Feeds:
Posts
Comments

Archive for the ‘COVID-19’ Category

2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

Reporter: Aviva Lev-Ari, PhD, RN

Collaborative innovation has never been more important

Join top leaders guiding the response, technology and people confronting this century’s greatest health challenge.

Priya Abani

CEO, AliveCor

General Keith Alexander

Co-CEO, IronNet; Former NSA Head

Stéphane Bancel

CEO, Moderna

Marc Casper

CEO, Thermo Fisher

Timothy Ferris, MD

CEO, MGPO; Professor, HMS

John Fernandez  

President, MEE; President, Ambulatory Care, Mass General Brigham

 

John Fish

CEO, Suffolk; BH Board Chair

JF Formela, MD

Partner, Atlas Venture

Jan Garfinkle

Manager Partner, Arboretum Ventures; Chair, NVCA

Phillip Gross

Managing Director, Adage Capital Management

Julia Hu

CEO, Lark Health

Anjali Kataria

CEO, Mytonomy

Roger Kitterman

VP, Managing Partner, Mass General Brigahm Fund

Jonathan Kraft

President, Kraft Group; Chair, MGH Board

Brooke LeVasseur

CEO, AristaMD

Mike Mahoney

CEO, Boston Scientific

Bernd Montag, PhD

CEO, Siemens Healthineers

Kieran Murphy

CEO, GE Healthcare

Elizabeth Nabel, MD

President, BH; Professor, HMS

Matt Sause

CEO, Roche Diagnostics

Peter Slavin, MD

President, MGH; Professor, HMS

Scott Sperling

Co-President, TH Lee; Chair, Mass General Brigham Board

Christopher Viehbacher

Managing Partner, Gurnet Point Capital

Michel Vounatsos

CEO, Biogen

Collaborative Innovation

Together we meet the challenge of the coronavirus and share our commitment to the future of medicine.

 

Anne Klibanski, MD

CEO, Mass General Brigham

Amy Abernethy, MD, PhD

Principal Deputy Commissioner and Acting CIO, FDA

PANEL

FDA Role in Managing Crisis and Anticipating the Next

Elizabeth Nabel, MD

President, Brigham Health; Professor of Medicine, HMS

PANEL

Care in the Next 18 Months 

Karen DeSalvo, MD

Chief Health Officer, Google Health

PANEL

Role of AI and Big Data in Fighting COVID-19 

Dawn Sugarman, PhD

Assistant Psychologist, Division of Alcohol, Drugs, and Addiction, McLean; Assistant Professor, Psychiatry, HMS

PANEL

Digital Therapeutics

Ann Prestipino

SVP; Incident Commander, MGH; Teaching Associate, HMS

PANEL

Real Time: Front Line Innovation

Hadine Joffe, MD

Vice Chair, Research, Psychiatry; Executive Director, Mary Horrigan Connors Center for Women’s Health and Gender Biology, BH; Paula Johnson Professor, Women’s Health, HMS

PANEL

Digital Therapeutics

Priya Abani

CEO, AliveCor

PANEL

Digital Therapeutics

Julia Hu

CEO, Lark Health

PANEL

Digital Therapeutics

Jan Garfinkle

Manager Partner, Arboretum Ventures; Chair NVCA

PANEL

Early Stage Investment Environment

Anjali Kataria

CEO, Mytonomy

PANEL

Patient Experience During the Pandemic

Brooke LeVasseur

CEO, AristaMD

PANEL

Digital Health Becomes a Pillar

Julie Lankiewicz

Head, Clinical Affairs & Health Economics Outcomes Research, Bose Health

PANEL

Emergency and Urgent Care

 

VIEW VIDEOS from the event

https://www.youtube.com/channel/UCauKpbsS_hUqQaPp8EVGYOg

 

From: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Date: Tuesday, May 12, 2020 at 6:48 AM

To: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Subject: REGISTRANT RECAP | World Medical Innovation Forum  

 

Dear World Forum Attendee, 

On behalf of Mass General Brigham CEO Anne Klibanski MD and Forum co-Chairs Gregg Meyer MD and Ravi Thadhani MD, many thanks for being among the nearly 11,000 registrants representing 93 countries, 46 states and 3200 organizations yesterday. A community was established around many pressing topics that  will continue long into the future. We hope you have a chance to examine the attached survey results. There are several revealing items that should be the basis for ongoing discussion. We expect to be in touch regularly during the year. Among the plans is a “First Look” video series highlighting top Mass General Brigham Harvard faculty as well as emerging Harvard investigators.  As promised, we  wanted to also share visual Forum session summaries.  You will be able to access the recordings on the Forum’s YouTube page . The first set will go up this morning

We hope you will join us for the 2021 Forum!  

Thanks again, Chris

e-Proceedings 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/04/22/world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-monday-may-11-815-a-m-515-p-m-et/

Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/05/11/tweets-retweets-2020-world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-mond/

Read Full Post »

2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

Reporter: Aviva Lev-Ari, PhD, RN

 

Thermo Fisher provides the technologies required to return to work as well as to combat a COVID-19 resurgence. CEO Marc Casper shares perspectives with MGB EVP Peter Markell.

Marc Casper

CEO, Thermo Fisher

Moderator

Peter Markell

EVP and CFO,

Mass General Brigham

 

VIEW VIDEOS from the event

https://www.youtube.com/channel/UCauKpbsS_hUqQaPp8EVGYOg

 

From: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Date: Tuesday, May 12, 2020 at 6:48 AM

To: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Subject: REGISTRANT RECAP | World Medical Innovation Forum  

 

Dear World Forum Attendee, 

On behalf of Mass General Brigham CEO Anne Klibanski MD and Forum co-Chairs Gregg Meyer MD and Ravi Thadhani MD, many thanks for being among the nearly 11,000 registrants representing 93 countries, 46 states and 3200 organizations yesterday. A community was established around many pressing topics that  will continue long into the future. We hope you have a chance to examine the attached survey results. There are several revealing items that should be the basis for ongoing discussion. We expect to be in touch regularly during the year. Among the plans is a “First Look” video series highlighting top Mass General Brigham Harvard faculty as well as emerging Harvard investigators.  As promised, we  wanted to also share visual Forum session summaries.  You will be able to access the recordings on the Forum’s YouTube page . The first set will go up this morning

We hope you will join us for the 2021 Forum!  

Thanks again, Chris

e-Proceedings 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/04/22/world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-monday-may-11-815-a-m-515-p-m-et/

Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/05/11/tweets-retweets-2020-world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-mond/

Read Full Post »

2020 World Medical Innovation Forum – COVID-19, AI  – Life Science and Digital Health Investments, MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

Reporter: Aviva Lev-Ari, PhD, RN

 

 

 

Life science and digital health investments have continued at a strong pace during the COVID-19 crisis. Senior investment leaders discuss what to expect. Will:

  • social distancing affect deal making?
  • key asset categories remain strong – venture, private equity, public offerings, acquisitions?
  • valuations hold up in some categories while others fall?

Moderator: Roger Kitterman, VP, Venture and Managing Partner, Partners Innovation Fund, Mass General Brigham


Jan Garfinkle
, Founder & Manager Partner, Arboretum Ventures, Chair NVCA

Phillip Gross, Managing Director, Adage Capital Management

Christopher Viehbacher, Managing Partner, Gurnet Point Capital

 

VIEW VIDEOS from the event

https://www.youtube.com/channel/UCauKpbsS_hUqQaPp8EVGYOg

From: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Date: Tuesday, May 12, 2020 at 6:48 AM

To: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Subject: REGISTRANT RECAP | World Medical Innovation Forum  

 

Dear World Forum Attendee, 

On behalf of Mass General Brigham CEO Anne Klibanski MD and Forum co-Chairs Gregg Meyer MD and Ravi Thadhani MD, many thanks for being among the nearly 11,000 registrants representing 93 countries, 46 states and 3200 organizations yesterday. A community was established around many pressing topics that  will continue long into the future. We hope you have a chance to examine the attached survey results. There are several revealing items that should be the basis for ongoing discussion. We expect to be in touch regularly during the year. Among the plans is a “First Look” video series highlighting top Mass General Brigham Harvard faculty as well as emerging Harvard investigators.  As promised, we  wanted to also share visual Forum session summaries.  You will be able to access the recordings on the Forum’s YouTube page . The first set will go up this morning

We hope you will join us for the 2021 Forum!  

Thanks again, Chris

e-Proceedings 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/04/22/world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-monday-may-11-815-a-m-515-p-m-et/

Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/05/11/tweets-retweets-2020-world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-mond/

Read Full Post »

2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

Reporter: Aviva Lev-Ari, PhD, RN

Front line caregivers have combined passion and innovation throughout the crisis, saving lives and bringing lasting change across the care continuum.

Nurses and other caregivers will share how patients were helped and future care was defined – acute, post-acute, rehab and home care – through real time innovations.

 

 

 

 

 

 

 

 

Moderator

Ann Prestipino

SVP and Incident Commander, MGH

PANELISTS

Theresa Gallivan, RN

Associate Chief Nurse, MGH

Karen Reilly, DNP, RN

Associate Chief Nursing Officer, Critical Care, Cardiovascular and Surgical Services, BH

Ross Zafonte, DO

SVP, Research Education and Medical Affairs, SRN; Earle P. and Ida S. Charlton Professor of Physical Medicine and Rehabilitation, HMS

VIEW VIDEOS from the event

https://www.youtube.com/channel/UCauKpbsS_hUqQaPp8EVGYOg

From: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Date: Tuesday, May 12, 2020 at 6:48 AM

To: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Subject: REGISTRANT RECAP | World Medical Innovation Forum  

 

Dear World Forum Attendee, 

On behalf of Mass General Brigham CEO Anne Klibanski MD and Forum co-Chairs Gregg Meyer MD and Ravi Thadhani MD, many thanks for being among the nearly 11,000 registrants representing 93 countries, 46 states and 3200 organizations yesterday. A community was established around many pressing topics that  will continue long into the future. We hope you have a chance to examine the attached survey results. There are several revealing items that should be the basis for ongoing discussion. We expect to be in touch regularly during the year. Among the plans is a “First Look” video series highlighting top Mass General Brigham Harvard faculty as well as emerging Harvard investigators.  As promised, we  wanted to also share visual Forum session summaries.  You will be able to access the recordings on the Forum’s YouTube page . The first set will go up this morning

We hope you will join us for the 2021 Forum!  

Thanks again, Chris

e-Proceedings 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/04/22/world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-monday-may-11-815-a-m-515-p-m-et/

Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/05/11/tweets-retweets-2020-world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-mond/

Read Full Post »

The ”Disruptive Dozen” – Harnessing Technology to Reduce Health Disparities: Twelve mostly likely to have significant impact on healthcare by end of 2021.

