cardiol. 2002 May-Jun; 9(3):319-27.
View in: PubMed
86. Xiao L, Pimentel DR, Wang J, Singh K, Colucci WS, Sawyer DB. Role of reactive oxygen species and NAD(P)H oxidase in alpha(1)-adrenoceptor signaling in adult rat cardiac myocytes. Am J Physiol Cell Physiol. 2002 Apr; 282(4):C926-34.
View in: PubMed
87. Sawyer DB, Siwik DA, Xiao L, Pimentel DR, Singh K, Colucci WS. Role of oxidative stress in myocardial hypertrophy and failure. J Mol Cell Cardiol. 2002 Apr; 34(4):379-88.
View in: PubMed
88. Communal C, Colucci WS, Remondino A, Sawyer DB, Port JD, Wichman SE, Bristow MR, Singh K. Reciprocal modulation of mitogen-activated protein kinases and mitogen-activated protein kinase phosphatase 1 and 2 in failing human myocardium. J Card Fail. 2002 Apr; 8(2):86-92.
View in: PubMed
89. Cuffe MS, Califf RM, Adams KF, Benza R, Bourge R, Colucci WS, Massie BM, O’Connor CM, Pina I, Quigg R, Silver MA, Gheorghiade M. Short-term intravenous milrinone for acute exacerbation of chronic heart failure: a randomized controlled trial. JAMA. 2002 Mar 27; 287(12):1541-7.
View in: PubMed
90. Leier CV, Silver MA, Rich MW, Eichhorn EJ, Fowler MB, Giles TD, Johnstone DE, Le Jemtel TH, Lachmann JS, Levine TB, Armstrong PW, Dec WG, Jessup M, Howlett J, Hershberger RE, Cohn JN, Adams KF, Colucci WS, Warner-Stevenson L, Hosenpud JD, Bristow MR, Pina I, Baughman KL, Binkley PF, Ventura HO, Francis GS, White M, Miller LW, Berry B, Missov E. Nuggets, pearls, and vignettes of master heart failure clinicians. Part 4–treatment. Congest Heart Fail. 2002 Mar-Apr; 8(2):98-124.
View in: PubMed
91. Colucci WS (Section Editor, “Heart Failure”): In: Cardiovascular Therapeutics, Antman E (Editor-in-Chief) Philadelphia: Saunders, 2002. . Colucci WS (Section Editor, “Heart Failure”). In: Cardiovascular Therapeutics, Antman E (Editor-in-Chief). Saunders. 2002.
92. Sawyer DB, Colucci WS. Molecular and cellular events in myocardial hypertrophy and failure. In: “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Third Edition, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 2002.
93. Givertz MM, Colucci WS. Beta-Blockers. In: “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Third Edition, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 2002.
94. Givertz MM, Colucci WS. Treatment of heart failure: New approaches. In: “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Third Edition, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 2002.
95. Colucci WS (Editor): Atlas of Heart Failure – Cardiac Function and Dysfunction, Third Edition, Braunwald E (Series Editor). Philadelphia:Current Medicine. 2002.
96. Singh K, Xiao L, Remondino A, Sawyer DB, Colucci WS. Adrenergic regulation of cardiac myocyte apoptosis. J Cell Physiol. 2001 Dec; 189(3):257-65.
View in: PubMed
97. Pimentel DR, Amin JK, Xiao L, Miller T, Viereck J, Oliver-Krasinski J, Baliga R, Wang J, Siwik DA, Singh K, Pagano P, Colucci WS, Sawyer DB. Reactive oxygen species mediate amplitude-dependent hypertrophic and apoptotic responses to mechanical stretch in cardiac myocytes. Circ Res. 2001 Aug 31; 89(5):453-60.
View in: PubMed
98. Sam F, Sawyer DB, Xie Z, Chang DL, Ngoy S, Brenner DA, Siwik DA, Singh K, Apstein CS, Colucci WS. Mice lacking inducible nitric oxide synthase have improved left ventricular contractile function and reduced apoptotic cell death late after myocardial infarction. Circ Res. 2001 Aug 17; 89(4):351-6.
View in: PubMed
99. Xie Z, Pimental DR, Lohan S, Vasertriger A, Pligavko C, Colucci WS, Singh K. Regulation of angiotensin II-stimulated osteopontin expression in cardiac microvascular endothelial cells: role of p42/44 mitogen-activated protein kinase and reactive oxygen species. J Cell Physiol. 2001 Jul; 188(1):132-8.
View in: PubMed
100. Loh E, Elkayam U, Cody R, Bristow M, Jaski B, Colucci WS. A randomized multicenter study comparing the efficacy and safety of intravenous milrinone and intravenous nitroglycerin in patients with advanced heart failure. J Card Fail. 2001 Jun; 7(2):114-21.
View in: PubMed
101. Trueblood NA, Xie Z, Communal C, Sam F, Ngoy S, Liaw L, Jenkins AW, Wang J, Sawyer DB, Bing OH, Apstein CS, Colucci WS, Singh K. Exaggerated left ventricular dilation and reduced collagen deposition after myocardial infarction in mice lacking osteopontin. Circ Res. 2001 May 25; 88(10):1080-7.
View in: PubMed
102. Givertz MM, Slawsky MT, Moraes DL, McIntyre KM, Colucci WS. Noninvasive determination of pulmonary artery wedge pressure in patients with chronic heart failure. Am J Cardiol. 2001 May 15; 87(10):1213-5; A7.
View in: PubMed
103. Yancy CW, Fowler MB, Colucci WS, Gilbert EM, Bristow MR, Cohn JN, Lukas MA, Young ST, Packer M. Race and the response to adrenergic blockade with carvedilol in patients with chronic heart failure. N Engl J Med. 2001 May 3; 344(18):1358-65.
View in: PubMed
104. Fowler MB, Vera-Llonch M, Oster G, Bristow MR, Cohn JN, Colucci WS, Gilbert EM, Lukas MA, Lacey MJ, Richner R, Young ST, Packer M. Influence of carvedilol on hospitalizations in heart failure: incidence, resource utilization and costs. U.S. Carvedilol Heart Failure Study Group. J Am Coll Cardiol. 2001 May; 37(6):1692-9.
View in: PubMed
105. Jain M, DerSimonian H, Brenner DA, Ngoy S, Teller P, Edge AS, Zawadzka A, Wetzel K, Sawyer DB, Colucci WS, Apstein CS, Liao R. Cell therapy attenuates deleterious ventricular remodeling and improves cardiac performance after myocardial infarction. Circulation. 2001 Apr 10; 103(14):1920-7.
View in: PubMed
106. Xiao L, Pimental DR, Amin JK, Singh K, Sawyer DB, Colucci WS. MEK1/2-ERK1/2 mediates alpha1-adrenergic receptor-stimulated hypertrophy in adult rat ventricular myocytes. J Mol Cell Cardiol. 2001 Apr; 33(4):779-87.
View in: PubMed
107. Podesser BK, Siwik DA, Eberli FR, Sam F, Ngoy S, Lambert J, Ngo K, Apstein CS, Colucci WS. ET(A)-receptor blockade prevents matrix metalloproteinase activation late postmyocardial infarction in the rat. Am J Physiol Heart Circ Physiol. 2001 Mar; 280(3):H984-91.
View in: PubMed
108. Colucci WS. Nesiritide for the treatment of decompensated heart failure. J Card Fail. 2001 Mar; 7(1):92-100.
View in: PubMed
109. Givertz MM, Sawyer DB, Colucci WS. Antioxidants and myocardial contractility: illuminating the “Dark Side” of beta-adrenergic receptor activation? Circulation. 2001 Feb 13; 103(6):782-3.
View in: PubMed
110. Siwik DA, Pagano PJ, Colucci WS. Oxidative stress regulates collagen synthesis and matrix metalloproteinase activity in cardiac fibroblasts. Am J Physiol Cell Physiol. 2001 Jan; 280(1):C53-60.
View in: PubMed
111. Amin JK, Xiao L, Pimental DR, Pagano PJ, Singh K, Sawyer DB, Colucci WS. Reactive oxygen species mediate alpha-adrenergic receptor-stimulated hypertrophy in adult rat ventricular myocytes. J Mol Cell Cardiol. 2001 Jan; 33(1):131-9.
View in: PubMed
112. Ooi H and Colucci WS. Pharmacological Treatment of Heart Failure; (Chapter 34). In: Hardman JG, Limbird LE and Gilman AG (eds): Goodman & Gilman’s The Pharmacological Basis of Therapeutics, 10th Edition, McGraw Hill. McGraw Hill. 2001; 901-932.
113. Colucci WS and Braunwald E. Pathophysiology of Heart Failure, (Chapter 16). In: Braunwald E (ed): Heart Disease. 6th Edition. Philadelphia:WB Saunders Co. 2001; 503-533.
114. Colucci WS and Schoen FJ. Primary Tumors of the Heart; (Chapter 49). In: Braunwald E. (ed): Heart Disease. 6th Edition. Philadelphia:WB Saunders Co. 2001; 1807-22.
115. Ooi H and Colucci WS. Congestive Heart Failure. In: Rakel & Bope: Conn’s Current Therapy. Philadelphia:WB Saunders Co. 2001; pp. 310-14.
116. Colucci WS. Heart Failure. In: Essential Atlas of Heart Diseases, Second Edition, Braunwald E (Editor–in-Chief). Philadelphia:Current Medicine. 2001.
117. Holubarsch CJ, Colucci WS, Meinertz T, Gaus W, Tendera M. Survival and prognosis: investigation of Crataegus extract WS 1442 in congestive heart failure (SPICE)–rationale, study design and study protocol. Eur J Heart Fail. 2000 Dec; 2(4):431-7.
View in: PubMed
118. Lim CC, Apstein CS, Colucci WS, Liao R. Impaired cell shortening and relengthening with increased pacing frequency are intrinsic to the senescent mouse cardiomyocyte. J Mol Cell Cardiol. 2000 Nov; 32(11):2075-82.
View in: PubMed
119. Nagata K, Communal C, Lim CC, Jain M, Suter TM, Eberli FR, Satoh N, Colucci WS, Apstein CS, Liao R. Altered beta-adrenergic signal transduction in nonfailing hypertrophied myocytes from Dahl salt-sensitive rats. Am J Physiol Heart Circ Physiol. 2000 Nov; 279(5):H2502-8.
View in: PubMed
120. Slawsky MT, Colucci WS, Gottlieb SS, Greenberg BH, Haeusslein E, Hare J, Hutchins S, Leier CV, LeJemtel TH, Loh E, Nicklas J, Ogilby D, Singh BN, Smith W. Acute hemodynamic and clinical effects of levosimendan in patients with severe heart failure. Study Investigators. Circulation. 2000 Oct 31; 102(18):2222-7.
View in: PubMed
121. Satoh N, Suter TM, Liao R, Colucci WS. Chronic alpha-adrenergic receptor stimulation modulates the contractile phenotype of cardiac myocytes in vitro. Circulation. 2000 Oct 31; 102(18):2249-54.
View in: PubMed
122. Moraes DL, Colucci WS, Givertz MM. Secondary pulmonary hypertension in chronic heart failure: the role of the endothelium in pathophysiology and management. Circulation. 2000 Oct 3; 102(14):1718-23.
View in: PubMed
123. Singh K, Communal C, Colucci WS. Inhibition of protein phosphatase 1 induces apoptosis in neonatal rat cardiac myocytes: role of adrenergic receptor stimulation. Basic Res Cardiol. 2000 Oct; 95(5):389-96.
View in: PubMed
124. Colucci WS, Elkayam U, Horton DP, Abraham WT, Bourge RC, Johnson AD, Wagoner LE, Givertz MM, Liang CS, Neibaur M, Haught WH, LeJemtel TH. Intravenous nesiritide, a natriuretic peptide, in the treatment of decompensated congestive heart failure. Nesiritide Study Group. N Engl J Med. 2000 Jul 27; 343(4):246-53.
View in: PubMed
125. Sam F, Sawyer DB, Chang DL, Eberli FR, Ngoy S, Jain M, Amin J, Apstein CS, Colucci WS. Progressive left ventricular remodeling and apoptosis late after myocardial infarction in mouse heart. Am J Physiol Heart Circ Physiol. 2000 Jul; 279(1):H422-8.
View in: PubMed
126. Givertz MM, Colucci WS, LeJemtel TH, Gottlieb SS, Hare JM, Slawsky MT, Leier CV, Loh E, Nicklas JM, Lewis BE. Acute endothelin A receptor blockade causes selective pulmonary vasodilation in patients with chronic heart failure. Circulation. 2000 Jun 27; 101(25):2922-7.
View in: PubMed
127. Siwik DA, Chang DL, Colucci WS. Interleukin-1beta and tumor necrosis factor-alpha decrease collagen synthesis and increase matrix metalloproteinase activity in cardiac fibroblasts in vitro. Circ Res. 2000 Jun 23; 86(12):1259-65.
View in: PubMed
128. Communal C, Colucci WS, Singh K. p38 mitogen-activated protein kinase pathway protects adult rat ventricular myocytes against beta -adrenergic receptor-stimulated apoptosis. Evidence for Gi-dependent activation. J Biol Chem. 2000 Jun 23; 275(25):19395-400.
View in: PubMed
129. Brooks WW, Bing OH, Boluyt MO, Malhotra A, Morgan JP, Satoh N, Colucci WS, Conrad CH. Altered inotropic responsiveness and gene expression of hypertrophied myocardium with captopril. Hypertension. 2000 Jun; 35(6):1203-9.
View in: PubMed
130. Sanders GP, Mendes LA, Colucci WS, Givertz MM. Noninvasive methods for detecting elevated left-sided cardiac filling pressure. J Card Fail. 2000 Jun; 6(2):157-64.
View in: PubMed
131. Colucci WS, Sawyer DB, Singh K, Communal C. Adrenergic overload and apoptosis in heart failure: implications for therapy. J Card Fail. 2000 Jun; 6(2 Suppl 1):1-7.
View in: PubMed
132. Bisognano JD, Weinberger HD, Bohlmeyer TJ, Pende A, Raynolds MV, Sastravaha A, Roden R, Asano K, Blaxall BC, Wu SC, Communal C, Singh K, Colucci W, Bristow MR, Port DJ. Myocardial-directed overexpression of the human beta(1)-adrenergic receptor in transgenic mice. J Mol Cell Cardiol. 2000 May; 32(5):817-30.
View in: PubMed
133. Sawyer DB, Colucci WS. Mitochondrial oxidative stress in heart failure: “oxygen wastage” revisited. Circ Res. 2000 Feb 4; 86(2):119-20.
View in: PubMed
134. Singh K, Communal C, Sawyer DB, Colucci WS. Adrenergic regulation of myocardial apoptosis. Cardiovasc Res. 2000 Feb; 45(3):713-9.
View in: PubMed
135. Cuffe MS, Califf RM, Adams KF, Bourge RC, Colucci W, Massie B, O’Connor CM, Pina I, Quigg R, Silver M, Robinson LA, Leimberger JD, Gheorghiade M. Rationale and design of the OPTIME CHF trial: outcomes of a prospective trial of intravenous milrinone for exacerbations of chronic heart failure. Am Heart J. 2000 Jan; 139(1 Pt 1):15-22.
View in: PubMed
136. Sawyer DB, Colucci, WS. Myocardial Nitric Oxide in Heart Failure. In: Loscalzo J and Vita JA, (ed): Contemporary Cardiology: Nitric Oxide and the Cardiovascular System. Totowa, NJ:Humana Press Inc. 2000; pp. 309-19.
137. Sawyer DB, Colucci WS. Role of oxidative stress, cytokines and apoptosis in myocardial dysfunction. In: Tardiff J-C and Bourassa MG, ed. Antioxidants and Cardiovascular Disease. Dordrecht:Kluwar. 2000.
138. Communal C, Singh K, Sawyer DB, Colucci WS. Opposing effects of beta(1)- and beta(2)-adrenergic receptors on cardiac myocyte apoptosis : role of a pertussis toxin-sensitive G protein. Circulation. 1999 Nov 30; 100(22):2210-2.
View in: PubMed
139. Sam F, Colucci WS. Role of endothelin-1 in myocardial failure. Proc Assoc Am Physicians. 1999 Sep-Oct; 111(5):417-22.
View in: PubMed
140. Siwik DA, Tzortzis JD, Pimental DR, Chang DL, Pagano PJ, Singh K, Sawyer DB, Colucci WS. Inhibition of copper-zinc superoxide dismutase induces cell growth, hypertrophic phenotype, and apoptosis in neonatal rat cardiac myocytes in vitro. Circ Res. 1999 Jul 23; 85(2):147-53.
View in: PubMed
141. Singh K, Sirokman G, Communal C, Robinson KG, Conrad CH, Brooks WW, Bing OH, Colucci WS. Myocardial osteopontin expression coincides with the development of heart failure. Hypertension. 1999 Feb; 33(2):663-70.
View in: PubMed
142. Givertz MM, Colucci WS. Treatment of heart failure: New approaches. In: “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Second Edition, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 1999.
143. Colucci WS (Editor): Atlas of Heart Failure – Cardiac Function and Dysfunction, Second Edition, Braunwald E (Series Editor). Philadelphia:Current Medicine. 1999.
144. Sawyer DB, Colucci WS. Molecular and cellular events in myocardial hypertrophy and failure. In: “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Second Edition, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 1999.
145. Colucci WS. The effects of norepinephrine on myocardial biology: implications for the therapy of heart failure. Clin Cardiol. 1998 Dec; 21(12 Suppl 1):I20-4.
View in: PubMed
146. Sawyer DB, Colucci WS. Nitric oxide in the failing myocardium. Cardiol Clin. 1998 Nov; 16(4):657-64, viii.
View in: PubMed
147. Communal C, Singh K, Pimentel DR, Colucci WS. Norepinephrine stimulates apoptosis in adult rat ventricular myocytes by activation of the beta-adrenergic pathway. Circulation. 1998 Sep 29; 98(13):1329-34.
View in: PubMed
148. Sam F, Colucci WS. Endothelin-1 in heart failure: does it play a role? Cardiologia. 1998 Sep; 43(9):889-92.
View in: PubMed
149. Pagano PJ, Chanock SJ, Siwik DA, Colucci WS, Clark JK. Angiotensin II induces p67phox mRNA expression and NADPH oxidase superoxide generation in rabbit aortic adventitial fibroblasts. Hypertension. 1998 Aug; 32(2):331-7.
View in: PubMed
150. Givertz MM, Colucci WS. New targets for heart-failure therapy: endothelin, inflammatory cytokines, and oxidative stress. Lancet. 1998 Aug; 352 Suppl 1:SI34-8.
View in: PubMed
151. Eberli FR, Sam F, Ngoy S, Apstein CS, Colucci WS. Left-ventricular structural and functional remodeling in the mouse after myocardial infarction: assessment with the isovolumetrically-contracting Langendorff heart. J Mol Cell Cardiol. 1998 Jul; 30(7):1443-7.
View in: PubMed
152. Lo MW, Toh J, Emmert SE, Ritter MA, Furtek CI, Lu H, Colucci WS, Uretsky BF, Rucinska E. Pharmacokinetics of intravenous and oral losartan in patients with heart failure. J Clin Pharmacol. 1998 Jun; 38(6):525-32.
View in: PubMed
153. Calderone A, Thaik CM, Takahashi N, Chang DL, Colucci WS. Nitric oxide, atrial natriuretic peptide, and cyclic GMP inhibit the growth-promoting effects of norepinephrine in cardiac myocytes and fibroblasts. J Clin Invest. 1998 Feb 15; 101(4):812-8.
View in: PubMed
154. Hare JM, Givertz MM, Creager MA, Colucci WS. Increased sensitivity to nitric oxide synthase inhibition in patients with heart failure: potentiation of beta-adrenergic inotropic responsiveness. Circulation. 1998 Jan 20; 97(2):161-6.
View in: PubMed
155. Colucci WS. Molecular and cellular mechanisms of myocardial failure. Am J Cardiol. 1997 Dec 4; 80(11A):15L-25L.
View in: PubMed
156. Cohn JN, Fowler MB, Bristow MR, Colucci WS, Gilbert EM, Kinhal V, Krueger SK, Lejemtel T, Narahara KA, Packer M, Young ST, Holcslaw TL, Lukas MA. Safety and efficacy of carvedilol in severe heart failure. The U.S. Carvedilol Heart Failure Study Group. J Card Fail. 1997 Sep; 3(3):173-9.
View in: PubMed
157. Givertz MM, Hartley LH, Colucci WS. Long-term sequential changes in exercise capacity and chronotropic responsiveness after cardiac transplantation. Circulation. 1997 Jul 1; 96(1):232-7.
View in: PubMed
158. Hare JM, Shernan SK, Body SC, Graydon E, Colucci WS, Couper GS. Influence of inhaled nitric oxide on systemic flow and ventricular filling pressure in patients receiving mechanical circulatory assistance. Circulation. 1997 May 6; 95(9):2250-3.
View in: PubMed
159. Cohn JN, Bristow MR, Chien KR, Colucci WS, Frazier OH, Leinwand LA, Lorell BH, Moss AJ, Sonnenblick EH, Walsh RA, Mockrin SC, Reinlib L. Report of the National Heart, Lung, and Blood Institute Special Emphasis Panel on Heart Failure Research. Circulation. 1997 Feb 18; 95(4):766-70.
View in: PubMed
160. Colucci WS, Braunwald E. Cardiac tumors, cardiac manifestations of systemic diseases, and traumatic cardiac injury, Chapter 241. In: Fauci AS, Braunwald E, Isselbacher KJ, Wilson JD, Martin JB, Kasper DL, Hauser SL, Longo DL, eds. Harrison’s Principles of Internal Medicine, 14th Edition. New York:McGraw-Hill. 1997; pp 1341-4.
161. Colucci WS, Schoen FJ, Braunwald E. Primary tumors of the heart, Chapter 42. In: Braunwald E, ed. Heart Disease, 5th Edition. Philadelphia:WB Saunders Co. 1997; pp 1464-77.
162. Colucci WS, Braunwald E. Pathophysiology of heart failure, Chapter 13. In: Braunwald E, ed. Heart Disease, 5th Edition. Philadelphia:WB Saunders Co. 1997; pp 394-420.
163. Colucci WS. Heart Failure. In: Essential Atlas of Heart Diseases, First Edition, Braunwald E (Editor–in-Chief). Philadelphia:Current Medicine. 1997.
164. Braunwald E, Colucci WS, Grossman W. Clinical aspects of heart failure, Chapter 15. In: Braunwald E, ed. Heart Disease, 5th Edition. Philadelphia:WB Saunders Co.. 1997; pp 445-70.
165. Newton GE, Parker AB, Landzberg JS, Colucci WS, Parker JD. Muscarinic receptor modulation of basal and beta-adrenergic stimulated function of the failing human left ventricle. J Clin Invest. 1996 Dec 15; 98(12):2756-63.
View in: PubMed
166. Keaney JF, Hare JM, Balligand JL, Loscalzo J, Smith TW, Colucci WS. Inhibition of nitric oxide synthase augments myocardial contractile responses to beta-adrenergic stimulation. Am J Physiol. 1996 Dec; 271(6 Pt 2):H2646-52.
View in: PubMed
167. Faggiano P, Colucci WS. The force-frequency relation in normal and failing heart. Cardiologia. 1996 Dec; 41(12):1155-64.
View in: PubMed
168. Packer M, Colucci WS, Sackner-Bernstein JD, Liang CS, Goldscher DA, Freeman I, Kukin ML, Kinhal V, Udelson JE, Klapholz M, Gottlieb SS, Pearle D, Cody RJ, Gregory JJ, Kantrowitz NE, LeJemtel TH, Young ST, Lukas MA, Shusterman NH. Double-blind, placebo-controlled study of the effects of carvedilol in patients with moderate to severe heart failure. The PRECISE Trial. Prospective Randomized Evaluation of Carvedilol on Symptoms and Exercise. Circulation. 1996 Dec 1; 94(11):2793-9.
View in: PubMed
169. Colucci WS, Packer M, Bristow MR, Gilbert EM, Cohn JN, Fowler MB, Krueger SK, Hershberger R, Uretsky BF, Bowers JA, Sackner-Bernstein JD, Young ST, Holcslaw TL, Lukas MA. Carvedilol inhibits clinical progression in patients with mild symptoms of heart failure. US Carvedilol Heart Failure Study Group. Circulation. 1996 Dec 1; 94(11):2800-6.
View in: PubMed
170. Givertz MM, Hare JM, Loh E, Gauthier DF, Colucci WS. Effect of bolus milrinone on hemodynamic variables and pulmonary vascular resistance in patients with severe left ventricular dysfunction: a rapid test for reversibility of pulmonary hypertension. J Am Coll Cardiol. 1996 Dec; 28(7):1775-80.
View in: PubMed
171. Colucci WS. Apoptosis in the heart. N Engl J Med. 1996 Oct 17; 335(16):1224-6.
View in: PubMed
172. Snider GL, Colucci WS, Sawin CT. A trial of increased access to primary care. N Engl J Med. 1996 Sep 19; 335(12):896; author reply 897-8.
View in: PubMed
173. Packer M, Bristow MR, Cohn JN, Colucci WS, Fowler MB, Gilbert EM, Shusterman NH. The effect of carvedilol on morbidity and mortality in patients with chronic heart failure. U.S. Carvedilol Heart Failure Study Group. N Engl J Med. 1996 May 23; 334(21):1349-55.
View in: PubMed
174. Colucci WS. Myocardial endothelin. Does it play a role in myocardial failure? Circulation. 1996 Mar 15; 93(6):1069-72.
View in: PubMed
175. Maki T, Gruver EJ, Davidoff AJ, Izzo N, Toupin D, Colucci W, Marks AR, Marsh JD. Regulation of calcium channel expression in neonatal myocytes by catecholamines. J Clin Invest. 1996 Feb 1; 97(3):656-63.
View in: PubMed
176. Colucci WS. Pathophysiologic and clinical considerations in the treatment of heart failure: An overview. Chapter 8. In: Cardiovascular Therapeutics, Smith TW (Editor-in-Chief). Philadelphia:WB Saunders. 1996; pp 171-175.
177. Stevenson LW, Colucci WS. Management of patients hospitalized with heart failure, Chapter 10. In Cardiovascular Therapeutics, Smith TW (Editor-in-Chief). Philadelphia:WB Saunders. 1996; pp 199-209.
178. Colucci WS. Principles and practice of inotropic therapy, Chapter 126. In: Messerli FH, ed. Cardiovascular Drug Therapy, 2nd Edition. Philadelphia:WB Saunders Co. 1996; pp 1146-1150.
179. Colucci WS (Section Editor, “Heart Failure”). In: Cardiovascular Therapeutics, Smith TW (Editor-in-Chief). Philadelphia:Saunders. 1996.
180. Calderone A, Takahashi N, Izzo NJ, Thaik CM, Colucci WS. Pressure- and volume-induced left ventricular hypertrophies are associated with distinct myocyte phenotypes and differential induction of peptide growth factor mRNAs. Circulation. 1995 Nov 1; 92(9):2385-90.
View in: PubMed
181. Hare JM, Loh E, Creager MA, Colucci WS. Nitric oxide inhibits the positive inotropic response to beta-adrenergic stimulation in humans with left ventricular dysfunction. Circulation. 1995 Oct 15; 92(8):2198-203.
View in: PubMed
182. Parker JD, Newton GE, Landzberg JS, Floras JS, Colucci WS. Functional significance of presynaptic alpha-adrenergic receptors in failing and nonfailing human left ventricle. Circulation. 1995 Oct 1; 92(7):1793-800.
View in: PubMed
183. Hare JM, Colucci WS. Role of nitric oxide in the regulation of myocardial function. Prog Cardiovasc Dis. 1995 Sep-Oct; 38(2):155-66.
View in: PubMed
184. Thaik CM, Calderone A, Takahashi N, Colucci WS. Interleukin-1 beta modulates the growth and phenotype of neonatal rat cardiac myocytes. J Clin Invest. 1995 Aug; 96(2):1093-9.
View in: PubMed
185. Levy AP, Levy NS, Loscalzo J, Calderone A, Takahashi N, Yeo KT, Koren G, Colucci WS, Goldberg MA. Regulation of vascular endothelial growth factor in cardiac myocytes. Circ Res. 1995 May; 76(5):758-66.
View in: PubMed
186. Loh E, Barnett JV, Feldman AM, Couper GS, Vatner DE, Colucci WS, Galper JB. Decreased adenylate cyclase activity and expression of Gs alpha in human myocardium after orthotopic cardiac transplantation. Circ Res. 1995 May; 76(5):852-60.
View in: PubMed
187. Hare JM, Keaney JF, Balligand JL, Loscalzo J, Smith TW, Colucci WS. Role of nitric oxide in parasympathetic modulation of beta-adrenergic myocardial contractility in normal dogs. J Clin Invest. 1995 Jan; 95(1):360-6.
View in: PubMed
188. Colucci WS (Editor): Atlas of Heart Failure – Cardiac Function and Dysfunction, First Edition, Braunwald E (Series Editor). Philadelphia:Current Medicine. 1995.
189. Colucci WS. Treatment of stable heart failure: New approaches. In “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 1995.
190. Thaik C, Colucci WS. Molecular and cellular abnormalities in hypertrophied and failing myocardium. In “Heart Failure: Cardiac Function and Dysfunction”, Colucci WS (ed): In: Atlas of Heart Diseases, Braunwald E (Editor-in-Chief). Philadelphia:Current Medicine. 1995.
191. Colucci WS. Secondary molecular alterations in failing human myocardium. In: Molecular Interventions and Local Drug Delivery in Cardiovascular Disease, Edelman ER (ed). London:WB Saunders. 1995.
192. Loh E, Stamler JS, Hare JM, Loscalzo J, Colucci WS. Cardiovascular effects of inhaled nitric oxide in patients with left ventricular dysfunction. Circulation. 1994 Dec; 90(6):2780-5.
View in: PubMed
193. Takahashi N, Calderone A, Izzo NJ, Mäki TM, Marsh JD, Colucci WS. Hypertrophic stimuli induce transforming growth factor-beta 1 expression in rat ventricular myocytes. J Clin Invest. 1994 Oct; 94(4):1470-6.
View in: PubMed
194. Izzo NJ, Colucci WS. Regulation of alpha 1B-adrenergic receptor half-life: protein synthesis dependence and effect of norepinephrine. Am J Physiol. 1994 Mar; 266(3 Pt 1):C771-5.
View in: PubMed
195. Izzo NJ, Tulenko TN, Colucci WS. Phorbol esters and norepinephrine destabilize alpha 1B-adrenergic receptor mRNA in vascular smooth muscle cells. J Biol Chem. 1994 Jan 21; 269(3):1705-10.
View in: PubMed
196. Landzberg JS, Parker JD, Gauthier DF, Colucci WS. Effects of intracoronary acetylcholine and atropine on basal and dobutamine-stimulated left ventricular contractility. Circulation. 1994 Jan; 89(1):164-8.
View in: PubMed
197. Matoba Y, Colucci WS, Fields BN, Smith TW. The reovirus M1 gene determines the relative capacity of growth of reovirus in cultured bovine aortic endothelial cells. J Clin Invest. 1993 Dec; 92(6):2883-8.
View in: PubMed
198. Colucci WS, Sonnenblick EH, Adams KF, Berk M, Brozena SC, Cowley AJ, Grabicki JM, Kubo SA, LeJemtel T, Littler WA, et al. Efficacy of phosphodiesterase inhibition with milrinone in combination with converting enzyme inhibitors in patients with heart failure. The Milrinone Multicenter Trials Investigators. J Am Coll Cardiol. 1993 Oct; 22(4 Suppl A):113A-118A.
View in: PubMed
199. Schmidt TA, Allen PD, Colucci WS, Marsh JD, Kjeldsen K. No adaptation to digitalization as evaluated by digitalis receptor (Na,K-ATPase) quantification in explanted hearts from donors without heart disease and from digitalized recipients with end-stage heart failure. Am J Cardiol. 1993 Jan 1; 71(1):110-4.
View in: PubMed
200. Packer M, Narahara KA, Elkayam U, Sullivan JM, Pearle DL, Massie BM, Creager MA, and the Principal Investigators of the Reflect Study. Double-blind, placebo-controlled study of the efficacy of flosequinan in patients with chronic heart failure. J Am Coll Cardiol. 1993; 22:65-72.
201. Colucci WS. In situ assessment of – and -Adrenergic responses in failing human myocardium. Circulation. 1993; 87(Suppl VII):63-7.
202. Feldman AM, Bristow MR, Parmley WW, Carson PE, Pepine CJ, Gilbert EM, Strobeck JE, Hendrix GH, Powers ER, Bain RP, White BH, for the Vesnarinone Study Group. Effects of vesnarinone on morbidity and mortality in patients with heart failure. N Engl J Med. 1993; 329:149-55.
203. Bialecki RA, Kulik TJ, Colucci WS. Stretching increases calcium influx and efflux in cultured pulmonary arterial smooth muscle cells. Am J Physiol. 1992 Nov; 263(5 Pt 1):L602-6.
View in: PubMed
204. Sen L, Bialecki RA, Smith E, Smith TW, Colucci WS. Cholesterol increases the L-type voltage-sensitive calcium channel current in arterial smooth muscle cells. Circ Res. 1992 Oct; 71(4):1008-14.
View in: PubMed
205. Willich SN, Tofler GH, Brezinski DA, Schafer AI, Muller JE, Michel T, Colucci WS. Platelet alpha 2 adrenoceptor characteristics during the morning increase in platelet aggregability. Eur Heart J. 1992 Apr; 13(4):550-5.
View in: PubMed
206. Bialecki RA, Tulenko TN, Colucci WS. Cholesterol enrichment increases basal and agonist-stimulated calcium influx in rat vascular smooth muscle cells. J Clin Invest. 1991 Dec; 88(6):1894-900.
View in: PubMed
207. Kulik TJ, Bialecki RA, Colucci WS, Rothman A, Glennon ET, Underwood RH. Stretch increases inositol trisphosphate and inositol tetrakisphosphate in cultured pulmonary vascular smooth muscle cells. Biochem Biophys Res Commun. 1991 Oct 31; 180(2):982-7.
View in: PubMed
208. Landzberg JS, Parker JD, Gauthier DF, Colucci WS. Effects of myocardial alpha 1-adrenergic receptor stimulation and blockade on contractility in humans. Circulation. 1991 Oct; 84(4):1608-14.
View in: PubMed
209. Parker JD, Landzberg JS, Bittl JA, Mirsky I, Colucci WS. Effects of beta-adrenergic stimulation with dobutamine on isovolumic relaxation in the normal and failing human left ventricle. Circulation. 1991 Sep; 84(3):1040-8.
View in: PubMed
210. Creager MA, Quigg RJ, Ren CJ, Roddy MA, Colucci WS. Limb vascular responsiveness to beta-adrenergic receptor stimulation in patients with congestive heart failure. Circulation. 1991 Jun; 83(6):1873-9.
View in: PubMed
211. Colucci WS. Cardiovascular effects of milrinone. Am Heart J. 1991 Jun; 121(6 Pt 2):1945-7.
View in: PubMed
212. Sperti G, Colucci WS. Calcium influx modulates DNA synthesis and proliferation in A7r5 vascular smooth muscle cells. Eur J Pharmacol. 1991 Apr 25; 206(4):279-84.
View in: PubMed
213. Sen L, Liang BT, Colucci WS, Smith TW. Enhanced alpha 1-adrenergic responsiveness in cardiomyopathic hamster cardiac myocytes. Relation to the expression of pertussis toxin-sensitive G protein and alpha 1-adrenergic receptors. Circ Res. 1990 Nov; 67(5):1182-92.
View in: PubMed
214. Colucci WS. In vivo studies of myocardial beta-adrenergic receptor pharmacology in patients with congestive heart failure. Circulation. 1990 Aug; 82(2 Suppl):I44-51.
View in: PubMed
215. Izzo NJ, Seidman CE, Collins S, Colucci WS. Alpha 1-adrenergic receptor mRNA level is regulated by norepinephrine in rabbit aortic smooth muscle cells. Proc Natl Acad Sci U S A. 1990 Aug; 87(16):6268-71.
View in: PubMed
216. Arnold JM, Ribeiro JP, Colucci WS. Muscle blood flow during forearm exercise in patients with severe heart failure. Circulation. 1990 Aug; 82(2):465-72.
View in: PubMed
217. Creager MA, Hirsch AT, Dzau VJ, Nabel EG, Cutler SS, Colucci WS. Baroreflex regulation of regional blood flow in congestive heart failure. Am J Physiol. 1990 May; 258(5 Pt 2):H1409-14.
View in: PubMed
218. Treasure CB, Vita JA, Cox DA, Fish RD, Gordon JB, Mudge GH, Colucci WS, Sutton MG, Selwyn AP, Alexander RW, et al. Endothelium-dependent dilation of the coronary microvasculature is impaired in dilated cardiomyopathy. Circulation. 1990 Mar; 81(3):772-9.
View in: PubMed
219. Ribeiro JP, White HD, Hartley LH, Colucci WS. Acute increase in exercise capacity with milrinone: lack of correlation with resting hemodynamic responses. Braz J Med Biol Res. 1990; 23(11):1069-78.
View in: PubMed
220. Bialecki RA, Izzo NJ, Colucci WS. Endothelin-1 increases intracellular calcium mobilization but not calcium uptake in rabbit vascular smooth muscle cells. Biochem Biophys Res Commun. 1989 Oct 16; 164(1):474-9.
View in: PubMed
221. Colucci WS. Myocardial and vascular actions of milrinone. Eur Heart J. 1989 Aug; 10 Suppl C:32-8.
View in: PubMed
222. Quigg RJ, Rocco MB, Gauthier DF, Creager MA, Hartley LH, Colucci WS. Mechanism of the attenuated peak heart rate response to exercise after orthotopic cardiac transplantation. J Am Coll Cardiol. 1989 Aug; 14(2):338-44.
View in: PubMed
223. Colucci WS, Ribeiro JP, Rocco MB, Quigg RJ, Creager MA, Marsh JD, Gauthier DF, Hartley LH. Impaired chronotropic response to exercise in patients with congestive heart failure. Role of postsynaptic beta-adrenergic desensitization. Circulation. 1989 Aug; 80(2):314-23.
View in: PubMed
224. Denniss AR, Colucci WS, Allen PD, Marsh JD. Distribution and function of human ventricular beta adrenergic receptors in congestive heart failure. J Mol Cell Cardiol. 1989 Jul; 21(7):651-60.
View in: PubMed
225. Denniss AR, Marsh JD, Quigg RJ, Gordon JB, Colucci WS. Beta-adrenergic receptor number and adenylate cyclase function in denervated transplanted and cardiomyopathic human hearts. Circulation. 1989 May; 79(5):1028-34.
View in: PubMed
226. Colucci WS. Positive inotropic/vasodilator agents. Cardiol Clin. 1989 Feb; 7(1):131-44.
View in: PubMed
227. Colucci WS. Observations on the intracoronary administration of milrinone and dobutamine to patients with congestive heart failure. Am J Cardiol. 1989 Jan 3; 63(2):17A-22A.
View in: PubMed
228. Arai Y, Saul JP, Albrecht P, Hartley LH, Lilly LS, Cohen RJ, Colucci WS. Modulation of cardiac autonomic activity during and immediately after exercise. Am J Physiol. 1989 Jan; 256(1 Pt 2):H132-41.
View in: PubMed
229. Colucci WS, Parker JD. Effects of beta-adrenergic agents on systolic and diastolic myocardial function in patients with and without heart failure. J Cardiovasc Pharmacol. 1989; 14 Suppl 5:S28-37.
View in: PubMed
230. Leatherman GF, Shook TL, Leatherman SM, Colucci WS. Use of a conductance catheter to detect increased left ventricular inotropic state by end-systolic pressure-volume analysis. Basic Res Cardiol. 1989; 84 Suppl 1:247-56.
View in: PubMed
231. Colucci WS, Akers M, Wise GM. Differential effects of norepinephrine and phorbol ester on alpha-1 adrenergic receptor number and surface-accessibility in DDT1 MF-2 cells. Biochem Biophys Res Commun. 1988 Oct 31; 156(2):924-30.
View in: PubMed
232. Colucci WS. Do positive inotropic agents adversely affect the survival of patients with chronic congestive heart failure? III. Antagonist’s viewpoint. J Am Coll Cardiol. 1988 Aug; 12(2):566-9.
View in: PubMed
233. Creager MA, Hirsch AT, Nabel EG, Cutler SS, Colucci WS, Dzau VJ. Responsiveness of atrial natriuretic factor to reduction in right atrial pressure in patients with chronic congestive heart failure. J Am Coll Cardiol. 1988 Jun; 11(6):1191-8.
View in: PubMed
234. Saul JP, Arai Y, Berger RD, Lilly LS, Colucci WS, Cohen RJ. Assessment of autonomic regulation in chronic congestive heart failure by heart rate spectral analysis. Am J Cardiol. 1988 Jun 1; 61(15):1292-9.
View in: PubMed
235. Lee RT, Mudge GH, Colucci WS. Coronary artery fistula after mitral valve surgery. Am Heart J. 1988 May; 115(5):1128-30.
View in: PubMed
236. Fish RD, Sperti G, Colucci WS, Clapham DE. Phorbol ester increases the dihydropyridine-sensitive calcium conductance in a vascular smooth muscle cell line. Circ Res. 1988 May; 62(5):1049-54.
View in: PubMed
237. Colucci WS, Denniss AR, Leatherman GF, Quigg RJ, Ludmer PL, Marsh JD, Gauthier DF. Intracoronary infusion of dobutamine to patients with and without severe congestive heart failure. Dose-response relationships, correlation with circulating catecholamines, and effect of phosphodiesterase inhibition. J Clin Invest. 1988 Apr; 81(4):1103-10.
View in: PubMed
238. Givertz MM, Colucci WS. Inotropic and vasoactive agents in the cardiac intensive care unit, Chapter 45. In: Brown DL, ed. Cardiac Intensive Care. Philadelphia:WB Saunders Co. 1988; pp. 545-54.
239. Colucci WS, Leatherman GF, Ludmer PL, Gauthier DF. Beta-adrenergic inotropic responsiveness of patients with heart failure: studies with intracoronary dobutamine infusion. Circ Res. 1987 Oct; 61(4 Pt 2):I82-6.
View in: PubMed
240. Nabel EG, Colucci WS, Lilly LS, Cutler SS, Majzoub JA, St John Sutton MG, Dzau VJ, Creager MA. Relationship of cardiac chamber volume to baroreflex activity in normal humans. J Clin Endocrinol Metab. 1987 Sep; 65(3):475-81.
View in: PubMed
241. Ribeiro JP, Knutzen A, Rocco MB, Hartley LH, Colucci WS. Periodic breathing during exercise in severe heart failure. Reversal with milrinone or cardiac transplantation. Chest. 1987 Sep; 92(3):555-6.
View in: PubMed
242. Ludmer PL, Baim DS, Antman EM, Gauthier DF, Rocco MB, Friedman PL, Colucci WS. Effects of milrinone on complex ventricular arrhythmias in congestive heart failure secondary to ischemic or idiopathic dilated cardiomyopathy. Am J Cardiol. 1987 Jun 1; 59(15):1351-5.
View in: PubMed
243. Colucci WS. Usefulness of calcium antagonists for congestive heart failure. Am J Cardiol. 1987 Jan 30; 59(3):52B-58B.
View in: PubMed
244. Ribeiro JP, White HD, Arnold JM, Hartley LH, Colucci WS. Exercise responses before and after long-term treatment with oral milrinone in patients with severe heart failure. Am J Med. 1986 Nov; 81(5):759-64.
View in: PubMed
245. Arnold JM, Ludmer PL, Wright RF, Ganz P, Braunwald E, Colucci WS. Role of reflex sympathetic withdrawal in the hemodynamic response to an increased inotropic state in patients with severe heart failure. J Am Coll Cardiol. 1986 Aug; 8(2):413-8.
View in: PubMed
246. Baim DS, Colucci WS, Monrad ES, Smith HS, Wright RF, Lanoue A, Gauthier DF, Ransil BJ, Grossman W, Braunwald E. Survival of patients with severe congestive heart failure treated with oral milrinone. J Am Coll Cardiol. 1986 Mar; 7(3):661-70.
View in: PubMed
247. Colucci WS, Wright RF, Jaski BE, Fifer MA, Braunwald E. Milrinone and dobutamine in severe heart failure: differing hemodynamic effects and individual patient responsiveness. Circulation. 1986 Mar; 73(3 Pt 2):III175-83.
View in: PubMed
248. Colucci WS, Alexander RW. Norepinephrine-induced alteration in the coupling of alpha 1-adrenergic receptor occupancy to calcium efflux in rabbit aortic smooth muscle cells. Proc Natl Acad Sci U S A. 1986 Mar; 83(6):1743-6.
View in: PubMed
249. Colucci WS, Gimbrone MA, Alexander RW. Phorbol diester modulates alpha-adrenergic receptor-coupled calcium efflux and alpha-adrenergic receptor number in cultured vascular smooth muscle cells. Circ Res. 1986 Mar; 58(3):393-8.
View in: PubMed
250. Colucci WS, Wright RF, Braunwald E. New positive inotropic agents in the treatment of congestive heart failure. Mechanisms of action and recent clinical developments. 2. N Engl J Med. 1986 Feb 6; 314(6):349-58.
View in: PubMed
251. Colucci WS. Adenosine 3′,5′-cyclic-monophosphate-dependent regulation of alpha 1-adrenergic receptor number in rabbit aortic smooth muscle cells. Circ Res. 1986 Feb; 58(2):292-7.
View in: PubMed
252. Colucci WS, Wright RF, Braunwald E. New positive inotropic agents in the treatment of congestive heart failure. Mechanisms of action and recent clinical developments. 1. N Engl J Med. 1986 Jan 30; 314(5):290-9.
View in: PubMed
253. Ludmer PL, Wright RF, Arnold JM, Ganz P, Braunwald E, Colucci WS. Separation of the direct myocardial and vasodilator actions of milrinone administered by an intracoronary infusion technique. Circulation. 1986 Jan; 73(1):130-7.
View in: PubMed
254. Powers RE, Colucci WS. An increase in putative voltage dependent calcium channel number following reserpine treatment. Biochem Biophys Res Commun. 1985 Oct 30; 132(2):844-9.
View in: PubMed
255. White HD, Ribeiro JP, Hartley LH, Colucci WS. Immediate effects of milrinone on metabolic and sympathetic responses to exercise in severe congestive heart failure. Am J Cardiol. 1985 Jul 1; 56(1):93-8.
View in: PubMed
256. Colucci WS, Brock TA, Gimbrone MA, Alexander RW. Nonlinear relationship between alpha 1-adrenergic receptor occupancy and norepinephrine-stimulated calcium flux in cultured vascular smooth muscle cells. Mol Pharmacol. 1985 May; 27(5):517-24.
View in: PubMed
257. Kern MJ, Horowitz JD, Ganz P, Gaspar J, Colucci WS, Lorell BH, Barry WH, Mudge GH. Attenuation of coronary vascular resistance by selective alpha 1-adrenergic blockade in patients with coronary artery disease. J Am Coll Cardiol. 1985 Apr; 5(4):840-6.
View in: PubMed
258. Fifer MA, Colucci WS, Lorell BH, Jaski BE, Barry WH. Inotropic, vascular and neuroendocrine effects of nifedipine in heart failure: comparison with nitroprusside. J Am Coll Cardiol. 1985 Mar; 5(3):731-7.
View in: PubMed
259. Colucci WS, Fifer MA, Lorell BH, Wynne J. Calcium channel blockers in congestive heart failure: theoretic considerations and clinical experience. Am J Med. 1985 Feb 22; 78(2B):9-17.
View in: PubMed
260. Jaski BE, Fifer MA, Wright RF, Braunwald E, Colucci WS. Positive inotropic and vasodilator actions of milrinone in patients with severe congestive heart failure. Dose-response relationships and comparison to nitroprusside. J Clin Invest. 1985 Feb; 75(2):643-9.
View in: PubMed
261. Colucci WS, Ludmer PL, Wright RF, Arnold JM, Ganz P, Braunwald E. Myocardial and vascular effects of intracoronary versus intravenous milrinone. Trans Assoc Am Physicians. 1985; 98:136-45.
View in: PubMed
262. Colucci WS, Brock TA, Atkinson WJ, Alexander RW, Gimbrone MA. Cultured vascular smooth muscle cells: an in vitro system for study of alpha-adrenergic receptor coupling and regulation. J Cardiovasc Pharmacol. 1985; 7 Suppl 6:S79-86.
View in: PubMed
263. Monrad ES, McKay RG, Baim DS, Colucci WS, Fifer MA, Heller GV, Royal HD, Grossman W. Improvement in indexes of diastolic performance in patients with congestive heart failure treated with milrinone. Circulation. 1984 Dec; 70(6):1030-7.
View in: PubMed
264. Colucci WS, Gimbrone MA, Alexander RW. Regulation of myocardial and vascular alpha-adrenergic receptor affinity. Effects of guanine nucleotides, cations, estrogen, and catecholamine depletion. Circ Res. 1984 Jul; 55(1):78-88.
View in: PubMed
265. Braunwald E, Colucci WS. Evaluating the efficacy of new inotropic agents. J Am Coll Cardiol. 1984 Jun; 3(6):1570-4.
View in: PubMed
266. Ganz P, Gaspar J, Colucci WS, Barry WH, Mudge GH, Alexander RW. Effects of prostacyclin on coronary hemodynamics at rest and in response to cold pressor testing in patients with angina pectoris. Am J Cardiol. 1984 Jun 1; 53(11):1500-4.
View in: PubMed
267. Colucci WS, Brock TA, Gimbrone MA, Alexander RW. Regulation of alpha 1-adrenergic receptor-coupled calcium flux in cultured vascular smooth muscle cells. Hypertension. 1984 Mar-Apr; 6(2 Pt 2):I19-24.
View in: PubMed
268. Braunwald E, Colucci WS. Vasodilator therapy of heart failure. Has the promissory note been paid? N Engl J Med. 1984 Feb 16; 310(7):459-61.
View in: PubMed
269. Colucci WS, Braunwald E. Adrenergic receptors: new concepts and implications for cardiovascular therapeutics. Cardiovasc Clin. 1984; 14(3):39-59.
View in: PubMed
270. Colucci WS, Jaski BE, Fifer MA, Wright RF, Braunwald E. Milrinone: a positive inotropic vasodilator. Trans Assoc Am Physicians. 1984; 97:124-33.
View in: PubMed
271. Polak JF, Holman BL, Wynne J, Colucci WS. Right ventricular ejection fraction: an indicator of increased mortality in patients with congestive heart failure associated with coronary artery disease. J Am Coll Cardiol. 1983 Aug; 2(2):217-24.
View in: PubMed
272. Colucci WS. New developments in alpha-adrenergic receptor pharmacology: implications for the initial treatment of hypertension. Am J Cardiol. 1983 Feb 24; 51(4):639-43.
View in: PubMed
273. Colucci WS, Lorell BH, Schoen FJ, Warhol MJ, Grossman W. Hypertrophic obstructive cardiomyopathy due to Fabry’s disease. N Engl J Med. 1982 Oct 7; 307(15):926-8.
View in: PubMed
274. Colucci WS. Alpha-adrenergic receptor blockade with prazosin. Consideration of hypertension, heart failure, and potential new applications. Ann Intern Med. 1982 Jul; 97(1):67-77.
View in: PubMed
275. Colucci WS, Gimbrone MA, McLaughlin MK, Halpern W, Alexander RW. Increased vascular catecholamine sensitivity and alpha-adrenergic receptor affinity in female and estrogen-treated male rats. Circ Res. 1982 Jun; 50(6):805-11.
View in: PubMed
276. Rude RE, Grossman W, Colucci WS, Benotti JR, Carabello BA, Wynne J, Malacoff R, Braunwald E. Problems in assessment of new pharmacologic agents for the heart failure patient. Am Heart J. 1981 Sep; 102(3 Pt 2):584-90.
View in: PubMed
277. Colucci WS, Alexander RW, Mudge GH, Rude RE, Holman BL, Wynne J, Grossman W, Braunwald E. Acute and chronic effects of pirbuterol on left ventricular ejection fraction and clinical status in severe congestive heart failure. Am Heart J. 1981 Sep; 102(3 Pt 2):564-8.
View in: PubMed
278. Colucci WS, Williams GH, Braunwald E. Clinical, hemodynamic, and neuroendocrine effects of chronic prazosin therapy for congestive heart failure. Am Heart J. 1981 Sep; 102(3 Pt 2):615-21.
View in: PubMed
279. Colucci WS, Alexander RW, Williams GH, Rude RE, Holman BL, Konstam MA, Wynne J, Mudge GH, Braunwald E. Decreased lymphocyte beta-adrenergic-receptor density in patients with heart failure and tolerance to the beta-adrenergic agonist pirbuterol. N Engl J Med. 1981 Jul 23; 305(4):185-90.
View in: PubMed
280. Colucci WS, Holman BL, Wynne J, Carabello B, Malacoff R, Grossman W, Braunwald E. Improved right ventricular function and reduced pulmonary vascular resistance during prazosin therapy of congestive heart failure. Am J Med. 1981 Jul; 71(1):75-80.
View in: PubMed
281. Colucci WS, Williams GH, Alexander RW, Braunwald E. Mechanisms and implications of vasodilator tolerance in the treatment of congestive heart failure. Am J Med. 1981 Jul; 71(1):89-99.
View in: PubMed
282. Rude RE, Turi Z, Brown EJ, Lorell BH, Colucci WS, Mudge GH, Taylor CR, Grossman W. Acute effects of oral pirbuterol on myocardial oxygen metabolism and systemic hemodynamics in chronic congestive heart failure. Circulation. 1981 Jul; 64(1):139-45.
View in: PubMed
283. Dzau VJ, Colucci WS, Hollenberg NK, Williams GH. Relation of the renin-angiotensin-aldosterone system to clinical state in congestive heart failure. Circulation. 1981 Mar; 63(3):645-51.
View in: PubMed
284. Colucci WS, Gimbrone MA, Alexander RW. Regulation of the postsynaptic alpha-adrenergic receptor in rat mesenteric artery. Effects of chemical sympathectomy and epinephrine treatment. Circ Res. 1981 Jan; 48(1):104-11.
View in: PubMed
285. Colucci WS, Williams GH, Braunwald E. Increased plasma norepinephrine levels during prazosin therapy for severe congestive heart failure. Ann Intern Med. 1980 Sep; 93(3):452-3.
View in: PubMed
286. Dzau VJ, Colucci WS, Williams GH, Curfman G, Meggs L, Hollenberg NK. Sustained effectiveness of converting-enzyme inhibition in patients with severe congestive heart failure. N Engl J Med. 1980 Jun 19; 302(25):1373-9.
View in: PubMed
287. Colucci WS, Gimbrone MA, Alexander RW. Characterization of postsynaptic alpha-adrenergic receptors by [3H]-dihydroergocryptine binding in muscular arteries from the rat mesentery. Hypertension. 1980 Mar-Apr; 2(2):149-55.
View in: PubMed
288. Colucci WS, Wynne J, Holman BL, Braunwald E. Long-term therapy of heart failure with prazosin: a randomized double blind trial. Am J Cardiol. 1980 Feb; 45(2):337-44.
View in: PubMed
289. Poole-Wilson PA, Colucci WS, Chatterjee K, Coats AJS, Massie BM (Editors). Heart Failure. New York:Churchill Livingstone. 1977.