Reporter: Aviva Lev-Ari, PhD, RN

 

2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

 

https://worldmedicalinnovation.org/2020-disruptive-dozen/

VIEW VIDEOS from the event

https://www.youtube.com/channel/UCauKpbsS_hUqQaPp8EVGYOg

From: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Date: Tuesday, May 12, 2020 at 6:48 AM

To: “Coburn, Christopher Mark” <CMCOBURN@PARTNERS.ORG>

Subject: REGISTRANT RECAP | World Medical Innovation Forum  

 

Dear World Forum Attendee, 

On behalf of Mass General Brigham CEO Anne Klibanski MD and Forum co-Chairs Gregg Meyer MD and Ravi Thadhani MD, many thanks for being among the nearly 11,000 registrants representing 93 countries, 46 states and 3200 organizations yesterday. A community was established around many pressing topics that  will continue long into the future. We hope you have a chance to examine the attached survey results. There are several revealing items that should be the basis for ongoing discussion. We expect to be in touch regularly during the year. Among the plans is a “First Look” video series highlighting top Mass General Brigham Harvard faculty as well as emerging Harvard investigators.  As promised, we  wanted to also share visual Forum session summaries.  You will be able to access the recordings on the Forum’s YouTube page . The first set will go up this morning

We hope you will join us for the 2021 Forum!  

Thanks again, Chris

e-Proceedings 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/04/22/world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-monday-may-11-815-a-m-515-p-m-et/

Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/05/11/tweets-retweets-2020-world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-mond/

https://worldmedicalinnovation.org/2020-disruptive-dozen/

The ”Disruptive Dozen” results from interviews of one hundred Mass General Brigham senior Harvard faculty followed by a rigorous selection process to identify the twelve mostly likely to have significant impact on healthcare by end of 2021.

Rochelle Walensky, MD

Chief, Infectious Disease, MGH; Professor of Medicine, Harvard Medical School

1.

Battling COVID-19: Maps, Technology, and AI

Mapping the spread of infectious diseases within communities is more important than ever as the novel coronavirus continues to sweep across the globe. Researchers are harnessing AI, technology, and advanced data analytics to map the spread of COVID-19 and identify those infected with the virus.

Watch the #1 disruptive technology in a series of 12.

Thomas Sequist, MD

Chief Patient Experience and Equity Officer, PHS; Professor of Medicine and Health Care Policy, Harvard Medical School

2.

Harnessing Technology to Reduce Health Disparities

Health is determined not just by genes, diet, and exercise, but also by the environments where people live, learn, work, and play. New technologies are emerging to help reduce health disparities and improve health outcomes.

Watch the #2 disruptive technology in a series of 12.

Orhun Muratoglu, PhD

Alan Gary Scholar, Director Harris Orthopaedics Lab, MGH; Professor, Harvard Medical School

4.

Solving the Problem of Infection in Total Joint Replacements

Total joint replacement is an increasingly common procedure. For most patients, recovery is uneventful and lasts a few months, but some experience a much more complicated and painful journey due to infection in the artificial joint. Find out how researchers are harnessing technology to help address this problem.

 

Watch the #4 disruptive technology in a series of 12.

Calum MacRae, MD, PhD

Vice Chair for Scientific Innovation, Department of Medicine, BH; Associate Professor of Medicine, Harvard Medical School

3.

Digital Management of Chronic Disease

Chronic diseases are a major challenge for patients and health care systems alike. In 2016, the U.S. spent over a trillion dollars caring for patients with heart disease, diabetes, cancer and other chronic conditions. Find out how technology could help improve care for these patients — and lower costs.

 

Watch the #3 disruptive technology in a series of 12.

David Scadden, MD

Director, Center for Regenerative Medicine, MGH; Co-Director, Harvard Stem Cell Institute; Gerald and Darlene Jordan Professor of Medicine, Harvard Medical School

7.

New Therapeutic Options for Sickle Cell Disease

Millions of people worldwide suffer from sickle cell disease. While the cause of this debilitating blood disorder has been known for half a century, only two drugs are currently available to treat it. New developments are on the horizon that could help transform the management of a disease that has too often been overlooked.

Watch the #7 disruptive technology in a series of 12.

Patricia Musolino, MD, PhD

Co-Director Pediatric Cerebrovascular Service, MGH; Assistant Professor, Harvard Medical School

6.

Gene Therapies Transform Treatment of Rare, Devastating Diseases

The emergence of the first gene therapies for clinical use signaled a watershed moment in the history of medicine. This treatment modality will do ever more in the coming year for patients, especially those with rare genetic conditions.

Watch the #6 disruptive technology in a series of 12.

Joan Miller, MD

Chief of Ophthalmology, MEE and MGH; Ophthalmologist-in-Chief, BH; David Glendenning Cogan Professor of Ophthalmology and Chair, Department of Ophthalmology, Harvard Medical School

5.

New Tools to Help Aging Eyes and Ears

Like many parts of the body, the eyes and ears can deteriorate with age, making them vulnerable to disease and loss of sensory functions. Find out how new technologies and treatments could help patients and clinicians better protect these organs from age-related decline.

Watch the #5 disruptive technology in a series of 12.

Astrid Weins, MD, PhD

Associate Pathologist, Brigham Health; Assistant Professor, Pathology, Harvard Medical School

10.

Making Cells Larger to See Them More Clearly

Visualizing cells at high-resolution is a cornerstone of modern biology and medicine. For more than a century, as scientists yearned to observe biological structures with greater power and clarity, they built more advanced microscopes. Yet today, even those sophisticated tools have limits. See how researchers are developing a innovative new approach to cell visualization.

Watch the third disruptive technology in a series of 12.

Dennis Selkoe, MD

Co-Director of the Ann Romney Center for Neurologic Diseases, Brigham Health; Vincent and Stella Coates Professor of Neurologic Diseases, Harvard Medical School

9.

First Disease-Modifying Therapy for Alzheimer’s Disease

The world lacks a meaningful treatment for Alzheimer’s disease, a progressive, debilitating neurodegenerative condition that affects millions across the globe. But that could change later this year, when the FDA is expected to weigh in on a novel drug that targets clumps of protein in the brain known as amyloid plaques. If approved, the drug would mark the first disease-modifying therapy for Alzheimer’s disease.

Watch the fourth disruptive technology in a series of 12.

Leonardo Riella, MD, PhD

Medical Director, Vascularized Composite Tissue Transplantation, Brigham Health; Associate Physician, Harvard Medical School

8.

Keeping Transplant Organs Fresher for Longer

Over 120,000 people in this country are now waiting for an organ transplant. What if it were possible to increase the time that organs can be safely stored outside the body prior to transplantation? Scientists are working to drive innovation in this area in an effort to expand the pool of donor organs available for those who need them.

Watch the fifth disruptive technology in a series of 12.

Read Full Post »

Promises on Covid-19 Vaccines

Reporter: Irina Robu, PhD

Vaccines play a vital role in keeping us healthy. Currently, scientists are racing through development at speeds never before seen. Even if the stages of vaccine development could be compressed and supplies could be quickly manufactured, it could take months or longer before people can have access to it.

The World Health Organization closely monitors Covid-19 vaccines which are designed in academic laboratories without having the commercial production capacity. Whereas China has widespread vaccine production capacity and other developing countries including India, Indonesia, and Brazil are amongst the world’s largest vaccine producers and exporters, a sizable amount of the manufacturing capacity belonging to pharmaceutical companies that sell vaccine in North America and Europe is based in the United States.

Assuming a vaccine can be developed rapidly, the production of some vaccine candidates could be easily ramped up than others it is conceivable that they could use the existing plants to produce more vaccines. Production of this type of candidate could reach hundreds of millions of doses within about a year, yet any vaccines would require longer time to reach those output levels.

An RNA vaccine project is being developed by Pfizer and BioNTech, began testing four possible vaccines in a compressed Phase ½ trial in the US on May 5, 2020. In addition, Moderna signed a deal with pharmaceutical company Lonzo to produce 1 billion doses of the vaccine in the U.S. and in Switzerland. Nevertheless, of who gets vaccines, it is believed that most new vaccines will require at least two doses to be effective, so any estimates of numbers of doses available in the autumn will need to be divided by two to find out how many people could expect to be vaccinated. The public, both in US and abroad need clear communications about realistic times to COVID-19 vaccine access. Yet when vaccines do start to become available, demand will be enormous and supply will be minimal.

SOURCE

Mounting promises on Covid-19 vaccines are fueling false expectations, experts say

https://www.the-scientist.com/news-opinion/covid-19-vaccine-frontrunners-67382

https://www.biospace.com/article/moderna-vaccine-clinical-trial-moves-into-2nd-round-of-dosing/

Read Full Post »

Tweets & Retweets 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

Curator: Aviva Lev-Ari, PhD, RN

From: “Partners Innovation (via Twitter)” <notify@twitter.com>

Date: Tuesday, May 12, 2020 at 2:24 PM

To: Aviva Lev-Ari <AvivaLev-Ari@alum.berkeley.edu>

Subject: Partners Innovation (@PHSInnovation) has sent you a Direct Message on Twitter!

 

Thanks for tweeting about the live event Aviva! We appreciate the support!

 

e-Proceedings 2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

https://pharmaceuticalintelligence.com/2020/04/22/world-medical-innovation-forum-covid-19-ai-and-the-future-of-medicine-featuring-harvard-and-industry-leader-insights-mgh-bwh-virtual-event-monday-may-11-815-a-m-515-p-m-et/

VIEW ALL VIDEOS

https://www.youtube.com/channel/UCauKpbsS_hUqQaPp8EVGYOg

 

Aviva Lev-Ari
@AVIVA1950

#WMIF2020

Michel Vounatsos, CEO, Biogen Venture community supportive to be on the safe side  employees tested every evenings to prevent rebound of the pandemic Pandemic is acceleration progress technologies new drugs Biogen will lead new model

Notifications

#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Digital Therapeutics Hadine Joffe, MD @BH; Paula A. Johnson Professor, Women’s Health, HMS Priya Abani, CEO, AliveCor Julia Hu, CEO, Lark Health Dawn Sugarman, PhD @McLeanHospital

liked your Tweet

#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Joerg Moeller, MD, PhD, Head of Research @BayerPharmaAG led team of 9 products Unprecedented is COVID-19: effect on work, travel, lifevAnti-Malaria vs COVID-19: In China testing early chloroquine approved for RA and anti Malaria

Retweeted 78 of your Tweets

#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Michael Mina, MD, PhD @BH Antigen test for home administration consumerization of the Testing  Walmart can be positioned for blood tests Not only Physicians can order tests @Microsoft @Amazon can interpretation of Test using Alexa

Show all

liked 85 of your Tweets

#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Michael Mina, MD, PhD @BH Antigen test for home administration consumerization of the Testing  Walmart can be positioned for blood tests Not only Physicians can order tests @Microsoft @Amazon can interpretation of Test using Alexa

Show all

Stephen J Williams
@StephenJWillia2

Quote Tweet
Aviva Lev-Ari
@AVIVA1950
·
#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Ross Zafonte, DO, SVP, Research Education and Medical Affairs, SRN; Earle P. and Ida S. Charlton Professor of Physical Medicine and Rehabilitation, HMS @MGH is family, the unattainable is attainable

Stephen J Williams
@StephenJWillia2

#WMIF2020 #Telemedicine so important for #COVID19 pandemic. Platforms developed years ago. Who would have known?