Publications on Heart Failure by Prof. William Gregory Stevenson, M.D.

Title Professor of Medicine
Institution Brigham and Women’s Hospital
Department Medicine
Address Brigham and Women’s Hospital Cardiovascular 75 Francis St Boston MA 02115
Phone 617/732-7535
Fax 617/732-7134
  1. Givertz MM, Teerlink JR, Albert NM, Westlake Canary CA, Collins SP, Colvin-Adams M, Ezekowitz JA, Fang JC, Hernandez AF, Katz SD, Krishnamani R, Stough WG, Walsh MN, Butler J, Carson PE, Dimarco JP, Hershberger RE, Rogers JG, Spertus JA, Stevenson WG, Sweitzer NK, Tang WH, Starling RC. Acute decompensated heart failure: update on new and emerging evidence and directions for future research. J Card Fail. 2013 Jun; 19(6):371-89.
    View in: PubMed
  2. Tokuda M, Kojodjojo P, Tung S, Tedrow UB, Nof E, Inada K, Koplan BA, Michaud GF, John RM, Epstein LM, Stevenson WG. Acute failure of catheter ablation for ventricular tachycardia due to structural heart disease: causes and significance. J Am Heart Assoc. 2013; 2(3):e000072.
    View in: PubMed
  3. Ng J, Barbhaiya C, Chopra N, Reichlin T, Nof E, Tadros T, Stevenson WG, John RM. Automatic external defibrillators-friend or foe? Am J Emerg Med. 2013 Aug; 31(8):1292.e1-2.
    View in: PubMed
  4. Steven D, Sultan A, Reddy V, Luker J, Altenburg M, Hoffmann B, Rostock T, Servatius H, Stevenson WG, Willems S, Michaud GF. Benefit of pulmonary vein isolation guided by loss of pace capture on the ablation line: results from a prospective 2-center randomized trial. J Am Coll Cardiol. 2013 Jul 2; 62(1):44-50.
    View in: PubMed
  5. Kojodjojo P, Tokuda M, Bohnen M, Michaud GF, Koplan BA, Epstein LM, Albert CM, John RM, Stevenson WG, Tedrow UB. Electrocardiographic left ventricular scar burden predicts clinical outcomes following infarct-related ventricular tachycardia ablation. Heart Rhythm. 2013 Aug; 10(8):1119-24.
    View in: PubMed
  6. Nof E, Stevenson WG, Epstein LM, Tedrow UB, Koplan BA. Catheter Ablation of Atrial Arrhythmias After Cardiac Transplantation: Findings at EP Study Utility of 3-D Mapping and Outcomes. J Cardiovasc Electrophysiol. 2013 May; 24(5):498-502.
    View in: PubMed
  7. Michaud GF, Stevenson WG. Feeling a little loopy? J Cardiovasc Electrophysiol. 2013 May; 24(5):553-5.
    View in: PubMed
  8. Epstein AE, Dimarco JP, Ellenbogen KA, Estes NA, Freedman RA, Gettes LS, Gillinov AM, Gregoratos G, Hammill SC, Hayes DL, Hlatky MA, Newby LK, Page RL, Schoenfeld MH, Silka MJ, Stevenson LW, Sweeney MO, Tracy CM, Epstein AE, Darbar D, Dimarco JP, Dunbar SB, Estes NA, Ferguson TB, Hammill SC, Karasik PE, Link MS, Marine JE, Schoenfeld MH, Shanker AJ, Silka MJ, Stevenson LW, Stevenson WG, Varosy PD, Anderson JL, Jacobs AK, Halperin JL, Albert NM, Creager MA, Demets D, Ettinger SM, Guyton RA, Hochman JS, Kushner FG, Ohman EM, Stevenson W, Yancy CW. 2012 ACCF/AHA/HRS Focused Update Incorporated Into the ACCF/AHA/HRS 2008 Guidelines for Device-Based Therapy of Cardiac Rhythm Abnormalities: A Report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines and the Heart Rhythm Society. Circulation. 2013 Jan 22; 127(3):e283-352.
    View in: PubMed
  9. Tracy CM, Epstein AE, Darbar D, Dimarco JP, Dunbar SB, Mark Estes NA, Ferguson TB, Hammill SC, Karasik PE, Link MS, Marine JE, Schoenfeld MH, Shanker AJ, Silka MJ, Stevenson LW, Stevenson WG, Varosy PD, Epstein AE, Dimarco JP, Ellenbogen KA, Mark Estes NA, Freedman RA, Gettes LS, Marc Gillinov A, Gregoratos G, Hammill SC, Hayes DL, Hlatky MA, Kristin Newby L, Page RL, Schoenfeld MH, Silka MJ, Warner Stevenson L, Sweeney MO, Anderson JL, Jacobs AK, Halperin JL, Albert NM, Creager MA, Demets D, Ettinger SM, Guyton RA, Hochman JS, Kushner FG, Ohman EM, Stevenson W, Yancy CW. 2012 ACCF/AHA/HRS focused update of the 2008 guidelines for device-based therapy of cardiac rhythm abnormalities: A report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. J Thorac Cardiovasc Surg. 2012 Dec; 144(6):e127-45.
    View in: PubMed
  10. John RM, Tedrow UB, Koplan BA, Albert CM, Epstein LM, Sweeney MO, Miller AL, Michaud GF, Stevenson WG. Ventricular arrhythmias and sudden cardiac death. Lancet. 2012 Oct 27; 380(9852):1520-9.
    View in: PubMed
  11. Tracy CM, Epstein AE, Darbar D, DiMarco JP, Dunbar SB, Estes NA, Ferguson TB, Hammill SC, Karasik PE, Link MS, Marine JE, Schoenfeld MH, Shanker AJ, Silka MJ, Stevenson LW, Stevenson WG, Varosy PD, Ellenbogen KA, Freedman RA, Gettes LS, Gillinov AM, Gregoratos G, Hayes DL, Page RL, Stevenson LW, Sweeney MO. 2012 ACCF/AHA/HRS focused update of the 2008 guidelines for device-based therapy of cardiac rhythm abnormalities: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Circulation. 2012 Oct 2; 126(14):1784-800.
    View in: PubMed
  12. Tracy CM, Epstein AE, Darbar D, Dimarco JP, Dunbar SB, Estes NA, Ferguson TB, Hammill SC, Karasik PE, Link MS, Marine JE, Schoenfeld MH, Shanker AJ, Silka MJ, Stevenson LW, Stevenson WG, Varosy PD. 2012 ACCF/AHA/HRS Focused Update of the 2008 Guidelines for Device-Based Therapy of Cardiac Rhythm Abnormalities: a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Heart Rhythm. 2012 Oct; 9(10):1737-53.
    View in: PubMed
  13. Tokuda M, Tedrow UB, Kojodjojo P, Inada K, Koplan BA, Michaud GF, John RM, Epstein LM, Stevenson WG. Catheter ablation of ventricular tachycardia in nonischemic heart disease. Circ Arrhythm Electrophysiol. 2012 Oct 1; 5(5):992-1000.
    View in: PubMed
  14. John RM, Stevenson WG. Ventricular arrhythmias in patients with implanted cardioverter defibrillators. Trends Cardiovasc Med. 2012 Oct; 22(7):169-73.
    View in: PubMed
  15. Waldo AL, Wilber DJ, Marchlinski FE, Stevenson WG, Aker B, Boo LM, Jackman WM. Safety of the open-irrigated ablation catheter for radiofrequency ablation: safety analysis from six clinical studies. Pacing Clin Electrophysiol. 2012 Sep; 35(9):1081-9.
    View in: PubMed
  16. Tedrow UB, Sobieszczyk P, Stevenson WG. Transvenous ethanol ablation of ventricular tachycardia. Heart Rhythm. 2012 Oct; 9(10):1640-1.
    View in: PubMed
  17. Stevenson WG, Tedrow UB. Ablation for ventricular tachycardia during stable sinus rhythm. Circulation. 2012 May 8; 125(18):2175-7.
    View in: PubMed
  18. Wissner E, Stevenson WG, Kuck KH. Catheter ablation of ventricular tachycardia in ischaemic and non-ischaemic cardiomyopathy: where are we today? A clinical review. Eur Heart J. 2012 Jun; 33(12):1440-50.
    View in: PubMed
  19. Vollmann D, Stevenson WG, Lüthje L, Sohns C, John RM, Zabel M, Michaud GF. Misleading long post-pacing interval after entrainment of typical atrial flutter from the cavotricuspid isthmus. J Am Coll Cardiol. 2012 Feb 28; 59(9):819-24.
    View in: PubMed
  20. Stevenson WG, Hernandez AF, Carson PE, Fang JC, Katz SD, Spertus JA, Sweitzer NK, Tang WH, Albert NM, Butler J, Westlake Canary CA, Collins SP, Colvin-Adams M, Ezekowitz JA, Givertz MM, Hershberger RE, Rogers JG, Teerlink JR, Walsh MN, Stough WG, Starling RC. Indications for cardiac resynchronization therapy: 2011 update from the Heart Failure Society of America Guideline Committee. J Card Fail. 2012 Feb; 18(2):94-106.
    View in: PubMed
  21. Inada K, Tokuda M, Roberts-Thomson KC, Steven D, Seiler J, Tedrow UB, Stevenson WG. Relation of high-pass filtered unipolar electrograms to bipolar electrograms during ventricular mapping. Pacing Clin Electrophysiol. 2012 Feb; 35(2):157-63.
    View in: PubMed
  22. Albert CM, Chen PS, Anderson ME, Cain ME, Fishman GI, Narayan SM, Olgin JE, Spooner PM, Stevenson WG, Van Wagoner DR, Packer DL. Full report from the first annual Heart Rhythm Society Research Forum: a vision for our research future, “dream, discover, develop, deliver”. Heart Rhythm. 2011 Dec; 8(12):e1-12.
    View in: PubMed
  23. Stevenson WG, John RM. Ventricular arrhythmias in patients with implanted defibrillators. Circulation. 2011 Oct 18; 124(16):e411-4.
    View in: PubMed
  24. Tokuda M, Sobieszczyk P, Eisenhauer AC, Kojodjojo P, Inada K, Koplan BA, Michaud GF, John RM, Epstein LM, Sacher F, Stevenson WG, Tedrow UB. Transcoronary ethanol ablation for recurrent ventricular tachycardia after failed catheter ablation: an update. Circ Arrhythm Electrophysiol. 2011 Dec; 4(6):889-96.
    View in: PubMed
  25. John RM, Stevenson WG. Catheter-based ablation for ventricular arrhythmias. Curr Cardiol Rep. 2011 Oct; 13(5):399-406.
    View in: PubMed
  26. Martinek M, Stevenson WG, Inada K, Tokuda M, Tedrow UB. QRS characteristics fail to reliably identify ventricular tachycardias that require epicardial ablation in ischemic heart disease. J Cardiovasc Electrophysiol. 2012 Feb; 23(2):188-93.
    View in: PubMed
  27. Asimaki A, Tandri H, Duffy ER, Winterfield JR, Mackey-Bojack S, Picken MM, Cooper LT, Wilber DJ, Marcus FI, Basso C, Thiene G, Tsatsopoulou A, Protonotarios N, Stevenson WG, McKenna WJ, Gautam S, Remick DG, Calkins H, Saffitz JE. Altered desmosomal proteins in granulomatous myocarditis and potential pathogenic links to arrhythmogenic right ventricular cardiomyopathy. Circ Arrhythm Electrophysiol. 2011 Oct; 4(5):743-52.
    View in: PubMed
  28. Wijnmaalen AP, Roberts-Thomson KC, Steven D, Klautz RJ, Willems S, Schalij MJ, Stevenson WG, Zeppenfeld K. Catheter ablation of ventricular tachycardia after left ventricular reconstructive surgery for ischemic cardiomyopathy. Heart Rhythm. 2012 Jan; 9(1):10-7.
    View in: PubMed
  29. Stevenson WG, Couper GS. A surgical option for ventricular tachycardia caused by nonischemic cardiomyopathy. Circ Arrhythm Electrophysiol. 2011 Aug; 4(4):429-31.
    View in: PubMed
  30. Tokuda M, Kojodjojo P, Epstein LM, Koplan BA, Michaud GF, Tedrow UB, Stevenson WG, John RM. Outcomes of cardiac perforation complicating catheter ablation of ventricular arrhythmias. Circ Arrhythm Electrophysiol. 2011 Oct; 4(5):660-6.
    View in: PubMed
  31. Kosmidou I, Inada K, Seiler J, Koplan B, Stevenson WG, Tedrow UB. Role of repeat procedures for catheter ablation of postinfarction ventricular tachycardia. Heart Rhythm. 2011 Oct; 8(10):1516-22.
    View in: PubMed
  32. Bohnen M, Stevenson WG, Tedrow UB, Michaud GF, John RM, Epstein LM, Albert CM, Koplan BA. Incidence and predictors of major complications from contemporary catheter ablation to treat cardiac arrhythmias. Heart Rhythm. 2011 Nov; 8(11):1661-6.
    View in: PubMed
  33. Wijnmaalen AP, Stevenson WG, Schalij MJ, Field ME, Stephenson K, Tedrow UB, Koplan BA, Putter H, Epstein LM, Zeppenfeld K. ECG identification of scar-related ventricular tachycardia with a left bundle-branch block configuration. Circ Arrhythm Electrophysiol. 2011 Aug; 4(4):486-93.
    View in: PubMed
  34. Steven D, Roberts-Thomson KC, Inada K, Seiler J, Koplan BA, Tedrow UB, Sweeney MO, Epstein LE, Stevenson WG. Long-term follow-up in patients with presumptive Brugada syndrome treated with implanted defibrillators. J Cardiovasc Electrophysiol. 2011 Oct; 22(10):1115-9.
    View in: PubMed
  35. Bohnen M, Shea JB, Michaud GF, John R, Stevenson WG, Epstein LM, Tedrow UB, Albert C, Koplan BA. Quality of life with atrial fibrillation: do the spouses suffer as much as the patients? Pacing Clin Electrophysiol. 2011 Jul; 34(7):804-9.
    View in: PubMed
  36. Fuster V, Rydén LE, Cannom DS, Crijns HJ, Curtis AB, Ellenbogen KA, Halperin JL, Kay GN, Le Huezey JY, Lowe JE, Olsson SB, Prystowsky EN, Tamargo JL, Wann LS, Smith SC, Priori SG, Estes NA, Ezekowitz MD, Jackman WM, January CT, Lowe JE, Page RL, Slotwiner DJ, Stevenson WG, Tracy CM, Jacobs AK, Anderson JL, Albert N, Buller CE, Creager MA, Ettinger SM, Guyton RA, Halperin JL, Hochman JS, Kushner FG, Ohman EM, Stevenson WG, Tarkington LG, Yancy CW. 2011 ACCF/AHA/HRS focused updates incorporated into the ACC/AHA/ESC 2006 guidelines for the management of patients with atrial fibrillation: a report of the American College of Cardiology Foundation/American Heart Association Task Force on practice guidelines. Circulation. 2011 Mar 15; 123(10):e269-367.
    View in: PubMed
  37. Wann LS, Curtis AB, Ellenbogen KA, Estes NA, Ezekowitz MD, Jackman WM, January CT, Lowe JE, Page RL, Slotwiner DJ, Stevenson WG, Tracy CM, Fuster V, Rydén LE, Cannom DS, Crijns HJ, Curtis AB, Ellenbogen KA, Halperin JL, Kay GN, Le Heuzey JY, Lowe JE, Olsson SB, Prystowsky EN, Tamargo JL, Wann LS, Jacobs AK, Anderson JL, Albert N, Creager MA, Ettinger SM, Guyton RA, Halperin JL, Hochman JS, Kushner FG, Ohman EM, Stevenson WG, Yancy CW. 2011 ACCF/AHA/HRS focused update on the management of patients with atrial fibrillation (update on Dabigatran): a report of the American College of Cardiology Foundation/American Heart Association Task Force on practice guidelines. Circulation. 2011 Mar 15; 123(10):1144-50.
    View in: PubMed
  38. Wann LS, Curtis AB, Ellenbogen KA, Estes NA, Ezekowitz MD, Jackman WM, January CT, Lowe JE, Page RL, Slotwiner DJ, Stevenson WG, Tracy CM. 2011 ACCF/AHA/HRS focused update on the management of patients with atrial fibrillation (update on dabigatran): a report of the American College of Cardiology Foundation/American Heart Association Task Force on practice guidelines. J Am Coll Cardiol. 2011 Mar 15; 57(11):1330-7.
    View in: PubMed
  39. Wann LS, Curtis AB, Ellenbogen KA, Estes NA, Ezekowitz MD, Jackman WM, January CT, Lowe JE, Page RL, Slotwiner DJ, Stevenson WG, Tracy CM, Fuster V, Rydén LE, Cannom DS, Crijns HJ, Curtis AB, Ellenbogen KA, Halperin JL, Kay GN, Le Heuzey JY, Lowe JE, Olsson SB, Prystowsky EN, Tamargo JL, Wann LS, Jacobs AK, Anderson JL, Albert N, Creager MA, Ettinger SM, Guyton RA, Halperin JL, Hochman JS, Kushner FG, Ohman EM, Stevenson WG, Yancy CW. 2011 ACCF/AHA/HRS focused update on the management of patients with atrial fibrillation (update on dabigatran). A report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Heart Rhythm. 2011 Mar; 8(3):e1-8.
    View in: PubMed
  40. Dukkipati SR, d’Avila A, Soejima K, Bala R, Inada K, Singh S, Stevenson WG, Marchlinski FE, Reddy VY. Long-term outcomes of combined epicardial and endocardial ablation of monomorphic ventricular tachycardia related to hypertrophic cardiomyopathy. Circ Arrhythm Electrophysiol. 2011 Apr; 4(2):185-94.
    View in: PubMed
  41. Tedrow UB, Stevenson WG. Recording and interpreting unipolar electrograms to guide catheter ablation. Heart Rhythm. 2011 May; 8(5):791-6.
    View in: PubMed
  42. Wann LS, Curtis AB, January CT, Ellenbogen KA, Lowe JE, Estes NA, Page RL, Ezekowitz MD, Slotwiner DJ, Jackman WM, Stevenson WG, Tracy CM, Fuster V, Rydén LE, Cannom DS, Le Heuzey JY, Crijns HJ, Lowe JE, Curtis AB, Olsson SB, Ellenbogen KA, Prystowsky EN, Halperin JL, Tamargo JL, Kay GN, Wann LS, Jacobs AK, Anderson JL, Albert N, Hochman JS, Buller CE, Kushner FG, Creager MA, Ohman EM, Ettinger SM, Stevenson WG, Guyton RA, Tarkington LG, Halperin JL, Yancy CW. 2011 ACCF/AHA/HRS focused update on the management of patients with atrial fibrillation (Updating the 2006 Guideline): a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. J Am Coll Cardiol. 2011 Jan 11; 57(2):223-42.
    View in: PubMed
  43. Wann LS, Curtis AB, January CT, Ellenbogen KA, Lowe JE, Estes NA, Page RL, Ezekowitz MD, Slotwiner DJ, Jackman WM, Stevenson WG, Tracy CM, Fuster V, Rydén LE, Cannom DS, Le Heuzey JY, Crijns HJ, Lowe JE, Curtis AB, Olsson S, Ellenbogen KA, Prystowsky EN, Halperin JL, Tamargo JL, Kay GN, Wann LS, Jacobs AK, Anderson JL, Albert N, Hochman JS, Buller CE, Kushner FG, Creager MA, Ohman EM, Ettinger SM, Stevenson WG, Guyton RA, Tarkington LG, Halperin JL, Yancy CW. 2011 ACCF/AHA/HRS focused update on the management of patients with atrial fibrillation (Updating the 2006 Guideline): a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Heart Rhythm. 2011 Jan; 8(1):157-76.
    View in: PubMed
  44. Wann LS, Curtis AB, January CT, Ellenbogen KA, Lowe JE, Estes NA, Page RL, Ezekowitz MD, Slotwiner DJ, Jackman WM, Stevenson WG, Tracy CM, Fuster V, Rydén LE, Cannom DS, Le Heuzey JY, Crijns HJ, Lowe JE, Curtis AB, Olsson S, Ellenbogen KA, Prystowsky EN, Halperin JL, Tamargo JL, Kay GN, Wann L, Jacobs AK, Anderson JL, Albert N, Hochman JS, Buller CE, Kushner FG, Creager MA, Ohman EM, Ettinger SM, Stevenson WG, Guyton RA, Tarkington LG, Halperin JL, Yancy CW. 2011 ACCF/AHA/HRS focused update on the management of patients with atrial fibrillation (updating the 2006 guideline): a report of the American College of Cardiology Foundation/American Heart Association Task Force on Practice Guidelines. Circulation. 2011 Jan 4; 123(1):104-23.
    View in: PubMed
  45. Stevenson WG, Asirvatham SJ. Teaching rounds in cardiac electrophysiology. Circ Arrhythm Electrophysiol. 2010 Dec; 3(6):563.
    View in: PubMed
  46. Rosman JZ, John RM, Stevenson WG, Epstein LM, Tedrow UB, Koplan BA, Albert CM, Michaud GF. Resetting criteria during ventricular overdrive pacing successfully differentiate orthodromic reentrant tachycardia from atrioventricular nodal reentrant tachycardia despite interobserver disagreement concerning QRS fusion. Heart Rhythm. 2011 Jan; 8(1):2-7.
    View in: PubMed
  47. Gautam S, John RM, Stevenson WG, Jain R, Epstein LM, Tedrow U, Koplan BA, McClennen S, Michaud GF. Effect of therapeutic INR on activated clotting times, heparin dosage, and bleeding risk during ablation of atrial fibrillation. J Cardiovasc Electrophysiol. 2011 Mar; 22(3):248-54.
    View in: PubMed
  48. Inada K, Seiler J, Roberts-Thomson KC, Steven D, Rosman J, John RM, Sobieszczyk P, Stevenson WG, Tedrow UB. Substrate characterization and catheter ablation for monomorphic ventricular tachycardia in patients with apical hypertrophic cardiomyopathy. J Cardiovasc Electrophysiol. 2011 Jan; 22(1):41-8.
    View in: PubMed
  49. Sacher F, Roberts-Thomson K, Maury P, Tedrow U, Nault I, Steven D, Hocini M, Koplan B, Leroux L, Derval N, Seiler J, Wright MJ, Epstein L, Haissaguerre M, Jais P, Stevenson WG. Epicardial ventricular tachycardia ablation a multicenter safety study. J Am Coll Cardiol. 2010 May 25; 55(21):2366-72.
    View in: PubMed
  50. Britton KA, Stevenson WG, Levy BD, Katz JT, Loscalzo J. Clinical problem-solving. The beat goes on. N Engl J Med. 2010 May 6; 362(18):1721-6.
    View in: PubMed
  51. Ross JJ, Britton KA, Desai AS, Stevenson WG. Interactive medical case. The beat goes on. N Engl J Med. 2010 Apr 15; 362(15):e53.
    View in: PubMed
  52. Tedrow UB, Stevenson WG. Arrhythmias: Catheter ablation for prevention of ventricular tachycardia. Nat Rev Cardiol. 2010 Apr; 7(4):181-2.
    View in: PubMed
  53. Sacher F, Wright M, Tedrow UB, O’Neill MD, Jais P, Hocini M, Macdonald R, Davies DW, Kanagaratnam P, Derval N, Epstein L, Peters NS, Stevenson WG, Haissaguerre M. Wolff-Parkinson-White ablation after a prior failure: a 7-year multicentre experience. Europace. 2010 Jun; 12(6):835-41.
    View in: PubMed
  54. Inada K, Roberts-Thomson KC, Seiler J, Steven D, Tedrow UB, Koplan BA, Stevenson WG. Mortality and safety of catheter ablation for antiarrhythmic drug-refractory ventricular tachycardia in elderly patients with coronary artery disease. Heart Rhythm. 2010 Jun; 7(6):740-4.
    View in: PubMed
  55. Steven D, Seiler J, Roberts-Thomson KC, Inada K, Stevenson WG. Mapping of atrial tachycardias after catheter ablation for atrial fibrillation: use of bi-atrial activation patterns to facilitate recognition of origin. Heart Rhythm. 2010 May; 7(5):664-72.
    View in: PubMed
  56. Stevenson WG, Tedrow U. Preventing ventricular tachycardia with catheter ablation. Lancet. 2010 Jan 2; 375(9708):4-6.
    View in: PubMed
  57. Al-Khatib SM, Calkins H, Eloff BC, Packer DL, Ellenbogen KA, Hammill SC, Natale A, Page RL, Prystowsky E, Jackman WM, Stevenson WG, Waldo AL, Wilber D, Kowey P, Yaross MS, Mark DB, Reiffel J, Finkle JK, Marinac-Dabic D, Pinnow E, Sager P, Sedrakyan A, Canos D, Gross T, Berliner E, Krucoff MW. Planning the Safety of Atrial Fibrillation Ablation Registry Initiative (SAFARI) as a Collaborative Pan-Stakeholder Critical Path Registry Model: a Cardiac Safety Research Consortium “Incubator” Think Tank. Am Heart J. 2010 Jan; 159(1):17-24.
    View in: PubMed
  58. Seiler J, Stevenson WG. Atrial fibrillation in congestive heart failure. Cardiol Rev. 2010 Jan-Feb; 18(1):38-50.
    View in: PubMed
  59. Steven D, Roberts-Thomson KC, Seiler J, Inada K, Tedrow UB, Mitchell RN, Sobieszczyk PS, Eisenhauer AC, Couper GS, Stevenson WG. Ventricular tachycardia arising from the aortomitral continuity in structural heart disease: characteristics and therapeutic considerations for an anatomically challenging area of origin. Circ Arrhythm Electrophysiol. 2009 Dec; 2(6):660-6.
    View in: PubMed
  60. Roberts-Thomson KC, Seiler J, Steven D, Inada K, Michaud GF, John RM, Koplan BA, Epstein LM, Stevenson WG, Tedrow UB. Percutaneous access of the epicardial space for mapping ventricular and supraventricular arrhythmias in patients with and without prior cardiac surgery. J Cardiovasc Electrophysiol. 2010 Apr; 21(4):406-11.
    View in: PubMed
  61. Steven D, Reddy VY, Inada K, Roberts-Thomson KC, Seiler J, Stevenson WG, Michaud GF. Loss of pace capture on the ablation line: a new marker for complete radiofrequency lesions to achieve pulmonary vein isolation. Heart Rhythm. 2010 Mar; 7(3):323-30.
    View in: PubMed
  62. Roberts-Thomson KC, Steven D, Seiler J, Inada K, Koplan BA, Tedrow UB, Epstein LM, Stevenson WG. Coronary artery injury due to catheter ablation in adults: presentations and outcomes. Circulation. 2009 Oct 13; 120(15):1465-73.
    View in: PubMed
  63. See VY, Roberts-Thomson KC, Stevenson WG, Camp PC, Koplan BA. Atrial arrhythmias after lung transplantation: epidemiology, mechanisms at electrophysiology study, and outcomes. Circ Arrhythm Electrophysiol. 2009 Oct; 2(5):504-10.
    View in: PubMed
  64. Stevenson WG, Saltzman JR. Gastroesophageal reflux and atrial-esophageal fistula. Heart Rhythm. 2009 Oct; 6(10):1463-4.
    View in: PubMed
  65. Aliot EM, Stevenson WG, Almendral-Garrote JM, Bogun F, Calkins CH, Delacretaz E, Della Bella P, Hindricks G, Jaïs P, Josephson ME, Kautzner J, Kay GN, Kuck KH, Lerman BB, Marchlinski F, Reddy V, Schalij MJ, Schilling R, Soejima K, Wilber D. EHRA/HRS Expert Consensus on Catheter Ablation of Ventricular Arrhythmias: developed in a partnership with the European Heart Rhythm Association (EHRA), a Registered Branch of the European Society of Cardiology (ESC), and the Heart Rhythm Society (HRS); in collaboration with the American College of Cardiology (ACC) and the American Heart Association (AHA). Heart Rhythm. 2009 Jun; 6(6):886-933.
    View in: PubMed
  66. Aliot EM, Stevenson WG, Almendral-Garrote JM, Bogun F, Calkins CH, Delacretaz E, Bella PD, Hindricks G, Jaïs P, Josephson ME, Kautzner J, Kay GN, Kuck KH, Lerman BB, Marchlinski F, Reddy V, Schalij MJ, Schilling R, Soejima K, Wilber D. EHRA/HRS Expert Consensus on Catheter Ablation of Ventricular Arrhythmias: developed in a partnership with the European Heart Rhythm Association (EHRA), a Registered Branch of the European Society of Cardiology (ESC), and the Heart Rhythm Society (HRS); in collaboration with the American College of Cardiology (ACC) and the American Heart Association (AHA). Europace. 2009 Jun; 11(6):771-817.
    View in: PubMed
  67. Raymond JM, Sacher F, Winslow R, Tedrow U, Stevenson WG. Catheter ablation for scar-related ventricular tachycardias. Curr Probl Cardiol. 2009 May; 34(5):225-70.
    View in: PubMed
  68. Lee JC, Steven D, Roberts-Thomson KC, Raymond JM, Stevenson WG, Tedrow UB. Atrial tachycardias adjacent to the phrenic nerve: recognition, potential problems, and solutions. Heart Rhythm. 2009 Aug; 6(8):1186-91.
    View in: PubMed
  69. Steven D, Roberts-Thomson KC, Seiler J, Michaud GF, John RM, Stevenson WG. Fibrillation in the superior vena cava mimicking atrial tachycardia. Circ Arrhythm Electrophysiol. 2009 Apr; 2(2):e4-7.
    View in: PubMed
  70. Roberts-Thomson KC, Seiler J, Steven D, Inada K, John R, Michaud G, Stevenson WG. Short AV response to atrial extrastimuli during narrow complex tachycardia: what is the mechanism? J Cardiovasc Electrophysiol. 2009 Aug; 20(8):946-8.
    View in: PubMed
  71. Koplan BA, Stevenson WG. Ventricular tachycardia and sudden cardiac death. Mayo Clin Proc. 2009 Mar; 84(3):289-97.
    View in: PubMed
  72. Khairy P, Stevenson WG. Catheter ablation in tetralogy of Fallot. Heart Rhythm. 2009 Jul; 6(7):1069-74.
    View in: PubMed
  73. Stevenson WG, Tedrow UB, Koplan BA. Management of ventricular tachycardia complicating cardiac surgery. Heart Rhythm. 2009 Aug; 6(8 Suppl):S66-9.
    View in: PubMed
  74. Lee JC, Epstein LM, Huffer LL, Stevenson WG, Koplan BA, Tedrow UB. ICD lead proarrhythmia cured by lead extraction. Heart Rhythm. 2009 May; 6(5):613-8.
    View in: PubMed
  75. Tedrow U, Stevenson WG. Strategies for epicardial mapping and ablation of ventricular tachycardia. J Cardiovasc Electrophysiol. 2009 Jun; 20(6):710-3.
    View in: PubMed
  76. Stevenson WG. Ventricular scars and ventricular tachycardia. Trans Am Clin Climatol Assoc. 2009; 120:403-12.
    View in: PubMed
  77. Stevenson WG, Wilber DJ, Natale A, Jackman WM, Marchlinski FE, Talbert T, Gonzalez MD, Worley SJ, Daoud EG, Hwang C, Schuger C, Bump TE, Jazayeri M, Tomassoni GF, Kopelman HA, Soejima K, Nakagawa H. Irrigated radiofrequency catheter ablation guided by electroanatomic mapping for recurrent ventricular tachycardia after myocardial infarction: the multicenter thermocool ventricular tachycardia ablation trial. Circulation. 2008 Dec 16; 118(25):2773-82.
    View in: PubMed
  78. Seiler J, Lee JC, Roberts-Thomson KC, Stevenson WG. Intracardiac echocardiography guided catheter ablation of incessant ventricular tachycardia from the posterior papillary muscle causing tachycardia–mediated cardiomyopathy. Heart Rhythm. 2009 Mar; 6(3):389-92.
    View in: PubMed
  79. Eckart RE, Field ME, Hruczkowski TW, Forman DE, Dorbala S, Di Carli MF, Albert CE, Maisel WH, Epstein LM, Stevenson WG. Association of electrocardiographic morphology of exercise-induced ventricular arrhythmia with mortality. Ann Intern Med. 2008 Oct 7; 149(7):451-60, W82.
    View in: PubMed
  80. Goldberger JJ, Cain ME, Hohnloser SH, Kadish AH, Knight BP, Lauer MS, Maron BJ, Page RL, Passman RS, Siscovick D, Stevenson WG, Zipes DP. American Heart Association/american College of Cardiology Foundation/heart Rhythm Society scientific statement on noninvasive risk stratification techniques for identifying patients at risk for sudden cardiac death: a scientific statement from the American Heart Association Council on Clinical Cardiology Committee on Electrocardiography and Arrhythmias and Council on Epidemiology and Prevention. Heart Rhythm. 2008 Oct; 5(10):e1-21.
    View in: PubMed
  81. Goldberger JJ, Cain ME, Hohnloser SH, Kadish AH, Knight BP, Lauer MS, Maron BJ, Page RL, Passman RS, Siscovick D, Siscovick D, Stevenson WG, Zipes DP. American Heart Association/American College of Cardiology Foundation/Heart Rhythm Society scientific statement on noninvasive risk stratification techniques for identifying patients at risk for sudden cardiac death: a scientific statement from the American Heart Association Council on Clinical Cardiology Committee on Electrocardiography and Arrhythmias and Council on Epidemiology and Prevention. Circulation. 2008 Sep 30; 118(14):1497-1518.
    View in: PubMed
  82. Goldberger JJ, Cain ME, Hohnloser SH, Kadish AH, Knight BP, Lauer MS, Maron BJ, Page RL, Passman RS, Siscovick D, Stevenson WG, Zipes DP. American Heart Association/American College of Cardiology Foundation/Heart Rhythm Society Scientific Statement on Noninvasive Risk Stratification Techniques for Identifying Patients at Risk for Sudden Cardiac Death. A scientific statement from the American Heart Association Council on Clinical Cardiology Committee on Electrocardiography and Arrhythmias and Council on Epidemiology and Prevention. J Am Coll Cardiol. 2008 Sep 30; 52(14):1179-99.
    View in: PubMed
  83. Seiler J, Roberts-Thomson KC, Raymond JM, Vest J, Delacretaz E, Stevenson WG. Steam pops during irrigated radiofrequency ablation: feasibility of impedance monitoring for prevention. Heart Rhythm. 2008 Oct; 5(10):1411-6.
    View in: PubMed
  84. Roy D, Talajic M, Nattel S, Wyse DG, Dorian P, Lee KL, Bourassa MG, Arnold JM, Buxton AE, Camm AJ, Connolly SJ, Dubuc M, Ducharme A, Guerra PG, Hohnloser SH, Lambert J, Le Heuzey JY, O’Hara G, Pedersen OD, Rouleau JL, Singh BN, Stevenson LW, Stevenson WG, Thibault B, Waldo AL. Rhythm control versus rate control for atrial fibrillation and heart failure. N Engl J Med. 2008 Jun 19; 358(25):2667-77.
    View in: PubMed
  85. Sacher F, Tedrow UB, Field ME, Raymond JM, Koplan BA, Epstein LM, Stevenson WG. Ventricular tachycardia ablation: evolution of patients and procedures over 8 years. Circ Arrhythm Electrophysiol. 2008 Aug; 1(3):153-61.
    View in: PubMed
  86. Vest JA, Seiler J, Stevenson WG. Clinical use of cooled radiofrequency ablation. J Cardiovasc Electrophysiol. 2008 Jul; 19(7):769-73.
    View in: PubMed
  87. Stevenson WG, Berul CI. Arrhythmia and Electrophysiology: the eagle can land. Circ Arrhythm Electrophysiol. 2008 Apr; 1(1):1.
    View in: PubMed
  88. Roberts-Thomson KC, Seiler J, Raymond JM, Stevenson WG. Exercise induced tachycardia with atrioventricular dissociation: what is the mechanism? Heart Rhythm. 2009 Mar; 6(3):426-8.
    View in: PubMed
  89. Zeppenfeld K, Stevenson WG. Ablation of ventricular tachycardia in patients with structural heart disease. Pacing Clin Electrophysiol. 2008 Mar; 31(3):358-74.
    View in: PubMed
  90. Cooper JM, Sapp JL, Robinson D, Epstein LM, Stevenson WG. A rewarming maneuver demonstrates the contribution of blood flow to electrode cooling during internally irrigated RF ablation. J Cardiovasc Electrophysiol. 2008 Apr; 19(4):409-14.
    View in: PubMed
  91. Zeppenfeld K, Schalij MJ, Bartelings MM, Tedrow UB, Koplan BA, Soejima K, Stevenson WG. Catheter ablation of ventricular tachycardia after repair of congenital heart disease: electroanatomic identification of the critical right ventricular isthmus. Circulation. 2007 Nov 13; 116(20):2241-52.
    View in: PubMed
  92. Eckart RE, Hruczkowski TW, Tedrow UB, Koplan BA, Epstein LM, Stevenson WG. Sustained ventricular tachycardia associated with corrective valve surgery. Circulation. 2007 Oct 30; 116(18):2005-11.
    View in: PubMed
  93. Sacher F, Sobieszczyk P, Tedrow U, Eisenhauer AC, Field ME, Selwyn A, Raymond JM, Koplan B, Epstein LM, Stevenson WG. Transcoronary ethanol ventricular tachycardia ablation in the modern electrophysiology era. Heart Rhythm. 2008 Jan; 5(1):62-8.
    View in: PubMed
  94. Sacher F, Vest J, Raymond JM, Stevenson WG. Incessant donor-to-recipient atrial tachycardia after bilateral lung transplantation. Heart Rhythm. 2008 Jan; 5(1):149-51.
    View in: PubMed
  95. Sacher F, Vest J, Raymond JM, Stevenson WG. Atrial pacing inducing narrow QRS tachycardia followed by wide complex tachycardia. J Cardiovasc Electrophysiol. 2007 Nov; 18(11):1213-5.
    View in: PubMed
  96. Stevenson WG, Soejima K. Catheter ablation for ventricular tachycardia. Circulation. 2007 May 29; 115(21):2750-60.
    View in: PubMed
  97. Koplan BA, Stevenson WG. Sudden arrhythmic death syndrome. Heart. 2007 May; 93(5):547-8.
    View in: PubMed
  98. Parkash R, Stevenson WG. Atrial fibrillation and clinical events in chronic heart failure. J Am Coll Cardiol. 2007 Jan 23; 49(3):376; author reply 376-7.
    View in: PubMed
  99. Sacher F, Jais P, Stephenson K, O’Neill MD, Hocini M, Clementy J, Stevenson WG, Haissaguerre M. Phrenic nerve injury after catheter ablation of atrial fibrillation. Indian Pacing Electrophysiol J. 2007; 7(1):1-6.
    View in: PubMed
  100. Tedrow UB, Stevenson WG, Wood MA, Shepard RK, Hall K, Pellegrini CP, Ellenbogen KA. Activation sequence modification during cardiac resynchronization by manipulation of left ventricular epicardial pacing stimulus strength. Pacing Clin Electrophysiol. 2007 Jan; 30(1):65-9.
    View in: PubMed
  101. Dzau VJ, Antman EM, Black HR, Hayes DL, Manson JE, Plutzky J, Popma JJ, Stevenson W. The cardiovascular disease continuum validated: clinical evidence of improved patient outcomes: part I: Pathophysiology and clinical trial evidence (risk factors through stable coronary artery disease). Circulation. 2006 Dec 19; 114(25):2850-70.
    View in: PubMed
  102. Dzau VJ, Antman EM, Black HR, Hayes DL, Manson JE, Plutzky J, Popma JJ, Stevenson W. The cardiovascular disease continuum validated: clinical evidence of improved patient outcomes: part II: Clinical trial evidence (acute coronary syndromes through renal disease) and future directions. Circulation. 2006 Dec 19; 114(25):2871-91.
    View in: PubMed
  103. Stevenson WG, Tedrow U. Management of atrial fibrillation in patients with heart failure. Heart Rhythm. 2007 Mar; 4(3 Suppl):S28-30.
    View in: PubMed
  104. Tedrow U, Stevenson WG. Substrate mapping and the aging atrium. Heart Rhythm. 2007 Feb; 4(2):145-6.
    View in: PubMed
  105. Eckart RE, Hruczkowski TW, Stevenson WG, Epstein LM. Myopotentials leading to ventricular fibrillation detection after advisory defibrillator generator replacement. Pacing Clin Electrophysiol. 2006 Nov; 29(11):1273-6.
    View in: PubMed
  106. Perloff JK, Middlekauf HR, Child JS, Stevenson WG, Miner PD, Goldberg GD. Usefulness of post-ventriculotomy signal averaged electrocardiograms in congenital heart disease. Am J Cardiol. 2006 Dec 15; 98(12):1646-51.
    View in: PubMed
  107. Koplan BA, Epstein LM, Albert CM, Stevenson WG. Survival in octogenarians receiving implantable defibrillators. Am Heart J. 2006 Oct; 152(4):714-9.
    View in: PubMed
  108. Veenhuyzen GD, Hruczkowski T, Dhir SK, Stevenson WG. Another way to prove the presence and participation of an accessory pathway in supraventricular tachycardia? J Cardiovasc Electrophysiol. 2006 Oct; 17(10):1147-9.
    View in: PubMed
  109. Yan AT, Shayne AJ, Brown KA, Gupta SN, Chan CW, Luu TM, Di Carli MF, Reynolds HG, Stevenson WG, Kwong RY. Characterization of the peri-infarct zone by contrast-enhanced cardiac magnetic resonance imaging is a powerful predictor of post-myocardial infarction mortality. Circulation. 2006 Jul 4; 114(1):32-9.
    View in: PubMed
  110. Sapp JL, Cooper JM, Zei P, Stevenson WG. Large radiofrequency ablation lesions can be created with a retractable infusion-needle catheter. J Cardiovasc Electrophysiol. 2006 Jun; 17(6):657-61.
    View in: PubMed
  111. Field ME, Miyazaki H, Epstein LM, Stevenson WG. Narrow complex tachycardia after slow pathway ablation: continue ablating? J Cardiovasc Electrophysiol. 2006 May; 17(5):557-9.
    View in: PubMed
  112. Tedrow UB, Kramer DB, Stevenson LW, Stevenson WG, Baughman KL, Epstein LM, Lewis EF. Relation of right ventricular peak systolic pressure to major adverse events in patients undergoing cardiac resynchronization therapy. Am J Cardiol. 2006 Jun 15; 97(12):1737-40.
    View in: PubMed
  113. Ames A, Stevenson WG. Cardiology patient page. Catheter ablation of atrial fibrillation. Circulation. 2006 Apr 4; 113(13):e666-8.
    View in: PubMed
  114. Koplan BA, Soejima K, Baughman K, Epstein LM, Stevenson WG. Refractory ventricular tachycardia secondary to cardiac sarcoid: electrophysiologic characteristics, mapping, and ablation. Heart Rhythm. 2006 Aug; 3(8):924-9.
    View in: PubMed
  115. Zei PC, Stevenson WG. Epicardial catheter mapping and ablation of ventricular tachycardia. Heart Rhythm. 2006 Mar; 3(3):360-3.
    View in: PubMed
  116. Miyazaki H, Stevenson WG, Stephenson K, Soejima K, Epstein LM. Entrainment mapping for rapid distinction of left and right atrial tachycardias. Heart Rhythm. 2006 May; 3(5):516-23.
    View in: PubMed
  117. Parkash R, Stevenson WG, Epstein LM, Maisel WH. Predicting early mortality after implantable defibrillator implantation: a clinical risk score for optimal patient selection. Am Heart J. 2006 Feb; 151(2):397-403.
    View in: PubMed
  118. Stevenson WG, Epstein LM. Endpoints for ablation of atrial fibrillation. Heart Rhythm. 2006 Feb; 3(2):146-7.
    View in: PubMed
  119. Stevenson LW, Stevenson WG. Cost-effectiveness of ICDs. N Engl J Med. 2006 Jan 12; 354(2):205-7; author reply 205-7.
    View in: PubMed
  120. Nazarian S, Maisel WH, Miles JS, Tsang S, Stevenson LW, Stevenson WG. Impact of implantable cardioverter defibrillators on survival and recurrent hospitalization in advanced heart failure. Am Heart J. 2005 Nov; 150(5):955-60.
    View in: PubMed
  121. Intini A, Goldstein RN, Jia P, Ramanathan C, Ryu K, Giannattasio B, Gilkeson R, Stambler BS, Brugada P, Stevenson WG, Rudy Y, Waldo AL. Electrocardiographic imaging (ECGI), a novel diagnostic modality used for mapping of focal left ventricular tachycardia in a young athlete. Heart Rhythm. 2005 Nov; 2(11):1250-2.
    View in: PubMed
  122. Parkash R, Maisel WH, Toca FM, Stevenson WG. Atrial fibrillation in heart failure: high mortality risk even if ventricular function is preserved. Am Heart J. 2005 Oct; 150(4):701-6.
    View in: PubMed
  123. Reynolds DW, Chen PS, Deal BJ, Donahue JK, Ellenbogen KA, Epstein AE, Friedman PA, Hammill SC, Hohnloser SH, Kanter RJ, Lindsay BD, Natale A, Saffitz J, Stevenson WG. Highlights of Heart Rhythm 2005, the Annual Scientific Sessions of the Heart Rhythm Society, May 4-7, 2005, New Orleans, Louisiana. Heart Rhythm. 2005 Sep; 2(9):1025-33.
    View in: PubMed
  124. Stevenson WG, Soejima K. Recording techniques for clinical electrophysiology. J Cardiovasc Electrophysiol. 2005 Sep; 16(9):1017-22.
    View in: PubMed
  125. Tedrow U, Stevenson WG, Benzaquen LR. Apical left ventricular aneurysm presenting with malignant ventricular tachycardia responsive to aneurysmectomy. Heart. 2005 May; 91(5):623.
    View in: PubMed
  126. Brunckhorst CB, Delacretaz E, Soejima K, Maisel WH, Friedman PL, Stevenson WG. Impact of changing activation sequence on bipolar electrogram amplitude for voltage mapping of left ventricular infarcts causing ventricular tachycardia. J Interv Card Electrophysiol. 2005 Mar; 12(2):137-41.
    View in: PubMed
  127. Stevenson WG. Catheter ablation of monomorphic ventricular tachycardia. Curr Opin Cardiol. 2005 Jan; 20(1):42-7.
    View in: PubMed
  128. Stevenson WG. To freeze or burn the epicardium? Heart Rhythm. 2005 Jan; 2(1):91-2.
    View in: PubMed
  129. Stevenson WG, Chaitman BR, Ellenbogen KA, Epstein AE, Gross WL, Hayes DL, Strickberger SA, Sweeney MO. Clinical assessment and management of patients with implanted cardioverter-defibrillators presenting to nonelectrophysiologists. Circulation. 2004 Dec 21; 110(25):3866-9.
    View in: PubMed
  130. Tedrow U, Maisel WH, Epstein LM, Soejima K, Stevenson WG. Feasibility of adjusting paced left ventricular activation by manipulating stimulus strength. J Am Coll Cardiol. 2004 Dec 7; 44(11):2249-52.
    View in: PubMed
  131. Stevenson WG, Stevenson LW. Atrial fibrillation and heart failure–five more years. N Engl J Med. 2004 Dec 2; 351(23):2437-40.
    View in: PubMed
  132. Brunckhorst CB, Delacretaz E, Soejima K, Jackman WM, Nakagawa H, Kuck KH, Ben-Haim SA, Seifert B, Stevenson WG. Ventricular mapping during atrial and right ventricular pacing: relation of electrogram parameters to ventricular tachycardia reentry circuits after myocardial infarction. J Interv Card Electrophysiol. 2004 Dec; 11(3):183-91.
    View in: PubMed
  133. Curtis AB, Abraham WT, Chen PS, Ellenbogen KA, Epstein AE, Friedman PA, Hohnloser SH, Kanter RJ, Stevenson WG. Highlights of Heart Rhythm 2004, the Annual Scientific Sessions of the Heart Rhythm Society: May 19 to 22, 2004, in San Francisco, California. J Am Coll Cardiol. 2004 Oct 19; 44(8):1550-6.
    View in: PubMed
  134. Stevenson WG, Cooper J, Sapp J. Optimizing RF output for cooled RF ablation. J Cardiovasc Electrophysiol. 2004 Oct; 15(10 Suppl):S24-7.
    View in: PubMed
  135. Soejima K, Stevenson WG. Athens, athletes, and arrhythmias: the cardiologist’s dilemma. J Am Coll Cardiol. 2004 Sep 1; 44(5):1059-61.
    View in: PubMed
  136. Cooper JM, Sapp JL, Tedrow U, Pellegrini CP, Robinson D, Epstein LM, Stevenson WG. Ablation with an internally irrigated radiofrequency catheter: learning how to avoid steam pops. Heart Rhythm. 2004 Sep; 1(3):329-33.
    View in: PubMed
  137. Soejima K, Couper G, Cooper JM, Sapp JL, Epstein LM, Stevenson WG. Subxiphoid surgical approach for epicardial catheter-based mapping and ablation in patients with prior cardiac surgery or difficult pericardial access. Circulation. 2004 Sep 7; 110(10):1197-201.
    View in: PubMed
  138. Brunckhorst CB, Delacretaz E, Soejima K, Maisel WH, Friedman PL, Stevenson WG. Identification of the ventricular tachycardia isthmus after infarction by pace mapping. Circulation. 2004 Aug 10; 110(6):652-9.
    View in: PubMed
  139. Friedman PL, Dubuc M, Green MS, Jackman WM, Keane DT, Marinchak RA, Nazari J, Packer DL, Skanes A, Steinberg JS, Stevenson WG, Tchou PJ, Wilber DJ, Worley SJ. Catheter cryoablation of supraventricular tachycardia: results of the multicenter prospective “frosty” trial. Heart Rhythm. 2004 Jul; 1(2):129-38.
    View in: PubMed