Quote Tweet
Aviva Lev-Ari
@AVIVA1950
·
#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Jan Garfinkle, Founder & Manager Partner, Arboretum Ventures Can you close a deal with out meeting management team Known funds will prevail vs new funds Parma adjacencies vs medical devices Telehealth is of interest GI Cardiovascular

Stephen J Williams
@StephenJWillia2

Quote Tweet
Aviva Lev-Ari
@AVIVA1950
·
#WMIF2020 @PHSInnovation @pharma_BI @AVIVA1950 Ravi Thadhani, MD, CAO, Mass General Brigham; Professor of Medicine and Faculty Dean for Academic Programs, HMS Great Broadcasting services, expertise on the top Management of the Event 100% no room to improve Recovery COVID Patients

Stephen J Williams
@StephenJWillia2

2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – #MGH & #BWH Virtual Event: Monday, May 11, 8:15 a.m. – 5:15 p.m. ET #WMIF

#bostonbio pharmaceuticalintelligence.com/2020/04/22/wor via

2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard…
2020 World Medical Innovation Forum – COVID-19, AI and the Future of Medicine, Featuring Harvard and Industry Leader Insights – MGH & BWH, Virtual Event: Monday, May 11, 8:15 a.m. –…
pharmaceuticalintelligence.com
1
1
News for you
Fears of homophobic backlash sparked as Korean media focus on gay club COVID-19 case

Retweeted your Tweet

#WMIF20 @pharma_BI @AVIVA1950 covering event in #realtime +9,500 Global Attendees for lnkd.in/ePwTDxm about worldmedicalinnovation.org/2020-disruptiv 2020 #Virtual #World #Medical #Innovation #Forum#COVID-19 #AI #Future #Medicine @MGH & @BWH, Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

liked your Tweet

#WMIF20 @pharma_BI @AVIVA1950 covering event in #realtime +9,500 Global Attendees for lnkd.in/ePwTDxm about worldmedicalinnovation.org/2020-disruptiv 2020 #Virtual #World #Medical #Innovation #Forum#COVID-19 #AI #Future #Medicine @MGH & @BWH, Monday, May 11, 8:15 a.m. – 5:15 p.m. ET

All Tweets by @AVIVA1950 on May 11, 2020

Read Full Post »

Reporter: Stephen J. Williams, PhD

via Special COVID-19 Christopher Magazine

 

Special COVID-19 Christopher Magazine

Article ID #277: Special COVID-19 Christopher Magazine. Published on 5/10/2020

WordCloud Image Produced by Adam Tubman

Christopher-cover

Antonio Giordano, MD, PhD. explains what COVID is and how to contain the infection, pointing also to what will require attention next.

Please see this special release at http://online.fliphtml5.com/qlnw/zgau/#p=1

 

Read Full Post »

Dr. Giordano Featured in Forbes Article on COVID-19 Antibody Tests in Italy and USA

Reporter: Stephen J. Williams, PhD

Article ID #276: Dr. Giordano Featured in Forbes Article on COVID-19 Antibody Tests in Italy and USA. Published on 5/10/2020

WordCloud Image Produced by Adam Tubman

via Dr. Giordano Featured in Forbes Article on COVID-19 Antibody Tests in Italy and USA

Read Full Post »

The Genome Structure of CORONAVIRUS, SARS-CoV-2

“I awaited for this article for 60 days”

Aviva Lev-Ari, PhD, RN

Reporter: Aviva Lev-Ari, PhD, RN

 

UPDATED on 8/9/2020

 

The Genome Structure of CORONAVIRUS, SARS-CoV-2

Note:

  • The four letters of DNA are A, C, G and T.
  • In RNA molecules like the coronavirus genome, the T (thymine) is replaced with U (uracil).

Sources:

  • Fan Wu et al., Nature;
  • National Center for Biotechnology Information;
  • Dr. David Gordon, University of California, San Francisco;
  • Dr. Matthew B.   and Dr. Stuart Weston, University of Maryland School of Medicine;
  • Dr. Pleuni Pennings, San Francisco State University;
  • David Haussler and Jason Fernandes, U.C. Santa Cruz Genomics Institute; Journal of Virology;
  • Annual Review of Virology.

Model sources:

  • Coronavirus by Maria Voigt, RCSB Protein Data Bank headquartered at Rutgers University–New Brunswick;
  • Ribosome from Heena Khatter et al., Nature;
  • Proteins from Yang Zhang’s Research Group, University of Michigan.

Bad News Wrapped in Protein: Inside the Coronavirus Genome

A virus is “simply a piece of bad news wrapped up in protein,” the biologists Jean and Peter Medawar wrote in 1977.

In January, scientists deciphered a piece of very bad news: the genome of SARS-CoV-2, the virus that causes Covid-19. The sample came from a 41-year-old man who worked at the seafood market in Wuhan where the first cluster of cases appeared.

Researchers are now racing to make sense of this viral recipe, which could inspire drugs, vaccines and other tools to fight the ongoing pandemic.

A String of RNA

Viruses must hijack living cells to replicate and spread. When the coronavirus finds a suitable cell, it injects a strand of RNA that contains the entire coronavirus genome.

The genome of the new coronavirus is less than 30,000 “letters” long. (The human genome is over 3 billion.) Scientists have identified genes for as many as 29 proteins, which carry out a range of jobs from making copies of the coronavirus to suppressing the body’s immune responses.

The first sequence of RNA letters reads:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag

This sequence recruits machinery inside the infected cell to read the RNA letters — acg and u — and translate them into coronavirus proteins.

The full coronavirus genome and the proteins it encodes are shown below.

A Chain of Proteins · ORF1ab

The first viral protein created inside the infected cell is actually a chain of 16 proteins joined together. Two of these proteins act like scissors, snipping the links between the different proteins and freeing them to do their jobs.

See graph at https://www.nytimes.com/interactive/2020/04/03/science/coronavirus-genome-bad-news-wrapped-in-protein.html

Research on other coronaviruses has given scientists a good understanding of what some of the SARS-CoV-2 proteins do. But other proteins are far more mysterious, and some might do nothing at all.

Cellular Saboteur · NSP1

This protein slows down the infected cell’s production of its own proteins. This sabotage forces the cell to make more virus proteins and prevents it from assembling antiviral proteins that could stop the virus.

auggagagccuugucccugguuucaacgagaaaacacacguccaacucaguuugccuguuuuacagguucgcgacgugcucguacguggcuuuggagacuccguggaggaggucuuaucagaggcacgucaacaucuuaaagauggcacuuguggcuuaguagaaguugaaaaaggcguuuugccucaacuugaacagcccuauguguucaucaaacguucggaugcucgaacugcaccucauggucauguuaugguugagcugguagcagaacucgaaggcauucaguacggucguaguggugagacacuugguguccuugucccucaugugggcgaaauaccaguggcuuaccgcaagguucuucuucguaagaacgguaauaaaggagcugguggccauaguuacggcgccgaucuaaagucauuugacuuaggcgacgagcuuggcacugauccuuaugaagauuuucaagaaaacuggaacacuaaacauagcagugguguuacccgugaacucaugcgugagcuuaacggaggg

Mystery Protein · NSP2

Scientists aren’t sure what NSP2 does. The other proteins it attaches to may offer some clues. Two of them help move molecule-filled bubbles called endosomes around the cell.

gcauacacucgcuaugucgauaacaacuucuguggcccugauggcuacccucuugagugcauuaaagaccuucuagcacgugcugguaaagcuucaugcacuuuguccgaacaacuggacuuuauugacacuaagagggguguauacugcugccgugaacaugagcaugaaauugcuugguacacggaacguucugaaaagagcuaugaauugcagacaccuuuugaaauuaaauuggcaaagaaauuugacaccuucaauggggaauguccaaauuuuguauuucccuuaaauuccauaaucaagacuauucaaccaaggguugaaaagaaaaagcuugauggcuuuauggguagaauucgaucugucuauccaguugcgucaccaaaugaaugcaaccaaaugugccuuucaacucucaugaagugugaucauuguggugaaacuucauggcagacgggcgauuuuguuaaagccacuugcgaauuuuguggcacugagaauuugacuaaagaaggugccacuacuugugguuacuuaccccaaaaugcuguuguuaaaauuuauuguccagcaugucacaauucagaaguaggaccugagcauagucuugccgaauaccauaaugaaucuggcuugaaaaccauucuucguaaggguggucgcacuauugccuuuggaggcuguguguucucuuauguugguugccauaacaagugugccuauuggguuccacgugcuagcgcuaacauagguuguaaccauacagguguuguuggagaagguuccgaaggucuuaaugacaaccuucuugaaauacuccaaaaagagaaagucaacaucaauauuguuggugacuuuaaacuuaaugaagagaucgccauuauuuuggcaucuuuuucugcuuccacaagugcuuuuguggaaacugugaaagguuuggauuauaaagcauucaaacaaauuguugaauccugugguaauuuuaaaguuacaaaaggaaaagcuaaaaaaggugccuggaauauuggugaacagaaaucaauacugaguccucuuuaugcauuugcaucagaggcugcucguguuguacgaucaauuuucucccgcacucuugaaacugcucaaaauucugugcguguuuuacagaaggccgcuauaacaauacuagauggaauuucacaguauucacugagacucauugaugcuaugauguucacaucugauuuggcuacuaacaaucuaguuguaauggccuacauuacaggugguguuguucaguugacuucgcaguggcuaacuaacaucuuuggcacuguuuaugaaaaacucaaacccguccuugauuggcuugaagagaaguuuaaggaagguguagaguuucuuagagacgguugggaaauuguuaaauuuaucucaaccugugcuugugaaauugucgguggacaaauugucaccugugcaaaggaaauuaaggagaguguucagacauucuuuaagcuuguaaauaaauuuuuggcuuugugugcugacucuaucauuauugguggagcuaaacuuaaagccuugaauuuaggugaaacauuugucacgcacucaaagggauuguacagaaaguguguuaaauccagagaagaaacuggccuacucaugccucuaaaagccccaaaagaaauuaucuucuuagagggagaaacacuucccacagaaguguuaacagaggaaguugucuugaaaacuggugauuuacaaccauuagaacaaccuacuagugaagcuguugaagcuccauugguugguacaccaguuuguauuaacgggcuuauguugcucgaaaucaaagacacagaaaaguacugugcccuugcaccuaauaugaugguaacaaacaauaccuucacacucaaaggcggu

Untagging and Cutting · NSP3

NSP3 is a large protein that has two important jobs. One is cutting loose other viral proteins so they can do their own tasks. It also alters many of the infected cell’s proteins.