  140. Sapp JL, Soejima K, Cooper JM, Epstein LM, Stevenson WG. Ablation lesion size correlates with pacing threshold: a physiological basis for use of pacing to assess ablation lesions. Pacing Clin Electrophysiol. 2004 Jul; 27(7):933-7.
    View in: PubMed
  141. Soejima K, Stevenson WG, Sapp JL, Selwyn AP, Couper G, Epstein LM. Endocardial and epicardial radiofrequency ablation of ventricular tachycardia associated with dilated cardiomyopathy: the importance of low-voltage scars. J Am Coll Cardiol. 2004 May 19; 43(10):1834-42.
    View in: PubMed
  142. Tedrow U, Sweeney MO, Stevenson WG. Physiology of cardiac resynchronization. Curr Cardiol Rep. 2004 May; 6(3):189-93.
    View in: PubMed
  143. Sapp JL, Cooper JM, Soejima K, Sorrell T, Lopera G, Satti SD, Koplan BA, Epstein LM, Edelman E, Rogers C, Stevenson WG. Deep myocardial ablation lesions can be created with a retractable needle-tipped catheter. Pacing Clin Electrophysiol. 2004 May; 27(5):594-9.
    View in: PubMed
  144. Stevenson WG, Sweeney MO. Single site left ventricular pacing for cardiac resynchronization. Circulation. 2004 Apr 13; 109(14):1694-6.
    View in: PubMed
  145. Koplan BA, Parkash R, Couper G, Stevenson WG. Combined epicardial-endocardial approach to ablation of inappropriate sinus tachycardia. J Cardiovasc Electrophysiol. 2004 Feb; 15(2):237-40.
    View in: PubMed
  146. Lopera G, Stevenson WG, Soejima K, Maisel WH, Koplan B, Sapp JL, Satti SD, Epstein LM. Identification and ablation of three types of ventricular tachycardia involving the his-purkinje system in patients with heart disease. J Cardiovasc Electrophysiol. 2004 Jan; 15(1):52-8.
    View in: PubMed
  147. Blomström-Lundqvist C, Scheinman MM, Aliot EM, Alpert JS, Calkins H, Camm AJ, Campbell WB, Haines DE, Kuck KH, Lerman BB, Miller DD, Shaeffer CW, Stevenson WG, Tomaselli GF, Antman EM, Smith SC, Alpert JS, Faxon DP, Fuster V, Gibbons RJ, Gregoratos G, Hiratzka LF, Hunt SA, Jacobs AK, Russell RO, Priori SG, Blanc JJ, Budaj A, Burgos EF, Cowie M, Deckers JW, Garcia MA, Klein WW, Lekakis J, Lindahl B, Mazzotta G, Morais JC, Oto A, Smiseth O, Trappe HJ. ACC/AHA/ESC guidelines for the management of patients with supraventricular arrhythmias–executive summary. a report of the American college of cardiology/American heart association task force on practice guidelines and the European society of cardiology committee for practice guidelines (writing committee to develop guidelines for the management of patients with supraventricular arrhythmias) developed in collaboration with NASPE-Heart Rhythm Society. J Am Coll Cardiol. 2003 Oct 15; 42(8):1493-531.
    View in: PubMed
  148. Blomström-Lundqvist C, Scheinman MM, Aliot EM, Alpert JS, Calkins H, Camm AJ, Campbell WB, Haines DE, Kuck KH, Lerman BB, Miller DD, Shaeffer CW, Stevenson WG, Tomaselli GF, Antman EM, Smith SC, Alpert JS, Faxon DP, Fuster V, Gibbons RJ, Gregoratos G, Hiratzka LF, Hunt SA, Jacobs AK, Russell RO, Priori SG, Blanc JJ, Budaj A, Burgos EF, Cowie M, Deckers JW, Garcia MA, Klein WW, Lekakis J, Lindahl B, Mazzotta G, Morais JC, Oto A, Smiseth O, Trappe HJ. ACC/AHA/ESC guidelines for the management of patients with supraventricular arrhythmias–executive summary: a report of the American College of Cardiology/American Heart Association Task Force on Practice Guidelines and the European Society of Cardiology Committee for Practice Guidelines (Writing Committee to Develop Guidelines for the Management of Patients With Supraventricular Arrhythmias). Circulation. 2003 Oct 14; 108(15):1871-909.
    View in: PubMed
  149. Delacretaz E, Soejima K, Brunckhorst CB, Maisel WH, Friedman PL, Stevenson WG. Assessment of radiofrequency ablation effect from unipolar pacing threshold. Pacing Clin Electrophysiol. 2003 Oct; 26(10):1993-6.
    View in: PubMed
  150. Soejima K, Stevenson WG. Catheter ablation of ventricular tachycardia in patients with ischemic heart disease. Curr Cardiol Rep. 2003 Sep; 5(5):364-8.
    View in: PubMed
  151. Tung S, Soejima K, Maisel WH, Suzuki M, Epstein L, Stevenson WG. Recognition of far-field electrograms during entrainment mapping of ventricular tachycardia. J Am Coll Cardiol. 2003 Jul 2; 42(1):110-5.
    View in: PubMed
  152. Stevenson WG, Soejima K. Inside or out? Another option for incessant ventricular tachycardia. J Am Coll Cardiol. 2003 Jun 4; 41(11):2044-5.
    View in: PubMed
  153. Brunckhorst CB, Stevenson WG, Soejima K, Maisel WH, Delacretaz E, Friedman PL, Ben-Haim SA. Relationship of slow conduction detected by pace-mapping to ventricular tachycardia re-entry circuit sites after infarction. J Am Coll Cardiol. 2003 Mar 5; 41(5):802-9.
    View in: PubMed
  154. Koplan BA, Stevenson WG, Epstein LM, Aranki SF, Maisel WH. Development and validation of a simple risk score to predict the need for permanent pacing after cardiac valve surgery. J Am Coll Cardiol. 2003 Mar 5; 41(5):795-801.
    View in: PubMed
  155. Ellison KE, Stevenson WG, Sweeney MO, Epstein LM, Maisel WH. Management of arrhythmias in heart failure. Congest Heart Fail. 2003 Mar-Apr; 9(2):91-9.
    View in: PubMed
  156. Stevenson WG, Epstein LM. Predicting sudden death risk for heart failure patients in the implantable cardioverter-defibrillator age. Circulation. 2003 Feb 4; 107(4):514-6.
    View in: PubMed
  157. Maisel WH, Stevenson WG, Epstein LM. Changing trends in pacemaker and implantable cardioverter defibrillator generator advisories. Pacing Clin Electrophysiol. 2002 Dec; 25(12):1670-8.
    View in: PubMed
  158. Khan HH, Maisel WH, Ho C, Suzuki M, Soejima K, Solomon S, Stevenson WG. Effect of radiofrequency catheter ablation of ventricular tachycardia on left ventricular function in patients with prior myocardial infarction. J Interv Card Electrophysiol. 2002 Dec; 7(3):243-7.
    View in: PubMed
  159. Fenelon G, Stambler BS, Huvelle E, Brugada P, Stevenson WG. Left ventricular dysfunction is associated with prolonged average ventricular fibrillation cycle length in patients with implantable cardioverter defibrillators. J Interv Card Electrophysiol. 2002 Dec; 7(3):249-54.
    View in: PubMed
  160. Soejima K, Stevenson WG, Maisel WH, Sapp JL, Epstein LM. Electrically unexcitable scar mapping based on pacing threshold for identification of the reentry circuit isthmus: feasibility for guiding ventricular tachycardia ablation. Circulation. 2002 Sep 24; 106(13):1678-83.
    View in: PubMed
  161. Maisel WH, Stevenson WG. Syncope–getting to the heart of the matter. N Engl J Med. 2002 Sep 19; 347(12):931-3.
    View in: PubMed
  162. Maisel WH, Stevenson WG, Epstein LM. Reduced atrial blood flow in patients with coronary artery disease. Coron Artery Dis. 2002 Aug; 13(5):283-90.
    View in: PubMed
  163. Soejima K, Stevenson WG. Ventricular tachycardia associated with myocardial infarct scar: a spectrum of therapies for a single patient. Circulation. 2002 Jul 9; 106(2):176-9.
    View in: PubMed
  164. Brunckhorst CB, Stevenson WG, Jackman WM, Kuck KH, Soejima K, Nakagawa H, Cappato R, Ben-Haim SA. Ventricular mapping during atrial and ventricular pacing. Relationship of multipotential electrograms to ventricular tachycardia reentry circuits after myocardial infarction. Eur Heart J. 2002 Jul; 23(14):1131-8.
    View in: PubMed
  165. Friedman RA, Walsh EP, Silka MJ, Calkins H, Stevenson WG, Rhodes LA, Deal BJ, Wolff GS, Demaso DR, Hanisch D, Van Hare GF. NASPE Expert Consensus Conference: Radiofrequency catheter ablation in children with and without congenital heart disease. Report of the writing committee. North American Society of Pacing and Electrophysiology. Pacing Clin Electrophysiol. 2002 Jun; 25(6):1000-17.
    View in: PubMed
  166. Stevenson WG, Ellison KE, Sweeney MO, Epstein LM, Maisel WH. Management of arrhythmias in heart failure. Cardiol Rev. 2002 Jan-Feb; 10(1):8-14.
    View in: PubMed
  167. Maisel WH, Rawn JD, Stevenson WG. Atrial fibrillation after cardiac surgery. Ann Intern Med. 2001 Dec 18; 135(12):1061-73.
    View in: PubMed
  168. Sapp J, Soejima K, Couper GS, Stevenson WG. Electrophysiology and anatomic characterization of an epicardial accessory pathway. J Cardiovasc Electrophysiol. 2001 Dec; 12(12):1411-4.
    View in: PubMed
  169. Sweeney MO, Ellison KE, Stevenson WG. Implantable cardioverter defibrillators in heart failure. Cardiol Clin. 2001 Nov; 19(4):653-67.
    View in: PubMed
  170. Maisel WH, Stevenson WG, Tung S, Blier LE, Brunckhorst CB. Less is more: 4:2:1 block. Circulation. 2001 Sep 4; 104(10):E50.
    View in: PubMed
  171. Delacrétaz E, Stevenson WG. Catheter ablation of ventricular tachycardia in patients with coronary heart disease. Part II: Clinical aspects, limitations, and recent developments. Pacing Clin Electrophysiol. 2001 Sep; 24(9 Pt 1):1403-11.
    View in: PubMed
  172. Maisel WH, Sweeney MO, Stevenson WG, Ellison KE, Epstein LM. Recalls and safety alerts involving pacemakers and implantable cardioverter-defibrillator generators. JAMA. 2001 Aug 15; 286(7):793-9.
    View in: PubMed
  173. Soejima K, Suzuki M, Maisel WH, Brunckhorst CB, Delacretaz E, Blier L, Tung S, Khan H, Stevenson WG. Catheter ablation in patients with multiple and unstable ventricular tachycardias after myocardial infarction: short ablation lines guided by reentry circuit isthmuses and sinus rhythm mapping. Circulation. 2001 Aug 7; 104(6):664-9.
    View in: PubMed
  174. Delacretaz E, Stevenson WG. Catheter ablation of ventricular tachycardia in patients with coronary heart disease: part I: Mapping. Pacing Clin Electrophysiol. 2001 Aug; 24(8 Pt 1):1261-77.
    View in: PubMed
  175. Delacretaz E, Ganz LI, Soejima K, Friedman PL, Walsh EP, Triedman JK, Sloss LJ, Landzberg MJ, Stevenson WG. Multi atrial maco-re-entry circuits in adults with repaired congenital heart disease: entrainment mapping combined with three-dimensional electroanatomic mapping. J Am Coll Cardiol. 2001 May; 37(6):1665-76.
    View in: PubMed
  176. Soejima K, Delacretaz E, Suzuki M, Brunckhorst CB, Maisel WH, Friedman PL, Stevenson WG. Saline-cooled versus standard radiofrequency catheter ablation for infarct-related ventricular tachycardias. Circulation. 2001 Apr 10; 103(14):1858-62.
    View in: PubMed
  177. Soejima K, Stevenson WG, Maisel WH, Delacretaz E, Brunckhorst CB, Ellison KE, Friedman PL. The N + 1 difference: a new measure for entrainment mapping. J Am Coll Cardiol. 2001 Apr; 37(5):1386-94.
    View in: PubMed
  178. Delacretaz E, Soejima K, Gottipaty VK, Brunckhorst CB, Friedman PL, Stevenson WG. Single catheter determination of local electrogram prematurity using simultaneous unipolar and bipolar recordings to replace the surface ECG as a timing reference. Pacing Clin Electrophysiol. 2001 Apr; 24(4 Pt 1):441-9.
    View in: PubMed
  179. Stevenson WG, Maisel WH. Electrocardiography artifact: what you do not know, you do not recognize. Am J Med. 2001 Apr 1; 110(5):402-3.
    View in: PubMed
  180. Stevenson WG, Soejima K. Knowing where to look. J Cardiovasc Electrophysiol. 2001 Mar; 12(3):367-8.
    View in: PubMed
  181. Stevenson WG, Stevenson LW. Prevention of sudden death in heart failure. J Cardiovasc Electrophysiol. 2001 Jan; 12(1):112-4.
    View in: PubMed
  182. Stevenson WG, Delacretaz E. Radiofrequency catheter ablation of ventricular tachycardia. Heart. 2000 Nov; 84(5):553-9.
    View in: PubMed
  183. Stevenson WG, Delacretaz E. Strategies for catheter ablation of scar-related ventricular tachycardia. Curr Cardiol Rep. 2000 Nov; 2(6):537-44.
    View in: PubMed
  184. Soejima K, Stevenson WG, Delacretaz E, Brunckhorst CB, Maisel WH, Friedman PL. Identification of left atrial origin of ectopic tachycardia during right atrial mapping: analysis of double potentials at the posteromedial right atrium. J Cardiovasc Electrophysiol. 2000 Sep; 11(9):975-80.
    View in: PubMed
  185. Weinfeld MS, Drazner MH, Stevenson WG, Stevenson LW. Early outcome of initiating amiodarone for atrial fibrillation in advanced heart failure. J Heart Lung Transplant. 2000 Jul; 19(7):638-43.
    View in: PubMed
  186. Maisel WH, Stevenson WG. Sudden death and the electrophysiological effects of angiotensin-converting enzyme inhibitors. J Card Fail. 2000 Jun; 6(2):80-2.
    View in: PubMed
  187. Ellison KE, Stevenson WG, Sweeney MO, Lefroy DC, Delacretaz E, Friedman PL. Catheter ablation for hemodynamically unstable monomorphic ventricular tachycardia. J Cardiovasc Electrophysiol. 2000 Jan; 11(1):41-4.
    View in: PubMed
  188. Delacretaz E, Stevenson WG, Ellison KE, Maisel WH, Friedman PL. Mapping and radiofrequency catheter ablation of the three types of sustained monomorphic ventricular tachycardia in nonischemic heart disease. J Cardiovasc Electrophysiol. 2000 Jan; 11(1):11-7.
    View in: PubMed
  189. Delacretaz E, Soejima K, Stevenson WG, Friedman PL. Short ventriculoatrial intervals during orthodromic atrioventricular reciprocating tachycardia: what is the mechanism? J Cardiovasc Electrophysiol. 2000 Jan; 11(1):121-4.
    View in: PubMed
  190. Soejima K, Delacretaz E, Stevenson WG, Friedman PL. DDD-pacing-induced cardiomyopathy following AV node ablation for persistent atrial tachycardia. J Interv Card Electrophysiol. 1999 Dec; 3(4):321-3.
    View in: PubMed
  191. Stevenson WG, Stevenson LW. Atrial fibrillation in heart failure. N Engl J Med. 1999 Sep 16; 341(12):910-1.
    View in: PubMed
  192. Kocovic DZ, Harada T, Friedman PL, Stevenson WG. Characteristics of electrograms recorded at reentry circuit sites and bystanders during ventricular tachycardia after myocardial infarction. J Am Coll Cardiol. 1999 Aug; 34(2):381-8.
    View in: PubMed
  193. Delacretaz E, Stevenson WG, Winters GL, Mitchell RN, Stewart S, Lynch K, Friedman PL. Ablation of ventricular tachycardia with a saline-cooled radiofrequency catheter: anatomic and histologic characteristics of the lesions in humans. J Cardiovasc Electrophysiol. 1999 Jun; 10(6):860-5.
    View in: PubMed
  194. Delacretaz E, Stevenson WG, Winters GL, Friedman PL. Radiofrequency ablation of atrial flutter. Circulation. 1999 Apr 13; 99(14):E1-2.
    View in: PubMed
  195. Friedman PL, Stevenson WG. Proarrhythmia. Am J Cardiol. 1998 Oct 16; 82(8A):50N-58N.
    View in: PubMed
  196. Ellison KE, Friedman PL, Ganz LI, Stevenson WG. Entrainment mapping and radiofrequency catheter ablation of ventricular tachycardia in right ventricular dysplasia. J Am Coll Cardiol. 1998 Sep; 32(3):724-8.
    View in: PubMed
  197. Lefroy DC, Fang JC, Stevenson LW, Hartley LH, Friedman PL, Stevenson WG. Recipient-to-donor atrioatrial conduction after orthotopic heart transplantation: surface electrocardiographic features and estimated prevalence. Am J Cardiol. 1998 Aug 15; 82(4):444-50.
    View in: PubMed
  198. Stevenson WG, Friedman PL, Kocovic D, Sager PT, Saxon LA, Pavri B. Radiofrequency catheter ablation of ventricular tachycardia after myocardial infarction. Circulation. 1998 Jul 28; 98(4):308-14.
    View in: PubMed
  199. Stevenson WG, Delacretaz E, Friedman PL, Ellison KE. Identification and ablation of macroreentrant ventricular tachycardia with the CARTO electroanatomical mapping system. Pacing Clin Electrophysiol. 1998 Jul; 21(7):1448-56.
    View in: PubMed
  200. Lefroy DC, Ellison KE, Friedman PL, Stevenson WG. Arrhythmia of the month: shortening of ventriculoatrial conduction time during radiofrequency catheter ablation of a concealed accessory pathway. J Cardiovasc Electrophysiol. 1998 Apr; 9(4):445-7.
    View in: PubMed
  201. Ganz LI, Couper GS, Friedman PL, Stevenson WG, Ellison K. Use of telemetered permanent pacemaker intracardiac electrograms to diagnose ventricular tachycardia. Am J Cardiol. 1997 Dec 1; 80(11):1511-3.
    View in: PubMed
  202. stevenson WG, Friedman PL, Ganz LI. Radiofrequency catheter ablation of ventricular tachycardia late after myocardial infarction. J Cardiovasc Electrophysiol. 1997 Nov; 8(11):1309-19.
    View in: PubMed
  203. Stevenson WG, Ellison KE, Lefroy DC, Friedman PL. Ablation therapy for cardiac arrhythmias. Am J Cardiol. 1997 Oct 23; 80(8A):56G-66G.
    View in: PubMed
  204. Ellison KE, Stevenson WG, Couper GS, Friedman PL. Ablation of ventricular tachycardia due to a postinfarct ventricular septal defect: identification and transection of a broad reentry loop. J Cardiovasc Electrophysiol. 1997 Oct; 8(10):1163-6.
    View in: PubMed
  205. Harada T, Stevenson WG, Kocovic DZ, Friedman PL. Catheter ablation of ventricular tachycardia after myocardial infarction: relation of endocardial sinus rhythm late potentials to the reentry circuit. J Am Coll Cardiol. 1997 Oct; 30(4):1015-23.
    View in: PubMed
  206. Stevenson WG, Sweeney MO. Arrhythmias and sudden death in heart failure. Jpn Circ J. 1997 Sep; 61(9):727-40.
    View in: PubMed
  207. Maisel WH, Kuntz KM, Reimold SC, Lee TH, Antman EM, Friedman PL, Stevenson WG. Risk of initiating antiarrhythmic drug therapy for atrial fibrillation in patients admitted to a university hospital. Ann Intern Med. 1997 Aug 15; 127(4):281-4.
    View in: PubMed
  208. Stevenson WG, Sweeney MO. Pharmacologic and nonpharmacologic treatment of ventricular arrhythmias in heart failure. Curr Opin Cardiol. 1997 May; 12(3):242-50.
    View in: PubMed
  209. Stevenson WG, Friedman PL, Sager PT, Saxon LA, Kocovic D, Harada T, Wiener I, Khan H. Exploring postinfarction reentrant ventricular tachycardia with entrainment mapping. J Am Coll Cardiol. 1997 May; 29(6):1180-9.
    View in: PubMed
  210. Hadjis TA, Stevenson WG, Harada T, Friedman PL, Sager P, Saxon LA. Preferential locations for critical reentry circuit sites causing ventricular tachycardia after inferior wall myocardial infarction. J Cardiovasc Electrophysiol. 1997 Apr; 8(4):363-70.
    View in: PubMed
  211. Hadjis TA, Harada T, Stevenson WG, Friedman PL. Effect of recording site on postpacing interval measurement during catheter mapping and entrainment of postinfarction ventricular tachycardia. J Cardiovasc Electrophysiol. 1997 Apr; 8(4):398-404.
    View in: PubMed
  212. Merliss AD, Seifert MJ, Collins RF, Higgins JP, Reimold SC, Lee RT, Friedman PL, Stevenson WG. Catheter ablation of idiopathic left ventricular tachycardia associated with a false tendon. Pacing Clin Electrophysiol. 1996 Dec; 19(12 Pt 1):2144-6.
    View in: PubMed
  213. Stevenson WG, Stevenson LW, Middlekauff HR, Fonarow GC, Hamilton MA, Woo MA, Saxon LA, Natterson PD, Steimle A, Walden JA, Tillisch JH. Improving survival for patients with atrial fibrillation and advanced heart failure. J Am Coll Cardiol. 1996 Nov 15; 28(6):1458-63.
    View in: PubMed
  214. Stevenson WG, Ridker PM. Should survivors of myocardial infarction with low ejection fraction be routinely referred to arrhythmia specialists? JAMA. 1996 Aug 14; 276(6):481-5.
    View in: PubMed
  215. Friedman PL, Stevenson WG, Kocovic DZ. Autonomic dysfunction after catheter ablation. J Cardiovasc Electrophysiol. 1996 May; 7(5):450-9.
    View in: PubMed
  216. Ganz LI, Stevenson WG. Catheter mapping and ablation of ventricular tachycardia. Coron Artery Dis. 1996 Jan; 7(1):29-35.
    View in: PubMed
  217. Stevenson WG, Stevenson LW, Middlekauff HR, Fonarow GC, Hamilton MA, Woo MA, Saxon LA, Natterson PD, Steimle A, Walden JA, et al. Improving survival for patients with advanced heart failure: a study of 737 consecutive patients. J Am Coll Cardiol. 1995 Nov 15; 26(6):1417-23.
    View in: PubMed
  218. Stevenson WG. Ventricular tachycardia after myocardial infarction: from arrhythmia surgery to catheter ablation. J Cardiovasc Electrophysiol. 1995 Oct; 6(10 Pt 2):942-50.
    View in: PubMed
  219. Bartlett TG, Mitchell R, Friedman PL, Stevenson WG. Histologic evolution of radiofrequency lesions in an old human myocardial infarct causing ventricular tachycardia. J Cardiovasc Electrophysiol. 1995 Aug; 6(8):625-9.
    View in: PubMed
  220. Stevenson WG, Sager PT, Natterson PD, Saxon LA, Middlekauff HR, Wiener I. Relation of pace mapping QRS configuration and conduction delay to ventricular tachycardia reentry circuits in human infarct scars. J Am Coll Cardiol. 1995 Aug; 26(2):481-8.
    View in: PubMed
  221. Stevenson WG. Mechanisms and management of arrhythmias in heart failure. Curr Opin Cardiol. 1995 May; 10(3):274-81.
    View in: PubMed
  222. Stevenson WG, Sager PT, Friedman PL. Entrainment techniques for mapping atrial and ventricular tachycardias. J Cardiovasc Electrophysiol. 1995 Mar; 6(3):201-16.
    View in: PubMed
  223. Stevenson WG. Functional approach to site-by-site catheter mapping of ventricular reentry circuits in chronic infarctions. J Electrocardiol. 1994; 27 Suppl:130-8.
    View in: PubMed

Read Full Post »

Cardiovascular Original Research: Cases in Methodology Design for Content Curation and Co-Curation

Author: Aviva Lev-Ari, PhD, RN

Article ID #71: Cardiovascular Original Research: Cases in Methodology Design for Content Curation and Co-Curation. Published on 7/29/2013

WordCloud Image Produced by Adam Tubman

For a general article on Science and Curation, go to

Science and Curation: the New Practice of Web 2.0

Since 4/2012, Leaders in Pharmaceutical Business Intelligence, is developing an innovative methodology for the facilitation of Global access to Biomedical knowledge rather than the access to sheer search results on Scientific subject matters in the Life Sciences and Medicine. For the methodology to attain this complex goal it is to be dealing with popularization of ORIGINAL Scientific Research via Content Curation of Scientific Research Results by Experts, Authors, Writers using the critical  thinking process of expert interpretation of the original research results. We demonstrate in this article two approaches to the process of reaching that goal successfully.

Editorial Team Members and Five Series of e-Bookd in BioMed

Series A: e-Books on Cardiovascular Diseases

Content Consultant: Justin D Pearlman, MD, PhD, FACC

Volume One: Perspectives on Nitric Oxide

Sr. Editor: Larry Bernstein

Editor: Aviral Vatsa

Content Consultant: Stephen J Williams

available on Kindle Store @ Amazon.com

http://www.amazon.com/dp/B00DINFFYC

Volume Two: Cardiovascular Original Research: Cases in Methodology Design for Content Co-Curation

Curators: Justin D Pearlman, Larry H Bernstein, Aviva Lev-Ari

  • Causes
  • Risks and Biomarkers
  • Therapeutic Implications

Volume Three: Etiologies of CVD: Epigenetics, Genetics & Genomics

Curators: Larry H Bernstein and Aviva Lev-Ari

  • Causes
  • Risks and Biomarkers
  • Therapeutic Implications

Chapter 1: Genomics and Medicine by Marcus Feldman

Volume Four: Therapeutic Promise: CVD, Regenerative & Translational Medicine

Curators: Larry H Bernstein and Aviva Lev-Ari

  • Causes
  • Risks and Biomarkers
  • Therapeutic Implications

Volume Five: Pharmaco-Therapies for CVD

Curators: Vivek Lal, Larry H Bernstein and Aviva Lev-Ari

  • Causes
  • Risks and Biomarkers
  • Therapeutic Implications

Volume Six: Interventional Cardiology and Cardiac Surgery

Curators: Justin D Pearlman, Larry H Bernstein, Aviva Lev-Ari

  • Causes
  • Risks and Biomarkers
  • Therapeutic Implications

Volume Seven: CVD Imaging for Disease Diagnosis and Guidance of Treatment

Curators: Justin D Pearlman and Aviva Lev-Ari

  • Causes
  • Risks and Biomarkers
  • Therapeutic Implications

Series B: e-Books on Genomics & Medicine

Content Consultant: Larry H Bernstein, MD, FCAP

Volume 1: Genomics and Individualized Medicine

Sr. Editor: Stephen J Williams

Editors: Larry H Bernstein and Aviva Lev-Ari

Volume 2: Methodological Breakthroughs in NGS

Editor: Marcus Feldman

Volume 3: Institutional Leadership in Genomics

Editors: Marcus Feldman and Aviva Lev-Ari 

Series C: e-Books on Cancer & Oncology

Content Consultant: Larry H Bernstein, MD, FCAP

Volume 1: Cancer and Genomics

Sr. Editor: Stephen J Williams

Editors: Ritu Saxena, Tilda Barliya

Volume 2: Immunotherapy in Oncology

Sr. Editor: Stephen J Williams

Editors: Tilda Barliya and Demet Sag

Volume 3: Nanotechnology and Drug Delivery

Editor and Author: Tilda Barliya

Series D: e-Books on BioMedicine

Volume 1: Metabolomics

Sr. Editors: Larry H Bernstein and

Editor: Ritu Saxena 

Volume 2: Infectious Diseases

Editor: TBA

Volume 3: Immunology and Therapeutics

Editor: TBA

Series E: Titles in the Strategic Plan for 2014 – 2015

Volume 1: The Patient’s Voice: Personal Experience with Invasive Medical Procedures

Editor: TBA 

Volume 2: Interviews with Scientific Leaders

Editor: TBA

Volume 3: Infectious Milestones in Physiology – Discoveries in Medicine

Editor: TBA

[affiliate] Dr. Pnina G. Abir-Am, Belmont, MA – Independent AUTHOR, History of Molecular Biology

Dr. Aviva Lev-Ari, Boston, MA – Editor-in-Chief, BioMed Series, Editor – Genomics Volume One

Site Statistics

Date

Views to Date

# of articles

NIH Clicks

Nature Clicks

6/24/2013

199,857

1,034

1,275

661

7/29/2013  217,356  1,138  1,389  705
9/11/2013   238,937  1,202  1,495  735
9/26/2013  249,535  1,221  1,570  759

Date

Views to Date

# of articles

NIH Clicks

Nature Clicks

10/14/2013

260,043

1,252

1,593

781

 

This article has two parts:

Part I: The Curator as a Scientific Content Critique for the Architecture of Knowledge, its meaning and its societal implications.

Part II: Cases in Co-Curation and Scientific Content Critique

In Part I, one curator edifies the e-Reader via his/hers OWN creative mental processes of knowledge synthesis following the creative mental process of analytical critique. The outcome is a new FORM of writing Science and of writing about Science, as well as, a new FORM of framework been created for the organization of the interrelations exposed in the analytical phase of a dialectically generated original synthesis, the process of which is manifold: the structure of the knowledge presented, culling in the midst of inclusion/exclusion dialectics and finally the Curator’s own original synthetic statements of the new Art, a new conceptual perspective on Science.

  • For our VISION, See

http://pharmaceuticalintelligence.com/vision/

  • For periodic updates to the List of Cases developed by this Author/Curator, see

http://pharmaceuticalintelligence.com/contributors-biographies/aviva-lev-ari/

  • For a complete contribution to the Open Access Online Scientific Journal by the Author/Curator, see

http://pharmaceuticalintelligence.com — Search by Author/Curator’s Last Name, 567 articles on 7/30/2013

  • For the BioMed e-Books Series in Production, see

http://pharmaceuticalintelligence.com/biomed-e-books/

  • FIRST book of their BioMedical E-Book Series, Perspectives on Nitric Oxide in Disease Mechanisms, now available on Amazon.com Kindle Store

http://www.amazon.com/dp/B00DINFFYC

  • For CV of our entire Team of Experts, Authors, Writers, see

http://pharmaceuticalintelligence.com/contributors-biographies/

In part Part II: Cases in Co-Curation and Scientific Content Critique, are presented. A similar process to the one in Part I, is been applied. However, the Co-Curation, brings on stage several players. The Actors in the Scientific Writers Theater,  all own scientific knowledge and master the process of creation of a new Synthesis for most writing engagements. Since the Co-curators are educated in different disciplines, they are skillfully providing interpretations for others’ and their own new conception of ideas. Thus, they are developing new views of the original scientific results presented in peer reviewed journals, just the leading ones in every field. The Co-Curators, their creation is a new layer of comprehension for the processes at hand.

Example #1:

Action Potential, a well define concept in Physiology. For us,  Action Potential was a conceptual creation for the process of Co-Curation. Dr. Lev-Ari, requesting Dr. Bernstein to elaborate creatively, on the function of actin in cytoskeleton mobility, he did,  THEN a new conceptual creation process emerged and had YIELDED the following article:

Identification of Biomarkers that are Related to the Actin Cytoskeleton

Curator: Larry H Bernstein, MD, FCAP

http://pharmaceuticalintelligence.com/2012/12/10/identification-of-biomarkers-that-are-related-to-the-actin-cytoskeleton/

Example #2:

The e-Reader reads first

High Serum Calcium Linked to Developing Diabetes: IRAS Study

 Sep 24, 2013

http://www.medscape.com/viewarticle/811536

The e-Reader reads second the curation of that Source Interview

Diabetes-risk Forecasts: Serum Calcium in Upper-Normal Range (>2.5 mmol/L) as a New Biomarker

http://pharmaceuticalintelligence.com/2013/09/25/diabetes-risk-forecasts-serum-calcium-in-upper-normal-range-2-5-mmoll-as-a-new-biomarker/

The e-Reader will compare which of the two is more beneficial for the e-Reader.

We believe that the curation of the Source Interview has remarkable value added analysis that the Reader can benefit from.

The unique process as described for Part I and for Part II, above, will be demonstrated, below,  in concrete cases, as we applied the methodology of curation by one or by several Experts, Authors, Writers in the field of Cardiovascular Diseases.

The Process: We culled the scene for Cardiovascular Original Research in +24 Journals, we pre-select domains of research to cover: The Etiology of the Disease, the Risks of dysfunction at cellular, tissue, organelle, organ, anatomy, physiology, pathophysiology and diagnostics for all of the above. We interpret the Disease Management Options in a comprehensive fashion, exposing the e-Reader to an integrative approach for the treatment of Cardiovascular Disease.

Below,  the e-Reader finds selective cases exemplifying the methodology described, making

the one and only on the Internet and in e-Book Stores, to date.

 

Part I       

The Curator as a Scientific Content Critique for the Architecture of Knowledge

Lev-Ari, A. 8/6/2013 Stent Design and Thrombosis:  Bifurcation Intervention, Drug Eluting Stents (DES) and Biodegrable Stents

http://pharmaceuticalintelligence.com/2013/08/06/stent-design-and-thrombosis-bifurcation-intervention-drug-eluting-stents-des-and-biodegrable-stents/

Lev-Ari, A. 8/1/2013 Calcium Cycling (ATPase Pump) in Cardiac Gene Therapy: Inhalable Gene Therapy for Pulmonary Arterial Hypertension and Percutaneous Intra-coronary Artery Infusion for Heart Failure: Contributions by Roger J. Hajjar, MD

http://pharmaceuticalintelligence.com/2013/08/01/calcium-molecule-in-cardiac-gene-therapy-inhalable-gene-therapy-for-pulmonary-arterial-hypertension-and-percutaneous-intra-coronary-artery-infusion-for-heart-failure-contributions-by-roger-j-hajjar/

Lev-Ari, A. 7/19/2013 3D Cardiovascular Theater – Hybrid Cath Lab/OR Suite, Hybrid Surgery, Complications Post PCI and Repeat Sternotomy

http://pharmaceuticalintelligence.com/2013/07/19/3d-cardiovascular-theater-hybrid-cath-labor-suite-hybrid-surgery-complications-post-pci-and-repeat-sternotomy/

Lev-Ari, A. 7/14/2013 Vascular Surgery: International, Multispecialty Position Statement on Carotid Stenting, 2013 and Contributions of a Vascular Surgeon at Peak Career – Richard Paul Cambria, MD

http://pharmaceuticalintelligence.com/2013/07/14/vascular-surgery-position-statement-in-2013-and-contributions-of-a-vascular-surgeon-at-peak-career-richard-paul-cambria-md-chief-division-of-vascular-and-endovascular-surgery-co-director-thoracic/

Lev-Ari, A. 7/9/2013 Heart Transplant (HT) Indication for Heart Failure (HF): Procedure Outcomes and Research on HF, HT @ Two Nation’s Leading HF & HT Centers

http://pharmaceuticalintelligence.com/2013/07/09/research-programs-george-m-linda-h-kaufman-center-for-heart-failure-cleveland-clinic/

Lev-Ari, A. 7/8/2013 Becoming a Cardiothoracic Surgeon: An Emerging Profile in the Surgery Theater and through Scientific Publications

http://pharmaceuticalintelligence.com/2013/07/08/becoming-a-cardiothoracic-surgeon-an-emerging-profile-in-the-surgery-theater-and-through-scientific-publications/

Lev-Ari, A. 7/1/22013 Endovascular Lower-extremity Revascularization Effectiveness: Vascular Surgeons (VSs), Interventional Cardiologists (ICs) and Interventional Radiologists (IRs)

http://pharmaceuticalintelligence.com/2013/07/01/endovascular-lower-extremity-revascularization-effectiveness-vascular-surgeons-vss-interventional-cardiologists-ics-and-interventional-radiologists-irs/

Lev-Ari, A. 6/10/2013 No Early Symptoms – An Aortic Aneurysm Before It Ruptures – Is There A Way To Know If I Have it?

http://pharmaceuticalintelligence.com/2013/06/10/no-early-symptoms-an-aortic-aneurysm-before-it-ruptures-is-there-a-way-to-know-if-i-have-it/

Lev-Ari, A. 6/9/2013 Congenital Heart Disease (CHD) at Birth and into Adulthood: The Role of Spontaneous Mutations

http://pharmaceuticalintelligence.com/2013/06/09/congenital-heart-disease-at-birth-and-into-adulthood-the-role-of-spontaneous-mutations-the-genes-and-the-pathways/

Lev-Ari, A. 6/3/2013 Clinical Indications for Use of Inhaled Nitric Oxide (iNO) in the Adult Patient Market: Clinical Outcomes after Use, Therapy Demand and Cost of Care

http://pharmaceuticalintelligence.com/2013/06/03/clinical-indications-for-use-of-inhaled-nitric-oxide-ino-in-the-adult-patient-market-clinical-outcomes-after-use-therapy-demand-and-cost-of-care/

Lev-Ari, A. 6/2/2013 Inhaled Nitric Oxide in Adults: Clinical Trials and Meta Analysis Studies – Recent Findings

http://pharmaceuticalintelligence.com/2013/06/02/inhaled-nitric-oxide-in-adults-with-acute-respiratory-distress-syndrome/

Lev-Ari, A. 5/17/2013 Synthetic Biology: On Advanced Genome Interpretation for Gene Variants and Pathways: What is the Genetic Base of Atherosclerosis and Loss of Arterial Elasticity with Aging

http://pharmaceuticalintelligence.com/2013/05/17/synthetic-biology-on-advanced-genome-interpretation-for-gene-variants-and-pathways-what-is-the-genetic-base-of-atherosclerosis-and-loss-of-arterial-elasticity-with-aging/

Lev-Ari, A. 4/28/2013 Genetics of Conduction Disease: Atrioventricular (AV) Conduction Disease (block): Gene Mutations – Transcription, Excitability, and Energy Homeostasis

http://pharmaceuticalintelligence.com/2013/04/28/genetics-of-conduction-disease-atrioventricular-av-conduction-disease-block-gene-mutations-transcription-excitability-and-energy-homeostasis/

Lev-Ari, A. 2/28/2013 The Heart: Vasculature Protection – A Concept-based Pharmacological Therapy including THYMOSIN

http://pharmaceuticalintelligence.com/2013/02/28/the-heart-vasculature-protection-a-concept-based-pharmacological-therapy-including-thymosin/

Part II         

Cases in Co-Curation and Scientific Content Critique

Pearlman, JD, and A.  Lev-Ari, 9/30/2013

State of Cardiology on Wall Stress, Ventricular Workload and Myocardial Contractile Reserve: Aspects of Translational Medicine(TM)

http://pharmaceuticalintelligence.com/2013/09/30/state-of-cardiology-on-wall-stress-ventricular-workload-and-myocardial-contractile-reserve-aspects-of-translational-medicine/

Lal, V, Pearlman JD, and A. Lev-Ari, 9/23/2013

Do Novel Anticoagulants Affect the PT/INR? The Cases of  XARELTO (rivaroxaban) or PRADAXA (dabigatran)

http://pharmaceuticalintelligence.com/2013/09/23/do-novel-anticoagulants-affect-the-ptinr-the-cases-of-xarelto-rivaroxaban-and-pradaxa-dabigatran/

Bernstein LH, SJ Williams and A. Lev-Ari, 8/26/2013

Part II: Role of Calcium, the Actin Skeleton, and Lipid Structures in Signaling and Cell Motility

http://pharmaceuticalintelligence.com/2013/08/26/role-of-calcium-the-actin-skeleton-and-lipid-structures-in-signaling-and-cell-motility/

Bernstein LH, SJ Williams and A. Lev-Ari,  9/2/2013

Part III: Renal Distal Tubular Ca2+ Exchange Mechanism in Health and Disease

http://pharmaceuticalintelligence.com/2013/09/02/renal-distal-tubular-ca2-exchange-mechanism-in-health-and-disease/

Bernstein LH, Pearlman JD and A. Lev-Ari, 9/8/2013

Part IV: The Centrality of Ca(2+) Signaling and Cytoskeleton Involving Calmodulin Kinases and Ryanodine Receptors in Cardiac Failure, Arterial Smooth Muscle, Post-ischemic Arrhythmia, Similarities and Differences, and Pharmaceutical Targets

http://pharmaceuticalintelligence.com/2013/09/08/the-centrality-of-ca2-signaling-and-cytoskeleton-involving-calmodulin-kinases-and-ryanodine-receptors-in-cardiac-failure-arterial-smooth-muscle-post-ischemic-arrhythmia-similarities-and-differen/