Normally, a healthy cell tags old proteins for destruction. But the coronavirus can remove those tags, changing the balance of proteins and possibly reducing the cell’s ability to fight the virus.

gcaccaacaaagguuacuuuuggugaugacacugugauagaagugcaagguuacaagagugugaauaucacuuuugaacuugaugaaaggauugauaaaguacuuaaugagaagugcucugccuauacaguugaacucgguacagaaguaaaugaguucgccuguguuguggcagaugcugucauaaaaacuuugcaaccaguaucugaauuacuuacaccacugggcauugauuuagaugaguggaguauggcuacauacuacuuauuugaugagucuggugaguuuaaauuggcuucacauauguauuguucuuucuacccuccagaugaggaugaagaagaaggugauugugaagaagaagaguuugagccaucaacucaauaugaguaugguacugaagaugauuaccaagguaaaccuuuggaauuuggugccacuucugcugcucuucaaccugaagaagagcaagaagaagauugguuagaugaugauagucaacaaacuguuggucaacaagacggcagugaggacaaucagacaacuacuauucaaacaauuguugagguucaaccucaauuagagauggaacuuacaccaguuguucagacuauugaagugaauaguuuuagugguuauuuaaaacuuacugacaauguauacauuaaaaaugcagacauuguggaagaagcuaaaaagguaaaaccaacagugguuguuaaugcagccaauguuuaccuuaaacauggaggagguguugcaggagccuuaaauaaggcuacuaacaaugccaugcaaguugaaucugaugauuacauagcuacuaauggaccacuuaaagugggugguaguuguguuuuaagcggacacaaucuugcuaaacacugucuucauguugucggcccaaauguuaacaaaggugaagacauucaacuucuuaagagugcuuaugaaaauuuuaaucagcacgaaguucuacuugcaccauuauuaucagcugguauuuuuggugcugacccuauacauucuuuaagaguuuguguagauacuguucgcacaaaugucuacuuagcugucuuugauaaaaaucucuaugacaaacuuguuucaagcuuuuuggaaaugaagagugaaaagcaaguugaacaaaagaucgcugagauuccuaaagaggaaguuaagccauuuauaacugaaaguaaaccuucaguugaacagagaaaacaagaugauaagaaaaucaaagcuuguguugaagaaguuacaacaacucuggaagaaacuaaguuccucacagaaaacuuguuacuuuauauugacauuaauggcaaucuucauccagauucugccacucuuguuagugacauugacaucacuuucuuaaagaaagaugcuccauauauagugggugauguuguucaagaggguguuuuaacugcugugguuauaccuacuaaaaaggcugguggcacuacugaaaugcuagcgaaagcuuugagaaaagugccaacagacaauuauauaaccacuuacccgggucaggguuuaaaugguuacacuguagaggaggcaaagacagugcuuaaaaaguguaaaagugccuuuuacauucuaccaucuauuaucucuaaugagaagcaagaaauucuuggaacuguuucuuggaauuugcgagaaaugcuugcacaugcagaagaaacacgcaaauuaaugccugucuguguggaaacuaaagccauaguuucaacuauacagcguaaauauaaggguauuaaaauacaagagggugugguugauuauggugcuagauuuuacuuuuacaccaguaaaacaacuguagcgucacuuaucaacacacuuaacgaucuaaaugaaacucuuguuacaaugccacuuggcuauguaacacauggcuuaaauuuggaagaagcugcucgguauaugagaucucucaaagugccagcuacaguuucuguuucuucaccugaugcuguuacagcguauaaugguuaucuuacuucuucuucuaaaacaccugaagaacauuuuauugaaaccaucucacuugcugguuccuauaaagauugguccuauucuggacaaucuacacaacuagguauagaauuucuuaagagaggugauaaaaguguauauuacacuaguaauccuaccacauuccaccuagauggugaaguuaucaccuuugacaaucuuaagacacuucuuucuuugagagaagugaggacuauuaagguguuuacaacaguagacaacauuaaccuccacacgcaaguuguggacaugucaaugacauauggacaacaguuugguccaacuuauuuggauggagcugauguuacuaaaauaaaaccucauaauucacaugaagguaaaacauuuuauguuuuaccuaaugaugacacucuacguguugaggcuuuugaguacuaccacacaacugauccuaguuuucuggguagguacaugucagcauuaaaucacacuaaaaaguggaaauacccacaaguuaaugguuuaacuucuauuaaaugggcagauaacaacuguuaucuugccacugcauuguuaacacuccaacaaauagaguugaaguuuaauccaccugcucuacaagaugcuuauuacagagcaagggcuggugaagcugcuaacuuuugugcacuuaucuuagccuacuguaauaagacaguaggugaguuaggugauguuagagaaacaaugaguuacuuguuucaacaugccaauuuagauucuugcaaaagagucuugaacgugguguguaaaacuuguggacaacagcagacaacccuuaaggguguagaagcuguuauguacaugggcacacuuucuuaugaacaauuuaagaaagguguucagauaccuuguacgugugguaaacaagcuacaaaauaucuaguacaacaggagucaccuuuuguuaugaugucagcaccaccugcucaguaugaacuuaagcaugguacauuuacuugugcuagugaguacacugguaauuaccaguguggucacuauaaacauauaacuucuaaagaaacuuuguauugcauagacggugcuuuacuuacaaaguccucagaauacaaagguccuauuacggauguuuucuacaaagaaaacaguuacacaacaaccauaaaaccaguuacuuauaaauuggaugguguuguuuguacagaaauugacccuaaguuggacaauuauuauaagaaagacaauucuuauuucacagagcaaccaauugaucuuguaccaaaccaaccauauccaaacgcaagcuucgauaauuuuaaguuuguaugugauaauaucaaauuugcugaugauuuaaaccaguuaacugguuauaagaaaccugcuucaagagagcuuaaaguuacauuuuucccugacuuaaauggugaugugguggcuauugauuauaaacacuacacacccucuuuuaagaaaggagcuaaauuguuacauaaaccuauuguuuggcauguuaacaaugcaacuaauaaagccacguauaaaccaaauaccugguguauacguugucuuuggagcacaaaaccaguugaaacaucaaauucguuugauguacugaagucagaggacgcgcagggaauggauaaucuugccugcgaagaucuaaaaccagucucugaagaaguaguggaaaauccuaccauacagaaagacguucuugaguguaaugugaaaacuaccgaaguuguaggagacauuauacuuaaaccagcaaauaauaguuuaaaaauuacagaagagguuggccacacagaucuaauggcugcuuauguagacaauucuagucuuacuauuaagaaaccuaaugaauuaucuagaguauuagguuugaaaacccuugcuacucaugguuuagcugcuguuaauagugucccuugggauacuauagcuaauuaugcuaagccuuuucuuaacaaaguuguuaguacaacuacuaacauaguuacacgguguuuaaaccguguuuguacuaauuauaugccuuauuucuuuacuuuauugcuacaauuguguacuuuuacuagaaguacaaauucuagaauuaaagcaucuaugccgacuacuauagcaaagaauacuguuaagagugucgguaaauuuugucuagaggcuucauuuaauuauuugaagucaccuaauuuuucuaaacugauaaauauuauaauuugguuuuuacuauuaaguguuugccuagguucuuuaaucuacucaaccgcugcuuuagguguuuuaaugucuaauuuaggcaugccuucuuacuguacugguuacagagaaggcuauuugaacucuacuaaugucacuauugcaaccuacuguacugguucuauaccuuguaguguuugucuuagugguuuagauucuuuagacaccuauccuucuuuagaaacuauacaaauuaccauuucaucuuuuaaaugggauuuaacugcuuuuggcuuaguugcagagugguuuuuggcauauauucuuuucacuagguuuuucuauguacuuggauuggcugcaaucaugcaauuguuuuucagcuauuuugcaguacauuuuauuaguaauucuuggcuuaugugguuaauaauuaaucuuguacaaauggccccgauuucagcuaugguuagaauguacaucuucuuugcaucauuuuauuauguauggaaaaguuaugugcauguuguagacgguuguaauucaucaacuuguaugauguguuacaaacguaauagagcaacaagagucgaauguacaacuauuguuaaugguguuagaagguccuuuuaugucuaugcuaauggagguaaaggcuuuugcaaacuacacaauuggaauuguguuaauugugauacauucugugcugguaguacauuuauuagugaugaaguugcgagagacuugucacuacaguuuaaaagaccaauaaauccuacugaccagucuucuuacaucguugauaguguuacagugaagaaugguuccauccaucuuuacuuugauaaagcuggucaaaagacuuaugaaagacauucucucucucauuuuguuaacuuagacaaccugagagcuaauaacacuaaagguucauugccuauuaauguuauaguuuuugaugguaaaucaaaaugugaagaaucaucugcaaaaucagcgucuguuuacuacagucagcuuaugugucaaccuauacuguuacuagaucaggcauuagugucugauguuggugauagugcggaaguugcaguuaaaauguuugaugcuuacguuaauacguuuucaucaacuuuuaacguaccaauggaaaaacucaaaacacuaguugcaacugcagaagcugaacuugcaaagaauguguccuuagacaaugucuuaucuacuuuuauuucagcagcucggcaaggguuuguugauucagauguagaaacuaaagauguuguugaaugucuuaaauugucacaucaaucugacauagaaguuacuggcgauaguuguaauaacuauaugcucaccuauaacaaaguugaaaacaugacaccccgugaccuuggugcuuguauugacuguagugcgcgucauauuaaugcgcagguagcaaaaagucacaacauugcuuugauauggaacguuaaagauuucaugucauugucugaacaacuacgaaaacaaauacguagugcugcuaaaaagaauaacuuaccuuuuaaguugacaugugcaacuacuagacaaguuguuaauguuguaacaacaaagauagcacuuaaggguggu

Bubble Maker · NSP4

Combining with other proteins, NSP4 helps build fluid-filled bubbles within infected cells. Inside these bubbles, parts for new copies of the virus are constructed.