Bernstein LH, Pearlman JD and A. Lev-Ari, 8/26/2013

Part V: Heart, Vascular Smooth Muscle, Excitation-Contraction Coupling (E-CC), Cytoskeleton, Cellular Dynamics and Ca2 Signaling

http://pharmaceuticalintelligence.com/2013/08/26/heart-smooth-muscle-excitation-contraction-coupling-cytoskeleton-cellular-dynamics-and-ca2-signaling/

Pearlman, JD, Bernstein, HL and A. Lev-Ari 8/28/2013

Part VII: Cardiac Contractility & Myocardium Performance: Ventricular Arrhythmias and Non-ischemic Heart Failure – Therapeutic Implications for Cardiomyocyte Ryanopathy (Calcium Release-related Contractile Dysfunction) and Catecholamine Responses

http://pharmaceuticalintelligence.com/2013/08/28/cardiac-contractility-myocardium-performance-ventricular-arrhythmias-and-non-ischemic-heart-failure-therapeutic-implications-for-cardiomyocyte-ryanopathy-calcium-release-related-contractile/

Pearlman, JD, Bernstein, LH and A. Lev-Ari, 9/12/2013

Part VIII: Disruption of Calcium Homeostasis: Cardiomyocytes and Vascular Smooth Muscle Cells: The Cardiac and Cardiovascular Calcium Signaling Mechanism

http://pharmaceuticalintelligence.com/2013/09/12/disruption-of-calcium-homeostasis-cardiomyocytes-and-vascular-smooth-muscle-cells-the-cardiac-and-cardiovascular-calcium-signaling-mechanism/

Pearlman, JD, Bernstein, LH and A. Lev-Ari, 9/16/2013

Part IX: Calcium-Channel Blockers, Calcium Release-related Contractile Dysfunction (Ryanopathy) and Calcium as Neurotransmitter Sensor

http://pharmaceuticalintelligence.com/2013/09/16/calcium-channel-blocker-calcium-as-neurotransmitter-sensor-and-calcium-release-related-contractile-dysfunction-ryanopathy/

Bernstein, LH and A. Lev-Ari, 9/10/2013

Part X: Synaptotagmin functions as a Calcium Sensor: How Calcium Ions Regulate the fusion of vesicles with cell membranes during Neurotransmission

http://pharmaceuticalintelligence.com/2013/09/10/synaptotagmin-functions-as-a-calcium-sensor-how-calcium-ions-regulate-the-fusion-of-vesicles-with-cell-membranes-during-neurotransmission/

Pearlman JD and A. Lev-Ari 8/25/2013

Coronary Circulation Combined Assessment: Optical Coherence Tomography (OCT), Near-Infrared Spectroscopy (NIRS) and Intravascular Ultrasound (IVUS) – Detection of Lipid-Rich Plaque and Prevention of Acute Coronary Syndrome (ACS)

http://pharmaceuticalintelligence.com/2013/08/25/coronary-circulation-combined-assessment-optical-coherence-tomography-oct-near-infrared-spectroscopy-nirs-and-intravascular-ultrasound-ivus-detection-of-lipid-rich-plaque-and-prevention-of-a/

Pearlman, JD, Bernstein, LH and A. Lev-Ari 8/5/2013

Alternative Designs for the Human Artificial Heart: The Patients in Heart Failure – Outcomes of Transplant (donor)/Implantation (artificial) and Monitoring Technologies for the Transplant/Implant Patient in the Community. To be submitted to Heart Failure Society of America (HFSA)

http://pharmaceuticalintelligence.com/2013/08/05/alternative-designs-for-the-human-artificial-heart-the-patients-in-heart-failure-outcomes-of-transplant-donorimplantation-artificial-and-monitoring-technologies-for-the-transplantimplant-pat/

Pearlman, JD and A. Lev-Ari 7/23/2013

Cardiovascular Complications: Death from Reoperative Sternotomy after prior CABG, MVR, AVR, or Radiation; Complications of PCI; Sepsis from Cardiovascular Interventions

http://pharmaceuticalintelligence.com/2013/07/23/cardiovascular-complications-of-multiple-etiologies-repeat-sternotomy-post-cabg-or-avr-post-pci-pad-endoscopy-andor-resultant-of-systemic-sepsis/

Pearlman, JD and A. Lev-Ari 7/22/2013

Cardiac Resynchronization Therapy (CRT) to Arrhythmias: Pacemaker/Implantable Cardioverter Defibrillator (ICD) Insertion

http://pharmaceuticalintelligence.com/2013/07/22/cardiac-resynchronization-therapy-crt-to-arrhythmias-pacemakerimplantable-cardioverter-defibrillator-icd-insertion

Pearlman, JD and A. Lev-Ari 7/17/2013

Emerging Clinical Applications for Cardiac CT: Plaque Characterization, SPECT Functionality, Angiogram’s and Non-Invasive FFR

http://pharmaceuticalintelligence.com/2013/07/17/emerging-clinical-applications-for-cardiac-ct-plaque-characterization-spect-functionality-angiograms-and-non-invasive-ffr/

Pearlman, JD and A. Lev-Ari 7/4/2013

Fractional Flow Reserve (FFR) & Instantaneous wave-free ratio (iFR): An Evaluation of Catheterization Lab Tools for Ischemic Assessment

http://pharmaceuticalintelligence.com/2013/07/04/fractional-flow-reserve-ffr-instantaneous-wave-free-rario-ifr-an-evaluation-of-catheterization-lab-tools-for-ischemic-assessment/

Pearlman, JD and A. Lev-Ari 5/24/2013

Imaging Biomarker for Arterial Stiffness: Pathways in Pharmacotherapy for Hypertension and Hypercholesterolemia Management

http://pharmaceuticalintelligence.com/2013/05/24/imaging-biomarker-for-arterial-stiffness-pathways-in-pharmacotherapy-for-hypertension-and-hypercholesterolemia-management/

Pearlman, JD and A. Lev-Ari 5/22/2013

Acute and Chronic Myocardial Infarction: Quantification of Myocardial Perfusion Viability – FDG-PET/MRI vs. MRI or PET alone

http://pharmaceuticalintelligence.com/2013/05/22/acute-and-chronic-myocardial-infarction-quantification-of-myocardial-viability-fdg-petmri-vs-mri-or-pet-alone/

Pearlman JD, LH Bernstein and A. Lev-Ari 5/15/2013

Diagnosis of Cardiovascular Disease, Treatment and Prevention: Current & Predicted Cost of Care and the Promise of Individualized Medicine Using Clinical Decision Support Systems

http://pharmaceuticalintelligence.com/2013/05/15/diagnosis-of-cardiovascular-disease-treatment-and-prevention-current-predicted-cost-of-care-and-the-promise-of-individualized-medicine-using-clinical-decision-support-systems-2/

Pearlman, JD and A. Lev-Ari 5/11/2013

Hypertension and Vascular Compliance: 2013 Thought Frontier – An Arterial Elasticity Focus

http://pharmaceuticalintelligence.com/2013/05/11/arterial-elasticity-in-quest-for-a-drug-stabilizer-isolated-systolic-hypertension-caused-by-arterial-stiffening-ineffectively-treated-by-vasodilatation-antihypertensives/

Pearlman, JD and A. Lev-Ari 5/7/2013

On Devices and On Algorithms: Arrhythmia after Cardiac Surgery Prediction and ECG Prediction of Paroxysmal Atrial Fibrillation Onset

http://pharmaceuticalintelligence.com/2013/05/07/on-devices-and-on-algorithms-arrhythmia-after-cardiac-surgery-prediction-and-ecg-prediction-of-paroxysmal-atrial-fibrillation-onset/

Pearlman, JD and A. Lev-Ari 5/4/2013

Clinical Decision Support Systems for Management Decision Making of Cardiovascular Diseases

http://pharmaceuticalintelligence.com/2013/05/04/cardiovascular-diseases-decision-support-systems-for-disease-management-decision-making/

Lev-Ari, A. and LH Bernstein 3/7/2013

Genomics & Genetics of Cardiovascular Disease Diagnoses: A Literature Survey of AHA’s Circulation Cardiovascular Genetics, 3/2010 – 3/2013

http://pharmaceuticalintelligence.com/2013/03/07/genomics-genetics-of-cardiovascular-disease-diagnoses-a-literature-survey-of-ahas-circulation-cardiovascular-genetics-32010-32013/

Find out more:

« Curation is the new research, »… et le nouveau média, Benoit Raphael, 2011http://benoitraphael.com/2011/01/17/curation-is-the-new-search/

La curation : la révolution du webjournalisme?, non-fiction.fr http://www.nonfiction.fr/article-4158-la_curation__la_revolution_du_webjournalisme_.htm

La curation : les 10 raisons de s’y intéresser, Pierre Tran http://pro.01net.com/editorial/529947/la-curation-les-10-raisons-de-sy-interesser/

Curation : quelle valeur pour les entreprises, les médias, et sa « marque personnelle »?, Marie-Laure Vie http://marilor.posterous.com/curation-et-marketing-de-linformation

Cracking Open the Scientific Process, Thomas Lin, New York Timeshttp://www.nytimes.com/2012/01/17/science/open-science-challenges-journal-tradition-with-web-collaboration.html?_r=4&pagewanted=1

La « massification » du web transforme les relations sociales, Valérie Varandat, INRIAhttp://www.inria.fr/actualite/actualites-inria/internet-du-futur

Internet a révolutionné le métier de chercheur, AgoraVoxhttp://www.agoravox.fr/actualites/technologies/article/internet-a-revolutionne-le-metier-103514

Gérer ses références numériques, Université de Genèvehttp://www.unige.ch/medecine/udrem/Unit/actualites/biblioManager.html

Notre liste Scoop-it : Scientific Social Network, MyScienceWork

SOURCE on Curation and Science

Share this:

 

Read Full Post »

The Effects of Bovine Thrombin on HUVEC and AoSMC

Curators: Demet Sağ, 1,* and Jeffrey Harold Lawson 1,2

From the Department of Surgery1 and Pathology2  Duke University Medical Center Durham, NC-USA

Running Foot:

Thrombin induces vascular cell proliferation

 

crystal structure of thrombin.

crystal structure of thrombin. (Photo credit: Wikipedia)

Review Profs and correspondence should be addressed to:

Dr. Jeffrey Lawson

Duke University Medical Center

Room 481 MSRB/ Boxes 2622

Research Drive

Durham, NC 27710

Phone (919) 681-6432

Fax      (919) 681-1094

Email: lawso717@duke.edu, demet.sag@gmail.com

*Current Address:  TransGenomics Consulting, Principal, 3830 Valley Center Drive, Suite 705-223 San Diego, CA 92130

 

Abstract: 

Thrombin is a serine protease with multiple cellular functions that acts through protease activated receptor kinases (PARs) and responds to trauma at the endothelial cells of vein resulting in coagulation.  In this study, we had analyzed the activity of thrombin on the vein by using human umbilical vein endothelial (HUVEC) and human aorta smooth muscle (AoSMC) cells.  Ectopic thrombin increases the expression of PARs, cAMP concentration, and Gi signaling as a result the proliferation events in the smooth muscle cells achieved by the elevation of activated ERK leading to gene activation through c-AMP binding elements responsive transcription factors such as CREB, NFkB50, c-fos, ATF-2.  We had observed activation of p38 as well as JNK but they were related to stress and inflammation. In the nucleus, ATF-2 activity is the start point of IL-2 proliferation through T cell activation creating APC and B-cell memory leading to autoimmune reaction as a result of ectopic thrombin.  These changes in the gene activation increased connective tissue growth factor as well as cysteine rich protein expression at the mRNA level, which proven to involve in vascularization and angiogenesis in several studies.  Consequently, when ectopic thrombin used during the graft transplant surgeries, it causes occlusion of the veins so that transplant needs to be replaced within six months due to thrombin’s proliferative function as mitogen in the smooth muscle cells.

WORD COUNT OF ABSTRACT: 221

 

  

The Effect of Thrombin(s) on Smooth Muscle and Endothelial Cells

Thrombin is a multifunctional serine protease that plays a major role in the highly regulated series of biochemical reactions leading to the formation of fibrin (1, 2).  Thrombin has been shown to affect a vast number of cell types, including platelets, endothelial cells, smooth muscle cells, cardiomyocytes, fibroblasts, mast cells, neurons, keratinocytes, monocytes, macrophages and a variety of lymphocytes, including B-cells and T-cells, and stimulate smooth muscle and endothelial cell proliferation (3-13).

Induction of thrombin results in cells response as immune response and proliferation by affecting transcriptional control of gene expression through series of signaling mechanisms (14).  First, protease activated receptor kinases (PAR), which are seven membrane spanning receptors called G protein coupled receptors (GPCR) are initiate the line of mechanism by thrombin resulting in variety of cellular responses. These receptorsare activated by a unique mechanism in which the protease createsa new extracellular amino-terminus functioning as a tetheredligand, results in intermolecular activation.  PARs are ‘single-use’ receptors: activation is irreversible and the cleaved receptors are degraded in lysosomes, as they play important roles in ’emergency situations’, such as trauma and inflammation.  Protease activated receptor 1 (PAR1) is the prototype of this family and is activated when thrombin cleaves its amino-terminal extracellular domain.  PAR1, PAR3, and PAR4 are activated by thrombin. Whereas PAR2 is activated by trypsin, factor VIIa, tissue factor, factor Xa, thrombin cleaved PAR1.

Second, the activated PAR by the thrombin stimulates downstream signaling events by G protein dependent or independent pathways.  Although each of the PAR respond to thrombin undoubtedly mediates different thrombin responses, most of what is known about thrombin signaling downstream of the receptors themselves has derived from studies of PAR1.  PAR couples with at least three G protein families Gq, Gi, and G12/13.  With G protein activation: Gi/q leads InsP3 induced Ca release and/or Rac induced membrane ruffling.  Gi dependent signaling activates Ras, p42/44, Src/Fak, p42.  Rho related proteins and phospholipase C results in mitogenesis and actin cytoskeletal rearrangements. G protein independent activation happens either through tyrosine kinase trans-activation results in mitogenesis and stress-fibre formation, neurite retraction by Rho path, or activation of choline for Rap association with newly systhesized actin.  These events are tightly regulated to support diverse cellular responses of thrombin. (15-17).

Treatment of veins with topical bovine thrombin showed early occlusion of the veins result in proliferation of smooth muscle cells (18-24) due to change of gene expression transcription.  The change of Ca++ and cAMP concentrations influence cAMP response element binding protein (25-30) carrying transcription factors such as CREB, ATF-2, c-jun, c-fos, c-Rel.  Activation of angiogenesis and vascularization affects cysteine rich gene family (CCN) genes such as connective tissue factor (CTGF) and cysteine rich gene (Cyr61) according to performed studies and microarray analysis by (31-36).   Currently the most common topical products approved by FDA are bovine originated.   Although bovine thrombin is very similar to human (37, 38), it has a species specific activity, shown to cause autoimmune-response (39-42), which results in repeated surgeries (40, 43, 44), and renal failures that cost to health of individuals as well as to the economy.

In this report we had evaluated the effect of topically applied bovine thrombin to human umbilical endothelial cells (HUVECs) and human aorta smooth muscle cells (AoSMCs).  We had showed that use of bovine thrombin cause adverse affects on the cellular physiology of human vein towards proliferation of smooth muscle tissue.   Collectively, thrombin usage should be assessed before and after surgery because it is a very potent substance.

MATERIALS AND METHODS:

Thrombins:  Bovine thrombin and human thrombin ((Haematologic Technologies Inc, VT); topical bovine thrombin (JMI, King’s Pharmaceutical, KS); topical human thrombin (Baxter, NC human thrombin sealant).

Cell Culture:  The pooled cells were received from Clonetics. Human endothelial cells  (HUVEC) were grown in EGM-2MV bullet kit (refinements to basal medium CCMD130 and the growth factors, 5% FBS, 0.04% hydrocortisone, 2.5% hFGF, 0.1% of each VEGF, IGF-1, Ascorbic acid, hEGF, GA-1000) and human aorta smooth muscle cells (AoSMC) were grown in SmGM-2 medium (5% FBS, 0.1% Insulin, 1.25% hFGF, 0.1% GA-1000, and 0.1% hEGF).     The cells were grown to confluence (2-3 days for HUVEC and 4-5 days for HOSMC) before splitted, and only used from passage 3 to 5.  Before stimulating the confluent cells, they had been starved with starvation media containing 0.1% bovine serum albumin (BSA) EGM-2 or SmBM basal media.

RNA isolation and RT-PCR:  The total RNA was isolated by RNeasy mini kit (Qiagen, Cat#74104) fibrous animal tissue protocol.  The two-step protocol had been applied to amplify cDNA by Prostar Ultra HF RT PCR kit (Stratagene Cat# 600166).  At first step, cDNA from the total RNA had been synthesized. After denaturing the RNA at 65 oC for 5 min, the Pfu Turbo added at room temperature to the reaction with random primers, then incubated at 42oC for 15min for cDNA amplification.   At the second step, hot start PCR reaction had been designed by use of gene specific primers for PAR1, PAR2, PAR3, and PAR4 to amplify DNA with robotic arm PCR. The reaction conditions were one cycle at 95oC for 1 min, 40 cycles for denatured at 95oC for 1 min, annealed at 50 oC 1min, amplified at 68 oC for 3min, finally one cycle of extension at 68 oC for 10 min.  The cDNA products were then usedas PCR templates for the amplification of a 614 bp PAR-1 fragment(PAR-1 sense: 5′-CTGACGCTCTTCATCCCCTCCGTG, PAR-1 antisense:5′-GACAGGAACAAAGCCCGCGACTTC), a 599 bp PAR-2 fragment (PAR-2sense: 5′-GGTCTTTCTTCCGGTCGTCTACAT, PAR-2 antisense: 5′-GCAGTTATGCAGTCAGGC),a 601 bp PAR-3 fragment (PAR-3 sense: 5′-GAGTCCCTGCCCACACAGTC,PAR-3 antisense: 5′-TCGCCAAATACCCAGTTGTT), a 492 bp PAR-4 fragment(PAR-4 sense: 5′-GAGCCGAAGTCCTCAGACAA, PAR-4 antisense: 5′-AGGCCACCAAACAGAGTCCA). The PCR consistedof 25 to 40 cycles between 95°C (15 seconds) and 55°C(45 seconds). Controls included reactions without template,without reverse transcriptase, and water alone. Primers forglyceraldehydes phosphate dehydrogenase (GAPDH; sense: 5′-GACCCCTTCATTGACCTCAAC,antisense: 5′-CTTCTCCATGGTGGTGAAGA) were used as controls. Reactionproducts were resolved on a 1.2% agarose gel and visualizedusing ethidium bromide.

The primers CTGF-(forward) 5′- GGAGCGAGACACCAACC -3′ and CTGF-(reverse) CCAGTCATAATCAAAGAAGCAGC ; Cyr61- (forward)  GGAAGCCTTGCT CATTCTTGA  and Cyr61- (reverse) TCC AAT CGT GGC TGC ATT AGT were used for RT-PCR.  The conditions were hot start at 95C for 1 min, fourty cycles of denaturing for 45 sec at 95C, annealing for 45 sec at 55C and amplifying for 2min at 68C, followed by 10 minutes at 68C extension.

 

Cell Proliferation Assay with WST-1—Cell proliferation assays were performed using the cell proliferation reagent 3-(4,5 dimethylthiazaol-2-y1)-2,5-dimethyltetrazolium bromide (WST-1, Roche Cat# 1-644-807) via indirect mechanism.   This non-radioactive colorimetric assay is based on the cleavage of the tetrazolium salt WST-1 by mitocondrial dehydrogenases in viable cells forming colored reaction product.   HUVECs were grown in 96 well plates (starting from 250, 500, and 1000 cells/well) for 1 day and then incubated the medium without FBS and growth factors for 24 h.  The cells were then treated with WST-1 and four types of thrombins, 100 units of each BIIa, HIIa, TBIIa, and THIIa.  The reaction was stopped by H2SO4 and absorbance (450 nm) of the formazan product was measured as an index of cell proliferation. The standard error of mean had been calculated.

BrDu incorporation:  This method being chosen to determine the cellular proliferation with a direct non-radioactive measurement of DNA synthesis based on the incorporation of the pyridine analogous 5 bromo-2’-deoxyuridine (BrDu) instead of thymidine into the DNA of proliferating cells. The antibody conjugate reacts with BrDu and with BrDu incorporated into DNA.  The antibody does not cross-react with endogenous cellular components such as thymidine, uridine, or DNA.  The cells were seeded, next day starved for 24h, and were stimulated at time intervals 3h, 24h, and 72h with 100 units of each BIIa, HIIa, TBIIa, and THIIa, and BrDu (Roche).  Cells were fixed for 15 min with fixation-denature solution and incubated with primary antibody (anti-BrDu) prior to incubation with the secondary antibody.  The cells were then fixed in 3.7% formaldehyde for 10 min at room temperature, rinsed in PBS and the chromatin was rendered accessible by a 10 min treatment with HCI (2 M), then measured the activity at A450nm.

Nuclear Extract Preparation:  The nuclear extracts were prepared by the protocol suggested in the ELISA inflammation kit (BD).   For each treatment one 100mm plate were used per cell line.

EMSA:  The 96 well-plates were blocked at room temperature before incubating with the 50 ul of prepared nuclear extracts from each treated cell line were placed for one hour at 25C.  The washed plates were incubated with primary antibodies of each transcription factors for another hour at 25C and repeat the wash step with transfactor/blocking buffer prior to secondary antibody addition for 30 min at 25C, wash again with transfactor buffer, which was followed by development of the blue color for ten minutes and the reaction was stopped with 1M sulfuric acid, and the absorbance readings were taking at 450nm by multiple well plate reader.

Immunoblotting:  The activated level of pERK, Gi, Gq, and PAR1 had been immunoblotted to observe the mitogenic effect of bovine thrombin on both HUVEC and AoSMCs.   The cells were lysed in sample buffer (0.25M Tris-HCl, pH 6.8, 10% glycerol, 5%SDS, 5% b-mercaptoethanol, 0.02%bromophenol blue).  The samples were run on the 16% SDS-PAGE for 1 hour at 30mA per gel. Following the completion of transfer onto 0.45micro molar nitrocellulose membrane for 1 hour at 250mA, the membranes were blocked in 5% skim milk phosphate buffered saline at 4C for 4 hours. The membranes were washed three times for 10 minutes each in 0.1% Tween-20 in PBS after both primary and secondary antibody incubations.  The pERK (42/44 kD), Gi (40kDa), Gq (40kDa) and PAR1 (55kDa) visualized with the polyclonal antibody raised against each in rabbit (1:5000 dilution from g/ml, Cell Signaling) and chemiluminescent detection of anti-rabbit IgG 1/200 conjugated with horseradish peroxidase (ECL, Amersham Corp).

RESULTS:

The expression of PARs differs for the types  of  vascular cells. 

Figure 1 shows PAR 1 and PAR3 expression on HUVECs and AoSMCs. The expression was evaluated consisted with prior work PAR1 and PAR3 express on AoSMC but PAR2 and PAR4 are not.  The level of PAR1 expression is significantly greater on AoSMC (3:1) then HUVECs.  We determine the PAR2 in vitro in HUVECs or AoSMCs, PAR2, does not respond to thrombin however according to reports, has function in inflammation. PAR4 is not detected in either cell types. However, PAR3 responding to thrombin at low concentration showed minute amount in AoSMC compare to weak presence in HUVECs. The origin of the thrombin may influence the difference in expression of PAR4 in HUVECs, since BIIa caused higher PAR4 expression than HIIA, but THIIa had almost none (not shown).

The expression of the PARs, G proteins, and pERK use different signaling dynamics. The application of thrombin triggers the extracellular signaling mechanism through the PARs on the membrane; next, the signal travels through cytoplasm by Gi and Gq to MAPKs. Gi was activated   more on AoSMC than HUVECs (Figure 2 and Figure 3).

In Figure 2 demonstrates the expression of Gi on HUVEC starts at 20minutes and continues to be expressed until 5.5h time interval, but Gq/11 expression is almost same between non-stimulated and stimulated samples from 20min to 5.5 h period.  The difference of expression between the two kinds of G proteins is subtle, Gi is at least five fold more than Gi expression on AoSMC. 

In Figure 3, there is a difference between Gi and Gq/11 expression on HUVEC. The linear  increase from 0 to 30 minutes was detected, at 1hour the expression decreased by 50%, then the expression became un-detectable.   Both Gi and Gq/11 showed the same pattern of expression but only Gi had again showed five times stronger signal than Gq/11.  This brings the possibility that Gi had been activated due to thrombin and this signal pass onto AoSMC and remain there long period of time.

Next, the proliferation through MAPK signaling had been tested by ERK activation.  Figure 4 represents this activation data that both HUVECs and AoSMCs express activated ERK, but the activity dynamics is different as expected from G protein signaling pattern.   Both AoSMC and HUVECs starts to express the activated ERK around 20min time and reach to the plato at 3.5hr.  AoSMCs get phosphorylated at least 5 times more than HUVECs.   This might be related to dynamics of each PARs as it had been suggested previously (by Coughlin group PAR1 vs. PAR4).

Activation of DNA synthesis in AoSMCs.  As it had been shown the serine proteases, thrombin and trypsin are among many factors that malignant cells secrete into the extracellular space to mediate metastatic processes such as cellular invasion, extracellular matrix degradation, angiogenesis, and tissue remodeling. We want to examine whether the types of thrombin had any specificity on proliferation on either cell types. Moreover, if there was a correlation between the number of cells and origin of thrombin, it can be use as reference to predict the response from the patient that may be valuable in patient’s recovery. As a result, we had investigated the proliferation of HUVECs and AoSMCs by WST-1 and BrDu.

DNA synthesis experiments for HUVECs with WST-1and BrDu showed no mitogenic response to thrombins we used with WST-1 or BrDu.   All together, in our data showed that there is no significant proliferation in HUVECs due to thrombins we used (data not shown).

DNA synthesis for AoSMCs With WST-1: After the starvation of the cells hours by depleting the cells were treated with WST-1 and readings were collected at time intervals of 0, 3.5, 25, and 45hours.  The measured WST-1 reaction increased 20% between each time points from 0 to 25 h and stop at 45 h except THIIa continue 20% increase (not shown). 

DNA synthesis at AoSMCs With BrDu: We had observed 2.5 fold increase of DNA synthesis of AoSMC after 72 hr in response to thrombin treatments, that resulted in cell proliferation according to Figure 5.  The plates were seeded with 500 cells and the proliferation was measured at time intervals 3h, 24h, and 72h.  At 3h time interval no difference between non-stimulated and  stimulated by topical bovine thrombin AoSMC.  At 24h the cells proliferate 20% by favor of treated cells, finally at 72h the ectopical bovine thrombin cause 253% more cell proliferationthan baseline. On the same token, TBIIa had 100% more mitogenic than THIIa but there was almost no difference between the HIIa and BIIa on proliferation (not shown).  This predicts that as well as the origin of the product the purity of the preparation is important.

Effects of thrombin and TRAPS (thrombin receptor activated peptides) on the HUVECs

Figure 6A (Figure 6) presents how TRAP stimulated cells change their transcription factor expression.  PAR1 effects CREB and c-Rel, but PAR3 affects ATF-2 and c-Rel. The proliferation signals eventually affect the gene expression and activation of downstream genes.  HUVECs were treated all four known TRAPs directly, before treating them with types of ectopical thrombins.  As a result, it is important to find how direct application of specific peptides for each PAR receptor will change the gene expression in the nucleus of ECs as well as their phenotype to activate SMCs.  PAR1 caused 175% increase on 200% on c-rel, 175% CREB, 90% on ATF2, 80% on c-fos, 70% on NfkB 50 and 60% on NFkB65. On the other hand, PAR3 affected the ATF2 by 200%.  PAR3 increased the c-Rel by 160%, and NfkB50, NFkB65, and c-fos by 60%.  These factors have CREs (cAMP response elements) in their transcriptional sequence and they bind to p300/CREB either creating homodimers or heterodimers to trigger transcriptional control mechanism of a cell, e.g. T cell activation by IL2 proliferation activated by ATF dimers or choosing between controlled versus un-controlled cellular proliferation. These decisions determine what downstream genes are going to be on and when.  This data confirms the increased of activated ERK, p38 and JNK protein expression in vivo study (Sag et al., 2013)

The effects of thrombins on the transcription factors.  Figure 7 demonstrates the comparison between HUVECs and AoSMC after topical bovine thrombin (JMI) stimulation to detect a difference on transcription activation. First, Figure 7A shows in HUVECs  topical bovine thrombin causes elevation of ATF2 activation by  50% and c-Rel by 30%.  Figure 7B represents in AoSMC thrombin affects CREB specifically since no change on HUVECs.  As a result, the transcription factors are activated differently, therefore, CREB 40%, ATF2 80%, and c-Rel 10% elevated by TBII treatment compare to baseline.

Gene Interaction changes after the thrombin treatment both in vivo and in vitro:  Figure 8 shows RT-PCR for two of the cysteine rich family proteins in vitro (this study) as well as in vivo (Sag et al manuscript 2006).  These genes have a  predicted function in angiogenesis, connective tissue growth factor (CTGF) and cystein rich protein 61 (Cyr61).  In our in vivo study, CTGF was only expressed if the veins are treated with thrombin and Cys61 expression is also elevated but both controls and bovine thrombin treated veins showed expression.  The total RNA from the cells was purified and testes against controls, the negative controls by water or by no reverse transcriptase and positive controls by internal gene, expression of beta actin.  The expression of beta actin is  at least two-three times abundant in HUVECs than that of AoSMC.  The CTGF is higher in AoSMCs  than HUVEC.  Simply the fact that the concentration of RNA is lower along with low internal expression positive control gene, but the CTGF expression was even 1 fold higher than HUVEC.  In perfect picture this theoretically adds up to 4 times difference between the cell types in favor of AoSMCs.  However, the Cyr61 expression adds up to the equal level of cDNA expression.

Consequently, the overall use of topical thrombins changed the fate of the cells plus when they were in their very fragile state under the surgical trauma and inflammation caused by the operation.  As a result, the cells may not be able make cohesive decision to avoid these extra signals, depending on the age and types of operations but eventually they lead to complications.

DISCUSSION:

In this study, we had shown the molecular pathway(s) affected by using ectopic thrombin during/after surgery on pig animal model that causing differentiation in the gene interactions for proliferation. In our study the mechanism for ectopic thrombins to investigate whether there was a difference in cell stimulation and gene interactions. Starting from the cell surface to the nucleus we had tested the mechanisms for thrombin affect on cells.  We had found that there were differences between endothelial cells and smooth muscle cell responses depending on the type of thrombin origin.  For example, PAR1 expressed heavily on HUVECs, but PAR1 and PAR3 on the AoSMCs.   Activated PARs couples to signaling cascades affect cell shape, secretion, integrin activation, metabolic responses, transcriptional responses and cell motility. Moreover, according to the literature these diverse functions differ depending on the cell type and time that adds another dimension.

Presence of PARs on different cell types have been studied by many groups for different reasons development, coagulation, inflammation and immune response. For example, PAR1 is the predominant thrombin receptor expressed in HUVECs and cleavage of PAR1 is required for EC responses to thrombin.  As a result, PAR2 may activate PAR1 for action in addition to transactivation between PAR3 and PAR4 observed. PAR4 is not expressed on HUVEC; and transactivation of PAR2 by cleaved PAR1 can contribute to endothelial cell responses to thrombin, particularly when signaling through PAR1 is blocked.

Next, the measurement of G protein expression shows that Gi and Gq have function at both cell types in terms of ectopical response to cAMP; therefore, Gi was heavily expressed. However Gi was stated to be function in development and growth therefore activates MAPKs most.  As it was expected from previous studies and our hands in vivo, observation of elevated ERK phosphorylation in vitro at time intervals relay us to determine simply what molecular genetics and development players cause the thickening in the vessel.  Analysis between the cell types resulted in proliferation of AoSMC, which was enough to occlude a vessel.

The ability of the immune system to distinguish between benignand harmful antigens is central to maintaining the overall healthof an organism. Fields and Shoenecker (2003) from our lab showed that proteases, namely those that can activate the PAR-2 transmembraneprotein, can up-regulate costimulatory molecules on DC and initiatean immune response (45).  Once activated, PAR-2 initiates a numberof intracellular events, including G and Gß signaling. Here, we show the PAR protein expression for PAR1 and PAR3 but not for PAR2.  Yet we had seen mRNA expression of PAR2 in vitro. We had also detected Gi and Gq but no expression of Ga or Gbg.   However, we did detect the difference of transcription factor activation by EMSA that correlates well with danger signal creation by thrombin.  In this report with the highlights of our data it seems that it is possibly an indirect response.

The bovine thrombin also affected the gene activation, measured by EMSA ELISA by direct treatment of the cells with thrombin response activation peptides (TRAPs) for PAR1, PAR2, PAR3, PAR4 on HUVECs since the endothelial cells directly exposed to ectopical thrombin treatment on vascular system and smooth muscle cells are inside of the vein.  Therefore, plausibly ECs transfer the signals received from their surface to the smooth muscle cells.  Second, we applied ectopical thrombins on AoSMCs as well as HUVECs by the same technique for the analysis of change same transcription factors previously with HUVEC for response to TRAPs.  These factors were ATF-2, CREB, c-rel, NFkB p50, NFkB p65, and c-fos.   In HUVECs, NFkB 50 increased the most by PAR2 oligo and PAR4 oligo, CREB as inflammatory response by PAR1 oligo, and ATF2 for PAR3 and PAR4 oligos, and c-fos with PAR4 oligo  The cellular response for thrombin in AoSMC differs from HUVEC since the at AoSMC not only proliferation by CREB  but also T cell activation by ATF-2 observed.

CREB (CRE-binding protein, Cyclic AMP Responsive DNA Binding Protein) protein has been shown to function as calcium regulated transcription factor as well as a substrate for depolarization-activated calcium calmodulin-dependent protein kinases II and I.   Some growth control genes, such as FOS have CRE, in their transcriptional regulatory region and their expression is induced by increase in the intracellular cAMP levels. This data goes very well with our finding of highly elevated Gi expression compare to Gq/11.  The CREB, or ATF (activating transcription factor, CRBP1, cAMP response element-binding protein 2, formerly; (CREB2) are also interacting with p300/CBP.  Transcriptional activation of CREB is controlled through phosphorylation at Ser133 by p90Rsk and the p44/42 MAP kinase (pERK, phosphorylated ERK). The transcriptional activity of the proto-oncogene c-Fos has been implicated in cell growth, differentiation, and development. Like CREB, c-Fos is regulated by p90Rsk.   NFKB has been detected in numerous cell types that express cytokines, chemokines, growth factors, cell adhesion molecules, and some acute phase proteins in health and in various disease states. In sum, our data is coherent from cellular membrane to nucleus as well as from nucleus to cellular membrane.

The origin of the thrombin is proven to be important, and required to be used very defined and clear concentrations.  It is not an old dog trick since ectopical thrombins have been used to control bleeding very widely without much required regulations not only in the surgeries but also in many other common applications.

In our experiments we observe MAPKs activities showed that pERK is active in AoSMCs more than HUVECs. The underlying mechanism how MAPKs connects to the cell cycle agree with our data that the mitogen-dependent induction of cyclin D1 expression, one of the earliest cell cycle-related events to occur during the G0/G1 to S-phase transition, is a potential target of MAPK regulation.  Activation of this signaling pathway by thrombin cause similar affects as expression of a constitutively active MKK1 mutant (46) does which results in dramatically increased cyclin D1 promoter activity and cyclin D1 protein expression.  In marked contrast, the p38 (MAPK) cascade showed an opposite effect on the regulation of cyclin D1 expression, which means that using unconcerned use of ectopic bovine thrombin will lead to more catastrophic affects then it was thought.  Since the p38 also is responsible for immune response mechanism, the system will be alarmed by the danger signal created by bovine thrombin.  The minute amount of well balanced mechanism will start against itself as it was observed previously (39-43, 47).

Finally, according to the lead from the literature tested the cysteine rich gene expression of CTGF and Cyr61 showing elevation of CTGF in AoSMCs also  make our argument stronger that the use of bovine thrombin does affect the cells beyond the proliferation but as system.

All together, both in vivo and in vitro studies confirms that choosing the right kind of ectopic product for the proper “hemostasis” to be resumed at an unexpected situation in the operation room is critical, therefore, this decision should require careful considiration to avoid long term health problems.

References:

1.         Kalafatis, M., Egan, J. O., van ‘t Veer, C., Cawthern, K. M., and Mann, K. G. The regulation of clotting factors. Crit Rev Eukaryot Gene Expr. 7: 241-280, 1997.

2.         Mann, K. G., Brummel-Ziedins, K., Orfeo, T., and Butenas, S. Models of blood coagulation. Blood Cells Mol Dis, 2006.

3.         Mann, K. G., Butenas, S., and Brummel, K. The dynamics of thrombin formation. Arterioscler Thromb Vasc Biol. 23: 17-25, 2003.

4.         Brummel, K. E., Butenas, S., and Mann, K. G. An integrated study of fibrinogen during blood coagulation. J Biol Chem. 274: 22862-22870, 1999.

5.         Kalafatis, M., Swords, N. A., Rand, M. D., and Mann, K. G. Membrane-dependent reactions in blood coagulation: role of the vitamin K-dependent enzyme complexes. Biochim Biophys Acta. 1227: 113-129, 1994.

6.         Lawson, J. H., and Mann, K. G. Cooperative activation of human factor IX by the human extrinsic pathway of blood coagulation. J Biol Chem. 266: 11317-11327, 1991.

7.         Mann, K. G., Nesheim, M. E., Church, W. R., Haley, P., and Krishnaswamy, S. Surface-dependent reactions of the vitamin K-dependent enzyme complexes. Blood. 76: 1-16, 1990.

8.         Hanisch, U. K., van Rossum, D., Xie, Y., Gast, K., Misselwitz, R., Auriola, S., Goldsteins, G., Koistinaho, J., Kettenmann, H., and Moller, T. The microglia-activating potential of thrombin: the protease is not involved in the induction of proinflammatory cytokines and chemokines. J Biol Chem. 279: 51880-51887, 2004.

9.         Zakharov, S. I., Smani, T., Dobrydneva, Y., Monje, F., Fichandler, C., Blackmore, P. F., and Bolotina, V. M. Diethylstilbestrol is a potent inhibitor of store-operated channels and capacitative Ca(2+) influx. Mol Pharmacol. 66: 702-707, 2004.

10.       Park, S. M., Jung, H. Y., Kim, H. O., Rhim, H., Paik, S. R., Chung, K. C., Park, J. H., and Kim, J. Evidence that alpha-synuclein functions as a negative regulator of Ca(++)-dependent alpha-granule release from human platelets. Blood. 100: 2506-2514, 2002.

11.       Naldini, A., Carney, D. H., Pucci, A., and Carraro, F. Human alpha-thrombin stimulates proliferation of interferon-gamma differentiated, growth-arrested U937 cells, overcoming differentiation-related changes in expression of p21CIP1/WAF1 and cyclin D1. J Cell Physiol. 191: 290-297, 2002.

12.       Xi, G., Keep, R. F., Hua, Y., and Hoff, J. T. Thrombin preconditioning, heat shock proteins and thrombin-induced brain edema. Acta Neurochir Suppl. 76: 511-515, 2000.

13.       Ballermann, B. J., and Marsden, P. A. Endothelium-derived vasoactive mediators and renal glomerular function. Clin Invest Med. 14: 508-517, 1991.

14.       Coughlin, S. R. Protease-activated receptors in hemostasis, thrombosis and vascular biology. J Thromb Haemost. 3: 1800-1814, 2005.

15.       Blaukat, A., Barac, A., Cross, M. J., Offermanns, S., and Dikic, I. G protein-coupled receptor-mediated mitogen-activated protein kinase activation through cooperation of Galpha(q) and Galpha(i) signals. Mol Cell Biol. 20: 6837-6848, 2000.

16.       Grand, R. J., Turnell, A. S., and Grabham, P. W. Cellular consequences of thrombin-receptor activation. Biochem J. 313 ( Pt 2): 353-368, 1996.

17.       Hagemann, C., and Blank, J. L. The ups and downs of MEK kinase interactions. Cell Signal. 13: 863-875, 2001.

18.       Fager, G. Thrombin and proliferation of vascular smooth muscle cells. Circ Res. 77: 645-650, 1995.

19.       Gospodarowicz, D., Brown, K. D., Birdwell, C. R., and Zetter, B. R. Control of proliferation of human vascular endothelial cells. Characterization of the response of human umbilical vein endothelial cells to fibroblast growth factor, epidermal growth factor, and thrombin. J Cell Biol. 77: 774-788, 1978.

20.       Kanthou, C., Kanse, S. M., Kakkar, V. V., and Benzakour, O. Involvement of pertussis toxin-sensitive and -insensitive G proteins in alpha-thrombin signalling on cultured human vascular smooth muscle cells. Cell Signal. 8: 59-66, 1996.

21.       Kanthou, C., Kanse, S. M., Newman, P., Kakkar, V. V., and Benzakour, O. Variability in the proliferative responsiveness of cultured human vascular smooth muscle cells to alpha-thrombin. Blood Coagul Fibrinolysis. 6: 753-760, 1995.

22.       Maragoudakis, M. E., Tsopanoglou, N. E., and Andriopoulou, P. Mechanism of thrombin-induced angiogenesis. Biochem Soc Trans. 30: 173-177, 2002.

23.       McNamara, C. A., Sarembock, I. J., Bachhuber, B. G., Stouffer, G. A., Ragosta, M., Barry, W., Gimple, L. W., Powers, E. R., and Owens, G. K. Thrombin and vascular smooth muscle cell proliferation: implications for atherosclerosis and restenosis. Semin Thromb Hemost. 22: 139-144, 1996.

24.       Tsopanoglou, N. E., and Maragoudakis, M. E. Role of thrombin in angiogenesis and tumor progression. Semin Thromb Hemost. 30: 63-69, 2004.

25.       Lau, L. F., and Lam, S. C. The CCN family of angiogenic regulators: the integrin connection. Exp Cell Res. 248: 44-57, 1999.

26.       Fimia, G. M., De Cesare, D., and Sassone-Corsi, P. Mechanisms of activation by CREB and CREM: phosphorylation, CBP, and a novel coactivator, ACT. Cold Spring Harb Symp Quant Biol. 63: 631-642, 1998.

27.       De Cesare, D., and Sassone-Corsi, P. Transcriptional regulation by cyclic AMP-responsive factors. Prog Nucleic Acid Res Mol Biol. 64: 343-369, 2000.

28.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. CREM, a master-switch of the transcriptional cascade in male germ cells. J Endocrinol Invest. 23: 592-596, 2000.

29.       De Cesare, D., Fimia, G. M., and Sassone-Corsi, P. Signaling routes to CREM and CREB: plasticity in transcriptional activation. Trends Biochem Sci. 24: 281-285, 1999.

30.       Bonovich, M., Olive, M., Reed, E., O’Connell, B., and Vinson, C. Adenoviral delivery of A-FOS, an AP-1 dominant negative, selectively inhibits drug resistance in two human cancer cell lines. Cancer Gene Ther. 9: 62-70, 2002.

31.       Mo, F. E., Muntean, A. G., Chen, C. C., Stolz, D. B., Watkins, S. C., and Lau, L. F. CYR61 (CCN1) is essential for placental development and vascular integrity. Mol Cell Biol. 22: 8709-8720, 2002.

32.       O’Brien, T. P., Yang, G. P., Sanders, L., and Lau, L. F. Expression of cyr61, a growth factor-inducible immediate-early gene. Mol Cell Biol. 10: 3569-3577, 1990.

33.       Sampath, D., Winneker, R. C., and Zhang, Z. Cyr61, a member of the CCN family, is required for MCF-7 cell proliferation: regulation by 17beta-estradiol and overexpression in human breast cancer. Endocrinology. 142: 2540-2548, 2001.

34.       Pendurthi, U. R., Allen, K. E., Ezban, M., and Rao, L. V. Factor VIIa and thrombin induce the expression of Cyr61 and connective tissue growth factor, extracellular matrix signaling proteins that could act as possible downstream mediators in factor VIIa x tissue factor-induced signal transduction. J Biol Chem. 275: 14632-14641, 2000.

35.       Chen, C. C., Chen, N., and Lau, L. F. The angiogenic factors Cyr61 and connective tissue growth factor induce adhesive signaling in primary human skin fibroblasts. J Biol Chem. 276: 10443-10452, 2001.

36.       Liu, B., Yu, J., Taylor, L., Zhou, X., and Polgar, P. Microarray and phosphokinase screenings leading to studies on ERK and JNK regulation of connective tissue growth factor expression by angiotensin II 1a and bradykinin B2 receptors in Rat1 fibroblasts. J Cell Biochem. 97: 1104-1120, 2006.

37.       Bode, W., Turk, D., and Karshikov, A. The refined 1.9-A X-ray crystal structure of D-Phe-Pro-Arg chloromethylketone-inhibited human alpha-thrombin: structure analysis, overall structure, electrostatic properties, detailed active-site geometry, and structure-function relationships. Protein Sci. 1: 426-471, 1992.

38.       Bode, W., Turk, D., and Sturzebecher, J. Geometry of binding of the benzamidine- and arginine-based inhibitors N alpha-(2-naphthyl-sulphonyl-glycyl)-DL-p-amidinophenylalanyl-pipe ridine (NAPAP) and (2R,4R)-4-methyl-1-[N alpha-(3-methyl-1,2,3,4-tetrahydro-8- quinolinesulphonyl)-L-arginyl]-2-piperidine carboxylic acid (MQPA) to human alpha-thrombin. X-ray crystallographic determination of the NAPAP-trypsin complex and modeling of NAPAP-thrombin and MQPA-thrombin. Eur J Biochem. 193: 175-182, 1990.

39.       Lawson, J. H., Lynn, K. A., Vanmatre, R. M., Domzalski, T., Klemp, K. F., Ortel, T. L., Niklason, L. E., and Parker, W. Antihuman factor V antibodies after use of relatively pure bovine thrombin. Ann Thorac Surg. 79: 1037-1038, 2005.

40.       Lawson, J. H., and Murphy, M. P. Challenges for providing effective hemostasis in surgery and trauma. Semin Hematol. 41: 55-64, 2004.

41.       Schoenecker, J. G., Johnson, R. K., Lesher, A. P., Day, J. D., Love, S. D., Hoffman, M. R., Ortel, T. L., Parker, W., and Lawson, J. H. Exposure of mice to topical bovine thrombin induces systemic autoimmunity. Am J Pathol. 159: 1957-1969, 2001.

42.       Su, Z., Izumi, T., Thames, E. H., Lawson, J. H., and Ortel, T. L. Antiphospholipid antibodies after surgical exposure to topical bovine thrombin. J Lab Clin Med. 139: 349-356, 2002.

43.       Lawson, J. H., Pennell, B. J., Olson, J. D., and Mann, K. G. Isolation and characterization of an acquired antithrombin antibody. Blood. 76: 2249-2257, 1990.

44.       Lundblad, R. L., Bradshaw, R. A., Gabriel, D., Ortel, T. L., Lawson, J., and Mann, K. G. A review of the therapeutic uses of thrombin. Thromb Haemost. 91: 851-860, 2004.

45.       Fields, R. C., Schoenecker, J. G., Hart, J. P., Hoffman, M. R., Pizzo, S. V., and Lawson, J. H. Protease-activated receptor-2 signaling triggers dendritic cell development. Am J Pathol. 162: 1817-1822, 2003.

46.       Lavoie, L., Roy, D., Ramlal, T., Dombrowski, L., Martin-Vasallo, P., Marette, A., Carpentier, J. L., and Klip, A. Insulin-induced translocation of Na+-K+-ATPase subunits to the plasma membrane is muscle fiber type specific. Am J Physiol. 270: C1421-1429, 1996.

47.       O’Shea S, I., Lawson, J. H., Reddan, D., Murphy, M., and Ortel, T. L. Hypercoagulable states and antithrombotic strategies in recurrent vascular access site thrombosis. J Vasc Surg. 38: 541-548, 2003.

Figure Legends:

Figure 1: PAR signaling in HUVEC AND AoSMC by western blotting. Figure 1

Figure 2: The Effects of TBIIa on G Protein signaling of AoSMCs. (a) Gi (B) Gq/11 Figure 2

Figure 3:  The Effects of TBIIa on G Protein signaling of HUVECs (a) Gi (B) Gq/11  Figure 3

Figure 4:  The effects of TBIIa on AoSMC and HUVEC ERK activation. Figure 4

Figure 5:  AoSMC proliferation after BrDu treatment. Figure 5

Figure 6:  Affects of TRAPs, thrombin responsive activation peptides, for the transcription factors on HUVEC Figure 6

Figure 7:  The ectopical thrombin effects the transcription factors differently on HUVECs and AoSMCs.  Figure 7

Figure 8:  Gene interactions differ after ectopic IIa. (A) in the AoSMC,  (B) In the HUVEC. Figure 8

 

Read Full Post »

« Newer Posts - Older Posts »