aaaauuguuaauaauugguugaagcaguuaauuaaaguuacacuuguguuccuuuuuguugcugcuauuuucuauuuaauaacaccuguucaugucaugucuaaacauacugacuuuucaagugaaaucauaggauacaaggcuauugaugguggugucacucgugacauagcaucuacagauacuuguuuugcuaacaaacaugcugauuuugacacaugguuuagccagcguggugguaguuauacuaaugacaaagcuugcccauugauugcugcagucauaacaagagaaguggguuuugucgugccugguuugccuggcacgauauuacgcacaacuaauggugacuuuuugcauuucuuaccuagaguuuuuagugcaguugguaacaucuguuacacaccaucaaaacuuauagaguacacugacuuugcaacaucagcuuguguuuuggcugcugaauguacaauuuuuaaagaugcuucugguaagccaguaccauauuguuaugauaccaauguacuagaagguucuguugcuuaugaaaguuuacgcccugacacacguuaugugcucauggauggcucuauuauucaauuuccuaacaccuaccuugaagguucuguuagagugguaacaacuuuugauucugaguacuguaggcacggcacuugugaaagaucagaagcugguguuuguguaucuacuagugguagauggguacuuaacaaugauuauuacagaucuuuaccaggaguuuucugugguguagaugcuguaaauuuacuuacuaauauguuuacaccacuaauucaaccuauuggugcuuuggacauaucagcaucuauaguagcuggugguauuguagcuaucguaguaacaugccuugccuacuauuuuaugagguuuagaagagcuuuuggugaauacagucauguaguugccuuuaauacuuuacuauuccuuaugucauucacuguacucuguuuaacaccaguuuacucauucuuaccugguguuuauucuguuauuuacuuguacuugacauuuuaucuuacuaaugauguuucuuuuuuagcacauauucaguggaugguuauguucacaccuuuaguaccuuucuggauaacaauugcuuauaucauuuguauuuccacaaagcauuucuauugguucuuuaguaauuaccuaaagagacguguagucuuuaaugguguuuccuuuaguacuuuugaagaagcugcgcugugcaccuuuuuguuaaauaaagaaauguaucuaaaguugcguagugaugugcuauuaccucuuacgcaauauaauagauacuuagcucuuuauaauaaguacaaguauuuuaguggagcaauggauacaacuagcuacagagaagcugcuuguugucaucucgcaaaggcucucaaugacuucaguaacucagguucugauguucuuuaccaaccaccacaaaccucuaucaccucagcuguuuugcag

Protein Scissors · NSP5

This protein makes most of the cuts that free other NSP proteins to carry out their own jobs.

agugguuuuagaaaaauggcauucccaucugguaaaguugaggguuguaugguacaaguaacuugugguacaacuacacuuaacggucuuuggcuugaugacguaguuuacuguccaagacaugugaucugcaccucugaagacaugcuuaacccuaauuaugaagauuuacucauucguaagucuaaucauaauuucuugguacaggcugguaauguucaacucaggguuauuggacauucuaugcaaaauuguguacuuaagcuuaagguugauacagccaauccuaagacaccuaaguauaaguuuguucgcauucaaccaggacagacuuuuucaguguuagcuuguuacaaugguucaccaucugguguuuaccaaugugcuaugaggcccaauuucacuauuaaggguucauuccuuaaugguucaugugguaguguugguuuuaacauagauuaugacugugucucuuuuuguuacaugcaccauauggaauuaccaacuggaguucaugcuggcacagacuuagaagguaacuuuuauggaccuuuuguugacaggcaaacagcacaagcagcugguacggacacaacuauuacaguuaauguuuuagcuugguuguacgcugcuguuauaaauggagacaggugguuucucaaucgauuuaccacaacucuuaaugacuuuaaccuuguggcuaugaaguacaauuaugaaccucuaacacaagaccauguugacauacuaggaccucuuucugcucaaacuggaauugccguuuuagauaugugugcuucauuaaaagaauuacugcaaaaugguaugaauggacguaccauauuggguagugcuuuauuagaagaugaauuuacaccuuuugauguuguuagacaaugcucagguguuacuuuccaa

Bubble Factory · NSP6

Works with NSP3 and NSP4 to make virus factory bubbles.

agugcagugaaaagaacaaucaaggguacacaccacugguuguuacucacaauuuugacuucacuuuuaguuuuaguccagaguacucaauggucuuuguucuuuuuuuuguaugaaaaugccuuuuuaccuuuugcuauggguauuauugcuaugucugcuuuugcaaugauguuugucaaacauaagcaugcauuucucuguuuguuuuuguuaccuucucuugccacuguagcuuauuuuaauauggucuauaugccugcuaguugggugaugcguauuaugacaugguuggauaugguugauacuaguuugucugguuuuaagcuaaaagacuguguuauguaugcaucagcuguaguguuacuaauccuuaugacagcaagaacuguguaugaugauggugcuaggagaguguggacacuuaugaaugucuugacacucguuuauaaaguuuauuaugguaaugcuuuagaucaagccauuuccaugugggcucuuauaaucucuguuacuucuaacuacucagguguaguuacaacugucauguuuuuggccagagguauuguuuuuauguguguugaguauugcccuauuuucuucauaacugguaauacacuucaguguauaaugcuaguuuauuguuucuuaggcuauuuuuguacuuguuacuuuggccucuuuuguuuacucaaccgcuacuuuagacugacucuugguguuuaugauuacuuaguuucuacacaggaguuuagauauaugaauucacagggacuacucccacccaagaauagcauagaugccuucaaacucaacauuaaauuguuggguguugguggcaaaccuuguaucaaaguagccacuguacag

Copy Assistants · NSP7 and NSP8

These two proteins help NSP12 make new copies of the RNA genome, which can ultimately end up inside new viruses.

ucuaaaaugucagauguaaagugcacaucaguagucuuacucucaguuuugcaacaacucagaguagaaucaucaucuaaauugugggcucaauguguccaguuacacaaugacauucucuuagcuaaagauacuacugaagccuuugaaaaaaugguuucacuacuuucuguuuugcuuuccaugcagggugcuguagacauaaacaagcuuugugaagaaaugcuggacaacagggcaaccuuacaa

gcuauagccucagaguuuaguucccuuccaucauaugcagcuuuugcuacugcucaagaagcuuaugagcaggcuguugcuaauggugauucugaaguuguucuuaaaaaguugaagaagucuuugaauguggcuaaaucugaauuugaccgugaugcagccaugcaacguaaguuggaaaagauggcugaucaagcuaugacccaaauguauaaacaggcuagaucugaggacaagagggcaaaaguuacuagugcuaugcagacaaugcuuuucacuaugcuuagaaaguuggauaaugaugcacucaacaacauuaucaacaaugcaagagaugguuguguucccuugaacauaauaccucuuacaacagcagccaaacuaaugguugucauaccagacuauaacacauauaaaaauacgugugaugguacaacauuuacuuaugcaucagcauugugggaaauccaacagguuguagaugcagauaguaaaauuguucaacuuagugaaauuaguauggacaauucaccuaauuuagcauggccucuuauuguaacagcuuuaagggccaauucugcugucaaauuacag

At the Heart of the Cell · NSP9

This protein infiltrates tiny channels in the infected cell’s nucleus, which holds our own genome. It may be able to influence the movement of molecules in and out of the nucleus — but for what purpose, no one knows.

aauaaugagcuuaguccuguugcacuacgacagaugucuugugcugccgguacuacacaaacugcuugcacugaugacaaugcguuagcuuacuacaacacaacaaagggagguagguuuguacuugcacuguuauccgauuuacaggauuugaaaugggcuagauucccuaagagugauggaacugguacuaucuauacagaacuggaaccaccuuguagguuuguuacagacacaccuaaagguccuaaagugaaguauuuauacuuuauuaaaggauuaaacaaccuaaauagagguaugguacuugguaguuuagcugccacaguacgucuacaa

Genetic Camouflage · NSP10

Human cells have antiviral proteins that find viral RNA and shred it. This protein works with NSP16 to camouflage the virus’s genes so that they don’t get attacked.

gcugguaaugcaacagaagugccugccaauucaacuguauuaucuuucugugcuuuugcuguagaugcugcuaaagcuuacaaagauuaucuagcuagugggggacaaccaaucacuaauuguguuaagauguuguguacacacacugguacuggucaggcaauaacaguuacaccggaagccaauauggaucaagaauccuuugguggugcaucguguugucuguacugccguugccacauagaucauccaaauccuaaaggauuuugugacuuaaaagguaaguauguacaaauaccuacaacuugugcuaaugacccuguggguuuuacacuuaaaaacacagucuguaccgucugcgguauguggaaagguuauggcuguaguugugaucaacuccgcgaacccaugcuucag

Copy Machine · NSP12

This protein assembles genetic letters into new virus genomes. Researchers have found that the antiviral remdesivir interferes with NSP12 in other coronaviruses, and trials are now underway to see if the drug can treat Covid-19.

The infected cell begins reading the RNA sequence for NSP12:

ucagcugaugcacaaucguuuuuaaac

Then it backtracks and reads c again, continuing as:

cggguuugcgguguaagugcagcccgucuuacaccgugcggcacaggcacuaguacugaugucguauacagggcuuuugacaucuacaaugauaaaguagcugguuuugcuaaauuccuaaaaacuaauuguugucgcuuccaagaaaaggacgaagaugacaauuuaauugauucuuacuuuguaguuaagagacacacuuucucuaacuaccaacaugaagaaacaauuuauaauuuacuuaaggauuguccagcuguugcuaaacaugacuucuuuaaguuuagaauagacggugacaugguaccacauauaucacgucaacgucuuacuaaauacacaauggcagaccucgucuaugcuuuaaggcauuuugaugaagguaauugugacacauuaaaagaaauacuugucacauacaauuguugugaugaugauuauuucaauaaaaaggacugguaugauuuuguagaaaacccagauauauuacgcguauacgccaacuuaggugaacguguacgccaagcuuuguuaaaaacaguacaauucugugaugccaugcgaaaugcugguauuguugguguacugacauuagauaaucaagaucucaaugguaacugguaugauuucggugauuucauacaaaccacgccagguaguggaguuccuguuguagauucuuauuauucauuguuaaugccuauauuaaccuugaccagggcuuuaacugcagagucacauguugacacugacuuaacaaagccuuacauuaagugggauuuguuaaaauaugacuucacggaagagagguuaaaacucuuugaccguuauuuuaaauauugggaucagacauaccacccaaauuguguuaacuguuuggaugacagaugcauucugcauugugcaaacuuuaauguuuuauucucuacaguguucccaccuacaaguuuuggaccacuagugagaaaaauauuuguugaugguguuccauuuguaguuucaacuggauaccacuucagagagcuagguguuguacauaaucaggauguaaacuuacauagcucuagacuuaguuuuaaggaauuacuuguguaugcugcugacccugcuaugcacgcugcuucugguaaucuauuacuagauaaacgcacuacgugcuuuucaguagcugcacuuacuaacaauguugcuuuucaaacugucaaacccgguaauuuuaacaaagacuucuaugacuuugcugugucuaaggguuucuuuaaggaaggaaguucuguugaauuaaaacacuucuucuuugcucaggaugguaaugcugcuaucagcgauuaugacuacuaucguuauaaucuaccaacaaugugugauaucagacaacuacuauuuguaguugaaguuguugauaaguacuuugauuguuacgaugguggcuguauuaaugcuaaccaagucaucgucaacaaccuagacaaaucagcugguuuuccauuuaauaaaugggguaaggcuagacuuuauuaugauucaaugaguuaugaggaucaagaugcacuuuucgcauauacaaaacguaaugucaucccuacuauaacucaaaugaaucuuaaguaugccauuagugcaaagaauagagcucgcaccguagcuggugucucuaucuguaguacuaugaccaauagacaguuucaucaaaaauuauugaaaucaauagccgccacuagaggagcuacuguaguaauuggaacaagcaaauucuauggugguuggcacaacauguuaaaaacuguuuauagugauguagaaaacccucaccuuauggguugggauuauccuaaaugugauagagccaugccuaacaugcuuagaauuauggccucacuuguucuugcucgcaaacauacaacguguuguagcuugucacaccguuucuauagauuagcuaaugagugugcucaaguauugagugaaauggucauguguggcgguucacuauauguuaaaccagguggaaccucaucaggagaugccacaacugcuuaugcuaauaguguuuuuaacauuugucaagcugucacggccaauguuaaugcacuuuuaucuacugaugguaacaaaauugccgauaaguauguccgcaauuuacaacacagacuuuaugagugucucuauagaaauagagauguugacacagacuuugugaaugaguuuuacgcauauuugcguaaacauuucucaaugaugauacucucugacgaugcuguuguguguuucaauagcacuuaugcaucucaaggucuaguggcuagcauaaagaacuuuaagucaguucuuuauuaucaaaacaauguuuuuaugucugaagcaaaauguuggacugagacugaccuuacuaaaggaccucaugaauuuugcucucaacauacaaugcuaguuaaacagggugaugauuauguguaccuuccuuacccagauccaucaagaauccuaggggccggcuguuuuguagaugauaucguaaaaacagaugguacacuuaugauugaacgguucgugucuuuagcuauagaugcuuacccacuuacuaaacauccuaaucaggaguaugcugaugucuuucauuuguacuuacaauacauaagaaagcuacaugaugaguuaacaggacacauguuagacauguauucuguuaugcuuacuaaugauaacacuucaagguauugggaaccugaguuuuaugaggcuauguacacaccgcauacagucuuacag

Another sequence, NSP11, overlaps part of the same stretch of RNA. But it’s not clear if the tiny protein encoded by this gene has any function at all.

Unwinding RNA · NSP13

Normally, virus RNA is wound into intricate twists and turns. Scientists suspect that NSP13 unwinds it so that other proteins can read its sequence and make new copies.

gcuguuggggcuuguguucuuugcaauucacagacuucauuaagauguggugcuugcauacguagaccauucuuauguuguaaaugcuguuacgaccaugucauaucaacaucacauaaauuagucuugucuguuaauccguauguuugcaaugcuccagguugugaugucacagaugugacucaacuuuacuuaggagguaugagcuauuauuguaaaucacauaaaccacccauuaguuuuccauugugugcuaauggacaaguuuuugguuuauauaaaaauacauguguugguagcgauaauguuacugacuuuaaugcaauugcaacaugugacuggacaaaugcuggugauuacauuuuagcuaacaccuguacugaaagacucaagcuuuuugcagcagaaacgcucaaagcuacugaggagacauuuaaacugucuuaugguauugcuacuguacgugaagugcugucugacagagaauuacaucuuucaugggaaguugguaaaccuagaccaccacuuaaccgaaauuaugucuuuacugguuaucguguaacuaaaaacaguaaaguacaaauaggagaguacaccuuugaaaaaggugacuauggugaugcuguuguuuaccgagguacaacaacuuacaaauuaaauguuggugauuauuuugugcugacaucacauacaguaaugccauuaagugcaccuacacuagugccacaagagcacuauguuagaauuacuggcuuauacccaacacucaauaucucagaugaguuuucuagcaauguugcaaauuaucaaaagguugguaugcaaaaguauucuacacuccagggaccaccugguacugguaagagucauuuugcuauuggccuagcucucuacuacccuucugcucgcauaguguauacagcuugcucucaugccgcuguugaugcacuaugugagaaggcauuaaaauauuugccuauagauaaauguaguagaauuauaccugcacgugcucguguagaguguuuugauaaauucaaagugaauucaacauuagaacaguaugucuuuuguacuguaaaugcauugccugagacgacagcagauauaguugucuuugaugaaauuucaauggccacaaauuaugauuugaguguugucaaugccagauuacgugcuaagcacuauguguacauuggcgacccugcucaauuaccugcaccacgcacauugcuaacuaagggcacacuagaaccagaauauuucaauucaguguguagacuuaugaaaacuauagguccagacauguuccucggaacuugucggcguuguccugcugaaauuguugacacugugagugcuuugguuuaugauaauaagcuuaaagcacauaaagacaaaucagcucaaugcuuuaaaauguuuuauaaggguguuaucacgcaugauguuucaucugcaauuaacaggccacaaauaggcgugguaagagaauuccuuacacguaacccugcuuggagaaaagcugucuuuauuucaccuuauaauucacagaaugcuguagccucaaagauuuugggacuaccaacucaaacuguugauucaucacagggcucagaauaugacuaugucauauucacucaaaccacugaaacagcucacucuuguaauguaaacagauuuaauguugcuauuaccagagcaaaaguaggcauacuuugcauaaugucugauagagaccuuuaugacaaguugcaauuuacaagucuugaaauuccacguaggaauguggcaacuuuacaa

Viral Proofreader · NSP14

As NSP12 duplicates the coronavirus genome, it sometimes adds a wrong letter to the new copy. NSP14 cuts out these errors, so that the correct letter can be added instead.

gcugaaaauguaacaggacucuuuaaagauuguaguaagguaaucacuggguuacauccuacacaggcaccuacacaccucaguguugacacuaaauucaaaacugaagguuuauguguugacauaccuggcauaccuaaggacaugaccuauagaagacucaucucuaugauggguuuuaaaaugaauuaucaaguuaaugguuacccuaacauguuuaucacccgcgaagaagcuauaagacauguacgugcauggauuggcuucgaugucgaggggugucaugcuacuagagaagcuguugguaccaauuuaccuuuacagcuagguuuuucuacagguguuaaccuaguugcuguaccuacagguuauguugauacaccuaauaauacagauuuuuccagaguuagugcuaaaccaccgccuggagaucaauuuaaacaccucauaccacuuauguacaaaggacuuccuuggaauguagugcguauaaagauuguacaaauguuaagugacacacuuaaaaaucucucugacagagucguauuugucuuaugggcacauggcuuugaguugacaucuaugaaguauuuugugaaaauaggaccugagcgcaccuguugucuaugugauagacgugccacaugcuuuuccacugcuucagacacuuaugccuguuggcaucauucuauuggauuugauuacgucuauaauccguuuaugauugauguucaacaaugggguuuuacagguaaccuacaaagcaaccaugaucuguauugucaaguccaugguaaugcacauguagcuaguugugaugcaaucaugacuaggugucuagcuguccacgagugcuuuguuaagcguguugacuggacuauugaauauccuauaauuggugaugaacugaagauuaaugcggcuuguagaaagguucaacacaugguuguuaaagcugcauuauuagcagacaaauucccaguucuucacgacauugguaacccuaaagcuauuaaguguguaccucaagcugauguagaauggaaguucuaugaugcacagccuuguagugacaaagcuuauaaaauagaagaauuauucuauucuuaugccacacauucugacaaauucacagaugguguaugccuauuuuggaauugcaaugucgauagauauccugcuaauuccauuguuuguagauuugacacuagagugcuaucuaaccuuaacuugccugguugugaugguggcaguuuguauguaaauaaacaugcauuccacacaccagcuuuugauaaaagugcuuuuguuaauuuaaaacaauuaccauuuuucuauuacucugacaguccaugugagucucauggaaaacaaguagugucagauauagauuauguaccacuaaagucugcuacguguauaacacguugcaauuuagguggugcugucuguagacaucaugcuaaugaguacagauuguaucucgaugcuuauaacaugaugaucucagcuggcuuuagcuuguggguuuacaaacaauuugauacuuauaaccucuggaacacuuuuacaagacuucag

Cleaning Up · NSP15

Researchers suspect that this protein chops up leftover virus RNA as a way to hide from the infected cell’s antiviral defenses.

agaguuuagaaaauguggcuuuuaauguuguaaauaagggacacuuugauggacaacagggugaaguaccaguuucuaucauuaauaacacuguuuacacaaaaguugaugguguugauguagaauuguuugaaaauaaaacaacauuaccuguuaauguagcauuugagcuuugggcuaagcgcaacauuaaaccaguaccagaggugaaaauacucaauaauuuggguguggacauugcugcuaauacugugaucugggacuacaaaagagaugcuccagcacauauaucuacuauugguguuuguucuaugacugacauagccaagaaaccaacugaaacgauuugugcaccacucacugucuuuuuugaugguagaguugauggucaaguagacuuauuuagaaaugcccguaaugguguucuuauuacagaagguaguguuaaagguuuacaaccaucuguaggucccaaacaagcuagucuuaauggagucacauuaauuggagaagccguaaaaacacaguucaauuauuauaagaaaguugaugguguuguccaacaauuaccugaaacuuacuuuacucagaguagaaauuuacaagaauuuaaacccaggagucaaauggaaauugauuucuuagaauuagcuauggaugaauucauugaacgguauaaauuagaaggcuaugccuucgaacauaucguuuauggagauuuuagucauagucaguuaggugguuuacaucuacugauuggacuagcuaaacguuuuaaggaaucaccuuuugaauuagaagauuuuauuccuauggacaguacaguuaaaaacuauuucauaacagaugcgcaaacagguucaucuaaguguguguguucuguuauugauuuauuacuugaugauuuuguugaaauaauaaaaucccaagauuuaucuguaguuucuaagguugucaaagugacuauugacuauacagaaauuucauuuaugcuuugguguaaagauggccauguagaaacauuuuacccaaaauuacaa

More Camouflage · NSP16

NSP16 works with NSP10 to help the virus’s genes hide from proteins that chop up viral RNA.

ucuagucaagcguggcaaccggguguugcuaugccuaaucuuuacaaaaugcaaagaaugcuauuagaaaagugugaccuucaaaauuauggugauagugcaacauuaccuaaaggcauaaugaugaaugucgcaaaauauacucaacugugucaauauuuaaacacauuaacauuagcuguacccuauaauaugagaguuauacauuuuggugcugguucugauaaaggaguugcaccagguacagcuguuuuaagacagugguugccuacggguacgcugcuugucgauucagaucuuaaugacuuugucucugaugcagauucaacuuugauuggugauugugcaacuguacauacagcuaauaaaugggaucucauuauuagugauauguacgacccuaagacuaaaaauguuacaaaagaaaaugacucuaaagaggguuuuuucacuuacauuuguggguuuauacaacaaaagcuagcucuuggagguuccguggcuauaaagauaacagaacauucuuggaaugcugaucuuuauaagcucaugggacacuucgcaugguggacagccuuuguuacuaaugugaaugcgucaucaucugaagcauuuuuaauuggauguaauuaucuuggcaaaccacgcgaacaaauagaugguuaugucaugcaugcaaauuacauauuuuggaggaauacaaauccaauucaguugucuuccuauucuuuauuugacaugaguaaauuuccccuuaaauuaagggguacugcuguuaugucuuuaaaagaaggucaaaucaaugauaugauuuuaucucuucuuaguaaagguagacuuauaauuagagaaaacaacagaguuguuauuucuagugauguucuuguuaacaacuaaacgaaca

Spike Protein · S

The spike protein is one of four structural proteins — SEM and N — that form the outer layer of the coronavirus and protect the RNA inside. Structural proteins also help assemble and release new copies of the virus.

The S proteins form prominent spikes on the surface of the virus by arranging themselves in groups of three. These crownlike spikes give coronaviruses their name.

Part of the spike can extend and attach to a protein called ACE2 (in yellow below), which appears on particular cells in the human airway. The virus can then invade the cell.

The gene for the spike protein in SARS-CoV-2 has an insertion of 12 genetic letters: ccucggcgggca. This mutation may help the spikes bind tightly to human cells — a crucial step in its evolution from a virus that infected bats and other species.

A number of scientific teams are now designing vaccines that could prevent the spikes from attaching to human cells.

auguuuguuuuucuuguuuuauugccacuagucucuagucaguguguuaaucuuacaaccagaacucaauuacccccugcauacacuaauucuuucacacgugguguuuauuacccugacaaaguuuucagauccucaguuuuacauucaacucaggacuuguucuuaccuuucuuuuccaauguuacuugguuccaugcuauacaugucucugggaccaaugguacuaagagguuugauaacccuguccuaccauuuaaugaugguguuuauuuugcuuccacugagaagucuaacauaauaagaggcuggauuuuugguacuacuuuagauucgaagacccagucccuacuuauuguuaauaacgcuacuaauguuguuauuaaagucugugaauuucaauuuuguaaugauccauuuuuggguguuuauuaccacaaaaacaacaaaaguuggauggaaagugaguucagaguuuauucuagugcgaauaauugcacuuuugaauaugucucucagccuuuucuuauggaccuugaaggaaaacaggguaauuucaaaaaucuuagggaauuuguguuuaagaauauugaugguuauuuuaaaauauauucuaagcacacgccuauuaauuuagugcgugaucucccucaggguuuuucggcuuuagaaccauugguagauuugccaauagguauuaacaucacuagguuucaaacuuuacuugcuuuacauagaaguuauuugacuccuggugauucuucuucagguuggacagcuggugcugcagcuuauuauguggguuaucuucaaccuaggacuuuucuauuaaaauauaaugaaaauggaaccauuacagaugcuguagacugugcacuugacccucucucagaaacaaaguguacguugaaauccuucacuguagaaaaaggaaucuaucaaacuucuaacuuuagaguccaaccaacagaaucuauuguuagauuuccuaauauuacaaacuugugcccuuuuggugaaguuuuuaacgccaccagauuugcaucuguuuaugcuuggaacaggaagagaaucagcaacuguguugcugauuauucuguccuauauaauuccgcaucauuuuccacuuuuaaguguuauggagugucuccuacuaaauuaaaugaucucugcuuuacuaaugucuaugcagauucauuuguaauuagaggugaugaagucagacaaaucgcuccagggcaaacuggaaagauugcugauuauaauuauaaauuaccagaugauuuuacaggcugcguuauagcuuggaauucuaacaaucuugauucuaagguuggugguaauuauaauuaccuguauagauuguuuaggaagucuaaucucaaaccuuuugagagagauauuucaacugaaaucuaucaggccgguagcacaccuuguaaugguguugaagguuuuaauuguuacuuuccuuuacaaucauaugguuuccaacccacuaaugguguugguuaccaaccauacagaguaguaguacuuucuuuugaacuucuacaugcaccagcaacuguuuguggaccuaaaaagucuacuaauuugguuaaaaacaaaugugucaauuucaacuucaaugguuuaacaggcacagguguucuuacugagucuaacaaaaaguuucugccuuuccaacaauuuggcagagacauugcugacacuacugaugcuguccgugauccacagacacuugagauucuugacauuacaccauguucuuuugguggugucaguguuauaacaccaggaacaaauacuucuaaccagguugcuguucuuuaucaggauguuaacugcacagaagucccuguugcuauucaugcagaucaacuuacuccuacuuggcguguuuauucuacagguucuaauguuuuucaaacacgugcaggcuguuuaauaggggcugaacaugucaacaacucauaugagugugacauacccauuggugcagguauaugcgcuaguuaucagacucagacuaauucuccucggcgggcacguaguguagcuagucaauccaucauugccuacacuaugucacuuggugcagaaaauucaguugcuuacucuaauaacucuauugccauacccacaaauuuuacuauuaguguuaccacagaaauucuaccagugucuaugaccaagacaucaguagauuguacaauguacauuuguggugauucaacugaaugcagcaaucuuuuguugcaauauggcaguuuuuguacacaauuaaaccgugcuuuaacuggaauagcuguugaacaagacaaaaacacccaagaaguuuuugcacaagucaaacaaauuuacaaaacaccaccaauuaaagauuuuggugguuuuaauuuuucacaaauauuaccagauccaucaaaaccaagcaagaggucauuuauugaagaucuacuuuucaacaaagugacacuugcagaugcuggcuucaucaaacaauauggugauugccuuggugauauugcugcuagagaccucauuugugcacaaaaguuuaacggccuuacuguuuugccaccuuugcucacagaugaaaugauugcucaauacacuucugcacuguuagcggguacaaucacuucugguuggaccuuuggugcaggugcugcauuacaaauaccauuugcuaugcaaauggcuuauagguuuaaugguauuggaguuacacagaauguucucuaugagaaccaaaaauugauugccaaccaauuuaauagugcuauuggcaaaauucaagacucacuuucuuccacagcaagugcacuuggaaaacuucaagauguggucaaccaaaaugcacaagcuuuaaacacgcuuguuaaacaacuuagcuccaauuuuggugcaauuucaaguguuuuaaaugauauccuuucacgucuugacaaaguugaggcugaagugcaaauugauagguugaucacaggcagacuucaaaguuugcagacauaugugacucaacaauuaauuagagcugcagaaaucagagcuucugcuaaucuugcugcuacuaaaaugucagaguguguacuuggacaaucaaaaagaguugauuuuuguggaaagggcuaucaucuuauguccuucccucagucagcaccucaugguguagucuucuugcaugugacuuaugucccugcacaagaaaagaacuucacaacugcuccugccauuugucaugauggaaaagcacacuuuccucgugaaggugucuuuguuucaaauggcacacacugguuuguaacacaaaggaauuuuuaugaaccacaaaucauuacuacagacaacacauuugugucugguaacugugauguuguaauaggaauugucaacaacacaguuuaugauccuuugcaaccugaauuagacucauucaaggaggaguuagauaaauauuuuaagaaucauacaucaccagauguugauuuaggugacaucucuggcauuaaugcuucaguuguaaacauucaaaaagaaauugaccgccucaaugagguugccaagaauuuaaaugaaucucucaucgaucuccaagaacuuggaaaguaugagcaguauauaaaauggccaugguacauuuggcuagguuuuauagcuggcuugauugccauaguaauggugacaauuaugcuuugcuguaugaccaguugcuguaguugucucaagggcuguuguucuuguggauccugcugcaaauuugaugaagacgacucugagccagugcucaaaggagucaaauuacauuacacauaaacgaacuu

Escape Artist · ORF3a

The SARS-CoV-2 genome also encodes a group of so-called “accessory proteins.” They help change the environment inside the infected cell to make it easier for the virus to replicate.

The ORF3a protein pokes a hole in the membrane of an infected cell, making it easier for new viruses to escape. It also triggers inflammation, one of the most dangerous symptoms of Covid-19.

auggauuuguuuaugagaaucuucacaauuggaacuguaacuuugaagcaaggugaaaucaaggaugcuacuccuucagauuuuguucgcgcuacugcaacgauaccgauacaagccucacucccuuucggauggcuuauuguuggcguugcacuucuugcuguuuuucagagcgcuuccaaaaucauaacccucaaaaagagauggcaacuagcacucuccaaggguguucacuuuguuugcaacuugcuguuguuguuuguaacaguuuacucacaccuuuugcucguugcugcuggccuugaagccccuuuucucuaucuuuaugcuuuagucuacuucuugcagaguauaaacuuuguaagaauaauaaugaggcuuuggcuuugcuggaaaugccguuccaaaaacccauuacuuuaugaugccaacuauuuucuuugcuggcauacuaauuguuacgacuauuguauaccuuacaauaguguaacuucuucaauugucauuacuucaggugauggcacaacaaguccuauuucugaacaugacuaccagauuggugguuauacugaaaaaugggaaucuggaguaaaagacuguguuguauuacacaguuacuucacuucagacuauuaccagcuguacucaacucaauugaguacagacacugguguugaacauguuaccuucuucaucuacaauaaaauuguugaugagccugaagaacauguccaaauucacacaaucgacgguucauccggaguuguuaauccaguaauggaaccaauuuaugaugaaccgacgacgacuacuagcgugccuuuguaagcacaagcugaugaguacgaacuu

ORF3b overlaps the same RNA, but scientists aren’t sure if SARS-CoV-2 uses this gene to make proteins.

Envelope Protein · E

The envelope protein is a structural protein that helps form the oily bubble of the virus. It may also have jobs to do once the virus is inside the cell. Researchers have found that it latches onto proteins that help turn our own genes on and off. It’s possible that pattern changes when the E protein interferes.

auguacucauucguuucggaagagacagguacguuaauaguuaauagcguacuucuuuuucuugcuuucgugguauucuugcuaguuacacuagccauccuuacugcgcuucgauugugugcguacugcugcaauauuguuaacgugagucuuguaaaaccuucuuuuuacguuuacucucguguuaaaaaucugaauucuucuagaguuccugaucuucuggucuaaacgaacuaaauauuauauuaguuuuucuguuuggaacuuuaauuuuagcc

Membrane Protein · M

Another structural protein that forms part of the outer coat of the virus.

auggcagauuccaacgguacuauuaccguugaagagcuuaaaaagcuccuugaacaauggaaccuaguaauagguuuccuauuccuuacauggauuugucuucuacaauuugccuaugccaacaggaauagguuuuuguauauaauuaaguuaauuuuccucuggcuguuauggccaguaacuuuagcuuguuuugugcuugcugcuguuuacagaauaaauuggaucaccgguggaauugcuaucgcaauggcuugucuuguaggcuugauguggcucagcuacuucauugcuucuuucagacuguuugcgcguacgcguuccauguggucauucaauccagaaacuaacauucuucucaacgugccacuccauggcacuauucugaccagaccgcuucuagaaagugaacucguaaucggagcugugauccuucguggacaucuucguauugcuggacaccaucuaggacgcugugacaucaaggaccugccuaaagaaaucacuguugcuacaucacgaacgcuuucuuauuacaaauugggagcuucgcagcguguagcaggugacucagguuuugcugcauacagucgcuacaggauuggcaacuauaaauuaaacacagaccauuccaguagcagugacaauauugcuuugcuuguacaguaagugacaacag

Signal Blocker · ORF6

This accessory protein blocks signals that the infected cell would send out to the immune system. It also blocks some of the cell’s own virus-fighting proteins, the same ones targeted by other viruses such as polio and influenza.

auguuucaucucguugacuuucagguuacuauagcagagauauuacuaauuauuaugaggacuuuuaaaguuuccauuuggaaucuugauuacaucauaaaccucauaauuaaaaauuuaucuaagucacuaacugagaauaaauauucucaauuagaugaagagcaaccaauggagauugauuaaacgaac

Virus Liberator · ORF7a

When new viruses try to escape a cell, the cell can snare them with proteins called tetherin. Some research suggests that ORF7a cuts down an infected cell’s supply of tetherin, allowing more of the viruses to escape. Researchers have also found that the protein can trigger infected cells to commit suicide — which contributes to the damage Covid-19 causes to the lungs.

augaaaauuauucuuuucuuggcacugauaacacucgcuacuugugagcuuuaucacuaccaagaguguguuagagguacaacaguacuuuuaaaagaaccuugcucuucuggaacauacgagggcaauucaccauuucauccucuagcugauaacaaauuugcacugacuugcuuuagcacucaauuugcuuuugcuuguccugacggcguaaaacacgucuaucaguuacgugccagaucaguuucaccuaaacuguucaucagacaagaggaaguucaagaacuuuacucuccaauuuuucuuauuguugcggcaauaguguuuauaacacuuugcuucacacucaaaagaaagacagaaugauugaacuuucauuaauugacuucuauuugugcuuuuuagccuuucugcuauuccuuguuuuaauuaugcuuauuaucuuuugguucucacuugaacugcaagaucauaaugaaacuugucacgccuaaacgaac

ORF7b overlaps this same stretch of RNA, but it’s not clear what, if anything, the gene does.

Mystery Protein · ORF8

The gene for this accessory protein is dramatically different in SARS-CoV-2 than in other coronaviruses. Researchers are debating what it does.

augaaauuucuuguuuucuuaggaaucaucacaacuguagcugcauuucaccaagaauguaguuuacagucauguacucaacaucaaccauauguaguugaugacccguguccuauucacuucuauucuaaaugguauauuagaguaggagcuagaaaaucagcaccuuuaauugaauugugcguggaugaggcugguucuaaaucacccauucaguacaucgauaucgguaauuauacaguuuccuguuuaccuuuuacaauuaauugccaggaaccuaaauuggguagucuuguagugcguuguucguucuaugaagacuuuuuagaguaucaugacguucguguuguuuuagauuucaucuaaacgaacaaacuaaa

Nucleocapsid Protein · N

The N protein protects the virus RNA, keeping it stable inside the virus. Many N proteins link together in a long spiral, wrapping and coiling the RNA:

augucugauaauggaccccaaaaucagcgaaaugcaccccgcauuacguuugguggacccucagauucaacuggcaguaaccagaauggagaacgcaguggggcgcgaucaaaacaacgucggccccaagguuuacccaauaauacugcgucuugguucaccgcucucacucaacauggcaaggaagaccuuaaauucccucgaggacaaggcguuccaauuaacaccaauagcaguccagaugaccaaauuggcuacuaccgaagagcuaccagacgaauucgugguggugacgguaaaaugaaagaucucaguccaagaugguauuucuacuaccuaggaacugggccagaagcuggacuucccuauggugcuaacaaagacggcaucauauggguugcaacugagggagccuugaauacaccaaaagaucacauuggcacccgcaauccugcuaacaaugcugcaaucgugcuacaacuuccucaaggaacaacauugccaaaaggcuucuacgcagaagggagcagaggcggcagucaagccucuucucguuccucaucacguagucgcaacaguucaagaaauucaacuccaggcagcaguaggggaacuucuccugcuagaauggcuggcaauggcggugaugcugcucuugcuuugcugcugcuugacagauugaaccagcuugagagcaaaaugucugguaaaggccaacaacaacaaggccaaacugucacuaagaaaucugcugcugaggcuucuaagaagccucggcaaaaacguacugccacuaaagcauacaauguaacacaagcuuucggcagacgugguccagaacaaacccaaggaaauuuuggggaccaggaacuaaucagacaaggaacugauuacaaacauuggccgcaaauugcacaauuugcccccagcgcuucagcguucuucggaaugucgcgcauuggcauggaagucacaccuucgggaacgugguugaccuacacaggugccaucaaauuggaugacaaagauccaaauuucaaagaucaagucauuuugcugaauaagcauauugacgcauacaaaacauucccaccaacagagccuaaaaaggacaaaaagaagaaggcugaugaaacucaagccuuaccgcagagacagaagaaacagcaaacugugacucuucuuccugcugcagauuuggaugauuucuccaaacaauugcaacaauccaugagcagugcugacucaacucaggccuaaacucaugcagaccacacaaggcag

The accessory proteins ORF9b and ORF9c overlap this same stretch of RNA. ORF9b blocks interferon, a key molecule in the defense against viruses, but it’s not clear if ORF9c is used at all.

Mystery Protein · ORF10

Close relatives of the SARS-CoV-2 virus don’t have the gene for this tiny accessory protein, so it’s hard to know what it’s for yet — or even if the virus makes proteins from it.

augggcuauauaaacguuuucgcuuuuccguuuacgauauauagucuacucuugugcagaaugaauucucguaacuacauagcacaaguagauguaguuaacuuuaaucucacauag

End of the Line

The coronavirus genome ends with a snippet of RNA that stops the cell’s protein-making machinery. It then trails away as a repeating sequence of aaaaaaaaaaaaa

caaucuuuaaucaguguguaacauuagggaggacuugaaagagccaccacauuuucaccgaggccacgcggaguacgaucgaguguacagugaacaaugcuagggagagcugccuauauggaagagcccuaauguguaaaauuaauuuuaguagugcuauccccaugugauuuuaauagcuucuuaggagaaugacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa

Other related articles in this Open Access Online Scientific Journal include the following:

 

  • Structure-guided Drug Discovery: (1) The Coronavirus 3CL hydrolase (Mpro) enzyme (main protease) essential for proteolytic maturation of the virus and (2) viral protease, the RNA polymerase, the viral spike protein, a viral RNA as promising two targets for discovery of cleavage inhibitors of the viral spike polyprotein preventing the Coronavirus Virion the spread of infection

Curators and Reporters: Stephen J. Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2020/03/12/structure-guided-drug-discovery-1-the-coronavirus-3cl-hydrolase-mpro-enzyme-main-protease-essential-for-proteolytic-maturation-of-the-virus-and-2-viral-protease-the-rna-polymerase-the-viral/

  • Predicting the Protein Structure of Coronavirus: Inhibition of Nsp15 can slow viral replication and Cryo-EM – Spike protein structure (experimentally verified) vs AI-predicted protein structures (not experimentally verified) of DeepMind (Parent: Google) aka AlphaFold

Curators: Stephen J. Williams, PhD and Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2020/03/08/predicting-the-protein-structure-of-coronavirus-inhibition-of-nsp15-can-slow-viral-replication-and-cryo-em-spike-protein-structure-experimentally-verified-vs-ai-predicted-protein-structures-not/

  • Promise of Synthetic Biology for Covid-19 Vaccine

Reporter: Irina Robu, PhD

https://pharmaceuticalintelligence.com/2020/03/23/promise-of-synthetic-biology-for-covid-19-vaccine/

  • Glycobiology vs Proteomics: Glycobiologists Prespective in the effort to explain the origin, etiology and potential therapeutics for the Coronavirus Pandemic (COVID-19).

 Curator: Ofer Markman, PhD

https://pharmaceuticalintelligence.com/2020/03/26/glycobiology-vs-proteomics-glycobiologists-prespective-in-the-effort-to-explain-the-origin-etiology-and-potential-therapeutics-for-the-coronavirus-pandemic-covid-19/

  • Worldwide trial uses AI to quickly identify ideal Covid-19 treatments

Reporter : Irina Robu, PhD

https://pharmaceuticalintelligence.com/2020/04/09/worldwide-trial-uses-ai-to-quickly-identify-ideal-covid-19-treatments/

  • Updated listing of COVID-19 vaccine and therapeutic trials from NIH Clinical Trials.gov

Curator: Stephen J. Williams, PhD

https://pharmaceuticalintelligence.com/2020/04/16/updated-listing-of-covid-19-vaccine-and-therapeutic-trials-from-nih-clinical-trials-gov/

  • Actemra, immunosuppressive which was designed to treat rheumatoid arthritis but also approved in 2017 to treat cytokine storms in cancer patients SAVED the sickest of all COVID-19 patients

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2020/04/14/actemra-immunosuppressive-which-was-designed-to-treat-rheumatoid-arthritis-but-also-approved-in-2017-to-treat-cytokine-storms-in-cancer-patients-saved-the-sickest-of-all-covid-19-patients/

  • Innate Immune Genes and Two Nasal Epithelial Cell Types: Expression of SARS-CoV-2 Entry Factors – COVID19 Cell Atlas

Reporter: Aviva Lev-Ari, PhD, RN

https://pharmaceuticalintelligence.com/2020/04/23/innate-immune-genes-and-two-nasal-epithelial-cell-types-expression-of-sars-cov-2-entry-factors-covid19-cell-atlas/

 

Read Full Post »

« Newer Posts - Older Posts »